CA2222562A1 - Method for screening for receptor agonists and antagonists - Google Patents
Method for screening for receptor agonists and antagonists Download PDFInfo
- Publication number
- CA2222562A1 CA2222562A1 CA 2222562 CA2222562A CA2222562A1 CA 2222562 A1 CA2222562 A1 CA 2222562A1 CA 2222562 CA2222562 CA 2222562 CA 2222562 A CA2222562 A CA 2222562A CA 2222562 A1 CA2222562 A1 CA 2222562A1
- Authority
- CA
- Canada
- Prior art keywords
- region
- taf
- receptor
- promoter
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
- G01N33/567—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds utilising isolate of tissue or organ as binding agent
Abstract
This invention relates to a method for identifying a receptor agonist or antagonist by providing a nucleic acid encoding a receptor having a first TAF region able to activate transcription from a promotor, and a second TAF region mutated to have the functional context of the second TAF region, but not able on its own to activate transcription of the promoter. The nucleic acid is provided within a cell unable to exhibit transcription from the promoter in the presence of the second TAF region alone, but able to exhibit transcription from the promoter in the presence of the first TAF region. The cell further includes a reporter construct containing the promoter operatively linked to a reporter gene. The reporter gene is transcribed when the promoter is activated in the presence of the first TAF region. The method further includes contacting the cell with a potential agonist or antagonist, under conditions in which contact of the cell with a known agonist or antagonist of the receptor increases or decreases transcription from the promoter and the level of the product of the reporter construct. Finally, the method involves measuring the level of increase of the product of the reporter construct as an indication of the agonist activity of the potential agonist. The method is applicable to intracellular receptors including ER, AR, PR and GR.
Description
CA 02222~62 1997-11-27 WO 96/41013 PCTAJ~9G~ 8 DESCRIPTION
Method For Screeninq For Receptor Aqonists And Antaqonists Related Applications This application is a continuation-in-part of McDonnell and Tzukerman, entitled "Method For Screening For Receptor Agonists", filed April 6, 1994, U.S. Serial No. 08/223,943, which is a continuation-in-part of McDonnell and Tzukerman, entitled "Method For Screening For Receptor Agonists", filed January 10, 1994, U.S.
Serial No. 08/179,750, which is a continuation-in-part of McDonnell and Tzukerman, entitled "Method For Screening For Receptor Agonists", filed April 4, 1993, U.S. Serial No. 08/045,807, incorporated by reference herein, including the drawings attached thereto.
Field of the Invention This invention relates to methods and constructs useful for identifying agonists and antagonists active at intracellular receptors.
Backqround of the Invention Steroid hormones, such as estrogen, progesterone, androgens, glucocorticoids, and mineralocorticoids travel via the blood stream to their target cells, enter these cells, and then bind to steroid hormone receptors.
The steroid hormone receptors exist in inactive apoprotein forms either in the cytoplasm or nucleus.
_ Upon binding their respective hormonal ligands, the receptors become activated. The activated receptor can bind effectively to a hormone response element (HRE) on a chromosome and activate transcription of a cis-linked gene.
The steroid hormone receptor superfamily includes receptors ~or the steroids, e.g., estrogen, CA 02222~62 1997-11-27 WO96/41013 PCT~S96/09638 progesterone, glucocorticoid, mineralocorticoid and androgen. It also includes receptors for thyroid hormone, vitamin D, retinoic acid and a 9- cis retinoid acid and ecdysone. Furthermore, it includes a large number of proteins having sequence homologous to the steroid hormone receptors, but whose ligands are unknown, e.g., peroxisome proliferator activated receptor. These proteins have been termed ''orphan receptors".
A typical steroid hormone receptor can be divided into six domains, A, B, C, D, E and F as indicated in Figure ll. The function of each domain is 1ndicated by solid lines. The N-terminal A/B domain contains a transactivation function. The C region is -esponsible for DNA binding and receptor dimerization. The D region is a hinge region which allows the protein l_o bend or alter conformation. The E region is important for dimerization, transactivation, intramolecular repression and ligand binding. DNA sequences responsive to steroid hormones have been termed hormone response elements (HRES). I
Evans et al., U.S. Patent 5,071,773, incorporated by reference herein, describes an assay by which hormone receptors, ligands for such receptors, and proteins having transcription activating properties of a hormone receptor, can be detected. Generally, the assay involves using a cell containing both a DNA encoding a receptor protein, and a DNA encoding a hormone responsive element (e.q., a promoter) linked to an operative reporter gene. When a suitable hormone or ligand is provided to the cell, a receptor-hormone is formed and delivered to an appropriate DNA-binding region to thereby activate the hormone responsive element and cause expression of the reporter gene. The expression product of the reporter gene is detected by st~n~d procedures known to one skilled in the art.
CA 02222~62 1997-11-27 W O 96/41013 PCTAJS96/0~8 Web~ter et al., Cell 54:199 (1988), used chimeric receptors to localize regions responsible for transcription activation function. The authors propose that a hormone is responsible for allowing a receptor to recognize a DNA response element, and that the hormone induces a transcription activation function in the hormone-binding domain.
Summary of the Invention The present invention features a method for identifying agonists and antagonists of an intracellular receptor. These agonists and antagonists modulate the transcription activity of a promoter through a TAF
region of the receptor in a cell. The present invention also features a method for using these agents to treat diseases and pathological conditions affected by an intracellular receptor, such as, but not limited to, breast cancer, endometrial cancer, fibroids, and endometriosis. This invention makes it possible to screen large collections of natural, semisynthetic, or synthetic compounds for therapeutic agents that affect the transcription activation activity of an intracellular receptor.
This invention provides an assay to screen for an agonist or antagonist of an intracellular receptor which interacts with one of the TAF regions of the receptor.
Not only can an agonist or antagonist be specifically identified, but the type of agonist or antagonist can be determined in such an assay. The agonists and antagonists so identified may be used to selectively modulate a promoter in a cell.
In order to detect agonists and antagonists which act through a particular TAF region of a chosen intracellular receptor, Applicant inactivates the transcription activation function of other TAF regions in the receptor. Considering that the activity of a TAF
region is dependent on having the functional context of CA 02222~62 1997-11-27 W O96/41013 ~ PCTrUS96/09638 other TAF regions available, this invention describes introducing mutations to receptor constructs to inactivate the transcription activation act-vity of these other TAF regions, while retaining the functional context of these TAF regions. Such modifiec receptors can be used to identify promoter and cell-type specific requirements for the transcriptional activation activity of a particular TAF region. This invention allows the determination o~ such promoter-type and cell-type specific differences in transcription activation activity.
This invention also relates to selectinc a cellular context in which the rem~;n'ng TAF region is able to activated transcription from a promoter. Furthermore, this invention relates to selecting a promoter context which is responsive to the transactivation by the r~m~;n;ng TAF region. Therefore, by properly preparing a receptor construct and selecting a cellular context and promoter context, the claimed assay alllws the r~m~;n;ng TAF region to exhibit its transcription activation activity on a promoter in a cell.~
Without being bound by any theory, Applicant proposes that such promoter-type and cell-type speci~ic transcription activity of a TAF region may be explained by a model in which one TAF region acts as a dominant transcriptional activator, and a second TAF region as a transcriptional facilitator (see Fig. 7). The second TAF region prepares the transcription apparatus for the action of the first TAF region. Such preparation may be recruitment of basic transcription ~actors, alteration of chromatin structure, or causing removal of a transcriptional repressor. Alternatively, the second TAF region may prepare a transcription apparatus for other transcriptional activators, and alone have little inherent transcription activation activity. In such a model, the ~irst TAF region is unable to access the transcription apparatus until the second TAF~ region has CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 acted appropriately to prepare it for the action of the first TAF region.
Applicant proposes that cell specificity for a particular TAF activity may reflect the presence or absence of a function in a cell that mimics the presence of a helper TAF region, respectively. Such a mimetic in a cell will allow a receptor construct having a mutated and inactive helper TAF region to be active because the inactive portion of the receptor is complemented by the active functionality present in the cell.
A similar model may exist for promoter specificity, i.e., only selected promoters will be activated by a particular TAF in a cell, depending on the functionalities present in those promoters. In this model, the difference in agonist activity of various agents is dependent on the effect of that agonist on the TAF1 region or TAF2 region, and interaction of the resulting TAF1 or TAF2 region with a selected promoter or general transcription apparatus.
Thus, in a first aspect, the invention features a method for identifying an agonist or antagonist of an intracellular receptor. The method includes providing a cell containing a nucleic acid encoding an intracellular receptor having a first TAF region and a second TAF
region. The first TAF regions is able to activate transcription from a selected promoter, and the second TAF region is mutated so that, while it provides the functional context of that region, it is not able to activate transcription from the promoter.
The cell also includes a reporter construct which has a promoter region which is activated to cause transcription of a reporter gene in the presence of a receptor having an active TAF region corresponding to that which is not mutated above. The promoter is not activated by the presence of a receptor containing only the TAF region corresponding to that mutated above. The CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 receptor construct and reporter construct may be inserted in two vectors or a single vector.
The cell is so chosen that no, or m; n; m~l, transcription of the promoter occurs in the,presence of a receptor having only an unmutated second TAF region corresponding to that mutated above (and not the other TAF region). The cell is also chosen such that transcription o~ the promoter occurs in the~presence of a receptor having the above nonmutated ~irs_ TAF region alone.
For example, in a receptor construct having an operative TAF1 region and a mutated, inoperative TAF2 region, transcription of the promoter will not occur (i.e., no signi~icant level of transcription is detectable, usually less than 5-10~ of normal levels) in the presence o~ a receptor having an operative TAF2 region only, but will occur in the presenceiof a receptor having an operative TAF1 region only.
The method further includes the step oflcontacting the cell with a potential agent under conditions in which contact of the cell with a normal agonist (e.q., estrogen for an estrogen receptor) or antagonist will either increase or decrease the transcription of the reporter gene from the promoter, respectively. The method may involve transcribing the reporter construct at a basal (low or minimal) level in the cell before the agonist or antagonist is applied. Alternatively, the method may involve applying the agonist or antagonist first, and then transcribing the reporter construct.
Finally, the method involves the step o- measuring the level o~ increase or decrease o~ the reporter gene product, as an indication of the agonist or antagonist activity of said agent, respectively.
By "intracellular receptor" is meant an transcription polypeptide in the cytoplasm or nucleus of a cell whose transcription regulation activity is regulated by binding of small molecules such as steroid CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 hormones, including, but not limited to, estrogen receptor (ER), retinoid acid receptors (RAR), retinoid X
receptors (RXR), glucocorticoid receptors (GR), progesterone receptors (PR), androgen receptors (AR), mineralocorticoid receptor (MR), thyroid hormone receptors (TR), peroxisome proliferator activated receptor (PPAR), and vitamin D receptors. An intracellular receptor may be mutated by site-directed mutagenesis, deletion, substitution, and other genetic methods known to those skilled in the art. The intracellular receptor may either be endogenous to the cell or transfected into the cell.
By "transcription polypeptide" is meant a cytoplasmic or nuclear protein that, when activated, binds a promoter, enhancer or silencer either directly, or indirectly through a complex of proteins to modulate the transcription activity of the promoter.
By "TAF" is meant a transactivation function domain located in an intracellular receptor having the ability to interact with a transcription target and activate the transcription from a promoter. In the art, a TAF region sometimes is referred to as an AF region. The A/B
domain and E domain of a typical steroid hormone receptor contain TAF regions. Other TAF regions may be identified by deletions, site-directed mutagenesis and other methods known to those skilled in the art.
By "agonist" is meant a compound or composition which when combined with an intracellular receptor stimulates or increases a reaction typical for the receptor, e.g., transcription activation activity.
By "antagonist" is meant a compound or composition which when combined with an intracellular receptor interferes or decreases a reaction typical for the receptor, e.g., transcription activation activity.
By "promoter" is meant a DNA regulatory region pro~;m~l to the RNA start site in the 5' or upstream direction capable of binding directly or indirectly to CA 02222~62 1997-11-27 RNA polymerase and associated transcription ~actors in a cell and initiating transcription of a downstream (3' direction) coding sequence. A promoter o~ a DNA
construct, including an oligonucleotide sequence according to the present invention, may be linked to a heterologous gene where the presence of the~promoter influences transcription from the heterologous gene, including genes encoding reporter molecules such as human growth hormone, luci~erase, chloramphenicol acetyl trans~erase, ~-galactosidase, secreted placental alkaline phosphatase and other secreted enzyme reporters.
By "reporter gene" is meant a nucleotide sequence encoding a polypeptide whose presence or activity is readily detectable, including, but not limited to, luci~erase, chloramphenicol acetyl transfer?se (CAT), ~-galactosidase, secreted placental alkaline phosphatase, human growth hormone, and other secreted enzyme reporters. Generally reporter genes encode a polypeptide not otherwise produced by the host cell which is detectable by in si tu analysis o~ the cell culture, e.g., by the direct ~luorometric, radioisotopic or spectrophotometric analysis o~ the cell culture without the need to remove the cells ~or signal analysis from the culture chamber in which they are contained.
Preferably the gene encodes an enzyme which produces colorimetric or ~luorometric changes in the host cell which is detectable by in si tu analysis and which is a quantitative or semi-quantitative ~unction o~
transcriptional activation. Exemplary enzy~es include esterases, phosphatases, proteases (tissue plasminogen activator or urokinase) and other enzymes wkose ~unction can be detected by appropriate chromogenic or ~luorogenic substrates known to those skilled in the art.
By "functional context" is meant only a ~ew amino acids (i.e., up to 10), or pre~erably only I-3 amino CA 02222~62 1997-11-27 acids are altered in one region so that the interaction o~ a hormone or transcription ~actor with the region is altered to a minimum extent (pre~erably, the interaction is unaltered). Such interaction will allow ~ull expression o~ the activity of the unaltered or non-mutated region. Thus the functional context of one TAF
region contains the ~unctional activities o~ the other TAF region with respect to agonist binding, dimerization, and heat shock protein interaction, but not with respect to the ability to activate transcription.
In another word, ~unctional context is meant the part of a TAF region that contains the functional activities o~ another TAF region with respect to agonist binding, dimerization, and heat shock protein interaction, but not with respect to the ability to activate transcription. The ~unctional context of a TAF
region can be preserved while the transcription activation activity o~ the TAF region is destroyed. For example, receptor dimerization or the interaction o~ a hormone or transcription factor with the TAF region is altered to a minimum extent, or pre~erably unaltered, when certain mutations are made in the TAF region (e.g., a ~ew amino acids (i.e., up to 10), or pre~erably only 1-3 amino acids are mutated in the TAF region). Such interaction allows the ~ull~illment of transcription activation activity o~ another unaltered or non-mutated TAF region.
In this invention, a cell is provided with a speci~ic receptor construct having a selected TAF
activity, and having a suitable promoter, which responds to the TAF activity, linked to an operative reporter gene. The promoter is selected in conjunction with a speci~ic cell so that activity o~ an agonist or antagonist is observed only under selected conditions.
Thus, in one example, the receptor may have an active ~irst TAF region, and a mutated (inactive) second TAF
CA 02222~62 1997-11-27 W O 96/41013 I PCT~US96/09638 region which provides the functional conte7t for the first TAF region, and the cell is chosen such that it has a component which mimlcs or replaces tke second TAF
region function of the receptor at the chosen promoter.
The promoter in turn provides an appropriate binding context to allow the component to manifest¦the desired TAF functions. In this way, an agonist or antagonist which acts at the first TAF region can be readily identified by its ability to increase or dqcrease expression of the reporter gene, despite the lack of an active second TAF region on the receptor. I
In preferred embodiments, the agent isla human hormone agonist or antagonist, and a nuclear receptor, e.q., a human hormone receptor is encoded by the nucleic acid within the cell.
In another preferred embodiment, the receptor has a mutated TAF2 region, and the cell and promcter are chosen to exhibit no, or minimal, response to the presence of TAF2 alone.
In a further preferred embodiment, suck a cell is a liver cell (specifically, a HepG2 cell) in which a receptor with an operative TAF2 region has no activity.
That is, there is no inherent transcriptional activity with a receptor having just TAF2 and no TAF1 region present in the cell, but there is transcriptional activity with a receptor only having an operative TAF1 region available. Most preferably, the promoter (e.g., a C3 promoter) is chosen such that it does not require a receptor with a TAF2 function to be provided within the chosen cell, so that any agonist (e.g., an!ER agonist) which acts in conjunction with a functionai TAF1 in the receptor construct is able to show its agorist activity.
In yet another preferred embodiment, tke candidate agent is selected from the group consistinc of glucocorticoids and other agonists and antagonists of GR, nonsteroid glucocorticoids; estrogens and other agonists and antagonists of ER, nonsteroid estrogens;
CA 02222~62 1997-11-27 androgens and other agonists and antagonists of AR, nonsteroid androgens; progestins and other agonists and antagonists of PR; non-steroid progestins;
mineralocorticoids and other agonists and antagonists of MR, nonsteroid mineralocorticoids.
Candidate compounds include but are not limited to those disclosed and re~erred to in Table 2. Peptide or small molecule combinatorial libraries can be used to screen for agonists and antagonists (Bunin, B.A.N.
Ellman, J. A., J. An. Chem. Soc. 114:10997-10998 (1992) and references contained therein).
By "comprising" is meant including, but not limited to, whatever follows the word "comprising". Thus, use of the term "comprising" indicates that the listed elements are required or mandatory, but that other ele-ments are optional and may or may not be present. By "consisting of" is meant including, and limited to, whatever follows the phrase "consisting of". Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present. By "consisting essentially of"
is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but that other ele-ments are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.
In another aspect, the invention features a method for identifying a receptor agonist by providing a cell containing both a nonmutated intracellular receptor having functional TAFl and TAF2 regions and a reporter construct having a promoter.
The cell is chosen to lack a mimicking TAFl or TAF2 activity (i.e., a receptor having either an active TAFl CA 02222~62 1997-ll-27 W O 96/41013 PCTAJS96~5'~8 or TAF2 region alone does not cause activation of transcription in the cell). The promoter is chosen so that activation is achieved in this cell from this promoter in the presence of an agonist for _he receptor which acts only through one of the TAF regions but not both.
In a preferred embodiment, a liver cell'(e.q., HepG2) and a complex C3 promoter together p~ovide a useful assay for agonists (e.g., an ER agonist) active at a TAF1 region only. The liver cell and C3 promoter have a TAF2 activity, but the promoter is not activated in the presence of a receptor having an active TAF2 region alone. However, the promoter is active in the presence of an active TAF1 region. Thus, agonists active at the receptor TAF1 region can be identified as those which increase expression of the reporter gene.
In another preferred embodiment, the TAF2 region is mutated.
This cell provides a useful screening test to determine the type of agonist tested. The level of transcription observed is related to the agonist type as exemplified below. The above two methods (with mutated and nonmutated receptor constructs) may be used in combination to detect, grade or type agonis_s at a selected receptor.
Unlike prior methods in which laborious procedures were involved to detect useful agonists, the methods described herein allow rapid screening of potential agonists and antagonists of intracellular receptors, including, but not limited to, estrogen, progesterone, glucocorticoid, androgen and mineralocorticoid receptors. The assay may be conducted not only in the human derived cells, but also in other eucaryotic cell lines, such as chicken and yeast cell lines.
The agonists and antagonists identi~ied-by this invention have advantages in treating diseases. For example, an estrogen agonist can be identified which is CA 02222~62 1997-11-27 W O 96/41013 PCTAUS~'0~8 useful for treatment of osteoporosis. In osteoporosis, it appears as though TAF1 activity alone is sufficient for prevention of bone loss. Thus, agonists having activity only at the TAF1 region and not at the TAF2 region of the receptor are useful for disease treatment with no or fewer side effects.
In another aspect, the invention features a method for treating or preventing an estrogen related disease or condition. By "estrogen related disease or condition" is meant a disease or condition that is caused or associated with an elevated or depressed level of the hormone estrogen, including, but not limited to, osteoporosis, breast cancer, uterine cancer, endometriosis, vasomotor abnormalities, hot flashes, depression, other psychiatric abnormalities and uterine fibroids. In some diseases the patient may be unable to produce estrogen in an amount required by the body. In other diseases, estrogen may be overproduced. By "hormone~ is meant a naturally occurring biochemical that will function as a receptor agonist. Synthetic hormones are more properly referred to as agonists.
The method involves administering a chemical compound other than keoxifene, but having a keoxifene-like transcriptional profile to a patient (or causing 1n vivo production of a compound other than keoxifene, but having a keoxifene-like transcriptional profile).
The treatment may have the effect of preventing new tumors from developing and/or of shrinking the size of existing tumors. The method includes varieties o~
hormone replacement therapy. In this method, the patient is preferably first identified as suffering from such a disease or condition by standard techniques, and then treated as described below.
By "keoxifene-like transcriptional profile" is meant the activity of a compound in producing a normalized response similar to that produced by keoxifene, i.e., a relatively low TAF1 response at low concentrations of CA 02222~62 1997-11-27 the compound but relatively high response a~t higher concentrations o~ the compound. In additioh, little or no TAF2 response should be present at all concentrations. Furthermore, it should have a greater (about twice or more) TAFl response than with a wild type receptor at higher concentrations (about 10-7 M), see Fig. 8E compared to Figs. 8A-D). The ~m; n; stration o~ compounds with keoxi~ene-like transcriptional pro~iles is expected to exhibit bone protecting activity and uterine/breast sparing activity.
By "bone protecting activity" is meant =he ability to prevent bone resorption which can be measured by standard techniques. Bone resorption is typically associated with a loss o~ estrogen. Bone resorption is typically associated with osteoporosis and is manifest by bone dissolution due to a loss o~ calcium.
By "uterine/breast sparing activity" is meant the prevention or reduction of the proli~eration o~ tumorous cancer cells which can be measured by standard techniques.
Dihydronaphthalenes, benzothiophenes and other compounds described and suggested in Jones, U.S. Patent No. 4,418,068, issued November 29, 1983 (incorporated herein by re~erence), may be screened for keoxi~ene-like transcriptional pro~ile. Other compounds that can be screened include compounds with a similar chemical structure to keoxi~ene or keoxifene-like an$10gs. Some o~ these compounds could be produced by making substitutions of 1-10 carbon long alkyl, alkenyl or similar-type ~h~;n~ in the nitrogen-contain-ng ring o~
keoxi~ene. Other alterations could include altering the length or saturation characteristic o~ the alkyl chain (e.g., ~rom 0-10 carbon atoms) that links the nitrogen-containing ring to the rest of the keoxi~ene compound.
Other compounds that can be screened ~or a keoxi~ene-like pro~ile include compounds with a chemical structure similar to tamoxi~ine or tamoxi~ine analogs. Those CA 02222~62 1997-11-27 skilled in the art will readily recognize other modifications and substitutions that can be made to compounds that can be screened for a keoxifene-like profile.
While steroids and steroid analogues may exemplify agents identified by the present invention, Applicant is particularly interested in the identification of agents of low molecular weight (less than 10,000 daltons, preferably less than 5,000, and most preferably less than 1,000) which can be readily formulated as useful therapeutic agents.
Such agents can then be screened to ensure that they are specific to tissues with pathological conditions related to an intracellular receptor with little or no effect on healthy tissues such that the agents can be used in a therapeutic or prophylactic manner. If such agents have some effect on healthy tissues they may still be useful in therapeutic treatment, particularly in those diseases which are life threatening.
Once isolated, a candidate agent can be put in pharmaceutically acceptable formulations, such as those described in Reminqton's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, PA (1990), incorporated by reference herein, and used for specific treatment of diseases and pathological conditions with little or no effect on healthy tissues.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.
Brief Description of the Drawinas Fig. 1 shows schematic diagrams of BR-wt, ER-TAF1, ER-TAF2 (i.e., ER179C) and ER-Null mutants (Fig. lA) and graphs indicating their transcription activation activities (Fig. lB, C and D).
CV1, HepG2 and HS578T cells were transiently co-transfected with increasing concentrations of the CA 02222~62 1997-11-27 W O96/41013 PCTrUS96/09638 di~erent receptor expression vectors as in~icated, together with 9.5 ~g/ml o~ ERE-tk-LUC repor_er plasmid, and 5 ~g/ml o~ pRSV-~-gal expression vector as an internal control for trans~ection e~iciency. Carrier DNA (pGEM4) was added to adjust the total amount o~ DNA
to 20 ~g/ml (see below).
Cultures were treated with or-without 10-7M
17-,~-estradiol (E2) as indicated for 36 hours and assayed ~or ~-galactosidase and luci~erase activity. LUC
activity is normalized ~or ~-gal activity. 'The relative luciferase activity is calculated by dividing the normalized luci~erase value at a given point by that obtained in the absence o~ a trans~ected receptor or ligand. A single experiment representative o~ four independent experiments is detailed above. Data shown indicate the mean + SE(m) o~ triplicate estimations.
Fig. 2 shows schematic diagrams o~ ER-w~, ERN282G
and ER-TAF2 (i.e., ER179C) mutants (Fig. 2A? and graphs indicating their transcription activation açtivities (Fig. 2B, C and D).
CV1, HepG2 and HS578T cells were transiently co-trans~ected with increasing concentrations o~ di~erent receptor expression vectors as indicated, and assays were conducted as described in Fig. 1.
Fig. 3 shows diagrams indicating transc~iption activities o~ TAF1 and TAF2 on the human C3 gene promoter in dif~erent cells.
In Fig. 3A, 3B and 3C, CV1, HepG2 and HS578T cells were transiently co-trans~ected with 0.5 ~g o~ the indicated receptor expression vector, 9.5 ~g o~ C3-LUC
reporter plasmid, 5 ~g pRSV-~-gal and carrier DNA to a total amount of 20 ~g DNA. In addition, a minus receptor control was included.
Cultures were treated with or without 1 0 -7 M
17-~-estradiol (E2) ~or 36 hours, and assayed for luci~erase activity. The data shown are representative curves o~ experiments that have been repeated 6 times CA 02222~62 1997-11-27 W O 96/41013 PCTAUS961~5~8 with similar results. The curves represent averages of quadruplicate data points averaged and normalized for transfection efficiency by simultaneous estimation of pRSV-~-gal transcriptional activity.
Fig. 4 shows graphs indicating transcription activities of ER-TAF1 and ER-TAF2(i.e., ER179C) on different promoter constructs.
In Fig. 4A and 4B, CV1 and HepG2 cells were transiently co-transfected with 0.5 ~g of the indicated receptor expression vector, 9.5 ~g of pA2-LUC reporter plasmid, 5 ~g pRSV-~-gal and carrier DNA to a total amount of 20 ~g. In Fig. 4C and D, CV1 and HepG2 cells were co-transfected as described above, using the pEREMLT-LUC reporter.
Cultures were treated with or without 10-7 M
~-estradiol (E2) for 36 hours and assayed for luciferase activity. Data presentation is described in Fig. 1.
Fig. 5 shows graphs indicating activation of ER-TAF1 and ER-TAF2 (i.e., ER179C) by triphenylethylene-derived estrogen partial agonists. ER represents ER-wt, ERm represents ER-TAF1, TAF2 represents ER-TAF2 (i.e., ER-179C,) and TAF2m represents ER-Null.
HepG2 cells were co-trans~ected with 0.5 ~g of the indicated receptor expression vectors, 9.5 ~g of C3-LUC
reporter, S ~g of pRSV-~-gal and carrier DNA to a total amount o~ 20 ~g.
Cultures were treated with 10-7M of 17-~-estradiol (i.e., E2, Fig. 5A), Tamoxifen (Fig. 5B), 4-hydroxy-Tamoxifen (Fig. 5C), Nafoxidine (Fig. 5D) or Clomiphene (Fig. 5E) for 36 hours and assayed for luciferase activity. Data presentation is described in Fig. 1.
Fig. 6 shows diagrams indicating displacement of estradiol binding to ER-wt and ER-TAF1 proteins by estrogen agonists.
Yeast cytosols prepared from cell expressing ER-wt or ER-TAF1 were incubated overnight at 4~C with 5 nM of 3H-17-~-estradiol alone or in the presence of the CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 indicated concentrations of the di~ferent e-strogen agonists. Ligand binding was determined by scintillation counting following separation;of bound and free ligand using hydroxylapatite.
Fig. 7 is a schematic model showing TAFi and TAF2 as ~unctionally dependent activators of transcription.
This schematic outlines a hypothesis fo~ the promoter and cell specificity of the individual transactivators of the estrogen receptor. Interaction of the receptor with ligand initiates a cascade of events which exposes the receptor DNA binding region (DBD) and promotes association of ER with D~A. Only "estrogenic compounds" are capable of functionally activating TAF2 region o~ the receptor. Upon activation (B), the TAF2 region of the receptor interacts with a transcriptional repressor (I), displacing it or altering its structure (C) to permit the TAF1 activation sequence access to the general transcription apparatus (GTA). In certain cells and on certain promoters, TAF2 function of the receptor can be supplied by other transcription factors, allowing TAF1 region of the receptor to function independently of TAF2. Therefore,'binding of the receptor to DNA is synonymous with transactivation and can be accomplished by both estrogen agonists, as well as antagonists that permit delivery of the receptor to DNA. In this model, the partial agonist activity of the triphenylethylene-derived estrogen agon1sts depends on the conformation induced by the ligand and the effect that this conformation has on the presentat-on of TAF1 to the transcription apparatus.
Fig. 8 shows diagrams indicating that the partial agonist activities of the triphenylethylene derived antiestrogens depends on TAF1 function.
HepG2 cells were cotransfected with 0.5 ~g of the indicated receptor expression vectors, 9.5 ~g of C3-LUC
reporter, 5 ~g of pRSV-~-gal and pGem4 as carrier DNA to a total amount of 20 ~g.
CA 02222~62 1997-11-27 W O 96/41013 PCTrUS96/09f~8 Cultures were treated with various concentrations of 17-~-estradiol (Fig. 8A), Clomiphene (Fig. 8B), Nafoxidine (Fig. 8C), 4-OH-Tamoxifen (Fig. 8D) and keoxifene (Fig. 8E) for 36 hours and assayed for luciferase activity. The data for panel E was obtained relative to a different estradiol control than the other panels. Thus, the peak in panel E appears approximately five times higher than it would if the data had been obtained relative to the same estradiol control that was used in panel A. The relative luciferase activity was calculated as described for Fig. 1. A single experiment representative of 6 independent experiments is detailed.
The data shown indicate the mean + SE(m) of triplicate estimations.
Fig. 9 is a diagram showing the effect of keoxifene (keox) on MCF-7 cell proliferation. The activity of estrogen in this assay is maximum at 10-l~ M, and induces MCF-7 cell proliferation to 1500~ of the control.
Fig. 10 is a diagram showing the structure of pC3-LUC plasmid.
Fig. 11 is a diagram showing functional domains ofintracellular receptors.
Fig. 12 shows diagrams indicating schematic structure organization of PRB, PR-TAFl (i.e., PRB(Eg07A,E9llA)), PR-TAF2 (i.e., PRA) and PR-Null (i.e., PRAlE907A,E9llA) ) -Fig. 13 shows diagrams indicating activity of PR-TAF1 on MMTV promoter.
Plasmid phPRB or phPRB(Eg07A E9llA) was transfected into MCF-10 cells (A) or CV-1 cells (B) together with an MMTV-LUC reporter plasmid (10 ~g/ml) and pCH110 (5 ~g/ml) as an internal control. The amount of expression vector was chosen to permit maximal transcriptional activation in each cell line e~mi ned. The transfected cells were incubated for 40 h with increasing concentrations of progesterone as indicated, and assayed CA 02222~62 1997-11-27 WO 96/41013 PCT/U',G~56~8 for luciferase and ~-galactoside activities~ The data are presented as normalized luciferase (LUC~ units.
Normalization was calculated by dividing the raw luciferase activity (relative light units x~ 104) for each point by the ~-galactosidase activity (A415 x 105)/time in minutes) at that point. The data shown represent the mean values +/- the standard errors of the means of 12 replicates.
Fig. 14 shows graphs indicating activity of PR-TAF2 on TAT promoter in HeLa cells.
HeLa cells were transiently co-transfected with increasing concentrations of the hPR expression plasmid phPRB or phPRA (A), or phPRA or phPRAtEg07A,EgllA) (i-e-, PR-TAF1) (B) together with a TAT-LUC reporter plasmid (10 ~g/ml) and pCH110 (5 ~g/ml) as an internal control. The transfected cells were incubated with or without 10-7 M
progesterone as indicated for 40 h and assayed for luciferase (LUC) units calculated as for Fig. 13.
Fig. 15 shows graphs indicating activity of PR-TAF2 on MMTV promoter in HepG2 cells.
HepG2 cells were transiently co-transfected with increasing concentrations of the hPR expression plasmid phPRB or phPRA (A), or phPRA or phPRA (E907A,E9llA) (i.e., PR-TAF1) (B) together with an MMTV-LUC reporter plasmid (10 ~g/ml) and pCH110 (5 ~g/ml) as an internal control.
The transfected cells were incubated with or without 10-7 M progesterone as indicated for 40 h and as.sayed for luciferase and ~-galactosidase activities. ~The data are presented as normalized luciferase (LUC) units calculated as for Fig. 13.
Fig. 16 (A-D) are diagrams showing saturation analysis of the binding of [3H] progesterone to PRA and PRB mutants.
Aliquots of in vi tro expressed receptor proteins PRB-wt (A), PRB(Ego~A~Eg1lA) (B), PRA-wt (C) and PRA(Eg07A~Eg (D) were incubated for 18 h at 4~C with increasing concentrations of [3H] progesterone. Bound¦and free CA 02222~62 1997-11-27 W O 96/41013 PCT/U5,G~'~3G38 ligand were separated using the dextran coated charcoal method. Each point represents duplicate determinations.
Scatchard analysis o~ the saturation data are shown for each receptor protein in the inserts.
Fig. 17 is a graph showing the agonist activity of DHT on AR and the antagonist activity of 2-OH Fluramide on AR.
Fig. 18 is a graph showing an AR-TAF1 specific assay for screening AR-TAF1 agonists.
Figure 19 shows the structure organization of GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-Null.
Fig. 20 shows the organization structures of GR-Gal4 constructs.
Fig. 21 is a graph showing the effect of mutations on TAF2 transactivation function.
Gal4 DNA binding domain fused to the ligand binding domain of either wt GR (Gal-G) or mutant galG. The number following Gal-G indicates the amino acid(s) that was mutated to alanine. These constructs were transfected into CV-1 cells. Dexamethasone was added to the cell culture. Each mutation resulted in a drastic reduction of the luciferase gene activation by dexamethasone.
Fig. 22 is a graph showing activation profiles obtained with different promoters.
Wild type and mutant GRs were co-transfected in CV1 cells with luciferase reporter genes driven by either MMTV, C3 or TAT3 promoters. Gene activation is measured after 24 hours of dexamethasone treatment.
Description of the Preferred Embodiments The methods discussed briefly above are useful for - identifying agonists or antagonists of various intracellular receptors, including, but not limited to, ER, GR, AR and PR.
ER, GR, AR and PR are members of the nuclear receptor super-family, a class of transcription factors CA 02222~62 1997-11-27 WO96/41013 , PCT/U',G/~638 whose ~unctions are regulated by steroids, vitamins or thyroid hormone (Beato, Cell 56:335, 1989). This ~amily of regulatory proteins share common mechani!stic ~eatures in that they are transcriptionally inactive within the cell until exposed to hormone. Occupancy by hormone results in trans~ormation of=the receptor to an activated state, thus allowing it to productively interact with speci~ic DNA sequences in the regulatory regions of target genes. The resultant positive or negative effects o~ the bound receptor on specific gene transcription are cell-type and promoter-context dependent. Nonetheless, the relative ef~ect may be measured in any particular cell/promoter construct.
Thus, the desired effect may be observed in a wide variety of constructs.
The following are speci~ic examples of this invention. These examples make use of the estrogen receptor, androgen receptor, progesterone receptor and glucocorticoid receptor, but are not limiting in the invention. Those in the art will recognize that other equivalent receptors, cells and promoters c m be readily used in equivalent procedures within the scope of the claims.
I. Estroqen RecePtor The cDNA for ER has been cloned and used to reconstitute estrogen responsive transcription units in heterologous m~mm~l ian cells (Kumar et al., EMBO J.
5:2231, 1986, and Green et al., 231 Science,1150, 1986).
This has enabled a detailed ~m; n~tion 0~ the functional domains within the protein (Kumar et al., Cell 51:941, 1987). A functional ~m;n~tion of the domains of ER in several systems has revealed the likely structural ~eatures within the receptor which may interface with critical cellular componentslto generate a variety of hormone responsive endpoints (Danielian et al., EMso J. 11:1025, 1992).
CA 02222~62 1997-11-27 W O 96/41013 PCT~US9G/~96~8 Two distinct transactivation domains have been defined, a sequence at the amino terminus of the receptor, termed TAF1, and a sequence confined to the carboxyl 60 amino acids, termed TAF2 (Danielian et al., supra; Berry et al., EMBO J. 9:2811, 1990; and Tasset et al., Cell 62:1177, 1990), all hereby incorporated by reference herein. Recently, investigators involved in intracellular receptor research have favored referring to the TAF domains, as AF domains (e.g. Cavailles et al., J. of Cellular Bio., 341, 1994) to avoid confusion with the discovery and cloning of TATA-binding protein associated factors (Dynlacht et al., 66 Cell, 563, 1991) .
Pierre Chambon and his group (Kumar et al., Cell 51:941, 1987) have used truncated estrogen-receptor-encoding genes to study properties of the estrogen receptor and its alleged cell-type and promoter-context dependent activity. These truncated genes express ERs lacking all or a portion of two domains termed TAF1 and TAF2. These domains are thought to be regulated by estrogen and then cause promoter activation.
Tora et al., Cell 59:477 (1989), analyzed truncated mutants of human estrogen receptor, and described TAFl and TAF2 as two transcriptional activation functions in the receptor. These activators are said to exhibit cell-type specificity and promoter-context dependency.
The authors indicate that TAF2 acts synergistically with upstream elements.
Meyer et al., Cell 57:433 (1989), describe inhibition of transcription stimulation by the progesterone receptor by co-expression of the estrogen receptor. The authors propose that the observations reflect competition by the receptors for a limiting transcription factor.
Berry et al., EMBO Journal 9:2811 (1990), describe promoter-specific and cell-specific effects of an agonist on estrogen-responsive genes. Truncated and CA 02222~62 1997-11-27 i WO96/4l013 PCT~S96/09638 chimeric estrogen receptors were used which contained TAFl and/or TAF2 regions from the same or different sources.
Tassett et al., Cell 62:177 (1990), deslcribe interaction of TAFl and TAF2 regions, and c~ompetition (squelching) for limiting factors, by comparing relative activities of TAF regions and competitor constructs.
Fawell et al., Cell 60:953 (1990), describe estrogen-receptor dimerization and its alteration by mutations in the molecule.
Metzger et al., Nucleic Acids Research 20:2813 (1992), describe alleged promoter- and cell-specificity of TAFl and TAF2 regions in the yeast Saccharomyces cerevisiae. Truncated receptors, or recept~rs having regions deleted from them, were used in the analyses.
Danielian et al., EMBO Journal 11:1025 ~(1992), describe conserved regions in the estrogen receptor and state that:
Activities of TAFl and TAF2 vary depending upon the responsive promoter and cell type and, in some cases, both are re~uired for full transcriptional stimulation.
The authors identify amino acids near the C-terminus of the mouse estrogen and glucocorticoid recep=ors which are said to be essential for hormone dependent stimulation of transcription. Point mutations were introduced either into the full-length receptor, or into an internal deletion mutant which lacked the TAFl region, to allow the authors to determine the effects of mutations upon TAF2 activity in the absence or presence of TAFl.
It appears that alterations in charged residues of the amino terminal portion of the hormone binding domain can result in increases or decreases in ER
transcriptional activity with no change in receptor affinity of cognate hormone. Therefore, the regions around residue 530 (Danielian et al., supral) and the CA 02222~62 1997-11-27 W 096/41013 PCT/U~,6/'~ 8 . .
region around cystelne 381 (Pakdel et al., Mol Endocrinol, 7:1408, 1993) may in themselves constitute AF su~domains within TAF-2. It follows then, that changes in such domains, such as the region around cysteine 381, could result in mutant receptors which could discriminate between estrogen and antiestrogen ligands, paralleling the results obtained as detailed herein. Furthermore the analogous situation could exist for discreet residues in the TAF-1 region of ER.
The following experiments characterize the dependence of ER-TAF1 and ER-TAF2 activities on cell-context and promoter-context in m~mm~l ian cells, and the role of agonist or antagonist in the manifestation of these differences. Some of these experiments are described in Tzukerman et al., Mol. Endocrin 8:21, 1994, hereby incorporated by reference herein.
Receptor constructs cDNA sequences encoding the ER-wt and a TAFl -deleted receptor derivative were excised from the plasmids YEpwtER and YEpER179C, respectively, using BfrI
and SacI. The DNA encoding the TAFl receptor derivative was excised from the plasmid YePERN282G using BfrI and K~nI. Construction of the vectors YEpwtER, YEpER179C
and YEpERN282G, have been described previously (Pham et 25 al., Mol. Endo. 6:1043, 1992). The excised DNA was treated with T4 DNA polymerase (Boehringer Mannheim Co.) and ligated into the unique EcoRV site within the m~mm~l ian expression vector pRST7 (Berger et al., J.
Steroid Biochem. Mol. Biol. 41:733, 1992).
The wild type estrogen receptor cDNA (ER-wt) was cloned into pGEM-llZf(+) (Promega, Wisconsin). Specific mutations were introduced into the hormone binding domain of the receptor by substituting alanine for amino acids located at positions 538, 542, and 545, using site directed mutagenesis (Kunkel et al., 154 Methods in Enzvmoloqy 367, 1987), creating the plasmid pGERm. The CA 02222~62 1997-11-27 WO96/41013 PCT~S96~09~8 mutated hormone binding domains were introduced into ER-wt and ER179C by exchanging the BglII-SacIIC-terminal ~ragment o~ this vector with the analogous'mutated ~ragment from pGERm.
Reporter plasmids The reporter ERE-tk-LUC contains a sinqle copy o~
the vitellogenin ERE upstream o~ the herpes simplex thymidine kinase promoter sequences linked to luci~erase (LUC).
The C3-LUC reporter contains 1.8 kb of the human C3 gene promoter (-1807 to +58) (Vik et al., Biochemistrv 30:1080, 1991). Unique restriction sites Xhol and BamH1 were introduced into the C3 promoter, the DNA was then cloned into the cognate sites o~ the vector pl-LUC
(Berger et al., J. Steroid Biochem. Mol Biol. 41:733, 1992), where a polyclonal site has been inserted into the MMTV-LUC vector (see Fig. 10). Those in the art can readily construct equivalent vectors.
pA2-LUC contains a 835 bp ~ragment (-821 to +14) of the Xenopus vitellogenin A2 gene promoter (Vik et al., Biochemistrv 30:1080, 1991).
pEREMLT-LUC contains a single ERE upstream the adenovirus major late promoter sequences (-44 to +11) (Hu and Manly, Proc. Natl. Acad. Sci. USA 78:820, 1981).
Cell cultures CV1 and HS578T cells were routinely maintained in Dulbecco's modi~ied Eagle's medium - DMEM (Biowittaker, Maryland) supplemented with 10~ ~etal bovire serum (FBS) (Hyclone Laboratories, Utah). HepG2 cells were maintained in M;n;m~l Essential Medium Eagle's - MEM
(Biowittaker, Maryland) containing 10~ FCS.
Transient trans:Eection assay Cells were seeded 24 hours prior to trans~ection in ~lat-bottom 96-well tissue culture platesj(5xlo3 CA 02222~62 1997-11-27 W O 96/41013 PCT/U',~1'05~38 cells/well), in phenol red-free DMEM containing 10~ FBS.
DNA was introduced into cells using calcium phosphate precipitation. Plasmid DNA was diluted in 1 ml of 1 mM
Tris, pH 7.4, 0.1 mM EDTA, 0.25 M CaCl2. DNA solution was added dropwise with vortexing into an equal volume of 2X HBS pH 6.9 (280 mM NaCl, 50 mM HEPES, 1.5 mM
Na2HPO4) and precipitates were allowed to form for 20 minutes. Transfections (11 ~l of DNA mix/well) were performed on a Biomek 1000 Automated Laboratory Workstation (Beckman, California). Cells were transfected for 6 hours and then washed with phosphate-buffered saline (PBS) to remove the precipitate. Cells were incubated for an additional 36 hours in phenol red-free medium containing 10~ charcoal-treated FBS, with or without hormones as indicated in the text. Cell extracts were prepared as described by Berger et al., J.
Steroid Biochem. Mol. Biol. 41:733, 1992, and assayed for luciferase and ~-galactosidase activities. All determinations were performed in triplicate in at least two independent experiments, and were normalized for transfection efficiency by using expression of ~-galactosidase as an internal control.
Preparation of Yeast receptor proteins Expression vectors producing ER-TAF1 were constructed by replacing the B~rl-Mlul fragment of YEpE10 (Pham et al., 88 Proc. Natl. Acad. Sci. USA 3125, 1991) with the corresponding fragment of pRST7ER-TAF1.
This vector and a vector producing wild type receptor (YEPE10) were transformed into the yeast strain BJ2168 as described by McDonnell et al., J. Steroid Biochem.
Molec. Biol. 39:291, 1991. Individual transformants were picked and grown to an OD600=1. Cultures were then induced with 100 ~M CuS04, and 2 mM chloroquine for 16 hours at 30~C. Cells were then pelleted and washed with cold water. Cells were resuspended in 2-5X pellet volume o~ 10 mM Tris, 0.4 M KCl, 2 mM EDTA, 0.5 mM PMSF, .
CA 02222~62 1997-11-27 W O96/41013 ' PCTAJS96/09638 1 ~g/ml aprotinin, 2 mM DTT, pH 7.6, and lysed by vortexing with 0.45-0.5 mm glass beads, intermittently with cooling on ice, until at least 90~ o~ the cells were observed to be open. Extracts were cehtrifuged at 13,000xg and the supernatants were recovereld. Protein concentrations were determined by Bio-Rad Plotein Assay (Bio-Rad, Richmond, CA).
~-Estradiol bindinq competition assay This assay was performed on a Biomek 1000 automated workstation (Beckman Instrument, Fullerton, CA). Ten-fold serial dilutions of the compounds to be tested were made in 10 mM Tris, 0.3 M KCl, 5 mM DTT, pH 7.6, and transferred to polystyrene tubes containing' 100 ~1 at final concentrations of 10-4 M to 10-1l M dillted compounds, 5 mM 3H-~-estradiol (Amersham, UK), and 22 ~g total protein derived from strains producing ER or ER-TAFl. Following an overnight incubation at'4 C, 100 ~1 of a 6~ hydroxylapatite slurry in 10 mM Tris, 5 mM DTT, pH 7.6 was added. The tubes were incubated for an additional 30 minutes at 4~C, mixing after the first 15 minutes. Hydroxylapatite pellets were washed 4X with 1 ml 1~ Triton X-100 in 10 mM Tris, 5 mM DTT, pH 7.6.
Finally, the hydroxylapatite pellets were resuspended in 800 ~1 of Ecoscint A scintillation fluid (National Diagnostics, Manville, NJ). Activity in each sample was measured u~ing a LS6000IC scintillation counter (Beckman Instruments, Fullerton, CA).
Example 1: ER-TAFl Transcription Activation Requires the Functional Context of TAF2 TAFl and TAF2 functions have been defined as individual domains within the estrogen receptor that were capable of supporting transcription of an ER
responsive promoter (Berry et al., 9 EMBO J. 2811, 1990, and Tasset et al., 62 Cell 1177, 1990). However, we were unable to show a distinct activity of _he TAFl CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 sequence when analyzed in the context of the ERN282G
deletion in the mammalian cells tested here. Therefore, we considered whether analysis of this transactivator outside the context of the full-length receptor may not reflect its true biological activity.
Danielian et al., su~ra, changed three amino acids between residues 535 and 550 in the carboxyl terminus of the mouse estrogen receptor which comprises transcriptional activity of TAF2 without diminishing the receptor's ability of binding both specific DNA and cognate ligand with wild type affinity, indicating that these changes did not lead to gross structural abnormalities in the protein.
We created similar amino acid changes in the carboxyl terminus of human ER at residues 538, 542 and 549 using site-directed mutagenesis (see the ER-TAFl construct of Fig. 1). This triple mutation was also introduced into ER179C creating a null estrogen receptor (See the ER-Null construct of Figure 1). ER-Null and ER-TAFl constructs allowed a specific determination of the effect of these mutations on TAF2 function. The transcriptional activities of these mutant ERs were assessed by transient transfection into CV-l cells together with the ERE-tk-LUC reporter.
Mutation of these three amino acids provides but one example by which the context of a TAF region can be maintained while inactivating that region. Those in the art will recognize that equivalent mutations in the same or other amino acids can be readily made by standard techniques.
Introduction of the triple mutation into ER179C
totally abolished TAF2 activity (Fig. lB). Thus, we believed that introduction of this mutation into the wild-type ER would allow an ~mi n~tion of TAFl activity in the full-length receptor context without interference from TAF2 activity. The ability to specifically mutate the TAF2 activator within the human estrogen receptor in CA 02222~62 1997-11-27 W O 96/41013 j PCT~US96/09638 this manner is consistent with the results previously reported for the mouse ER, and indicates that equivalent mutations can be made in the other receptor TAF regions.
The full-length receptor containing the triple mutation (ER-TAF1) was subsequently used for analysis of TAF1 function in the context of the intact'receptor.
Constructs encoding wild type receptor, ER-TAF1, ER-TAF2 (i.e., ER179C) or ER-Null were transfected into CV-1, HepG2 or HS578T cells, together with the EPE-tk-LUC
reporter. The results are shown in Fig. 1 In all cell lines, the ER179C was transcriptionally active, as observed earlier (Figs. lB, C &'D), whereas the null receptor was inactive. Interestingly, in CV-1 cells, in the absence of a functional TAF2 activation sequence, the ER-TAF1 protein exhibited a significant transcriptional activity (Figs. lB, C & D). Thus, the activity of the TAF1 activator when analyzed in the context of a full length receptor molecule, as observed here, was different ~rom that when analyzed as a deletion mutant (ERN282G, Fig. 2). This suggests that TAF1 activity does not function independently, but rather requires additional carboxyl-terminal sequences for appropriate function.
Interestingly, increasing the concentration of transfected ER-TAF1 DNA did not result in a receptor dependent "squelching" of transcriptional activity.
This observation implies that both TAF1 and TAF2 activators and possibly the context of the full-length receptor are required for this squelching function.
A comparison was made o~ the expression level of each of these receptors by transfecting the expression vectors into CV-1 cells and analyzing the hormone binding activities in the resulting cytoso_ic extracts (data not shown). The Kds of the ER-wt, ER-TAF1 and ER179C were the same. The ER-wt and ER-TA-~1 were synthesized in comparable levels as measured by hormone binding activity, whereas the amino-terminally deleted CA 02222~62 1997-11-27 WO 96/41013 PCTAUS96/096~8 ER179C and the null receptor were expressed at about 25~
of ER-wt level. Since all the transcriptional responses detected with each receptor were maximal responses achievable, it is unlikely that receptor expression S levels are a significant factor in the outcome of our experiments.
Example 2: Transcriptional Activation bY TAF1 and TAF2 Truncated Receptors Referring to Fig. 2, truncated forms of the human estrogen receptor were prepared which lacked either the TAF1 (ER179C, see Fig. 2A) or the TAF2 (ERN282G, see Fig. 2A) activation sequence. These constructs encode proteins structurally similar to those used previously in m~mm~lian (Berry et al., 9 EMBO J. 2811, 1990) and yeast cells (Pham et al., 6 Mol. Endo. 1043, 1992).
The transcriptional activities of these ER
derivatives were assessed using a reporter plasmid containing one copy of the vitellogenin estrogen response element (ERE) (Klein-Hitpass et al., 76 Cell 1053, 1986) inserted upstream of the thymidine kinase promoter (ERE-tk-LUC). The reporter plasmid and increasing concentrations of ER or mutant ER expression vectors were transiently transfected into the ER
negative cell lines CV-1 (monkey kidney fibroblasts), HepG2 (human hepatocellular carcinoma) and HS578T (human breast cancer cells), and activity assessed as documented in Fig. 2B. All transfections were performed in the absence or in the presence of 17-~-estradiol at concentrations ranging from 10-5M to 10-11M. However, due to the number of data points obtained in this way (~2,500) only the activities obtained using 10-7M 17-~-estradiol are presented since this is a concentration that elicited m~l m~ l transcriptional response in all cell lines ~m~ ned.
The ER-wt was active in all cell lines. Using this protocol, we were unable to detect significant TAF1-CA 02222~62 1997-11-27 W O 96/41013 PCTnJS96/09638 mediated transcriptional activity in either CV-l, HepG2, HS578T (Figs. 2B, C, D) or HeLa or U20S cells (data not shown) when assayed in the context o~ the ERN282G
deletion. In contrast, however, the TAF2 activation ~unction (ER179C) exhibited substantial activity in these cells (Figs. 2B, C & D). The magnit4de o~ the TAF2 transcriptional activity by ER179C was cell-type dependent. This isolated activator exhibitled a lower e~icacy relative to wild type receptor, even at DNA
concentrations that produced saturating receptor levels.
In HepG2 cells ER179C was about 35~ as active as ER-wt (Fig. 2C), whereas in CV-l and HS578T, the ER179C
demonstrated 70~ and 65~ o~ ER-wt activity respectively (Figs. 2B & D). Trans~ection e~iciency ard recombinant expression levels were similar as estimatec by indirect ~luorescence microscopy and flow cytometric analysis (data not shown).
The results obtained in this analysis are consistent with the hypothesis that the TAFl and TAF2 sequences represent ~unctionally distinct transcriptional activators. A wild type receptor activity requires either both activator regions or an intact receptor context ~or an individual activator to exhibit m~; m~ 1 transcriptional activity. I
In addition to the partial activities observed by the above ER-mutants, increasing concentrations o~
trans~ected ER-wt in CV-l and HS578T cells led to a progressive decrease in hormone dependent transcriptional activity (Figs. 2B & D). This phenomenon has been observed by others and likely results ~rom sequestration o~ limited transcription ~actors or targets by the over-expressed, hormone-activated receptor, such that activated receptor ~unction is compromised (Tasset et al., 62 Cell 1177, 1990). This "squelching" or "transcriptional inter~erence" supports the idea that ER requires additional, limiting cellular transcription ~actors ~or CA 02222~62 1997-11-27 appropriate function. The failure of the ER-wt to ~squelch" in the HepG2 cell line (Fig. 2C) suggests either an increased abundance of a required co-factor, or the involvement of an additional cell specific component in this process.
Example 3: ER-TAF1, HepG2 Cell and C3 Promoter Constitute an Assav for an Aaonist or Antaqonist Actina Throuqh TAF1 The above results using the ERE-tk-LUC reporter indicated that the TAF1 activator of the estrogen receptor functions, albeit weakly, in the absence o~ an intact TAF2 function. In addition, TAF1 activity appeared to be cell-type dependent.
We extended our studies to ~m; ne the efficacy of the individual activator functions on other estrogen responsive promoters. To this end, we chose the estrogen responsive C3 promoter in which a s~rong ERE
has recently been identified (Zawaz, Gene Exp. 2:39, 1992; Vik et al. Biochemistrv 30:1080, 1991).
The activities of the of ER-wt, ER-TAF1 and ER-TAF2 (i.e., ER179C) activators were evaluated on C3 promoter-directed transcription as depicted in Fig. 3. In HS578T
cells, the C3 promoter can be activated equally well by either ER-wt, ER-TAF1 or ER179C (Fig. 3C). In HepG2 cells, however, the ER-TAF1 activator was as active in transcription as wild type ER, but the ER179C activator was silent (Fig. 3B).
These data suggest that, with respect to the C3 promoter, there is a strong cell-type bias in ER
transactivator functions. In CV-1 cells it appears that the combination of the activation sequences is required for m~; m~ 1 activity (Fig. 3A). Cumulatively, these data suggest that the TAF1 and TAF2 activators within ER
demonstrate a dependence upon cell-type and promoter, and furthermore, the dominant activator of ER-mediated regulation of C3 expression is TA~1.
CA 02222~62 1997-11-27 The analysis of the relative contributilon of the individual ER TAF domains in ER function was extended to include two additional promoters, namely the adenovirus major late promoter, containing an estrogen response element, and the vitellogenin promoter (Fig. 4). Both of these promoters were responsive to estrogen in the presence of ER-wt. However, unlike the C3 promoter the individual activation domains of ER were mihimally active in both cell lines examined. This highlights further the promoter specificity of the estrogen receptor activation domains. Similar tests to those described above can be used to quickly identify useful promoter and cell combinations for use in assays for agonists discussed above (see also, Example 4, below).
Example 4: Screeninq Aaents for Partial Aqonist Activity Certain triphenylethylene-derived estrogen receptor antagonists (i.e., tamoxifen, nafoxidine) aire reported to exhibit partial agonist activities. We ,tested whether these compounds preferentially actilvate either TAF1 or TAF2 transactivators.
A series of these compounds was evaluatled in HepG2 cells using the ER-TAF-specific receptor derivatives and the C3 promoter. In this cellular and promoter context, ER179C was not activated by either estradiol or the partial estrogen agonists. On the C3 promo~ter, tamoxifen, 4-hydroxy-t~mox~fen, nafoxidine and clomiphene were all potent activators of ER-wt mediated C3 gene transcription (Figs. 5B-E) Howevelr, none of these compounds were as effective as estrogjen in this regard (Fig. 5A). In addition, estrogen was an efficient activator of the ER-TAF1, whereas the partial estrogen agonists were not as effective.
These data imply that even though TAF1 ~activity is necessary, it alone does not activate this promoter by triphenylethylene-derived antihormones, suggesting that CA 02222~62 1997-11-27 W O 96/41013 PCT~US~6~
their mode of action may be mechanistically different from that of estrogen (Figs. 5A-F). The differences in hormonal responsiveness of these receptor derivatives do not relate to alterations in the affinity of the proteins for ligands. As shown in Figs. 6A and B, the affinity and specificity for ligands of the ER-wt and ER-TAF1 were indistinguishable. It is notable that not all the anti-hormones tested in this system have an identical transcriptional profile (Figs. 5B-E). The absolute efficacy for each of the anti-hormones is different, as is their ability to differentially activate TAF1, suggesting subtle mechanistic differences in the agonistic properties of these ligands.
These examples demonstrate specific point mutations in the human estrogen receptor affects ER-transcription activation function. Mutation of TAF2 in this manner is still compatible with wild-type binding affinities for estrogen, tamoxifen and 4-hydroxy-tamoxifen.
Surprisingly, TAF1 retained considerable transcriptional activity despite TAF2 mutation. When we deleted the entire TAF2 sequence (ERN282G) we were unable to observe residual transcriptional activity of TAF1 in any cell line ~X~m; ned. This suggests that either TAF2 or the context of the full length receptor is required for full manifestation of TAF1 activity.
Berry et al. have observed that a construct identical to ERN282G was constitutively active in avian CEF cells (Berry et al., g EMBO J. 2811, 1990). This may suggest a difference in estrogen receptor function in m~mm~l ian and avian cells, and may not reflect basic differences between the two sets of results.
Using the modified receptors we were able to identify cell and promoter specific differences in the activity of ER-TAFl and ER-TAF2 (i.e., ER179C). In studies which were controlled for expression level and transfection efficiency we saw that both activators displayed promoter and cell type specific differences in CA 02222~62 1997-11-27 WO 96/41013 PCT/U'9G~638 their activity. The most striking example of this is the inability o~ ER179C to ~unction well on any promoter in HepG2 cells. The ER-TAF1 activator, on the other hand, ~unctions very well on the complex C3,promoter, but less well on the other promoters ~m; ned The activity pro~iles o~ ER-TAF1 and ER179C are clearly distinct, suggesting dissimilar mechanisms Q~ action.
On the complex C3 promoter there is no apparent synergism between TAF1 and TAF2, whereas it'clearly exists on other promoters. This suggests that on this promoter the ER activation domains may interact with di~ering transcription ~actors. The data obtained using the C3 promoter in HepG2 cells indicate that there is a transcription ~actor in these cells that can ~unctionally replace TAF2, as TAF1 is as good a transcriptional activator as ER-wt. However, since TAF2 alone does not activate transcription, it suggests that no mimetic ~or TAF1 exists ~or transcription of this promoter in this particular cell line.
The dissimilar mechanism o~ action and the promoter and cell type speci~icity can be explained by a model in which TAF1 is the dominant transcriptional a,ctivator and TAF2 is a transcriptional facilitator (see model in Fig.
7). We suggest that the ~unction o~ TAF2 is to "prepare" the transcription apparatus ~or TAF1 function.
This "preparation" ~unction could be the reçruitment o~
basic transcription ~actors, alteration o~ chromatin structure or overcoming the e~ects of a transcriptional repressor. On the other hand, TAF2 could ~prepare" the transcription apparatus ~or another transcrlptional activator, but on its own would have little inherent transcriptional activity. In support o~ this hypothesis, the TAF2 activator is poorly active on m; n; m~ 1 promoters.
This dependence on promoter complexity -s also observed for ER-TAF1 activity. Additional ~vidence in support o~ the ~acilitator role o~ TAF2 is that in yeast CA 02222~62 1997-11-27 W O 96/41013 PCT/W'6'~96~8 the TAF1 activator is inactive on a minimal promoter.
However, a mutation of the SSN6 locus (a cellular repressor of transcription), Keleher et al., 68 Cell, 709, 1992, results in a 100-fold increase in ER-TAF1 activity (to a level comparable to ER-wt), whereas ER179C activity is not effected (McDonnell et al., 89 Proc. Natl. Acad. Sci. USA 10563, 1992). We suggest that this cellular mutation has the effect of mimicking the function of TAF2, and that in mammalian cells TAF2 has a similar role. In this system TAF1 is unable to access the transcription apparatus as a result of stearic hindrance by an inhibitor Where TAF2 is available, then the inhibitor is displaced and TAF1 is able to interact with the transcriptional apparatus.
Example 5: Screeninq For and Use 0~ Compounds With Keoxi~ene-Like Transcri~tional Profiles In hnm~n.q the tri-phenylethylene derived anti-estrogen keoxifene exhibits bone sparing activity while having no significant effects on uterine proliferation.
In contrast, tamoxifen, a related anti-estrogen, is bone sparing but functions as a partial estrogen agonist in the uterus promoting an undesirable proliferative effect.
In order to determine whether the differences in the in vivo biological activity o~ tamoxifen and keoxifene could be reconciled by their differential ability to transcriptionally activate TAF1, these compounds were studied in HepG2 cells using the ER-TAF specific receptor derivatives on the C3 promoter. The results are shown in Figure 8D and 8E.
Keoxifene had a unique transcription profile in this promoter and cellular context. In particular, low concentrations of keoxi~ene stimulated ER
transcriptional activity. At higher concentrations, keoxifene inhibited the basal transcriptional activity of ER and did not cause further transcriptional CA 02222~62 1997-11-27 activation (See Fig. 8E). On the ER-TAFl construct, keoxifene demonstrated significant partial;agonist activity inducing C3 promoter transcription 5-fold over background. The mechanism by which keoxifene manifests a transcriptional profile distinct from the related molecule tamoxifen is unclear. However, it is likely that these compounds induce subtle alteratilons in receptor structure which facilitate distinct interactions of the ER-TAFs with the genera~l transcription apparatus.
The unique profile exhibited by keoxifehe in this in vitro assay suggested that additional compounds displaying similar transcriptional profiles may also exhibit favorable bone protective/uterine sparing activities. To this end we have studied several compounds derived from tamoxifen using this assay system and have been able to split these compounds into three distinct groups based on their ability to modulate TAFl activity. The first category contains compounds that resemble the activity of estrogen, the second group resembles the activity of tamoxi~en and the third group profile similar to keoxifene.
When the keoxifene-like compounds are alsayed in the ovariectomized rat model they are expected to be bone protective and to demonstrate no uterotrophic activity.
Rats are given a dorsal ovariectomy as follows:
The animals are anesthetized with Ketamlne:Xylazine and surgery is performed. Shave the centrai back of the anesthetized rat. Make a longitudinal incision in the skin parallel to the spine about 1 inch long. Spread the connective tissue away from the muscle layer with the tips of scissors. About 1 inch from the spinal column at the base of the rib cage, make a small cut (1/4") of the muscle with scissors. With small forceps, pull out ovarian fat. Ovary will be visible as a cluster-like structure, attached to the end of the uterine horn. Cut the connective tissue that holds them CA 02222~62 1997-11-27 W O96/41013 PCTrUS~6~'~5-~8 together. Staunch any bleeding. Replace fat into body cavity. Repeat on opposite side. Clip skin together and use betadine on the incision to retard infection and reduce clip removal. The next day injections are begun.
Injections are done subcutaneously in the hip daily (usually in the morning). Vehicle is 10~ ethanol and all injection volumes are 300 ~l. After 28 days of injections, the ~n;m~ls are sacrificed under anesthetic by cervical dislocation and the body and wet uterine weights are determined. The hindlimbs are taken for histology and histomorphometry.
The transcriptional profile exhibited by keoxifene in vitro is predictive of agents demonstrating bone selective estrogenic activity. Thus, the use of these ER-TAF constructs ~x~m;ned on this promoter and cellular context provides a useful screen for compounds useful for the treatment of osteoporosis.
In in vivo studies, rats are subjected to sham or authentic ovariectomy and allowed to recover for 5 days.
Rats (4-6 per group) are then injected subcutaneously with vehicle or vehicle containing estrogen, keoxifene, or a test compound daily for periods up to 28 days.
~n;m~ls are sacrificed, weighed, and evaluated for uterine wet weight, total serum cholesterol, and bone mineral density. Established methods are utilized with the exception that bone mineral density of the distal femural metaphysis is determined utilizing an Hologic mineral densitometer. Bone marrow from test ~n;m~1s is evaluated for osteoclastic potential in the coculture assay with primary osteoblasts. Bone marrow is combined with primary osteoblasts in the presence of 1,25-dihydroxyvitamin D3 and parathyroid hormone for 8 days and scored for the number of tartrate acid phosphatase resistant multinucleated cells (TRAP + MNC). The number of TRAP + MNC in the sham operated animals is set at 100~. Tartrate resistant acid phosphatase positive, CA 02222~62 1997-11-27 , W O96/41013 PCT~US96/09638 multinucleated cells are scored by standard methods as nascent osteoclasts.
The in vitro effects of compounds on MCF-7 breast cell proliferation can also be studied. The partial agonist activities of estrogen, keoxifene, and the test compound on MCF-7 human breast carcinoma cells, is assessed by treating the cells for 7 days in the absence or presence of increasing concentrations of compound.
Cells are treated at day 0 and day 4 with compound.
Triplicate wells are evaluated for cell num~er at termination of the experiment on day 7. The activity of estrogen in this assay is expected to be ma~ imum at 10-~M, and induce proliferation to 1500~ of control.
The in vitro profiles of keoxifene and the test compounds could then be determined. The acthvities of increasing concentrations of compound on ER,~ER-TAF1, and ER-null receptor transactivation of the C3 promoter in HepG2 cells is determined by standard methods as described in this document. Thus, compounds that exhibit both bone protecting and uterine/breast sparing activity at a given concentration can be identified.
Higher potency compounds than keoxifene are preferred.
By "potency" is meant the amount of a compound required to produce the desired effect. Thus, high potency compounds will bind to the receptor with greater affinity than keoxifene. High potency compounds produce maximal effect at minimal dosages. As illus=rated in Fig. 8, compounds with high potency have pea~s further to the right than do compounds of lower potency.
ER agonists and their type can be quickly identified in the above systems. Specifically, the experiment described in Example 4l and illustrated in F-g. 5, is useful for identifying an agonist and then defining its type of activity. For example, the use o~ a wild type receptor (ER-wt) in this assay will indicate whether a test compound is an ER agonist. The use of a mutated CA 02222~62 l997-ll-27 W O 96/41013 PCT~US96/09638 receptor with full functional context (ERm) in the assay will indicate the type of agonist, i.e., what level of activity is observed. Examples of the range of results expected with various test compounds are shown in Fig.
5, and discussed in Example 4. Using such assays, one can readily screen for desired agonist activity, e.q., agonists active only at TAF1 regions which mimic the activity of estrogen and are useful for treatment of osteoporosis.
II. Proaesterone Receptor The steroid hormone progesterone is involved in the regulation of growth and development of m~m~y gland and uterus. Synthetic progestins and antiprogestins have been used or are in human clinical trials in treatment of endometrial and breast cancer, as combination oral contraceptive agents, and as ad~uncts to estrogen in hormonal replacement therapy.
The effects of progesterone are mediated by progesterone receptors. Upon binding to their hormonal ligands, the activated receptors bind with high affinity to specific DNA binding sites and activate transcription of the cis-linked genes.
Gronemeyer et al. (1987) EMBO J. 6:3985-3994, cloned and sequenced chicken PR and described that both the N-2 5 terminal A/B region and C-terminal hormone binding domain are required for transactivation function on MMTV
promoter in HeLa cells.
Carson et al. (1987) Mo. Endo. 1: 791-801, cloned and sequenced chicken PR, and conducted analysis to define the functional domains of the receptor. The authors state that a transcription activation function domain resides outside the hormone binding domain and that the C-terminal region may function as a "repressor".
Tora et al. (19 88) Nature 333:185-188, reported on the functional difference between chicken PRA and PRB in the transactivation of target genes.
CA 02222~62 1997-11-27 3 ' PCTrUS96/09638 Meyer et al. (1990) EMBO J 9:3923-3932, described the presence of two transcription activation ~unction (TAFs) located in the N-terminal region A/B (TAF1) and the hormone binding region (TAF2) of the human PR. The authors described the agonistlc activities of RU486.
Meyer et al. (1992) J Biol Chem 267:10882-10887, state that a region specific for PRB is required for TAF1 function.
Two isoforms of human progesterone receptor, sized 94kD and 120 kD, have been observed in human breast cancer T47D cells and primary human endometrial carcinoma. In T47D cells, two promoters in'a gene give rise to two distinct classes of human proge~terone receptor mRNAs, one of which codes for hPRB while the other one encodes hPRA. The two isoforms dilffer only in their N-terminal sequences. Form A lacks the amino terminal 164 amino acids present in form B.
The human progesterone receptor A and B lisoforms (hPAR and hPRB) differentially activate tran~scription of progesterone-responsive genes (Vegeto et al., Mol. Endo.
7:1244-1255, 1993; Wen et al., Mol. Cell. Biol. 14:8356-8364, 1994, all incorporated by reference he;rein).
Using site-directed mutagenesis we were ablelto show that hPRA has a functionally inactive TAF1. ITAF2 of hPRA is the sole transcription activator of Ihis receptor form. However, TAF2 is a weak transcription activator and functions only in some promotell and cellular contexts.
TAF1 of hPRB functions synergistically with TAF2 of hPRB in certain promoter and cellular contex_s. TAF1 of hPRB also functions independently in some promoter and cellular contexts.
Reaqents DNA restriction and modification enzymes were obtained from Boehringer Mannheim (Indianapolis, Ind.), New England Biolabs (Beverly,Mass.), or Stratagene (San CA 02222~62 1997-11-27 W O 96/41013 PCT~US~'/056 Diego, Cali~.). PCR reagents were obtained ~rom Persin-Elmer Cetus (Norwalk, Conn.). Progesterone, dexamethasone, and 17-~-estradiol were purchased ~rom igma (St. Louis, Mo.). [1,2-3H]progesterone was purchased ~rom Amersham (Arlington Heights, Ill.).
Rece~tor and reporter constructs Construction o~ the mammalian expression plasmids phPRB, phPRA and pRShGR has been described elsewhere (Vegeto et al. (1993) Mol. Endocrin. 7:1244-1255), as has the construction o~ PRE2-TK-LUC,TAT-LUC, and ERE-TK-LUC reporters (Berger et al., (1992) Cell 70:251-265,Tzukerman et al., (1994) Mol. Endocrinol. 8:21-30,Vegeto et al. (1993) Mol. Endocrin. 7:1244-1255).
Plasmid MMTV-ERE-LUC was constructed as ~ollows.
Plasmid ~MTV-LUC containing a deletion o~ the sequences ~rom +190 to -88 was obtained ~rom Ron Evans (Salk Institute, San Diego, Calif.). This plasmid was digested with HindIII to remove the glucocorticoid response elements, and five copies o~ a 33-bp oligonucleotide containing the consensus vitellogenin A2 estrogen response element were inserted. The sequence o~ the oligonucleotide used was 5'AATTAAAGTCAGGTCACAGTGACCTGATCAAA3'.
Glutamic acid residues at positions 907 and 911 were substituted with alanines by using PCR primers containing two base changes (underlined) as indicated:
5'CCAGCAATGATGTCTGCAGTTATTGC3' and 5'GCAATAACTGCAGACATCATTGCTGG3' (National Biosciences Inc., Plymouth, Minn.) to prepare the E907A and E9llA
mutations. The EcoNI-KpnI ~ragment o~ DNA containing the mutated receptor sequences was subcloned into plasmids phPR-B and phPR-A and sequenced to con~irm the mutations.
CA 02222~62 1997-11-27 WO 96/41013 PCT/U'~GI'~3~38 Cell lines The human m~mm~ry epithelial cell line MCF-10 was obtained originally from Samuel Brooks (Mic~igan Cancer Foundation). This cell line was routinely maintained in a 1:1 mixture of Dulbecco's modified Eagle's medium (Biofluids, Rockville, Md.) and Ham's F12 medium (Biofluids) with 20 ng of epidermal growth factor (Sigma) per ml, 100 ng of cholera toxin (Sigma) per ml, 0.01 ~g of insulin (Biofluids) per ml, 500 rg of hydrocortisone (Sigma) per ml, and 5~ horse serum (Biofluids). The human breast adenocarcinoma cell line MCF-7 was obtained from Marc E. Lippman (Vincent T.
Lombardi Cancer Center, Georgetown Universit,y) and maintained in Iscove's modified Eagle's medium (Biofluids) with 10~ fetal bovine serum (HyClone Laboratories, Inc., Logan, Utah). Monkey ki'dney CV-1 fibroblasts were routinely maintained in Dulbecco's modified Eagle's medium supplemented with 10l~ fetal bovine serum.
AssaYs Cotransfection assays were conducted as follows.
Cells were plated in 12- or 96-well tissue culture plates the day before transfection. DNA was introduced into cells by the calcium phosphate coprecipitation 25 method (Berger et al., (1992) Mol. Biol. 41: 733-738).
For each transfection reaction, 20 ~g of DNA per ml of transfection buffer was used. For the 96-well plate experiments, transfections were performed wi_h a Biomek 1000 automated laboratory workstation (Beckman, Fullerton, Calif.). Cells were incubated with the precipitate for 6 h, then washed with phosphate-buffered saline, and incubated for 40 h with or without hormones as indicated in the text. Cell extracts were prepared as previously described (Berger et al., (1992) Mol.
Biol. 41:733-738) and assayed for luciferase and ~-galactosidase activities.
CA 02222~62 1997-11-27 W O 96/41013 PCTrUS96/09638 Hormone bindinq assay Hormone binding assays were conducted as follows.
The wild-type PR and mutant receptor proteins were produced by in vitro translation of mRNA synthesized by using wild-type and mutant PR templates. The binding assay buffer constituted of 10~ glycerol, lOmM Tris, 2 mM dithiothreitol, 2 mM 3-[3-cholamidopropyl)-dimethyl-ammonio]-l-propanesulfonate, and 1.5 mM EDTA (pH 7.5).
The binding assays were performed in a 500-~1 volume containing 10 ~1 of reticulocyte lysate (containing PR) and various concentrations of [3H]progesterone in the absence or presence of 10 ~M progesterone. Incubations were carried out at 4~C for 16 h. At the end of the incubation period, bound and unbound progesterone were separated by using dextrancoated charcoal. The supernatants containing bound progesterone were drawn off, and the radioactivity retained was estimated by liquid scintillation counting. Data were analyzed by the method of Rosenthal, H.A. (1967) Anal. Biochem.
64:1393-1401. For competition binding assays, a similar protocol was used except that a fixed concentration of [3H]progesterone was added to extracts in the presence or absence of competing ligands (lnM to lO~M). After correcting for nonspecific binding, 50~ inhibitory concentration values were determined graphically from a log-logit plot of the data. Kis were determined from the calculated 50~ inhibitory concentration values by using the Cheng-Prusoff equation (Cheng et al., (1973) Biochem. Pharmacol. 22:3099-3108).
A PR-TAFl construct, phPRB(Eg07A~EgllA)~ was trans~ected into MCF-10 cells together with an MMTV-LUC reporter plasmid (see Figs. 12 and 13). In MCF-10 cells, PhPRB~Eg07AE9llA~ functioned as a hormone-dependent activator o~ MMTV gene transcription in the presence of progesterone (Fig. 13A). In contrast, this mutant CA 02222~62 1997-11-27 WO 96/41013 i PCTAUS96/09638 receptor was unable to activate MMTV gene transcription in CV-1 cells (Fig. 13B).
There~ore, MCF-10 cells, phPRB(Eg07AEg1~) and MMTV
promoter constitute an assay ~or an agonistlor antagonist which acts through the TAF1 region of PR.
With this assay, we were able to demonstrate that the partial agonist activity of some antiprogestins is mediated by the TAF1 region o~ hPRB.
A PR-TAF2 selective assay was also constructed. A
PR-TAF1 construct, phPRA, was trans~ected into XeLa cells together with a TAT-LUC reporter plasmid (see Figs. 12 and 13). The construction o~ plasmids, mutagenesis, cell culture, cotrans~ection assays and hormone binding assays were conducted as deccribed in Wen et al. supra.
In HeLa cells, phPRA ~unctioned as a hormone-dependent activator of TAT gene transcriptiojn in the presence o~ progesterone (Fig. 14). In contrast, this mutant receptor was unable to activate MMTV gene transcription in HepG2 cells (Fig. 15). There~ore, HeLa cells, phPRA and TAT promoter constitute an assay for an agonist or antagonist which acts through the TAF2 region Of PR.
Depending on the e~pression ration of hPRA and hPRB
and the particular target tissues or cells, PR agonists can activate the transcription o~ di~ferent isets o~
genes. PR antagonists can have di~erent e~fects o~
target gene transcription depending on cellular environments. Partial agonists or antagonists of PR
screened by the above described assays may be used as oral contraception, in hormone replacement therapy, to treat endometriosis, fibroids, endometrial cancer and breast cancer with little or no side e~ects.
III. Androaen Rece~tor The steroid hormones testosterone and its active metabolite dihydrotestosterone (DHT) have multiple CA 02222~62 l997-ll-27 effects in the body, including fusion of the labioscrotal fold during embryogenesis, induction of male differentiation of the wolffian ducts, growth of the male urogenital tract, induction of spermatogenesis, growth of beard and body hair, retention of nitrogen, temporal regression of scalp hair, hyperplasia of the sebaceous gland with increased sebum production, development of prostatic hyperplasia in aging males, secretion of ejaculate, and virilization of the hypothalamus. These diverse effects are modulated through the action of the androgen receptor AR.
The human AR cloned by Lubahn et al. Mol. Endo.
2:1265-1275, 1988, is a member of the superfamily of ligand inducible nuclear receptors. AR has high 15 homology with PR, MR and GR (Evans R.M. Science 240:889-895, 1988).
Chang et al. Proc. Natl. Acad. Sci. 85:7211-7215, 1988, described the cloning of AR and androgen binding specificity.
Jenster et al. Mol. End. 5:1394-1404, 1991, described a series of deletion mutants of AR that define steroid binding domain, regions of the N terminal region required for transactivation and regions required for nuclear targeting.
Palvimo et al. Mol. Endo. 7:1399-1407, 1993, described a region of the N terminal domain that is required for transactivation.
When testosterone or DHT binds to hAR, hAR binds to HREs in target genes and modulates transcription of those genes. DHT causes a dose-dependent enhancement of luciferase activity from cells cotransfected with a hAR
plasmid and a reporter plasmid containing an androgen response element (Figure 17). The activity induced by DHT can be reversed by the nonsteroidal AR antagonist, 2-hydroxy flutamide.
CA 02222~62 l997-ll-27 W O96/~1013 PCT~US96/09638 Rece~tor Constructs Four receptor constructs were generatedito establish an assay to screen for AR TAF region partial agonists and antagonists. These constructs are analogous to the mutant forms o~ the estrogen receptor descrlbed above.
cDNA sequence encoding the AR-wt was excised from plasmid hARpGBM3 as a 3.6Kb BglII/BamH1 fracment and ligated into unique BamH1 site o~ the m~m~l ian expression base vector pRS (Berger et al., 41 J. Steroid Biochem. Mol. Biol. 733,1992). The resulting plasmid was named pRShAR. pRShAR-wt contains the coding sequence of the full length human AR clonedlinto the expression vector pRS (AR-wt plasmid). I
The AR-TAF1 plasmid was generated by cloning a BamH1/Kpnl ~ragment of the hAR into the plas'mid pALTER
using an in vitro mutagenesis system by Promega.
Specific mutations were introduced into the hormone binding domain o~ the receptor by substituting alanine for amino acids located at positions 892, 896 and 899 using site directed mutagenesis according to'the manu~acturers instructions. The hormone binding domain o~ pRShAR-wt and pRShAR-TAF1 was then replaced with 1.5Kb Kpnl/BamHl mutated hormone binding domain DNA
fragment. The resulting plasmids were named pRShAR-TAF1 (derived ~rom pRShAR-wt) and pRShAR-null (derived from pRShAR-TAF2). pRShAR-TAFl contains a mutated ~orm o~
the AR that carries a series o~ point mutations that change the glutamic acid residues at positions 892, 896 and serine at position 899 to alanine (AR-TAFl).
The AR-TAF2 plasmid was constructed by e~cising the l.Skb AR cDNA fragment generated by cutting with Apal and BamH1. The single-stranded DNA overhang generated by Apal was removed by treatment with T4 polymerase prior to treatment with BamH1. Another aliquot o~
pRShAR was treated with Asp718, the ends of the DNA were ~illed by treatment with Klenow fragment. The DNA was then cut with BamH1. The 4 kb ~ragment generated was CA 02222~62 1997-11-27 WO 96/41013 PCTrUS9~'0~8 isolated and ligated with the 1.5 kb Apal/BamH1 hAR DNA.
pRShAR-TAF2 contains a mutated form of the AR that has the N terminal region of the receptor truncated so that amino acids residues 1-506 are missing, effectively removing the TAF1 portion of the receptor.
pRShAR-null contains a mutated form of the AR that carries both the point mutations in the TAF2 region and the truncation of the N terminal region as described above.
Cotransfection assaY
CV-1 cells (African green monkey kidney fibroblasts) were cultured in the presence of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10~ charcoal resin-stripped fetal bovine serum and then transferred to 96-well microtiter plates one day prior to transfection.
Cells were transiently transfected by calcium phosphate coprecipitation (Berger et al. J. Steroid Biochem. Mol. Biol. 41:733, 1992) with pRShAR (1 ng/well), MTV-LUC reporter (100 ng/well), pRS-~-Gal (50 ng/well) and pRS-CAT (filler DNA, ~9 ng/well). The receptor plasmid, pRShAR, contains the human AR under constitutive control of the rous sarcoma virus promoter.
The reporter plasmid, MTV-LUC, contains the cDNA for LUC
under control of the mouse m~mm~y tumor virus (MMTV) long terminal repeat, a conditional promoter containing an androgen response element (Berger, et al. J. Steroid Biochem. Mol. Biol. 41: 733, 1992). pRS-~B-Gal, coding for constitutive expression of E. coli ~-galactosidase (~-Gal), was included as an internal control for evaluation of transfection efficiency and compound toxicity. Transfections and subsequent procedures were performed on a Biomek 1000 automated laboratory work station.
Six hours after transfection, media was removed and the cells were washed with phosphate-buffered saline CA 02222~62 1997-11-27 W O96/41013 PCTAUS96/~56~8 (PBS). Media containing reference compounds (i.e., DHT
and 2-hydroxy flutamide) or test compounds in concentrations ranging from 10~12 to 10-5 M were added to the cells. Three to ~our replicates were used for each sample. ' After 40 hours, the cells were washed with PBS, lysed with Triton X-100-based buffer and assayed for LUC
and ~-Gal activities using a luminometer or spectrophotometer, respectively.
Data evaluation was performed using thelOracle relational database management system. Forleach replicate, the normalized response (NR) was,calculated as:
LUC response/~-Gal rate where ~-Gal rate = ~-Gal activity xlO~5/~-Gal incubation time.
The mean and standard error of the mean (SEM) of the NR were calculated. Data was plotted as the response of the compound compared to the reference compounds over the range of the dose-response curve. For agonist experiments, the effective concentration that produced 50% of the maximum response (ECso) was quanti-fied.
Agonist e~ficacy was a function (%) of LUC
expression relative to the maximum LUC production by the reference agonist, DHT. Antagonist activity'was determined by testing the amount of LUC exprlession in the presence of DHT at its EC50 concentratio$. The concentration of test compound that inhibited 50% of LUC
expression induced by DHT was quantified (IC50). In addition, the efficacy of antagonists was determined as a function (~) of maximal inhibition.
Cotransfection studies with the human glucocorticoid receptor (hGR, Giguere, et al. Cell 46:645-652, 1986), human progesterone receptor (hPR-B, Vegeto, et al. Cell 69:703-713, 1992), human mineralocorticoid receptor (hMR) with the MTV-LUC reporter and'human estrogen receptor (hER) with the MTV-ERE5-LUC reporter CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 were carried out as described above for evaluating the cross-reactivity of test compounds.
The receptor constructs were used in transient co-transfection studies (Fig. 18). HepG2 cells were trans~ected with 10 ~g of the reporter plasmid C'9, 5 ~g of pRSV-~-gal expression vector as an internal control for transfection efficiency, carrier DNA (pGEM4) added to adjust the total amount of DNA to 20 ~g and receptor expression DNA (i.e., pRShAR-wt 200 ng; pRShAR-TAF1 200ng; pRShAR-TAF2 3~g; or pRShAR-null 3~g).
Increasing concentrations of testosterone were added to the HepG2 cells. The procedures and calculations used to determine normalized response ~ollows that described above. The response element used in the reporter plasmid is the C'9 promoter (Adler et al. Mol.
Endo. 5:1587-1596, 1991), a fragment o~ the promoter region of the sex limited protein (SLP) cloned by the polymerase chain reaction from mouse genomic DNA.
Figure 18 demonstrates that in the context of the HEPG2 cell line and C'9 promoter a significant response is obtained with the AR-TAF1 construct relative to wild type AR whereas the AR-TAF2 construct exhibits a very minor response. The AR-null does not exhibit a dose dependent response to hormone. In this example agonist activity can be detected through function of the TAF1 in this context.
Therefore, HepG2 cells, pRShAR-TAF1 and C'9 promoter constitute an assay for an agonist or antagonist which acts through the TAFl region of AR. With this assay, we can screen agents for partial agonist or antagonist activity mediated by the TAF1 region of hAR.
The development of compounds with androgenic and anti-androgen properties acting through a particular TAF
region on certain promoters in certain cellular environments have clinical applications in the treatment of prostate cancer, alopecia, hirsutism, acne, benign prostate hyperplasia, male breast cancer, precocious CA 02222~62 1997-11-27 WO 96/41013 ~ PCTAUS96/09638 puberty and laryngeal carcinoma with little or no side effects. Currently known compounds have sice effects.
For example, cyprotene acetate (CPA) is a steroidal antiandrogen with progestin activity. Side effects are tests and adrenal suppression, feminization potential teratogen, cardiovascular disorder, liver toxicity, inhibition of libido and bone maturation. In addition, futamide is a nonsteroidal antiandrogen currently used in the treatment of prostate cancer. It is~also effective ~or treating hirsutism. Side effects of futamide include severe gastrointestinal disturbance, hot flashes, gynecomastia, liver toxicity, elevation of serum leutenizing hormone and testosterone levels.
Furthermore, casodex is a non-steroidal anti!androgen currently being developed for use in the clinic to treat prostate cancer, hirsutism (in women) and acne. Side effects of casodex include liver toxicity, breast tenderness, gynecomastia, hot flashes, mild back pain.
IV. Glucocorticoid Receptor Glucocorticoids are potent agents available for the treatment of inflammatory diseases, certain lymphoid cancers and various immunological disorders.' However, current therapy is limited by debilitating slde effects associated with long term use of glucocorticoids. Side effects include, but are not limited to, hyperglycemia and the resultant diabetes mellitus, osteoporosis, cataracts, fragile skin, weight gain and psychosis.
These effects result from the action of glucocorticoid receptor on groups of promoters in specific tissues. In many cases, such as osteoporosis, diabetes and psychosis, the side effects are unrelated to!the anti-inflammatory or anti-proliferative effects. ~Finding GR
agonists capable of distinguishing between tissues and/or promoters could limit the effects of the GR
agonists to the beneficial anti-inflammatory and anti-proliferative effects.
CA 02222~62 1997-11-27 W O 96/41013 PCTrUS96/Og~38 We have developed assays to detect and distinguish GR agonists that operate through a speci~ic TAF region in certain cellular environments. These assays use cells including a reporter construct containing multimerized glucocorticoid response elements (GRE) upstream ~rom a minimal promoter driving the expression o~ the reporter gene luciferase. This reporter responds strongly to glucocorticoids in CV1 cells when these cells are transfected with wild type GR.
Receptor ex~ression vectors Figure 19 is a diagram showing the structural organization o~ GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-null. These expression vectors produce modi~ied ~orms o~ GR that selectively inactivate one or more of the transactivation domain of GR.
GR-TAF2 and GR-N-Del plasmids were derived ~rom GR-wt. GR was modi~ied to add a NotI restriction site on the 5' side o~ the DNA binding domain and an XhoI site on the 3' side of the DNA binding domain. In GR-TAF2, 20 amino acids 77-262 were excised ~rom GR-wt using BglII.
In GR-N-del, amino acids 9-385 were excised ~rom GR-wt.
The procedures were described previously by Hollenberg et al., Cell 49:39-46, 1987, incorporated by re~erence hereln .
To prepare GR-TAF1 plasmid, the TAF2 domain was mutated using a site-directed mutagenesis kit by Clonetech. Amino acid residues 751, 755, 758, and 751+755, 751+758, 755+758 were changed to alanines using the ~ollowing mutagenesis primers:
30 751: 5'GCT AAC ATC GCG GGG AAT TC3' 755: 5'GAT GAT TGC AGC AGC TAA CAT C3' 758: 5'CTG ATT GGC GAT GAT TTC AGC3' 751+755: 5'GAT GAT TGC AGC TAA CAT CGC GGG GAA TTC3' 751+758: 5'CTG ATT GGC GAT GAT TTC AGC TAA CAT CGC GGG
GAA TTC3' 755+758: 5'CTG ATT GGC GAT GAT TGC AGC TAA C3' CA 02222~62 1997-11-27 WO 96/41013 I PCTrUS96/09638 The GR-Null plasmid serves as a negative control that lacks both TAFl and TAF2 translactivation activity. It is constructed ~rom GR-TAFl ~rom which the TAFl domain was excised by BglII.
To prepare the GR-Gal4 plasmids, the Gal4 DNA
binding domain was excised ~rom pBSGalG with KpnI and SalI. The Gal4 DNA binding domain ~ragment was then inserted into each o~ the TAF mutants ~rom which the N-terminus and the DNA binding domain of GR have been removed with KpnI and XhoI (see Figure 20).
Reporter plasmids The reporter plasmids contain either the Murine M~m~y Tumor Virus (MMTV-luc) promoter, Complement 3 gene promoter (C3-luc) or TAT3 promoter (i.e., a synthetic promoter consisting o~ 3 repeats o~ a Glucocorticoid Response Element (GRE) derived ~rom the Tyrosine Amino Transferase gene ~used to the alcohol dehydrogenase TATA box).
Cell culture CVl, Cos-l, CHO, 293, HepG2, HeLa and HIG82 cells were maintained in Dulbecco's modi~ied Eagle's medium (DMEM) supplemented with 10~ ~etal bovine scrum (FBS).
MCF7 were maintained in Iscove's modi~ied Eagle's medium (IMEM) supplemented with 10~ FBS.
Transient transfection assay Transient trans~ection assays were per~ormed essentially as described ~or ER except that the cells were incubated with or without hormone ~or 24 hours.
Dexamethasone bindinq competition assaY
GR proteins were expressed in reticulocyte lysates using a transcription/translation kit ~rom Promega.
Aliquots o~ reticulocyte lysates in binding bu~er are incubated with 4-7nM (3H)-dexamethasone andlvarying CA 02222~62 1997-11-27 concentrations o~ unlabelled competing ligand at concentrations ranging ~rom 0 to 10-5 M. Incubations were carried out at 4 ~C ~or 16 hours. At the end o~ the incubation period, GR-bound ligand was absorbed onto hydroxylapatite, pelleted and counted in liquid scintillation cocktail.
The e~fect o~ the TAF2 mutations on transactivation was tested by co-trans~ection (see Figure 21). CV1, Cos-1 (green monkey kidney cells), CHO (Chinese Hamster cells), HeLa (human cervical carcinoma cells), HepG2 (human Hepatocarcinoma cells), MCF7 (human Breast adenocarcinoma cells), HIG82 (rabbit synoviocytes) and 293 (human Embryonal kidney cells) were co-trans~ected with the Gal4-TAF2 mutants and a reporter plasmid containing Gal4 DNA binding sites ~used to luci~erase gene. The ability o~ the TAF2 domain to activate the luci~erase gene was detected by measuring chemiluminescence. The data in Figure 21 shows that the mutations in TAF2 inactivated the transactivation activity o~ TAF2. Similar assays may be conducted to analyze the e~ects o~ mutations to other transactivation domains in the GR.
GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-Null were cotrans~ected into CV1 cells with a reporter gene under the regulation o~ a TAT3 promoter. Dexamethasone was then added to the CV1 cells and the expression level o~
the reporter gene measured. GR mutants are expressed in CV1 cells. The GR mutations selectively eliminate each transactivation domain but do not signi~icantly change hormone binding. GR-TAF1, GR-N-del and GR-TAF2 have transactivation activity. However, the GR-null receptor has no activation capability, indicating that together the TAF1 and TAF2 mutations eliminate all the transactivation potential ~rom GR.
Figure 22 shows that despite TAF2 transactivation activity was inactivated in GR-TAF1 plasmid, GR-TAF1 CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 still exhibited transactivation activity in CV1 cells on TAT3 promoter. Therefore, CV1 cells, GR-TAF1 plasmid and TAT3 promoter constitute an assay for an'agonist or antagonist which acts through the TAF1 region of GR.
Figure 22 also shows that despite TAF1 transactivation activity was inactivated in GR-TAF2 and GR-N-del plasmids by deletion mutations, GR-TAF2 and GR-N-del still exhibited transactivation activity in CV1 cells on TAT3 promoter. Therefore, GR-TAF2 or GR-N-del plasmid, CV1 cells and TAT3 promoter constitute an assay for an agonist or antagonist which acts through the TAF2 region of GR.
The assay we have established for the de_ection of TAF selective GR agonists or antagonists can utilize any cell line in which either TAF1 or TAF2 is active. The approach described here makes use o~ the CVl'cell line and mutants of hGR in which either TAF1 or TAF2 is mutated. Each cotransfection assay contains a control ~-galactosidase expression vector for transfection efficiency and the TAT3-luciferase reporter.
Individual compounds may be screened in Ithree separate cotransfection assays, the first contains GR-wt, the second contains the GR-TAF1, and the~third contains the GR-TAF2 or GR-N-del. Compounds that are active in the wild type assay will be compared in the two mutant assays. All classes of agonists and antagonists may be screened.
Compounds with uni~ue profiles relative to TAFl or TAF2 identified by the above described assays will generate differences in the tissue or promoter selectivity of the receptor, allowing the determination of which TAF region is associated with the side effects and which is associated with the anti-proliferative or anti-inflammatory activity. The compounds identified by the above described assays may be put to therapeutical uses. For example, if TAF2 is crucial for GR activity in bone cells, then one may selectively eliminate side CA 02222~62 1997-11-27 effects of GR in osteoclasts and osteoblasts by administering a TAF1 selective agonist screened by the claimed assay to prevent TAF2 activity and reduce the osteoporosis associated with glucocorticoid therapy.
V. Pharmaceutical Compositions The present invention also encompasses pharmaceu-tical compositions prepared for storage and subsequent administration, which have a pharmaceutically effective amount of the products disclosed above in a pharmaceutically acceptable carrier or diluent.
Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Reminqton's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985).
Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. For example, sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid may be added as preservatives. Id. at 1449. In addition, antioxidants and suspending agents may be used. Id.
The compositions of the present invention may be formulated and used as tablets, capsules or elixirs for oral administration; suppositories for rectal administration; sterile solutions, suspensions for injectable administrationi and the like. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Suitable excipients are, for example, water, saline, dextrose, mannitol, lactose, lecithin, albumin, sodium glutamate, cysteine hydrochloride, and the like. In addition, if desired, the injectable pharmaceutical compositions may contain minor amounts of nontoxic auxiliary substances, such as wetting agents, pH buffering agents, and the like. If desired, CA 02222~62 1997-11-27 WO 96/41013 PCTrUS96/09638 absorption enhancing preparations (e q., lip'osomes) may be utilized.
The pharmaceutically e~ective amount o~ the composition required as a dose will depend cn the route o~ administration, the type o~ animal being treated, and the physical characteristics o~ the speci~ia animal under consideration. The dose can be tailored to achieve optimal e~icacy but will depend on such ~actors as weight, diet, concurrent medication and other ~actors which those skilled in the medical arts will recognize.
In practicing the methods of the invention, the products or compositions can be used alone or in combination with one another, or in combination with other therapeutic or diagnostic agents. These products can be utilized ln vivo, ordinarily in a m~mm~l, pre~erably in a human, or in vitro. In emp~oying them ln vivo, the products or compositions can be administered to the m~mm~ 1 in a variety o~ ways, including parenterally, intravenously, ~ubcutaneously, intramuscularly, colonically, rectally, nasally or intraperitoneally, employing a variety o~ dosage ~orms.
As will be readily apparent to one skilled in the art, the useful in vlvo dosage to be administered and the particular mode o~ administration will vary depending upon the age, weight and m~mm~l ian species treated, the particular compounds employed,land the speci~ic use ~or which these compounds are employed.
The determination o~ ef~ective dosage levels, that is the dosage levels necessary to achieve the desired result, will be within the ambit o~ one skilled in the art. Typically, human clinical applications o~ products are commenced at lower dosage levels, with'dosage level being increased until the desired e~ect is achieved.
In non-human ~n;m~l studies, application~ G~ products are commenced at higher dosage levels, witk dosage being decreased until the desired e~ect is no longer achieved or adverse side e~ects disappear.
CA 02222~62 1997-11-27 The dosage for the products of the present invention can range broadly depending upon the desired affects and the therapeutic indication. Typically, dosages may be 7 between about 10 ~g/kg and 100 mg/kg body weight, 5 preferably between about 100 ~g/kg and 10 mg/kg body weight. ~m; n; stration is preferably oral on a daily basis.
The exact formulation, route of administration and dosage can be chosen by the individual physician in view 10 of the patient's condition. (See e.q. Fingl et al., in The Pharmacoloqical Basis of Thera~eutics, 1975, Ch. 1 p. 1). It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity, or to organ dys-functions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxi-city). The magnitude of an administrated dose in the management of the disorder of interest will vary with the severity o~ the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency, will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may be used in veterinary medicine.
Depending on the specific conditions being treated, such agents may be formulated and administered systemically or locally. Techniques ~or formulation and administration may be found in Reminqton's Pharmaceu-tical Sciences, 18th ed., Mack Publishing Co., Easton, PA (1990). Suitable routes may include oral, rectal, transdermal, vaginal, transmucosal, or intestinal admin-istration; parenteral delivery, including intramuscular,subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, CA 02222~62 1997-11-27 WO 96/41013 , PCTrUS96/09~38 intraperitoneal, intranasal, or intraocular injections, just to name a ~ew.
For injection, the agents o~ the invention may be formulated in aqueous solutions, pre~erably in physio-logically compatible bu~fers such as Hanks'r, solution,Ringer's solution, or physiological saline bu~fer. For such transmucosal administration, penetrant~ appropriate to the barrier to be permeated are used in the ~ormula-tion. Such penetrants are generally known ln the art.
Use of pharmaceutically acceptable carriers to ~ormulate the compounds herein disclosed ~or the prac-tice o~ the invention into dosages suitable for systemic administration is within the scope of the i~vention.
With proper choice o~ carrier and suitable manu~acturing practice, the compositions o~ the present invention, in particular, those formulated as solutions, may be admin-istered parenterally, such as by intravenous injection.
The compounds can be ~ormulated readily uslng pharmaceu-tically acceptable carriers well known in the art into dosages suitable for oral administration. Such carriers enable the compounds o~ the invention to be ~ormulated as tablets, pills, capsules, liquids, gels syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
Agents intended to be administered intracellularly may be administered using techniques well known to those o~ ordinary skill in the art. For example, such agents may be encapsulated into liposomes, then ~m; n; stered as described above. Liposomes are spherical lipid bilayers with aqueous interiors. A11 molecules present in an aqueous solution at the time of liposome ~ormation are incorporated into the aqueous interior. The liposomal contents are both protected ~rom the external microenvi-ronment and, because liposomes fuse with cell membranes, are e~ficiently delivered into the cell cytoplasm.
Additionally, due to their hydrophobicity, small organic molecules may be directly administered in_racellularly.
CA 02222~62 1997-11-27 W O 96t41013 PCTAUS96/09638 Pharmaceutical compositions suitable ~or use in the present invention include compositions wherein the active ingredients are contained in an e~ective amount to achieve its intended purpose. Determination o~ the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which ~acilitate processing of the active compounds into preparations which can be used pharmaceutically. The preparations ~ormulated for oral administration may be in the form o~
tablets, dragees, capsules, or solutions. The pharmaceutical compositions of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levitating, emulsi~ying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical formulations for parenteral administration include aqueous solutions o~ the active compounds in water-soluble ~orm. Additionally, suspen-sions o~ the active compounds may be prepared as appro-priate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic ~atty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injec-tion suspensions may contain substances which increase the viscosity o~ the suspension, such as sodium carboxy-methyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility o~ the compounds to - allow ~or the preparation o~ highly concentrated solutions.
Pharmaceutical preparations ~or oral use can be obtained by combining the active compounds with solid excipient, optionally grinding a resulting mixture, and CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 processing the mixture of granules, a~ter adding suit-able auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose,lsucrose, mannitol, or sorbitoli cellulose preparatiohs such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellu-lose, hydroxypropylmethyl-cellulose, sodium carboxy-methylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings.
For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dye-stuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and G plasticizer, such as glycerol or=sorbitol. The push-fit capsules can contain the active ingredients in admixture with ~iller such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In so~t capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraff-n, or liquid polyethylene glycols. In addition, stabil_zers may be added.
All publications referenced are incorpprated by reference herein, including the nucleic acid sequences and amino acid sequences listed in each publication.
CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 All the compounds disclosed and re~erred to in the publications mentioned above are incorporated by re~erence herein, including those compounds disclosed and re~erred to in articles cited by the publications mentioned above.
Other embodiments o~ this invention are disclosed in the ~ollowing claims.
PCTnJS96/09638 EX Vivo Formatlon of Osteoclasts l RAP(t)MNC
(~,6 ~ontrol) Sh~m C)YX OVX OVX
+~BE2 +Ke~xlfen Exp~ 00 147.8~ 84,3c gg3c EXpt.2 100 ~4.0b 11~ 4C 78~2a ~Sign~Kant~different from sham. pc0.02.
bSignifi~n~differentfirom~h~m,p<O.~.
C~osigni(i~n~d~ere~etr~m~m.
i Table 1 Bone marrow from sham (control), OVX
(ovariectomized rats), OVX plus estrogen, and OVX plus keoxifene treated rats were evaluated for osteoclastic potential in the coculture assay. Bone marrow was combined with primary osteoblasts in the presence o~
1,25-dihydroxyvitamin D3 and parathyroid hcrmone for 8 days and scored for the number of tartrate acid phosphatase resistant multinucleated cells (TRAP + MNC).
The number of TRAP + MNC in the sham operatled animals was set at 100~.
CA 02222~62 1997-11-27 W O96/41013 PCTrUS96/09638 List of Candidate Com~ounds ~ CANDIDATE COMPOUNDS REFERENCES
1) Compounds Modulating *p.1213 ff, and Glucocorticoids references therein WO/92tl6546, WO92/16658, US 4,981,787 . US 5,071,773 R. Evans, Science 240:889-895 (1988) 2) Estrogens-agonists & antagonists *p. 1193 ff and references therein 3) Androgens-agonists & antagonists *p. 1208 ff, and references therein US 4,144,270 US 3,847,988 US 3,995,060 4) Progestins-agonists & antagonists *p. 1200 ff, and references therein Non-steroid progestins PCT/US93/03909 5) Mineralocorticoids-agonists & *p. 1213 ff, and antagonists references therein 6) Nonsteroidal anti-inflammatory **
drugs *Intracellular receptor general reference Comprehensive Medicinal Chemistry "The Rational Design, Mechanistic Study and Therapeutic Applications of Chemical Compounds," C.
Hamsch, P.G. Sammes, John B. Taylor and John C. Emmett Vol. 3-Membrane and Receptors, Pregammon Press, Oxford, Ch. 16.3 Steroid Hormone Receptors pp. 1176-1226.
**Negrel et al., Biochem. J 257:399-405 (1989)
Method For Screeninq For Receptor Aqonists And Antaqonists Related Applications This application is a continuation-in-part of McDonnell and Tzukerman, entitled "Method For Screening For Receptor Agonists", filed April 6, 1994, U.S. Serial No. 08/223,943, which is a continuation-in-part of McDonnell and Tzukerman, entitled "Method For Screening For Receptor Agonists", filed January 10, 1994, U.S.
Serial No. 08/179,750, which is a continuation-in-part of McDonnell and Tzukerman, entitled "Method For Screening For Receptor Agonists", filed April 4, 1993, U.S. Serial No. 08/045,807, incorporated by reference herein, including the drawings attached thereto.
Field of the Invention This invention relates to methods and constructs useful for identifying agonists and antagonists active at intracellular receptors.
Backqround of the Invention Steroid hormones, such as estrogen, progesterone, androgens, glucocorticoids, and mineralocorticoids travel via the blood stream to their target cells, enter these cells, and then bind to steroid hormone receptors.
The steroid hormone receptors exist in inactive apoprotein forms either in the cytoplasm or nucleus.
_ Upon binding their respective hormonal ligands, the receptors become activated. The activated receptor can bind effectively to a hormone response element (HRE) on a chromosome and activate transcription of a cis-linked gene.
The steroid hormone receptor superfamily includes receptors ~or the steroids, e.g., estrogen, CA 02222~62 1997-11-27 WO96/41013 PCT~S96/09638 progesterone, glucocorticoid, mineralocorticoid and androgen. It also includes receptors for thyroid hormone, vitamin D, retinoic acid and a 9- cis retinoid acid and ecdysone. Furthermore, it includes a large number of proteins having sequence homologous to the steroid hormone receptors, but whose ligands are unknown, e.g., peroxisome proliferator activated receptor. These proteins have been termed ''orphan receptors".
A typical steroid hormone receptor can be divided into six domains, A, B, C, D, E and F as indicated in Figure ll. The function of each domain is 1ndicated by solid lines. The N-terminal A/B domain contains a transactivation function. The C region is -esponsible for DNA binding and receptor dimerization. The D region is a hinge region which allows the protein l_o bend or alter conformation. The E region is important for dimerization, transactivation, intramolecular repression and ligand binding. DNA sequences responsive to steroid hormones have been termed hormone response elements (HRES). I
Evans et al., U.S. Patent 5,071,773, incorporated by reference herein, describes an assay by which hormone receptors, ligands for such receptors, and proteins having transcription activating properties of a hormone receptor, can be detected. Generally, the assay involves using a cell containing both a DNA encoding a receptor protein, and a DNA encoding a hormone responsive element (e.q., a promoter) linked to an operative reporter gene. When a suitable hormone or ligand is provided to the cell, a receptor-hormone is formed and delivered to an appropriate DNA-binding region to thereby activate the hormone responsive element and cause expression of the reporter gene. The expression product of the reporter gene is detected by st~n~d procedures known to one skilled in the art.
CA 02222~62 1997-11-27 W O 96/41013 PCTAJS96/0~8 Web~ter et al., Cell 54:199 (1988), used chimeric receptors to localize regions responsible for transcription activation function. The authors propose that a hormone is responsible for allowing a receptor to recognize a DNA response element, and that the hormone induces a transcription activation function in the hormone-binding domain.
Summary of the Invention The present invention features a method for identifying agonists and antagonists of an intracellular receptor. These agonists and antagonists modulate the transcription activity of a promoter through a TAF
region of the receptor in a cell. The present invention also features a method for using these agents to treat diseases and pathological conditions affected by an intracellular receptor, such as, but not limited to, breast cancer, endometrial cancer, fibroids, and endometriosis. This invention makes it possible to screen large collections of natural, semisynthetic, or synthetic compounds for therapeutic agents that affect the transcription activation activity of an intracellular receptor.
This invention provides an assay to screen for an agonist or antagonist of an intracellular receptor which interacts with one of the TAF regions of the receptor.
Not only can an agonist or antagonist be specifically identified, but the type of agonist or antagonist can be determined in such an assay. The agonists and antagonists so identified may be used to selectively modulate a promoter in a cell.
In order to detect agonists and antagonists which act through a particular TAF region of a chosen intracellular receptor, Applicant inactivates the transcription activation function of other TAF regions in the receptor. Considering that the activity of a TAF
region is dependent on having the functional context of CA 02222~62 1997-11-27 W O96/41013 ~ PCTrUS96/09638 other TAF regions available, this invention describes introducing mutations to receptor constructs to inactivate the transcription activation act-vity of these other TAF regions, while retaining the functional context of these TAF regions. Such modifiec receptors can be used to identify promoter and cell-type specific requirements for the transcriptional activation activity of a particular TAF region. This invention allows the determination o~ such promoter-type and cell-type specific differences in transcription activation activity.
This invention also relates to selectinc a cellular context in which the rem~;n'ng TAF region is able to activated transcription from a promoter. Furthermore, this invention relates to selecting a promoter context which is responsive to the transactivation by the r~m~;n;ng TAF region. Therefore, by properly preparing a receptor construct and selecting a cellular context and promoter context, the claimed assay alllws the r~m~;n;ng TAF region to exhibit its transcription activation activity on a promoter in a cell.~
Without being bound by any theory, Applicant proposes that such promoter-type and cell-type speci~ic transcription activity of a TAF region may be explained by a model in which one TAF region acts as a dominant transcriptional activator, and a second TAF region as a transcriptional facilitator (see Fig. 7). The second TAF region prepares the transcription apparatus for the action of the first TAF region. Such preparation may be recruitment of basic transcription ~actors, alteration of chromatin structure, or causing removal of a transcriptional repressor. Alternatively, the second TAF region may prepare a transcription apparatus for other transcriptional activators, and alone have little inherent transcription activation activity. In such a model, the ~irst TAF region is unable to access the transcription apparatus until the second TAF~ region has CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 acted appropriately to prepare it for the action of the first TAF region.
Applicant proposes that cell specificity for a particular TAF activity may reflect the presence or absence of a function in a cell that mimics the presence of a helper TAF region, respectively. Such a mimetic in a cell will allow a receptor construct having a mutated and inactive helper TAF region to be active because the inactive portion of the receptor is complemented by the active functionality present in the cell.
A similar model may exist for promoter specificity, i.e., only selected promoters will be activated by a particular TAF in a cell, depending on the functionalities present in those promoters. In this model, the difference in agonist activity of various agents is dependent on the effect of that agonist on the TAF1 region or TAF2 region, and interaction of the resulting TAF1 or TAF2 region with a selected promoter or general transcription apparatus.
Thus, in a first aspect, the invention features a method for identifying an agonist or antagonist of an intracellular receptor. The method includes providing a cell containing a nucleic acid encoding an intracellular receptor having a first TAF region and a second TAF
region. The first TAF regions is able to activate transcription from a selected promoter, and the second TAF region is mutated so that, while it provides the functional context of that region, it is not able to activate transcription from the promoter.
The cell also includes a reporter construct which has a promoter region which is activated to cause transcription of a reporter gene in the presence of a receptor having an active TAF region corresponding to that which is not mutated above. The promoter is not activated by the presence of a receptor containing only the TAF region corresponding to that mutated above. The CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 receptor construct and reporter construct may be inserted in two vectors or a single vector.
The cell is so chosen that no, or m; n; m~l, transcription of the promoter occurs in the,presence of a receptor having only an unmutated second TAF region corresponding to that mutated above (and not the other TAF region). The cell is also chosen such that transcription o~ the promoter occurs in the~presence of a receptor having the above nonmutated ~irs_ TAF region alone.
For example, in a receptor construct having an operative TAF1 region and a mutated, inoperative TAF2 region, transcription of the promoter will not occur (i.e., no signi~icant level of transcription is detectable, usually less than 5-10~ of normal levels) in the presence o~ a receptor having an operative TAF2 region only, but will occur in the presenceiof a receptor having an operative TAF1 region only.
The method further includes the step oflcontacting the cell with a potential agent under conditions in which contact of the cell with a normal agonist (e.q., estrogen for an estrogen receptor) or antagonist will either increase or decrease the transcription of the reporter gene from the promoter, respectively. The method may involve transcribing the reporter construct at a basal (low or minimal) level in the cell before the agonist or antagonist is applied. Alternatively, the method may involve applying the agonist or antagonist first, and then transcribing the reporter construct.
Finally, the method involves the step o- measuring the level o~ increase or decrease o~ the reporter gene product, as an indication of the agonist or antagonist activity of said agent, respectively.
By "intracellular receptor" is meant an transcription polypeptide in the cytoplasm or nucleus of a cell whose transcription regulation activity is regulated by binding of small molecules such as steroid CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 hormones, including, but not limited to, estrogen receptor (ER), retinoid acid receptors (RAR), retinoid X
receptors (RXR), glucocorticoid receptors (GR), progesterone receptors (PR), androgen receptors (AR), mineralocorticoid receptor (MR), thyroid hormone receptors (TR), peroxisome proliferator activated receptor (PPAR), and vitamin D receptors. An intracellular receptor may be mutated by site-directed mutagenesis, deletion, substitution, and other genetic methods known to those skilled in the art. The intracellular receptor may either be endogenous to the cell or transfected into the cell.
By "transcription polypeptide" is meant a cytoplasmic or nuclear protein that, when activated, binds a promoter, enhancer or silencer either directly, or indirectly through a complex of proteins to modulate the transcription activity of the promoter.
By "TAF" is meant a transactivation function domain located in an intracellular receptor having the ability to interact with a transcription target and activate the transcription from a promoter. In the art, a TAF region sometimes is referred to as an AF region. The A/B
domain and E domain of a typical steroid hormone receptor contain TAF regions. Other TAF regions may be identified by deletions, site-directed mutagenesis and other methods known to those skilled in the art.
By "agonist" is meant a compound or composition which when combined with an intracellular receptor stimulates or increases a reaction typical for the receptor, e.g., transcription activation activity.
By "antagonist" is meant a compound or composition which when combined with an intracellular receptor interferes or decreases a reaction typical for the receptor, e.g., transcription activation activity.
By "promoter" is meant a DNA regulatory region pro~;m~l to the RNA start site in the 5' or upstream direction capable of binding directly or indirectly to CA 02222~62 1997-11-27 RNA polymerase and associated transcription ~actors in a cell and initiating transcription of a downstream (3' direction) coding sequence. A promoter o~ a DNA
construct, including an oligonucleotide sequence according to the present invention, may be linked to a heterologous gene where the presence of the~promoter influences transcription from the heterologous gene, including genes encoding reporter molecules such as human growth hormone, luci~erase, chloramphenicol acetyl trans~erase, ~-galactosidase, secreted placental alkaline phosphatase and other secreted enzyme reporters.
By "reporter gene" is meant a nucleotide sequence encoding a polypeptide whose presence or activity is readily detectable, including, but not limited to, luci~erase, chloramphenicol acetyl transfer?se (CAT), ~-galactosidase, secreted placental alkaline phosphatase, human growth hormone, and other secreted enzyme reporters. Generally reporter genes encode a polypeptide not otherwise produced by the host cell which is detectable by in si tu analysis o~ the cell culture, e.g., by the direct ~luorometric, radioisotopic or spectrophotometric analysis o~ the cell culture without the need to remove the cells ~or signal analysis from the culture chamber in which they are contained.
Preferably the gene encodes an enzyme which produces colorimetric or ~luorometric changes in the host cell which is detectable by in si tu analysis and which is a quantitative or semi-quantitative ~unction o~
transcriptional activation. Exemplary enzy~es include esterases, phosphatases, proteases (tissue plasminogen activator or urokinase) and other enzymes wkose ~unction can be detected by appropriate chromogenic or ~luorogenic substrates known to those skilled in the art.
By "functional context" is meant only a ~ew amino acids (i.e., up to 10), or pre~erably only I-3 amino CA 02222~62 1997-11-27 acids are altered in one region so that the interaction o~ a hormone or transcription ~actor with the region is altered to a minimum extent (pre~erably, the interaction is unaltered). Such interaction will allow ~ull expression o~ the activity of the unaltered or non-mutated region. Thus the functional context of one TAF
region contains the ~unctional activities o~ the other TAF region with respect to agonist binding, dimerization, and heat shock protein interaction, but not with respect to the ability to activate transcription.
In another word, ~unctional context is meant the part of a TAF region that contains the functional activities o~ another TAF region with respect to agonist binding, dimerization, and heat shock protein interaction, but not with respect to the ability to activate transcription. The ~unctional context of a TAF
region can be preserved while the transcription activation activity o~ the TAF region is destroyed. For example, receptor dimerization or the interaction o~ a hormone or transcription factor with the TAF region is altered to a minimum extent, or pre~erably unaltered, when certain mutations are made in the TAF region (e.g., a ~ew amino acids (i.e., up to 10), or pre~erably only 1-3 amino acids are mutated in the TAF region). Such interaction allows the ~ull~illment of transcription activation activity o~ another unaltered or non-mutated TAF region.
In this invention, a cell is provided with a speci~ic receptor construct having a selected TAF
activity, and having a suitable promoter, which responds to the TAF activity, linked to an operative reporter gene. The promoter is selected in conjunction with a speci~ic cell so that activity o~ an agonist or antagonist is observed only under selected conditions.
Thus, in one example, the receptor may have an active ~irst TAF region, and a mutated (inactive) second TAF
CA 02222~62 1997-11-27 W O 96/41013 I PCT~US96/09638 region which provides the functional conte7t for the first TAF region, and the cell is chosen such that it has a component which mimlcs or replaces tke second TAF
region function of the receptor at the chosen promoter.
The promoter in turn provides an appropriate binding context to allow the component to manifest¦the desired TAF functions. In this way, an agonist or antagonist which acts at the first TAF region can be readily identified by its ability to increase or dqcrease expression of the reporter gene, despite the lack of an active second TAF region on the receptor. I
In preferred embodiments, the agent isla human hormone agonist or antagonist, and a nuclear receptor, e.q., a human hormone receptor is encoded by the nucleic acid within the cell.
In another preferred embodiment, the receptor has a mutated TAF2 region, and the cell and promcter are chosen to exhibit no, or minimal, response to the presence of TAF2 alone.
In a further preferred embodiment, suck a cell is a liver cell (specifically, a HepG2 cell) in which a receptor with an operative TAF2 region has no activity.
That is, there is no inherent transcriptional activity with a receptor having just TAF2 and no TAF1 region present in the cell, but there is transcriptional activity with a receptor only having an operative TAF1 region available. Most preferably, the promoter (e.g., a C3 promoter) is chosen such that it does not require a receptor with a TAF2 function to be provided within the chosen cell, so that any agonist (e.g., an!ER agonist) which acts in conjunction with a functionai TAF1 in the receptor construct is able to show its agorist activity.
In yet another preferred embodiment, tke candidate agent is selected from the group consistinc of glucocorticoids and other agonists and antagonists of GR, nonsteroid glucocorticoids; estrogens and other agonists and antagonists of ER, nonsteroid estrogens;
CA 02222~62 1997-11-27 androgens and other agonists and antagonists of AR, nonsteroid androgens; progestins and other agonists and antagonists of PR; non-steroid progestins;
mineralocorticoids and other agonists and antagonists of MR, nonsteroid mineralocorticoids.
Candidate compounds include but are not limited to those disclosed and re~erred to in Table 2. Peptide or small molecule combinatorial libraries can be used to screen for agonists and antagonists (Bunin, B.A.N.
Ellman, J. A., J. An. Chem. Soc. 114:10997-10998 (1992) and references contained therein).
By "comprising" is meant including, but not limited to, whatever follows the word "comprising". Thus, use of the term "comprising" indicates that the listed elements are required or mandatory, but that other ele-ments are optional and may or may not be present. By "consisting of" is meant including, and limited to, whatever follows the phrase "consisting of". Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present. By "consisting essentially of"
is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but that other ele-ments are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.
In another aspect, the invention features a method for identifying a receptor agonist by providing a cell containing both a nonmutated intracellular receptor having functional TAFl and TAF2 regions and a reporter construct having a promoter.
The cell is chosen to lack a mimicking TAFl or TAF2 activity (i.e., a receptor having either an active TAFl CA 02222~62 1997-ll-27 W O 96/41013 PCTAJS96~5'~8 or TAF2 region alone does not cause activation of transcription in the cell). The promoter is chosen so that activation is achieved in this cell from this promoter in the presence of an agonist for _he receptor which acts only through one of the TAF regions but not both.
In a preferred embodiment, a liver cell'(e.q., HepG2) and a complex C3 promoter together p~ovide a useful assay for agonists (e.g., an ER agonist) active at a TAF1 region only. The liver cell and C3 promoter have a TAF2 activity, but the promoter is not activated in the presence of a receptor having an active TAF2 region alone. However, the promoter is active in the presence of an active TAF1 region. Thus, agonists active at the receptor TAF1 region can be identified as those which increase expression of the reporter gene.
In another preferred embodiment, the TAF2 region is mutated.
This cell provides a useful screening test to determine the type of agonist tested. The level of transcription observed is related to the agonist type as exemplified below. The above two methods (with mutated and nonmutated receptor constructs) may be used in combination to detect, grade or type agonis_s at a selected receptor.
Unlike prior methods in which laborious procedures were involved to detect useful agonists, the methods described herein allow rapid screening of potential agonists and antagonists of intracellular receptors, including, but not limited to, estrogen, progesterone, glucocorticoid, androgen and mineralocorticoid receptors. The assay may be conducted not only in the human derived cells, but also in other eucaryotic cell lines, such as chicken and yeast cell lines.
The agonists and antagonists identi~ied-by this invention have advantages in treating diseases. For example, an estrogen agonist can be identified which is CA 02222~62 1997-11-27 W O 96/41013 PCTAUS~'0~8 useful for treatment of osteoporosis. In osteoporosis, it appears as though TAF1 activity alone is sufficient for prevention of bone loss. Thus, agonists having activity only at the TAF1 region and not at the TAF2 region of the receptor are useful for disease treatment with no or fewer side effects.
In another aspect, the invention features a method for treating or preventing an estrogen related disease or condition. By "estrogen related disease or condition" is meant a disease or condition that is caused or associated with an elevated or depressed level of the hormone estrogen, including, but not limited to, osteoporosis, breast cancer, uterine cancer, endometriosis, vasomotor abnormalities, hot flashes, depression, other psychiatric abnormalities and uterine fibroids. In some diseases the patient may be unable to produce estrogen in an amount required by the body. In other diseases, estrogen may be overproduced. By "hormone~ is meant a naturally occurring biochemical that will function as a receptor agonist. Synthetic hormones are more properly referred to as agonists.
The method involves administering a chemical compound other than keoxifene, but having a keoxifene-like transcriptional profile to a patient (or causing 1n vivo production of a compound other than keoxifene, but having a keoxifene-like transcriptional profile).
The treatment may have the effect of preventing new tumors from developing and/or of shrinking the size of existing tumors. The method includes varieties o~
hormone replacement therapy. In this method, the patient is preferably first identified as suffering from such a disease or condition by standard techniques, and then treated as described below.
By "keoxifene-like transcriptional profile" is meant the activity of a compound in producing a normalized response similar to that produced by keoxifene, i.e., a relatively low TAF1 response at low concentrations of CA 02222~62 1997-11-27 the compound but relatively high response a~t higher concentrations o~ the compound. In additioh, little or no TAF2 response should be present at all concentrations. Furthermore, it should have a greater (about twice or more) TAFl response than with a wild type receptor at higher concentrations (about 10-7 M), see Fig. 8E compared to Figs. 8A-D). The ~m; n; stration o~ compounds with keoxi~ene-like transcriptional pro~iles is expected to exhibit bone protecting activity and uterine/breast sparing activity.
By "bone protecting activity" is meant =he ability to prevent bone resorption which can be measured by standard techniques. Bone resorption is typically associated with a loss o~ estrogen. Bone resorption is typically associated with osteoporosis and is manifest by bone dissolution due to a loss o~ calcium.
By "uterine/breast sparing activity" is meant the prevention or reduction of the proli~eration o~ tumorous cancer cells which can be measured by standard techniques.
Dihydronaphthalenes, benzothiophenes and other compounds described and suggested in Jones, U.S. Patent No. 4,418,068, issued November 29, 1983 (incorporated herein by re~erence), may be screened for keoxi~ene-like transcriptional pro~ile. Other compounds that can be screened include compounds with a similar chemical structure to keoxi~ene or keoxifene-like an$10gs. Some o~ these compounds could be produced by making substitutions of 1-10 carbon long alkyl, alkenyl or similar-type ~h~;n~ in the nitrogen-contain-ng ring o~
keoxi~ene. Other alterations could include altering the length or saturation characteristic o~ the alkyl chain (e.g., ~rom 0-10 carbon atoms) that links the nitrogen-containing ring to the rest of the keoxi~ene compound.
Other compounds that can be screened ~or a keoxi~ene-like pro~ile include compounds with a chemical structure similar to tamoxi~ine or tamoxi~ine analogs. Those CA 02222~62 1997-11-27 skilled in the art will readily recognize other modifications and substitutions that can be made to compounds that can be screened for a keoxifene-like profile.
While steroids and steroid analogues may exemplify agents identified by the present invention, Applicant is particularly interested in the identification of agents of low molecular weight (less than 10,000 daltons, preferably less than 5,000, and most preferably less than 1,000) which can be readily formulated as useful therapeutic agents.
Such agents can then be screened to ensure that they are specific to tissues with pathological conditions related to an intracellular receptor with little or no effect on healthy tissues such that the agents can be used in a therapeutic or prophylactic manner. If such agents have some effect on healthy tissues they may still be useful in therapeutic treatment, particularly in those diseases which are life threatening.
Once isolated, a candidate agent can be put in pharmaceutically acceptable formulations, such as those described in Reminqton's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, PA (1990), incorporated by reference herein, and used for specific treatment of diseases and pathological conditions with little or no effect on healthy tissues.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.
Brief Description of the Drawinas Fig. 1 shows schematic diagrams of BR-wt, ER-TAF1, ER-TAF2 (i.e., ER179C) and ER-Null mutants (Fig. lA) and graphs indicating their transcription activation activities (Fig. lB, C and D).
CV1, HepG2 and HS578T cells were transiently co-transfected with increasing concentrations of the CA 02222~62 1997-11-27 W O96/41013 PCTrUS96/09638 di~erent receptor expression vectors as in~icated, together with 9.5 ~g/ml o~ ERE-tk-LUC repor_er plasmid, and 5 ~g/ml o~ pRSV-~-gal expression vector as an internal control for trans~ection e~iciency. Carrier DNA (pGEM4) was added to adjust the total amount o~ DNA
to 20 ~g/ml (see below).
Cultures were treated with or-without 10-7M
17-,~-estradiol (E2) as indicated for 36 hours and assayed ~or ~-galactosidase and luci~erase activity. LUC
activity is normalized ~or ~-gal activity. 'The relative luciferase activity is calculated by dividing the normalized luci~erase value at a given point by that obtained in the absence o~ a trans~ected receptor or ligand. A single experiment representative o~ four independent experiments is detailed above. Data shown indicate the mean + SE(m) o~ triplicate estimations.
Fig. 2 shows schematic diagrams o~ ER-w~, ERN282G
and ER-TAF2 (i.e., ER179C) mutants (Fig. 2A? and graphs indicating their transcription activation açtivities (Fig. 2B, C and D).
CV1, HepG2 and HS578T cells were transiently co-trans~ected with increasing concentrations o~ di~erent receptor expression vectors as indicated, and assays were conducted as described in Fig. 1.
Fig. 3 shows diagrams indicating transc~iption activities o~ TAF1 and TAF2 on the human C3 gene promoter in dif~erent cells.
In Fig. 3A, 3B and 3C, CV1, HepG2 and HS578T cells were transiently co-trans~ected with 0.5 ~g o~ the indicated receptor expression vector, 9.5 ~g o~ C3-LUC
reporter plasmid, 5 ~g pRSV-~-gal and carrier DNA to a total amount of 20 ~g DNA. In addition, a minus receptor control was included.
Cultures were treated with or without 1 0 -7 M
17-~-estradiol (E2) ~or 36 hours, and assayed for luci~erase activity. The data shown are representative curves o~ experiments that have been repeated 6 times CA 02222~62 1997-11-27 W O 96/41013 PCTAUS961~5~8 with similar results. The curves represent averages of quadruplicate data points averaged and normalized for transfection efficiency by simultaneous estimation of pRSV-~-gal transcriptional activity.
Fig. 4 shows graphs indicating transcription activities of ER-TAF1 and ER-TAF2(i.e., ER179C) on different promoter constructs.
In Fig. 4A and 4B, CV1 and HepG2 cells were transiently co-transfected with 0.5 ~g of the indicated receptor expression vector, 9.5 ~g of pA2-LUC reporter plasmid, 5 ~g pRSV-~-gal and carrier DNA to a total amount of 20 ~g. In Fig. 4C and D, CV1 and HepG2 cells were co-transfected as described above, using the pEREMLT-LUC reporter.
Cultures were treated with or without 10-7 M
~-estradiol (E2) for 36 hours and assayed for luciferase activity. Data presentation is described in Fig. 1.
Fig. 5 shows graphs indicating activation of ER-TAF1 and ER-TAF2 (i.e., ER179C) by triphenylethylene-derived estrogen partial agonists. ER represents ER-wt, ERm represents ER-TAF1, TAF2 represents ER-TAF2 (i.e., ER-179C,) and TAF2m represents ER-Null.
HepG2 cells were co-trans~ected with 0.5 ~g of the indicated receptor expression vectors, 9.5 ~g of C3-LUC
reporter, S ~g of pRSV-~-gal and carrier DNA to a total amount o~ 20 ~g.
Cultures were treated with 10-7M of 17-~-estradiol (i.e., E2, Fig. 5A), Tamoxifen (Fig. 5B), 4-hydroxy-Tamoxifen (Fig. 5C), Nafoxidine (Fig. 5D) or Clomiphene (Fig. 5E) for 36 hours and assayed for luciferase activity. Data presentation is described in Fig. 1.
Fig. 6 shows diagrams indicating displacement of estradiol binding to ER-wt and ER-TAF1 proteins by estrogen agonists.
Yeast cytosols prepared from cell expressing ER-wt or ER-TAF1 were incubated overnight at 4~C with 5 nM of 3H-17-~-estradiol alone or in the presence of the CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 indicated concentrations of the di~ferent e-strogen agonists. Ligand binding was determined by scintillation counting following separation;of bound and free ligand using hydroxylapatite.
Fig. 7 is a schematic model showing TAFi and TAF2 as ~unctionally dependent activators of transcription.
This schematic outlines a hypothesis fo~ the promoter and cell specificity of the individual transactivators of the estrogen receptor. Interaction of the receptor with ligand initiates a cascade of events which exposes the receptor DNA binding region (DBD) and promotes association of ER with D~A. Only "estrogenic compounds" are capable of functionally activating TAF2 region o~ the receptor. Upon activation (B), the TAF2 region of the receptor interacts with a transcriptional repressor (I), displacing it or altering its structure (C) to permit the TAF1 activation sequence access to the general transcription apparatus (GTA). In certain cells and on certain promoters, TAF2 function of the receptor can be supplied by other transcription factors, allowing TAF1 region of the receptor to function independently of TAF2. Therefore,'binding of the receptor to DNA is synonymous with transactivation and can be accomplished by both estrogen agonists, as well as antagonists that permit delivery of the receptor to DNA. In this model, the partial agonist activity of the triphenylethylene-derived estrogen agon1sts depends on the conformation induced by the ligand and the effect that this conformation has on the presentat-on of TAF1 to the transcription apparatus.
Fig. 8 shows diagrams indicating that the partial agonist activities of the triphenylethylene derived antiestrogens depends on TAF1 function.
HepG2 cells were cotransfected with 0.5 ~g of the indicated receptor expression vectors, 9.5 ~g of C3-LUC
reporter, 5 ~g of pRSV-~-gal and pGem4 as carrier DNA to a total amount of 20 ~g.
CA 02222~62 1997-11-27 W O 96/41013 PCTrUS96/09f~8 Cultures were treated with various concentrations of 17-~-estradiol (Fig. 8A), Clomiphene (Fig. 8B), Nafoxidine (Fig. 8C), 4-OH-Tamoxifen (Fig. 8D) and keoxifene (Fig. 8E) for 36 hours and assayed for luciferase activity. The data for panel E was obtained relative to a different estradiol control than the other panels. Thus, the peak in panel E appears approximately five times higher than it would if the data had been obtained relative to the same estradiol control that was used in panel A. The relative luciferase activity was calculated as described for Fig. 1. A single experiment representative of 6 independent experiments is detailed.
The data shown indicate the mean + SE(m) of triplicate estimations.
Fig. 9 is a diagram showing the effect of keoxifene (keox) on MCF-7 cell proliferation. The activity of estrogen in this assay is maximum at 10-l~ M, and induces MCF-7 cell proliferation to 1500~ of the control.
Fig. 10 is a diagram showing the structure of pC3-LUC plasmid.
Fig. 11 is a diagram showing functional domains ofintracellular receptors.
Fig. 12 shows diagrams indicating schematic structure organization of PRB, PR-TAFl (i.e., PRB(Eg07A,E9llA)), PR-TAF2 (i.e., PRA) and PR-Null (i.e., PRAlE907A,E9llA) ) -Fig. 13 shows diagrams indicating activity of PR-TAF1 on MMTV promoter.
Plasmid phPRB or phPRB(Eg07A E9llA) was transfected into MCF-10 cells (A) or CV-1 cells (B) together with an MMTV-LUC reporter plasmid (10 ~g/ml) and pCH110 (5 ~g/ml) as an internal control. The amount of expression vector was chosen to permit maximal transcriptional activation in each cell line e~mi ned. The transfected cells were incubated for 40 h with increasing concentrations of progesterone as indicated, and assayed CA 02222~62 1997-11-27 WO 96/41013 PCT/U',G~56~8 for luciferase and ~-galactoside activities~ The data are presented as normalized luciferase (LUC~ units.
Normalization was calculated by dividing the raw luciferase activity (relative light units x~ 104) for each point by the ~-galactosidase activity (A415 x 105)/time in minutes) at that point. The data shown represent the mean values +/- the standard errors of the means of 12 replicates.
Fig. 14 shows graphs indicating activity of PR-TAF2 on TAT promoter in HeLa cells.
HeLa cells were transiently co-transfected with increasing concentrations of the hPR expression plasmid phPRB or phPRA (A), or phPRA or phPRAtEg07A,EgllA) (i-e-, PR-TAF1) (B) together with a TAT-LUC reporter plasmid (10 ~g/ml) and pCH110 (5 ~g/ml) as an internal control. The transfected cells were incubated with or without 10-7 M
progesterone as indicated for 40 h and assayed for luciferase (LUC) units calculated as for Fig. 13.
Fig. 15 shows graphs indicating activity of PR-TAF2 on MMTV promoter in HepG2 cells.
HepG2 cells were transiently co-transfected with increasing concentrations of the hPR expression plasmid phPRB or phPRA (A), or phPRA or phPRA (E907A,E9llA) (i.e., PR-TAF1) (B) together with an MMTV-LUC reporter plasmid (10 ~g/ml) and pCH110 (5 ~g/ml) as an internal control.
The transfected cells were incubated with or without 10-7 M progesterone as indicated for 40 h and as.sayed for luciferase and ~-galactosidase activities. ~The data are presented as normalized luciferase (LUC) units calculated as for Fig. 13.
Fig. 16 (A-D) are diagrams showing saturation analysis of the binding of [3H] progesterone to PRA and PRB mutants.
Aliquots of in vi tro expressed receptor proteins PRB-wt (A), PRB(Ego~A~Eg1lA) (B), PRA-wt (C) and PRA(Eg07A~Eg (D) were incubated for 18 h at 4~C with increasing concentrations of [3H] progesterone. Bound¦and free CA 02222~62 1997-11-27 W O 96/41013 PCT/U5,G~'~3G38 ligand were separated using the dextran coated charcoal method. Each point represents duplicate determinations.
Scatchard analysis o~ the saturation data are shown for each receptor protein in the inserts.
Fig. 17 is a graph showing the agonist activity of DHT on AR and the antagonist activity of 2-OH Fluramide on AR.
Fig. 18 is a graph showing an AR-TAF1 specific assay for screening AR-TAF1 agonists.
Figure 19 shows the structure organization of GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-Null.
Fig. 20 shows the organization structures of GR-Gal4 constructs.
Fig. 21 is a graph showing the effect of mutations on TAF2 transactivation function.
Gal4 DNA binding domain fused to the ligand binding domain of either wt GR (Gal-G) or mutant galG. The number following Gal-G indicates the amino acid(s) that was mutated to alanine. These constructs were transfected into CV-1 cells. Dexamethasone was added to the cell culture. Each mutation resulted in a drastic reduction of the luciferase gene activation by dexamethasone.
Fig. 22 is a graph showing activation profiles obtained with different promoters.
Wild type and mutant GRs were co-transfected in CV1 cells with luciferase reporter genes driven by either MMTV, C3 or TAT3 promoters. Gene activation is measured after 24 hours of dexamethasone treatment.
Description of the Preferred Embodiments The methods discussed briefly above are useful for - identifying agonists or antagonists of various intracellular receptors, including, but not limited to, ER, GR, AR and PR.
ER, GR, AR and PR are members of the nuclear receptor super-family, a class of transcription factors CA 02222~62 1997-11-27 WO96/41013 , PCT/U',G/~638 whose ~unctions are regulated by steroids, vitamins or thyroid hormone (Beato, Cell 56:335, 1989). This ~amily of regulatory proteins share common mechani!stic ~eatures in that they are transcriptionally inactive within the cell until exposed to hormone. Occupancy by hormone results in trans~ormation of=the receptor to an activated state, thus allowing it to productively interact with speci~ic DNA sequences in the regulatory regions of target genes. The resultant positive or negative effects o~ the bound receptor on specific gene transcription are cell-type and promoter-context dependent. Nonetheless, the relative ef~ect may be measured in any particular cell/promoter construct.
Thus, the desired effect may be observed in a wide variety of constructs.
The following are speci~ic examples of this invention. These examples make use of the estrogen receptor, androgen receptor, progesterone receptor and glucocorticoid receptor, but are not limiting in the invention. Those in the art will recognize that other equivalent receptors, cells and promoters c m be readily used in equivalent procedures within the scope of the claims.
I. Estroqen RecePtor The cDNA for ER has been cloned and used to reconstitute estrogen responsive transcription units in heterologous m~mm~l ian cells (Kumar et al., EMBO J.
5:2231, 1986, and Green et al., 231 Science,1150, 1986).
This has enabled a detailed ~m; n~tion 0~ the functional domains within the protein (Kumar et al., Cell 51:941, 1987). A functional ~m;n~tion of the domains of ER in several systems has revealed the likely structural ~eatures within the receptor which may interface with critical cellular componentslto generate a variety of hormone responsive endpoints (Danielian et al., EMso J. 11:1025, 1992).
CA 02222~62 1997-11-27 W O 96/41013 PCT~US9G/~96~8 Two distinct transactivation domains have been defined, a sequence at the amino terminus of the receptor, termed TAF1, and a sequence confined to the carboxyl 60 amino acids, termed TAF2 (Danielian et al., supra; Berry et al., EMBO J. 9:2811, 1990; and Tasset et al., Cell 62:1177, 1990), all hereby incorporated by reference herein. Recently, investigators involved in intracellular receptor research have favored referring to the TAF domains, as AF domains (e.g. Cavailles et al., J. of Cellular Bio., 341, 1994) to avoid confusion with the discovery and cloning of TATA-binding protein associated factors (Dynlacht et al., 66 Cell, 563, 1991) .
Pierre Chambon and his group (Kumar et al., Cell 51:941, 1987) have used truncated estrogen-receptor-encoding genes to study properties of the estrogen receptor and its alleged cell-type and promoter-context dependent activity. These truncated genes express ERs lacking all or a portion of two domains termed TAF1 and TAF2. These domains are thought to be regulated by estrogen and then cause promoter activation.
Tora et al., Cell 59:477 (1989), analyzed truncated mutants of human estrogen receptor, and described TAFl and TAF2 as two transcriptional activation functions in the receptor. These activators are said to exhibit cell-type specificity and promoter-context dependency.
The authors indicate that TAF2 acts synergistically with upstream elements.
Meyer et al., Cell 57:433 (1989), describe inhibition of transcription stimulation by the progesterone receptor by co-expression of the estrogen receptor. The authors propose that the observations reflect competition by the receptors for a limiting transcription factor.
Berry et al., EMBO Journal 9:2811 (1990), describe promoter-specific and cell-specific effects of an agonist on estrogen-responsive genes. Truncated and CA 02222~62 1997-11-27 i WO96/4l013 PCT~S96/09638 chimeric estrogen receptors were used which contained TAFl and/or TAF2 regions from the same or different sources.
Tassett et al., Cell 62:177 (1990), deslcribe interaction of TAFl and TAF2 regions, and c~ompetition (squelching) for limiting factors, by comparing relative activities of TAF regions and competitor constructs.
Fawell et al., Cell 60:953 (1990), describe estrogen-receptor dimerization and its alteration by mutations in the molecule.
Metzger et al., Nucleic Acids Research 20:2813 (1992), describe alleged promoter- and cell-specificity of TAFl and TAF2 regions in the yeast Saccharomyces cerevisiae. Truncated receptors, or recept~rs having regions deleted from them, were used in the analyses.
Danielian et al., EMBO Journal 11:1025 ~(1992), describe conserved regions in the estrogen receptor and state that:
Activities of TAFl and TAF2 vary depending upon the responsive promoter and cell type and, in some cases, both are re~uired for full transcriptional stimulation.
The authors identify amino acids near the C-terminus of the mouse estrogen and glucocorticoid recep=ors which are said to be essential for hormone dependent stimulation of transcription. Point mutations were introduced either into the full-length receptor, or into an internal deletion mutant which lacked the TAFl region, to allow the authors to determine the effects of mutations upon TAF2 activity in the absence or presence of TAFl.
It appears that alterations in charged residues of the amino terminal portion of the hormone binding domain can result in increases or decreases in ER
transcriptional activity with no change in receptor affinity of cognate hormone. Therefore, the regions around residue 530 (Danielian et al., supral) and the CA 02222~62 1997-11-27 W 096/41013 PCT/U~,6/'~ 8 . .
region around cystelne 381 (Pakdel et al., Mol Endocrinol, 7:1408, 1993) may in themselves constitute AF su~domains within TAF-2. It follows then, that changes in such domains, such as the region around cysteine 381, could result in mutant receptors which could discriminate between estrogen and antiestrogen ligands, paralleling the results obtained as detailed herein. Furthermore the analogous situation could exist for discreet residues in the TAF-1 region of ER.
The following experiments characterize the dependence of ER-TAF1 and ER-TAF2 activities on cell-context and promoter-context in m~mm~l ian cells, and the role of agonist or antagonist in the manifestation of these differences. Some of these experiments are described in Tzukerman et al., Mol. Endocrin 8:21, 1994, hereby incorporated by reference herein.
Receptor constructs cDNA sequences encoding the ER-wt and a TAFl -deleted receptor derivative were excised from the plasmids YEpwtER and YEpER179C, respectively, using BfrI
and SacI. The DNA encoding the TAFl receptor derivative was excised from the plasmid YePERN282G using BfrI and K~nI. Construction of the vectors YEpwtER, YEpER179C
and YEpERN282G, have been described previously (Pham et 25 al., Mol. Endo. 6:1043, 1992). The excised DNA was treated with T4 DNA polymerase (Boehringer Mannheim Co.) and ligated into the unique EcoRV site within the m~mm~l ian expression vector pRST7 (Berger et al., J.
Steroid Biochem. Mol. Biol. 41:733, 1992).
The wild type estrogen receptor cDNA (ER-wt) was cloned into pGEM-llZf(+) (Promega, Wisconsin). Specific mutations were introduced into the hormone binding domain of the receptor by substituting alanine for amino acids located at positions 538, 542, and 545, using site directed mutagenesis (Kunkel et al., 154 Methods in Enzvmoloqy 367, 1987), creating the plasmid pGERm. The CA 02222~62 1997-11-27 WO96/41013 PCT~S96~09~8 mutated hormone binding domains were introduced into ER-wt and ER179C by exchanging the BglII-SacIIC-terminal ~ragment o~ this vector with the analogous'mutated ~ragment from pGERm.
Reporter plasmids The reporter ERE-tk-LUC contains a sinqle copy o~
the vitellogenin ERE upstream o~ the herpes simplex thymidine kinase promoter sequences linked to luci~erase (LUC).
The C3-LUC reporter contains 1.8 kb of the human C3 gene promoter (-1807 to +58) (Vik et al., Biochemistrv 30:1080, 1991). Unique restriction sites Xhol and BamH1 were introduced into the C3 promoter, the DNA was then cloned into the cognate sites o~ the vector pl-LUC
(Berger et al., J. Steroid Biochem. Mol Biol. 41:733, 1992), where a polyclonal site has been inserted into the MMTV-LUC vector (see Fig. 10). Those in the art can readily construct equivalent vectors.
pA2-LUC contains a 835 bp ~ragment (-821 to +14) of the Xenopus vitellogenin A2 gene promoter (Vik et al., Biochemistrv 30:1080, 1991).
pEREMLT-LUC contains a single ERE upstream the adenovirus major late promoter sequences (-44 to +11) (Hu and Manly, Proc. Natl. Acad. Sci. USA 78:820, 1981).
Cell cultures CV1 and HS578T cells were routinely maintained in Dulbecco's modi~ied Eagle's medium - DMEM (Biowittaker, Maryland) supplemented with 10~ ~etal bovire serum (FBS) (Hyclone Laboratories, Utah). HepG2 cells were maintained in M;n;m~l Essential Medium Eagle's - MEM
(Biowittaker, Maryland) containing 10~ FCS.
Transient trans:Eection assay Cells were seeded 24 hours prior to trans~ection in ~lat-bottom 96-well tissue culture platesj(5xlo3 CA 02222~62 1997-11-27 W O 96/41013 PCT/U',~1'05~38 cells/well), in phenol red-free DMEM containing 10~ FBS.
DNA was introduced into cells using calcium phosphate precipitation. Plasmid DNA was diluted in 1 ml of 1 mM
Tris, pH 7.4, 0.1 mM EDTA, 0.25 M CaCl2. DNA solution was added dropwise with vortexing into an equal volume of 2X HBS pH 6.9 (280 mM NaCl, 50 mM HEPES, 1.5 mM
Na2HPO4) and precipitates were allowed to form for 20 minutes. Transfections (11 ~l of DNA mix/well) were performed on a Biomek 1000 Automated Laboratory Workstation (Beckman, California). Cells were transfected for 6 hours and then washed with phosphate-buffered saline (PBS) to remove the precipitate. Cells were incubated for an additional 36 hours in phenol red-free medium containing 10~ charcoal-treated FBS, with or without hormones as indicated in the text. Cell extracts were prepared as described by Berger et al., J.
Steroid Biochem. Mol. Biol. 41:733, 1992, and assayed for luciferase and ~-galactosidase activities. All determinations were performed in triplicate in at least two independent experiments, and were normalized for transfection efficiency by using expression of ~-galactosidase as an internal control.
Preparation of Yeast receptor proteins Expression vectors producing ER-TAF1 were constructed by replacing the B~rl-Mlul fragment of YEpE10 (Pham et al., 88 Proc. Natl. Acad. Sci. USA 3125, 1991) with the corresponding fragment of pRST7ER-TAF1.
This vector and a vector producing wild type receptor (YEPE10) were transformed into the yeast strain BJ2168 as described by McDonnell et al., J. Steroid Biochem.
Molec. Biol. 39:291, 1991. Individual transformants were picked and grown to an OD600=1. Cultures were then induced with 100 ~M CuS04, and 2 mM chloroquine for 16 hours at 30~C. Cells were then pelleted and washed with cold water. Cells were resuspended in 2-5X pellet volume o~ 10 mM Tris, 0.4 M KCl, 2 mM EDTA, 0.5 mM PMSF, .
CA 02222~62 1997-11-27 W O96/41013 ' PCTAJS96/09638 1 ~g/ml aprotinin, 2 mM DTT, pH 7.6, and lysed by vortexing with 0.45-0.5 mm glass beads, intermittently with cooling on ice, until at least 90~ o~ the cells were observed to be open. Extracts were cehtrifuged at 13,000xg and the supernatants were recovereld. Protein concentrations were determined by Bio-Rad Plotein Assay (Bio-Rad, Richmond, CA).
~-Estradiol bindinq competition assay This assay was performed on a Biomek 1000 automated workstation (Beckman Instrument, Fullerton, CA). Ten-fold serial dilutions of the compounds to be tested were made in 10 mM Tris, 0.3 M KCl, 5 mM DTT, pH 7.6, and transferred to polystyrene tubes containing' 100 ~1 at final concentrations of 10-4 M to 10-1l M dillted compounds, 5 mM 3H-~-estradiol (Amersham, UK), and 22 ~g total protein derived from strains producing ER or ER-TAFl. Following an overnight incubation at'4 C, 100 ~1 of a 6~ hydroxylapatite slurry in 10 mM Tris, 5 mM DTT, pH 7.6 was added. The tubes were incubated for an additional 30 minutes at 4~C, mixing after the first 15 minutes. Hydroxylapatite pellets were washed 4X with 1 ml 1~ Triton X-100 in 10 mM Tris, 5 mM DTT, pH 7.6.
Finally, the hydroxylapatite pellets were resuspended in 800 ~1 of Ecoscint A scintillation fluid (National Diagnostics, Manville, NJ). Activity in each sample was measured u~ing a LS6000IC scintillation counter (Beckman Instruments, Fullerton, CA).
Example 1: ER-TAFl Transcription Activation Requires the Functional Context of TAF2 TAFl and TAF2 functions have been defined as individual domains within the estrogen receptor that were capable of supporting transcription of an ER
responsive promoter (Berry et al., 9 EMBO J. 2811, 1990, and Tasset et al., 62 Cell 1177, 1990). However, we were unable to show a distinct activity of _he TAFl CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 sequence when analyzed in the context of the ERN282G
deletion in the mammalian cells tested here. Therefore, we considered whether analysis of this transactivator outside the context of the full-length receptor may not reflect its true biological activity.
Danielian et al., su~ra, changed three amino acids between residues 535 and 550 in the carboxyl terminus of the mouse estrogen receptor which comprises transcriptional activity of TAF2 without diminishing the receptor's ability of binding both specific DNA and cognate ligand with wild type affinity, indicating that these changes did not lead to gross structural abnormalities in the protein.
We created similar amino acid changes in the carboxyl terminus of human ER at residues 538, 542 and 549 using site-directed mutagenesis (see the ER-TAFl construct of Fig. 1). This triple mutation was also introduced into ER179C creating a null estrogen receptor (See the ER-Null construct of Figure 1). ER-Null and ER-TAFl constructs allowed a specific determination of the effect of these mutations on TAF2 function. The transcriptional activities of these mutant ERs were assessed by transient transfection into CV-l cells together with the ERE-tk-LUC reporter.
Mutation of these three amino acids provides but one example by which the context of a TAF region can be maintained while inactivating that region. Those in the art will recognize that equivalent mutations in the same or other amino acids can be readily made by standard techniques.
Introduction of the triple mutation into ER179C
totally abolished TAF2 activity (Fig. lB). Thus, we believed that introduction of this mutation into the wild-type ER would allow an ~mi n~tion of TAFl activity in the full-length receptor context without interference from TAF2 activity. The ability to specifically mutate the TAF2 activator within the human estrogen receptor in CA 02222~62 1997-11-27 W O 96/41013 j PCT~US96/09638 this manner is consistent with the results previously reported for the mouse ER, and indicates that equivalent mutations can be made in the other receptor TAF regions.
The full-length receptor containing the triple mutation (ER-TAF1) was subsequently used for analysis of TAF1 function in the context of the intact'receptor.
Constructs encoding wild type receptor, ER-TAF1, ER-TAF2 (i.e., ER179C) or ER-Null were transfected into CV-1, HepG2 or HS578T cells, together with the EPE-tk-LUC
reporter. The results are shown in Fig. 1 In all cell lines, the ER179C was transcriptionally active, as observed earlier (Figs. lB, C &'D), whereas the null receptor was inactive. Interestingly, in CV-1 cells, in the absence of a functional TAF2 activation sequence, the ER-TAF1 protein exhibited a significant transcriptional activity (Figs. lB, C & D). Thus, the activity of the TAF1 activator when analyzed in the context of a full length receptor molecule, as observed here, was different ~rom that when analyzed as a deletion mutant (ERN282G, Fig. 2). This suggests that TAF1 activity does not function independently, but rather requires additional carboxyl-terminal sequences for appropriate function.
Interestingly, increasing the concentration of transfected ER-TAF1 DNA did not result in a receptor dependent "squelching" of transcriptional activity.
This observation implies that both TAF1 and TAF2 activators and possibly the context of the full-length receptor are required for this squelching function.
A comparison was made o~ the expression level of each of these receptors by transfecting the expression vectors into CV-1 cells and analyzing the hormone binding activities in the resulting cytoso_ic extracts (data not shown). The Kds of the ER-wt, ER-TAF1 and ER179C were the same. The ER-wt and ER-TA-~1 were synthesized in comparable levels as measured by hormone binding activity, whereas the amino-terminally deleted CA 02222~62 1997-11-27 WO 96/41013 PCTAUS96/096~8 ER179C and the null receptor were expressed at about 25~
of ER-wt level. Since all the transcriptional responses detected with each receptor were maximal responses achievable, it is unlikely that receptor expression S levels are a significant factor in the outcome of our experiments.
Example 2: Transcriptional Activation bY TAF1 and TAF2 Truncated Receptors Referring to Fig. 2, truncated forms of the human estrogen receptor were prepared which lacked either the TAF1 (ER179C, see Fig. 2A) or the TAF2 (ERN282G, see Fig. 2A) activation sequence. These constructs encode proteins structurally similar to those used previously in m~mm~lian (Berry et al., 9 EMBO J. 2811, 1990) and yeast cells (Pham et al., 6 Mol. Endo. 1043, 1992).
The transcriptional activities of these ER
derivatives were assessed using a reporter plasmid containing one copy of the vitellogenin estrogen response element (ERE) (Klein-Hitpass et al., 76 Cell 1053, 1986) inserted upstream of the thymidine kinase promoter (ERE-tk-LUC). The reporter plasmid and increasing concentrations of ER or mutant ER expression vectors were transiently transfected into the ER
negative cell lines CV-1 (monkey kidney fibroblasts), HepG2 (human hepatocellular carcinoma) and HS578T (human breast cancer cells), and activity assessed as documented in Fig. 2B. All transfections were performed in the absence or in the presence of 17-~-estradiol at concentrations ranging from 10-5M to 10-11M. However, due to the number of data points obtained in this way (~2,500) only the activities obtained using 10-7M 17-~-estradiol are presented since this is a concentration that elicited m~l m~ l transcriptional response in all cell lines ~m~ ned.
The ER-wt was active in all cell lines. Using this protocol, we were unable to detect significant TAF1-CA 02222~62 1997-11-27 W O 96/41013 PCTnJS96/09638 mediated transcriptional activity in either CV-l, HepG2, HS578T (Figs. 2B, C, D) or HeLa or U20S cells (data not shown) when assayed in the context o~ the ERN282G
deletion. In contrast, however, the TAF2 activation ~unction (ER179C) exhibited substantial activity in these cells (Figs. 2B, C & D). The magnit4de o~ the TAF2 transcriptional activity by ER179C was cell-type dependent. This isolated activator exhibitled a lower e~icacy relative to wild type receptor, even at DNA
concentrations that produced saturating receptor levels.
In HepG2 cells ER179C was about 35~ as active as ER-wt (Fig. 2C), whereas in CV-l and HS578T, the ER179C
demonstrated 70~ and 65~ o~ ER-wt activity respectively (Figs. 2B & D). Trans~ection e~iciency ard recombinant expression levels were similar as estimatec by indirect ~luorescence microscopy and flow cytometric analysis (data not shown).
The results obtained in this analysis are consistent with the hypothesis that the TAFl and TAF2 sequences represent ~unctionally distinct transcriptional activators. A wild type receptor activity requires either both activator regions or an intact receptor context ~or an individual activator to exhibit m~; m~ 1 transcriptional activity. I
In addition to the partial activities observed by the above ER-mutants, increasing concentrations o~
trans~ected ER-wt in CV-l and HS578T cells led to a progressive decrease in hormone dependent transcriptional activity (Figs. 2B & D). This phenomenon has been observed by others and likely results ~rom sequestration o~ limited transcription ~actors or targets by the over-expressed, hormone-activated receptor, such that activated receptor ~unction is compromised (Tasset et al., 62 Cell 1177, 1990). This "squelching" or "transcriptional inter~erence" supports the idea that ER requires additional, limiting cellular transcription ~actors ~or CA 02222~62 1997-11-27 appropriate function. The failure of the ER-wt to ~squelch" in the HepG2 cell line (Fig. 2C) suggests either an increased abundance of a required co-factor, or the involvement of an additional cell specific component in this process.
Example 3: ER-TAF1, HepG2 Cell and C3 Promoter Constitute an Assav for an Aaonist or Antaqonist Actina Throuqh TAF1 The above results using the ERE-tk-LUC reporter indicated that the TAF1 activator of the estrogen receptor functions, albeit weakly, in the absence o~ an intact TAF2 function. In addition, TAF1 activity appeared to be cell-type dependent.
We extended our studies to ~m; ne the efficacy of the individual activator functions on other estrogen responsive promoters. To this end, we chose the estrogen responsive C3 promoter in which a s~rong ERE
has recently been identified (Zawaz, Gene Exp. 2:39, 1992; Vik et al. Biochemistrv 30:1080, 1991).
The activities of the of ER-wt, ER-TAF1 and ER-TAF2 (i.e., ER179C) activators were evaluated on C3 promoter-directed transcription as depicted in Fig. 3. In HS578T
cells, the C3 promoter can be activated equally well by either ER-wt, ER-TAF1 or ER179C (Fig. 3C). In HepG2 cells, however, the ER-TAF1 activator was as active in transcription as wild type ER, but the ER179C activator was silent (Fig. 3B).
These data suggest that, with respect to the C3 promoter, there is a strong cell-type bias in ER
transactivator functions. In CV-1 cells it appears that the combination of the activation sequences is required for m~; m~ 1 activity (Fig. 3A). Cumulatively, these data suggest that the TAF1 and TAF2 activators within ER
demonstrate a dependence upon cell-type and promoter, and furthermore, the dominant activator of ER-mediated regulation of C3 expression is TA~1.
CA 02222~62 1997-11-27 The analysis of the relative contributilon of the individual ER TAF domains in ER function was extended to include two additional promoters, namely the adenovirus major late promoter, containing an estrogen response element, and the vitellogenin promoter (Fig. 4). Both of these promoters were responsive to estrogen in the presence of ER-wt. However, unlike the C3 promoter the individual activation domains of ER were mihimally active in both cell lines examined. This highlights further the promoter specificity of the estrogen receptor activation domains. Similar tests to those described above can be used to quickly identify useful promoter and cell combinations for use in assays for agonists discussed above (see also, Example 4, below).
Example 4: Screeninq Aaents for Partial Aqonist Activity Certain triphenylethylene-derived estrogen receptor antagonists (i.e., tamoxifen, nafoxidine) aire reported to exhibit partial agonist activities. We ,tested whether these compounds preferentially actilvate either TAF1 or TAF2 transactivators.
A series of these compounds was evaluatled in HepG2 cells using the ER-TAF-specific receptor derivatives and the C3 promoter. In this cellular and promoter context, ER179C was not activated by either estradiol or the partial estrogen agonists. On the C3 promo~ter, tamoxifen, 4-hydroxy-t~mox~fen, nafoxidine and clomiphene were all potent activators of ER-wt mediated C3 gene transcription (Figs. 5B-E) Howevelr, none of these compounds were as effective as estrogjen in this regard (Fig. 5A). In addition, estrogen was an efficient activator of the ER-TAF1, whereas the partial estrogen agonists were not as effective.
These data imply that even though TAF1 ~activity is necessary, it alone does not activate this promoter by triphenylethylene-derived antihormones, suggesting that CA 02222~62 1997-11-27 W O 96/41013 PCT~US~6~
their mode of action may be mechanistically different from that of estrogen (Figs. 5A-F). The differences in hormonal responsiveness of these receptor derivatives do not relate to alterations in the affinity of the proteins for ligands. As shown in Figs. 6A and B, the affinity and specificity for ligands of the ER-wt and ER-TAF1 were indistinguishable. It is notable that not all the anti-hormones tested in this system have an identical transcriptional profile (Figs. 5B-E). The absolute efficacy for each of the anti-hormones is different, as is their ability to differentially activate TAF1, suggesting subtle mechanistic differences in the agonistic properties of these ligands.
These examples demonstrate specific point mutations in the human estrogen receptor affects ER-transcription activation function. Mutation of TAF2 in this manner is still compatible with wild-type binding affinities for estrogen, tamoxifen and 4-hydroxy-tamoxifen.
Surprisingly, TAF1 retained considerable transcriptional activity despite TAF2 mutation. When we deleted the entire TAF2 sequence (ERN282G) we were unable to observe residual transcriptional activity of TAF1 in any cell line ~X~m; ned. This suggests that either TAF2 or the context of the full length receptor is required for full manifestation of TAF1 activity.
Berry et al. have observed that a construct identical to ERN282G was constitutively active in avian CEF cells (Berry et al., g EMBO J. 2811, 1990). This may suggest a difference in estrogen receptor function in m~mm~l ian and avian cells, and may not reflect basic differences between the two sets of results.
Using the modified receptors we were able to identify cell and promoter specific differences in the activity of ER-TAFl and ER-TAF2 (i.e., ER179C). In studies which were controlled for expression level and transfection efficiency we saw that both activators displayed promoter and cell type specific differences in CA 02222~62 1997-11-27 WO 96/41013 PCT/U'9G~638 their activity. The most striking example of this is the inability o~ ER179C to ~unction well on any promoter in HepG2 cells. The ER-TAF1 activator, on the other hand, ~unctions very well on the complex C3,promoter, but less well on the other promoters ~m; ned The activity pro~iles o~ ER-TAF1 and ER179C are clearly distinct, suggesting dissimilar mechanisms Q~ action.
On the complex C3 promoter there is no apparent synergism between TAF1 and TAF2, whereas it'clearly exists on other promoters. This suggests that on this promoter the ER activation domains may interact with di~ering transcription ~actors. The data obtained using the C3 promoter in HepG2 cells indicate that there is a transcription ~actor in these cells that can ~unctionally replace TAF2, as TAF1 is as good a transcriptional activator as ER-wt. However, since TAF2 alone does not activate transcription, it suggests that no mimetic ~or TAF1 exists ~or transcription of this promoter in this particular cell line.
The dissimilar mechanism o~ action and the promoter and cell type speci~icity can be explained by a model in which TAF1 is the dominant transcriptional a,ctivator and TAF2 is a transcriptional facilitator (see model in Fig.
7). We suggest that the ~unction o~ TAF2 is to "prepare" the transcription apparatus ~or TAF1 function.
This "preparation" ~unction could be the reçruitment o~
basic transcription ~actors, alteration o~ chromatin structure or overcoming the e~ects of a transcriptional repressor. On the other hand, TAF2 could ~prepare" the transcription apparatus ~or another transcrlptional activator, but on its own would have little inherent transcriptional activity. In support o~ this hypothesis, the TAF2 activator is poorly active on m; n; m~ 1 promoters.
This dependence on promoter complexity -s also observed for ER-TAF1 activity. Additional ~vidence in support o~ the ~acilitator role o~ TAF2 is that in yeast CA 02222~62 1997-11-27 W O 96/41013 PCT/W'6'~96~8 the TAF1 activator is inactive on a minimal promoter.
However, a mutation of the SSN6 locus (a cellular repressor of transcription), Keleher et al., 68 Cell, 709, 1992, results in a 100-fold increase in ER-TAF1 activity (to a level comparable to ER-wt), whereas ER179C activity is not effected (McDonnell et al., 89 Proc. Natl. Acad. Sci. USA 10563, 1992). We suggest that this cellular mutation has the effect of mimicking the function of TAF2, and that in mammalian cells TAF2 has a similar role. In this system TAF1 is unable to access the transcription apparatus as a result of stearic hindrance by an inhibitor Where TAF2 is available, then the inhibitor is displaced and TAF1 is able to interact with the transcriptional apparatus.
Example 5: Screeninq For and Use 0~ Compounds With Keoxi~ene-Like Transcri~tional Profiles In hnm~n.q the tri-phenylethylene derived anti-estrogen keoxifene exhibits bone sparing activity while having no significant effects on uterine proliferation.
In contrast, tamoxifen, a related anti-estrogen, is bone sparing but functions as a partial estrogen agonist in the uterus promoting an undesirable proliferative effect.
In order to determine whether the differences in the in vivo biological activity o~ tamoxifen and keoxifene could be reconciled by their differential ability to transcriptionally activate TAF1, these compounds were studied in HepG2 cells using the ER-TAF specific receptor derivatives on the C3 promoter. The results are shown in Figure 8D and 8E.
Keoxifene had a unique transcription profile in this promoter and cellular context. In particular, low concentrations of keoxi~ene stimulated ER
transcriptional activity. At higher concentrations, keoxifene inhibited the basal transcriptional activity of ER and did not cause further transcriptional CA 02222~62 1997-11-27 activation (See Fig. 8E). On the ER-TAFl construct, keoxifene demonstrated significant partial;agonist activity inducing C3 promoter transcription 5-fold over background. The mechanism by which keoxifene manifests a transcriptional profile distinct from the related molecule tamoxifen is unclear. However, it is likely that these compounds induce subtle alteratilons in receptor structure which facilitate distinct interactions of the ER-TAFs with the genera~l transcription apparatus.
The unique profile exhibited by keoxifehe in this in vitro assay suggested that additional compounds displaying similar transcriptional profiles may also exhibit favorable bone protective/uterine sparing activities. To this end we have studied several compounds derived from tamoxifen using this assay system and have been able to split these compounds into three distinct groups based on their ability to modulate TAFl activity. The first category contains compounds that resemble the activity of estrogen, the second group resembles the activity of tamoxi~en and the third group profile similar to keoxifene.
When the keoxifene-like compounds are alsayed in the ovariectomized rat model they are expected to be bone protective and to demonstrate no uterotrophic activity.
Rats are given a dorsal ovariectomy as follows:
The animals are anesthetized with Ketamlne:Xylazine and surgery is performed. Shave the centrai back of the anesthetized rat. Make a longitudinal incision in the skin parallel to the spine about 1 inch long. Spread the connective tissue away from the muscle layer with the tips of scissors. About 1 inch from the spinal column at the base of the rib cage, make a small cut (1/4") of the muscle with scissors. With small forceps, pull out ovarian fat. Ovary will be visible as a cluster-like structure, attached to the end of the uterine horn. Cut the connective tissue that holds them CA 02222~62 1997-11-27 W O96/41013 PCTrUS~6~'~5-~8 together. Staunch any bleeding. Replace fat into body cavity. Repeat on opposite side. Clip skin together and use betadine on the incision to retard infection and reduce clip removal. The next day injections are begun.
Injections are done subcutaneously in the hip daily (usually in the morning). Vehicle is 10~ ethanol and all injection volumes are 300 ~l. After 28 days of injections, the ~n;m~ls are sacrificed under anesthetic by cervical dislocation and the body and wet uterine weights are determined. The hindlimbs are taken for histology and histomorphometry.
The transcriptional profile exhibited by keoxifene in vitro is predictive of agents demonstrating bone selective estrogenic activity. Thus, the use of these ER-TAF constructs ~x~m;ned on this promoter and cellular context provides a useful screen for compounds useful for the treatment of osteoporosis.
In in vivo studies, rats are subjected to sham or authentic ovariectomy and allowed to recover for 5 days.
Rats (4-6 per group) are then injected subcutaneously with vehicle or vehicle containing estrogen, keoxifene, or a test compound daily for periods up to 28 days.
~n;m~ls are sacrificed, weighed, and evaluated for uterine wet weight, total serum cholesterol, and bone mineral density. Established methods are utilized with the exception that bone mineral density of the distal femural metaphysis is determined utilizing an Hologic mineral densitometer. Bone marrow from test ~n;m~1s is evaluated for osteoclastic potential in the coculture assay with primary osteoblasts. Bone marrow is combined with primary osteoblasts in the presence of 1,25-dihydroxyvitamin D3 and parathyroid hormone for 8 days and scored for the number of tartrate acid phosphatase resistant multinucleated cells (TRAP + MNC). The number of TRAP + MNC in the sham operated animals is set at 100~. Tartrate resistant acid phosphatase positive, CA 02222~62 1997-11-27 , W O96/41013 PCT~US96/09638 multinucleated cells are scored by standard methods as nascent osteoclasts.
The in vitro effects of compounds on MCF-7 breast cell proliferation can also be studied. The partial agonist activities of estrogen, keoxifene, and the test compound on MCF-7 human breast carcinoma cells, is assessed by treating the cells for 7 days in the absence or presence of increasing concentrations of compound.
Cells are treated at day 0 and day 4 with compound.
Triplicate wells are evaluated for cell num~er at termination of the experiment on day 7. The activity of estrogen in this assay is expected to be ma~ imum at 10-~M, and induce proliferation to 1500~ of control.
The in vitro profiles of keoxifene and the test compounds could then be determined. The acthvities of increasing concentrations of compound on ER,~ER-TAF1, and ER-null receptor transactivation of the C3 promoter in HepG2 cells is determined by standard methods as described in this document. Thus, compounds that exhibit both bone protecting and uterine/breast sparing activity at a given concentration can be identified.
Higher potency compounds than keoxifene are preferred.
By "potency" is meant the amount of a compound required to produce the desired effect. Thus, high potency compounds will bind to the receptor with greater affinity than keoxifene. High potency compounds produce maximal effect at minimal dosages. As illus=rated in Fig. 8, compounds with high potency have pea~s further to the right than do compounds of lower potency.
ER agonists and their type can be quickly identified in the above systems. Specifically, the experiment described in Example 4l and illustrated in F-g. 5, is useful for identifying an agonist and then defining its type of activity. For example, the use o~ a wild type receptor (ER-wt) in this assay will indicate whether a test compound is an ER agonist. The use of a mutated CA 02222~62 l997-ll-27 W O 96/41013 PCT~US96/09638 receptor with full functional context (ERm) in the assay will indicate the type of agonist, i.e., what level of activity is observed. Examples of the range of results expected with various test compounds are shown in Fig.
5, and discussed in Example 4. Using such assays, one can readily screen for desired agonist activity, e.q., agonists active only at TAF1 regions which mimic the activity of estrogen and are useful for treatment of osteoporosis.
II. Proaesterone Receptor The steroid hormone progesterone is involved in the regulation of growth and development of m~m~y gland and uterus. Synthetic progestins and antiprogestins have been used or are in human clinical trials in treatment of endometrial and breast cancer, as combination oral contraceptive agents, and as ad~uncts to estrogen in hormonal replacement therapy.
The effects of progesterone are mediated by progesterone receptors. Upon binding to their hormonal ligands, the activated receptors bind with high affinity to specific DNA binding sites and activate transcription of the cis-linked genes.
Gronemeyer et al. (1987) EMBO J. 6:3985-3994, cloned and sequenced chicken PR and described that both the N-2 5 terminal A/B region and C-terminal hormone binding domain are required for transactivation function on MMTV
promoter in HeLa cells.
Carson et al. (1987) Mo. Endo. 1: 791-801, cloned and sequenced chicken PR, and conducted analysis to define the functional domains of the receptor. The authors state that a transcription activation function domain resides outside the hormone binding domain and that the C-terminal region may function as a "repressor".
Tora et al. (19 88) Nature 333:185-188, reported on the functional difference between chicken PRA and PRB in the transactivation of target genes.
CA 02222~62 1997-11-27 3 ' PCTrUS96/09638 Meyer et al. (1990) EMBO J 9:3923-3932, described the presence of two transcription activation ~unction (TAFs) located in the N-terminal region A/B (TAF1) and the hormone binding region (TAF2) of the human PR. The authors described the agonistlc activities of RU486.
Meyer et al. (1992) J Biol Chem 267:10882-10887, state that a region specific for PRB is required for TAF1 function.
Two isoforms of human progesterone receptor, sized 94kD and 120 kD, have been observed in human breast cancer T47D cells and primary human endometrial carcinoma. In T47D cells, two promoters in'a gene give rise to two distinct classes of human proge~terone receptor mRNAs, one of which codes for hPRB while the other one encodes hPRA. The two isoforms dilffer only in their N-terminal sequences. Form A lacks the amino terminal 164 amino acids present in form B.
The human progesterone receptor A and B lisoforms (hPAR and hPRB) differentially activate tran~scription of progesterone-responsive genes (Vegeto et al., Mol. Endo.
7:1244-1255, 1993; Wen et al., Mol. Cell. Biol. 14:8356-8364, 1994, all incorporated by reference he;rein).
Using site-directed mutagenesis we were ablelto show that hPRA has a functionally inactive TAF1. ITAF2 of hPRA is the sole transcription activator of Ihis receptor form. However, TAF2 is a weak transcription activator and functions only in some promotell and cellular contexts.
TAF1 of hPRB functions synergistically with TAF2 of hPRB in certain promoter and cellular contex_s. TAF1 of hPRB also functions independently in some promoter and cellular contexts.
Reaqents DNA restriction and modification enzymes were obtained from Boehringer Mannheim (Indianapolis, Ind.), New England Biolabs (Beverly,Mass.), or Stratagene (San CA 02222~62 1997-11-27 W O 96/41013 PCT~US~'/056 Diego, Cali~.). PCR reagents were obtained ~rom Persin-Elmer Cetus (Norwalk, Conn.). Progesterone, dexamethasone, and 17-~-estradiol were purchased ~rom igma (St. Louis, Mo.). [1,2-3H]progesterone was purchased ~rom Amersham (Arlington Heights, Ill.).
Rece~tor and reporter constructs Construction o~ the mammalian expression plasmids phPRB, phPRA and pRShGR has been described elsewhere (Vegeto et al. (1993) Mol. Endocrin. 7:1244-1255), as has the construction o~ PRE2-TK-LUC,TAT-LUC, and ERE-TK-LUC reporters (Berger et al., (1992) Cell 70:251-265,Tzukerman et al., (1994) Mol. Endocrinol. 8:21-30,Vegeto et al. (1993) Mol. Endocrin. 7:1244-1255).
Plasmid MMTV-ERE-LUC was constructed as ~ollows.
Plasmid ~MTV-LUC containing a deletion o~ the sequences ~rom +190 to -88 was obtained ~rom Ron Evans (Salk Institute, San Diego, Calif.). This plasmid was digested with HindIII to remove the glucocorticoid response elements, and five copies o~ a 33-bp oligonucleotide containing the consensus vitellogenin A2 estrogen response element were inserted. The sequence o~ the oligonucleotide used was 5'AATTAAAGTCAGGTCACAGTGACCTGATCAAA3'.
Glutamic acid residues at positions 907 and 911 were substituted with alanines by using PCR primers containing two base changes (underlined) as indicated:
5'CCAGCAATGATGTCTGCAGTTATTGC3' and 5'GCAATAACTGCAGACATCATTGCTGG3' (National Biosciences Inc., Plymouth, Minn.) to prepare the E907A and E9llA
mutations. The EcoNI-KpnI ~ragment o~ DNA containing the mutated receptor sequences was subcloned into plasmids phPR-B and phPR-A and sequenced to con~irm the mutations.
CA 02222~62 1997-11-27 WO 96/41013 PCT/U'~GI'~3~38 Cell lines The human m~mm~ry epithelial cell line MCF-10 was obtained originally from Samuel Brooks (Mic~igan Cancer Foundation). This cell line was routinely maintained in a 1:1 mixture of Dulbecco's modified Eagle's medium (Biofluids, Rockville, Md.) and Ham's F12 medium (Biofluids) with 20 ng of epidermal growth factor (Sigma) per ml, 100 ng of cholera toxin (Sigma) per ml, 0.01 ~g of insulin (Biofluids) per ml, 500 rg of hydrocortisone (Sigma) per ml, and 5~ horse serum (Biofluids). The human breast adenocarcinoma cell line MCF-7 was obtained from Marc E. Lippman (Vincent T.
Lombardi Cancer Center, Georgetown Universit,y) and maintained in Iscove's modified Eagle's medium (Biofluids) with 10~ fetal bovine serum (HyClone Laboratories, Inc., Logan, Utah). Monkey ki'dney CV-1 fibroblasts were routinely maintained in Dulbecco's modified Eagle's medium supplemented with 10l~ fetal bovine serum.
AssaYs Cotransfection assays were conducted as follows.
Cells were plated in 12- or 96-well tissue culture plates the day before transfection. DNA was introduced into cells by the calcium phosphate coprecipitation 25 method (Berger et al., (1992) Mol. Biol. 41: 733-738).
For each transfection reaction, 20 ~g of DNA per ml of transfection buffer was used. For the 96-well plate experiments, transfections were performed wi_h a Biomek 1000 automated laboratory workstation (Beckman, Fullerton, Calif.). Cells were incubated with the precipitate for 6 h, then washed with phosphate-buffered saline, and incubated for 40 h with or without hormones as indicated in the text. Cell extracts were prepared as previously described (Berger et al., (1992) Mol.
Biol. 41:733-738) and assayed for luciferase and ~-galactosidase activities.
CA 02222~62 1997-11-27 W O 96/41013 PCTrUS96/09638 Hormone bindinq assay Hormone binding assays were conducted as follows.
The wild-type PR and mutant receptor proteins were produced by in vitro translation of mRNA synthesized by using wild-type and mutant PR templates. The binding assay buffer constituted of 10~ glycerol, lOmM Tris, 2 mM dithiothreitol, 2 mM 3-[3-cholamidopropyl)-dimethyl-ammonio]-l-propanesulfonate, and 1.5 mM EDTA (pH 7.5).
The binding assays were performed in a 500-~1 volume containing 10 ~1 of reticulocyte lysate (containing PR) and various concentrations of [3H]progesterone in the absence or presence of 10 ~M progesterone. Incubations were carried out at 4~C for 16 h. At the end of the incubation period, bound and unbound progesterone were separated by using dextrancoated charcoal. The supernatants containing bound progesterone were drawn off, and the radioactivity retained was estimated by liquid scintillation counting. Data were analyzed by the method of Rosenthal, H.A. (1967) Anal. Biochem.
64:1393-1401. For competition binding assays, a similar protocol was used except that a fixed concentration of [3H]progesterone was added to extracts in the presence or absence of competing ligands (lnM to lO~M). After correcting for nonspecific binding, 50~ inhibitory concentration values were determined graphically from a log-logit plot of the data. Kis were determined from the calculated 50~ inhibitory concentration values by using the Cheng-Prusoff equation (Cheng et al., (1973) Biochem. Pharmacol. 22:3099-3108).
A PR-TAFl construct, phPRB(Eg07A~EgllA)~ was trans~ected into MCF-10 cells together with an MMTV-LUC reporter plasmid (see Figs. 12 and 13). In MCF-10 cells, PhPRB~Eg07AE9llA~ functioned as a hormone-dependent activator o~ MMTV gene transcription in the presence of progesterone (Fig. 13A). In contrast, this mutant CA 02222~62 1997-11-27 WO 96/41013 i PCTAUS96/09638 receptor was unable to activate MMTV gene transcription in CV-1 cells (Fig. 13B).
There~ore, MCF-10 cells, phPRB(Eg07AEg1~) and MMTV
promoter constitute an assay ~or an agonistlor antagonist which acts through the TAF1 region of PR.
With this assay, we were able to demonstrate that the partial agonist activity of some antiprogestins is mediated by the TAF1 region o~ hPRB.
A PR-TAF2 selective assay was also constructed. A
PR-TAF1 construct, phPRA, was trans~ected into XeLa cells together with a TAT-LUC reporter plasmid (see Figs. 12 and 13). The construction o~ plasmids, mutagenesis, cell culture, cotrans~ection assays and hormone binding assays were conducted as deccribed in Wen et al. supra.
In HeLa cells, phPRA ~unctioned as a hormone-dependent activator of TAT gene transcriptiojn in the presence o~ progesterone (Fig. 14). In contrast, this mutant receptor was unable to activate MMTV gene transcription in HepG2 cells (Fig. 15). There~ore, HeLa cells, phPRA and TAT promoter constitute an assay for an agonist or antagonist which acts through the TAF2 region Of PR.
Depending on the e~pression ration of hPRA and hPRB
and the particular target tissues or cells, PR agonists can activate the transcription o~ di~ferent isets o~
genes. PR antagonists can have di~erent e~fects o~
target gene transcription depending on cellular environments. Partial agonists or antagonists of PR
screened by the above described assays may be used as oral contraception, in hormone replacement therapy, to treat endometriosis, fibroids, endometrial cancer and breast cancer with little or no side e~ects.
III. Androaen Rece~tor The steroid hormones testosterone and its active metabolite dihydrotestosterone (DHT) have multiple CA 02222~62 l997-ll-27 effects in the body, including fusion of the labioscrotal fold during embryogenesis, induction of male differentiation of the wolffian ducts, growth of the male urogenital tract, induction of spermatogenesis, growth of beard and body hair, retention of nitrogen, temporal regression of scalp hair, hyperplasia of the sebaceous gland with increased sebum production, development of prostatic hyperplasia in aging males, secretion of ejaculate, and virilization of the hypothalamus. These diverse effects are modulated through the action of the androgen receptor AR.
The human AR cloned by Lubahn et al. Mol. Endo.
2:1265-1275, 1988, is a member of the superfamily of ligand inducible nuclear receptors. AR has high 15 homology with PR, MR and GR (Evans R.M. Science 240:889-895, 1988).
Chang et al. Proc. Natl. Acad. Sci. 85:7211-7215, 1988, described the cloning of AR and androgen binding specificity.
Jenster et al. Mol. End. 5:1394-1404, 1991, described a series of deletion mutants of AR that define steroid binding domain, regions of the N terminal region required for transactivation and regions required for nuclear targeting.
Palvimo et al. Mol. Endo. 7:1399-1407, 1993, described a region of the N terminal domain that is required for transactivation.
When testosterone or DHT binds to hAR, hAR binds to HREs in target genes and modulates transcription of those genes. DHT causes a dose-dependent enhancement of luciferase activity from cells cotransfected with a hAR
plasmid and a reporter plasmid containing an androgen response element (Figure 17). The activity induced by DHT can be reversed by the nonsteroidal AR antagonist, 2-hydroxy flutamide.
CA 02222~62 l997-ll-27 W O96/~1013 PCT~US96/09638 Rece~tor Constructs Four receptor constructs were generatedito establish an assay to screen for AR TAF region partial agonists and antagonists. These constructs are analogous to the mutant forms o~ the estrogen receptor descrlbed above.
cDNA sequence encoding the AR-wt was excised from plasmid hARpGBM3 as a 3.6Kb BglII/BamH1 fracment and ligated into unique BamH1 site o~ the m~m~l ian expression base vector pRS (Berger et al., 41 J. Steroid Biochem. Mol. Biol. 733,1992). The resulting plasmid was named pRShAR. pRShAR-wt contains the coding sequence of the full length human AR clonedlinto the expression vector pRS (AR-wt plasmid). I
The AR-TAF1 plasmid was generated by cloning a BamH1/Kpnl ~ragment of the hAR into the plas'mid pALTER
using an in vitro mutagenesis system by Promega.
Specific mutations were introduced into the hormone binding domain o~ the receptor by substituting alanine for amino acids located at positions 892, 896 and 899 using site directed mutagenesis according to'the manu~acturers instructions. The hormone binding domain o~ pRShAR-wt and pRShAR-TAF1 was then replaced with 1.5Kb Kpnl/BamHl mutated hormone binding domain DNA
fragment. The resulting plasmids were named pRShAR-TAF1 (derived ~rom pRShAR-wt) and pRShAR-null (derived from pRShAR-TAF2). pRShAR-TAFl contains a mutated ~orm o~
the AR that carries a series o~ point mutations that change the glutamic acid residues at positions 892, 896 and serine at position 899 to alanine (AR-TAFl).
The AR-TAF2 plasmid was constructed by e~cising the l.Skb AR cDNA fragment generated by cutting with Apal and BamH1. The single-stranded DNA overhang generated by Apal was removed by treatment with T4 polymerase prior to treatment with BamH1. Another aliquot o~
pRShAR was treated with Asp718, the ends of the DNA were ~illed by treatment with Klenow fragment. The DNA was then cut with BamH1. The 4 kb ~ragment generated was CA 02222~62 1997-11-27 WO 96/41013 PCTrUS9~'0~8 isolated and ligated with the 1.5 kb Apal/BamH1 hAR DNA.
pRShAR-TAF2 contains a mutated form of the AR that has the N terminal region of the receptor truncated so that amino acids residues 1-506 are missing, effectively removing the TAF1 portion of the receptor.
pRShAR-null contains a mutated form of the AR that carries both the point mutations in the TAF2 region and the truncation of the N terminal region as described above.
Cotransfection assaY
CV-1 cells (African green monkey kidney fibroblasts) were cultured in the presence of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10~ charcoal resin-stripped fetal bovine serum and then transferred to 96-well microtiter plates one day prior to transfection.
Cells were transiently transfected by calcium phosphate coprecipitation (Berger et al. J. Steroid Biochem. Mol. Biol. 41:733, 1992) with pRShAR (1 ng/well), MTV-LUC reporter (100 ng/well), pRS-~-Gal (50 ng/well) and pRS-CAT (filler DNA, ~9 ng/well). The receptor plasmid, pRShAR, contains the human AR under constitutive control of the rous sarcoma virus promoter.
The reporter plasmid, MTV-LUC, contains the cDNA for LUC
under control of the mouse m~mm~y tumor virus (MMTV) long terminal repeat, a conditional promoter containing an androgen response element (Berger, et al. J. Steroid Biochem. Mol. Biol. 41: 733, 1992). pRS-~B-Gal, coding for constitutive expression of E. coli ~-galactosidase (~-Gal), was included as an internal control for evaluation of transfection efficiency and compound toxicity. Transfections and subsequent procedures were performed on a Biomek 1000 automated laboratory work station.
Six hours after transfection, media was removed and the cells were washed with phosphate-buffered saline CA 02222~62 1997-11-27 W O96/41013 PCTAUS96/~56~8 (PBS). Media containing reference compounds (i.e., DHT
and 2-hydroxy flutamide) or test compounds in concentrations ranging from 10~12 to 10-5 M were added to the cells. Three to ~our replicates were used for each sample. ' After 40 hours, the cells were washed with PBS, lysed with Triton X-100-based buffer and assayed for LUC
and ~-Gal activities using a luminometer or spectrophotometer, respectively.
Data evaluation was performed using thelOracle relational database management system. Forleach replicate, the normalized response (NR) was,calculated as:
LUC response/~-Gal rate where ~-Gal rate = ~-Gal activity xlO~5/~-Gal incubation time.
The mean and standard error of the mean (SEM) of the NR were calculated. Data was plotted as the response of the compound compared to the reference compounds over the range of the dose-response curve. For agonist experiments, the effective concentration that produced 50% of the maximum response (ECso) was quanti-fied.
Agonist e~ficacy was a function (%) of LUC
expression relative to the maximum LUC production by the reference agonist, DHT. Antagonist activity'was determined by testing the amount of LUC exprlession in the presence of DHT at its EC50 concentratio$. The concentration of test compound that inhibited 50% of LUC
expression induced by DHT was quantified (IC50). In addition, the efficacy of antagonists was determined as a function (~) of maximal inhibition.
Cotransfection studies with the human glucocorticoid receptor (hGR, Giguere, et al. Cell 46:645-652, 1986), human progesterone receptor (hPR-B, Vegeto, et al. Cell 69:703-713, 1992), human mineralocorticoid receptor (hMR) with the MTV-LUC reporter and'human estrogen receptor (hER) with the MTV-ERE5-LUC reporter CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 were carried out as described above for evaluating the cross-reactivity of test compounds.
The receptor constructs were used in transient co-transfection studies (Fig. 18). HepG2 cells were trans~ected with 10 ~g of the reporter plasmid C'9, 5 ~g of pRSV-~-gal expression vector as an internal control for transfection efficiency, carrier DNA (pGEM4) added to adjust the total amount of DNA to 20 ~g and receptor expression DNA (i.e., pRShAR-wt 200 ng; pRShAR-TAF1 200ng; pRShAR-TAF2 3~g; or pRShAR-null 3~g).
Increasing concentrations of testosterone were added to the HepG2 cells. The procedures and calculations used to determine normalized response ~ollows that described above. The response element used in the reporter plasmid is the C'9 promoter (Adler et al. Mol.
Endo. 5:1587-1596, 1991), a fragment o~ the promoter region of the sex limited protein (SLP) cloned by the polymerase chain reaction from mouse genomic DNA.
Figure 18 demonstrates that in the context of the HEPG2 cell line and C'9 promoter a significant response is obtained with the AR-TAF1 construct relative to wild type AR whereas the AR-TAF2 construct exhibits a very minor response. The AR-null does not exhibit a dose dependent response to hormone. In this example agonist activity can be detected through function of the TAF1 in this context.
Therefore, HepG2 cells, pRShAR-TAF1 and C'9 promoter constitute an assay for an agonist or antagonist which acts through the TAFl region of AR. With this assay, we can screen agents for partial agonist or antagonist activity mediated by the TAF1 region of hAR.
The development of compounds with androgenic and anti-androgen properties acting through a particular TAF
region on certain promoters in certain cellular environments have clinical applications in the treatment of prostate cancer, alopecia, hirsutism, acne, benign prostate hyperplasia, male breast cancer, precocious CA 02222~62 1997-11-27 WO 96/41013 ~ PCTAUS96/09638 puberty and laryngeal carcinoma with little or no side effects. Currently known compounds have sice effects.
For example, cyprotene acetate (CPA) is a steroidal antiandrogen with progestin activity. Side effects are tests and adrenal suppression, feminization potential teratogen, cardiovascular disorder, liver toxicity, inhibition of libido and bone maturation. In addition, futamide is a nonsteroidal antiandrogen currently used in the treatment of prostate cancer. It is~also effective ~or treating hirsutism. Side effects of futamide include severe gastrointestinal disturbance, hot flashes, gynecomastia, liver toxicity, elevation of serum leutenizing hormone and testosterone levels.
Furthermore, casodex is a non-steroidal anti!androgen currently being developed for use in the clinic to treat prostate cancer, hirsutism (in women) and acne. Side effects of casodex include liver toxicity, breast tenderness, gynecomastia, hot flashes, mild back pain.
IV. Glucocorticoid Receptor Glucocorticoids are potent agents available for the treatment of inflammatory diseases, certain lymphoid cancers and various immunological disorders.' However, current therapy is limited by debilitating slde effects associated with long term use of glucocorticoids. Side effects include, but are not limited to, hyperglycemia and the resultant diabetes mellitus, osteoporosis, cataracts, fragile skin, weight gain and psychosis.
These effects result from the action of glucocorticoid receptor on groups of promoters in specific tissues. In many cases, such as osteoporosis, diabetes and psychosis, the side effects are unrelated to!the anti-inflammatory or anti-proliferative effects. ~Finding GR
agonists capable of distinguishing between tissues and/or promoters could limit the effects of the GR
agonists to the beneficial anti-inflammatory and anti-proliferative effects.
CA 02222~62 1997-11-27 W O 96/41013 PCTrUS96/Og~38 We have developed assays to detect and distinguish GR agonists that operate through a speci~ic TAF region in certain cellular environments. These assays use cells including a reporter construct containing multimerized glucocorticoid response elements (GRE) upstream ~rom a minimal promoter driving the expression o~ the reporter gene luciferase. This reporter responds strongly to glucocorticoids in CV1 cells when these cells are transfected with wild type GR.
Receptor ex~ression vectors Figure 19 is a diagram showing the structural organization o~ GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-null. These expression vectors produce modi~ied ~orms o~ GR that selectively inactivate one or more of the transactivation domain of GR.
GR-TAF2 and GR-N-Del plasmids were derived ~rom GR-wt. GR was modi~ied to add a NotI restriction site on the 5' side o~ the DNA binding domain and an XhoI site on the 3' side of the DNA binding domain. In GR-TAF2, 20 amino acids 77-262 were excised ~rom GR-wt using BglII.
In GR-N-del, amino acids 9-385 were excised ~rom GR-wt.
The procedures were described previously by Hollenberg et al., Cell 49:39-46, 1987, incorporated by re~erence hereln .
To prepare GR-TAF1 plasmid, the TAF2 domain was mutated using a site-directed mutagenesis kit by Clonetech. Amino acid residues 751, 755, 758, and 751+755, 751+758, 755+758 were changed to alanines using the ~ollowing mutagenesis primers:
30 751: 5'GCT AAC ATC GCG GGG AAT TC3' 755: 5'GAT GAT TGC AGC AGC TAA CAT C3' 758: 5'CTG ATT GGC GAT GAT TTC AGC3' 751+755: 5'GAT GAT TGC AGC TAA CAT CGC GGG GAA TTC3' 751+758: 5'CTG ATT GGC GAT GAT TTC AGC TAA CAT CGC GGG
GAA TTC3' 755+758: 5'CTG ATT GGC GAT GAT TGC AGC TAA C3' CA 02222~62 1997-11-27 WO 96/41013 I PCTrUS96/09638 The GR-Null plasmid serves as a negative control that lacks both TAFl and TAF2 translactivation activity. It is constructed ~rom GR-TAFl ~rom which the TAFl domain was excised by BglII.
To prepare the GR-Gal4 plasmids, the Gal4 DNA
binding domain was excised ~rom pBSGalG with KpnI and SalI. The Gal4 DNA binding domain ~ragment was then inserted into each o~ the TAF mutants ~rom which the N-terminus and the DNA binding domain of GR have been removed with KpnI and XhoI (see Figure 20).
Reporter plasmids The reporter plasmids contain either the Murine M~m~y Tumor Virus (MMTV-luc) promoter, Complement 3 gene promoter (C3-luc) or TAT3 promoter (i.e., a synthetic promoter consisting o~ 3 repeats o~ a Glucocorticoid Response Element (GRE) derived ~rom the Tyrosine Amino Transferase gene ~used to the alcohol dehydrogenase TATA box).
Cell culture CVl, Cos-l, CHO, 293, HepG2, HeLa and HIG82 cells were maintained in Dulbecco's modi~ied Eagle's medium (DMEM) supplemented with 10~ ~etal bovine scrum (FBS).
MCF7 were maintained in Iscove's modi~ied Eagle's medium (IMEM) supplemented with 10~ FBS.
Transient transfection assay Transient trans~ection assays were per~ormed essentially as described ~or ER except that the cells were incubated with or without hormone ~or 24 hours.
Dexamethasone bindinq competition assaY
GR proteins were expressed in reticulocyte lysates using a transcription/translation kit ~rom Promega.
Aliquots o~ reticulocyte lysates in binding bu~er are incubated with 4-7nM (3H)-dexamethasone andlvarying CA 02222~62 1997-11-27 concentrations o~ unlabelled competing ligand at concentrations ranging ~rom 0 to 10-5 M. Incubations were carried out at 4 ~C ~or 16 hours. At the end o~ the incubation period, GR-bound ligand was absorbed onto hydroxylapatite, pelleted and counted in liquid scintillation cocktail.
The e~fect o~ the TAF2 mutations on transactivation was tested by co-trans~ection (see Figure 21). CV1, Cos-1 (green monkey kidney cells), CHO (Chinese Hamster cells), HeLa (human cervical carcinoma cells), HepG2 (human Hepatocarcinoma cells), MCF7 (human Breast adenocarcinoma cells), HIG82 (rabbit synoviocytes) and 293 (human Embryonal kidney cells) were co-trans~ected with the Gal4-TAF2 mutants and a reporter plasmid containing Gal4 DNA binding sites ~used to luci~erase gene. The ability o~ the TAF2 domain to activate the luci~erase gene was detected by measuring chemiluminescence. The data in Figure 21 shows that the mutations in TAF2 inactivated the transactivation activity o~ TAF2. Similar assays may be conducted to analyze the e~ects o~ mutations to other transactivation domains in the GR.
GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-Null were cotrans~ected into CV1 cells with a reporter gene under the regulation o~ a TAT3 promoter. Dexamethasone was then added to the CV1 cells and the expression level o~
the reporter gene measured. GR mutants are expressed in CV1 cells. The GR mutations selectively eliminate each transactivation domain but do not signi~icantly change hormone binding. GR-TAF1, GR-N-del and GR-TAF2 have transactivation activity. However, the GR-null receptor has no activation capability, indicating that together the TAF1 and TAF2 mutations eliminate all the transactivation potential ~rom GR.
Figure 22 shows that despite TAF2 transactivation activity was inactivated in GR-TAF1 plasmid, GR-TAF1 CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 still exhibited transactivation activity in CV1 cells on TAT3 promoter. Therefore, CV1 cells, GR-TAF1 plasmid and TAT3 promoter constitute an assay for an'agonist or antagonist which acts through the TAF1 region of GR.
Figure 22 also shows that despite TAF1 transactivation activity was inactivated in GR-TAF2 and GR-N-del plasmids by deletion mutations, GR-TAF2 and GR-N-del still exhibited transactivation activity in CV1 cells on TAT3 promoter. Therefore, GR-TAF2 or GR-N-del plasmid, CV1 cells and TAT3 promoter constitute an assay for an agonist or antagonist which acts through the TAF2 region of GR.
The assay we have established for the de_ection of TAF selective GR agonists or antagonists can utilize any cell line in which either TAF1 or TAF2 is active. The approach described here makes use o~ the CVl'cell line and mutants of hGR in which either TAF1 or TAF2 is mutated. Each cotransfection assay contains a control ~-galactosidase expression vector for transfection efficiency and the TAT3-luciferase reporter.
Individual compounds may be screened in Ithree separate cotransfection assays, the first contains GR-wt, the second contains the GR-TAF1, and the~third contains the GR-TAF2 or GR-N-del. Compounds that are active in the wild type assay will be compared in the two mutant assays. All classes of agonists and antagonists may be screened.
Compounds with uni~ue profiles relative to TAFl or TAF2 identified by the above described assays will generate differences in the tissue or promoter selectivity of the receptor, allowing the determination of which TAF region is associated with the side effects and which is associated with the anti-proliferative or anti-inflammatory activity. The compounds identified by the above described assays may be put to therapeutical uses. For example, if TAF2 is crucial for GR activity in bone cells, then one may selectively eliminate side CA 02222~62 1997-11-27 effects of GR in osteoclasts and osteoblasts by administering a TAF1 selective agonist screened by the claimed assay to prevent TAF2 activity and reduce the osteoporosis associated with glucocorticoid therapy.
V. Pharmaceutical Compositions The present invention also encompasses pharmaceu-tical compositions prepared for storage and subsequent administration, which have a pharmaceutically effective amount of the products disclosed above in a pharmaceutically acceptable carrier or diluent.
Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Reminqton's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985).
Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. For example, sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid may be added as preservatives. Id. at 1449. In addition, antioxidants and suspending agents may be used. Id.
The compositions of the present invention may be formulated and used as tablets, capsules or elixirs for oral administration; suppositories for rectal administration; sterile solutions, suspensions for injectable administrationi and the like. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Suitable excipients are, for example, water, saline, dextrose, mannitol, lactose, lecithin, albumin, sodium glutamate, cysteine hydrochloride, and the like. In addition, if desired, the injectable pharmaceutical compositions may contain minor amounts of nontoxic auxiliary substances, such as wetting agents, pH buffering agents, and the like. If desired, CA 02222~62 1997-11-27 WO 96/41013 PCTrUS96/09638 absorption enhancing preparations (e q., lip'osomes) may be utilized.
The pharmaceutically e~ective amount o~ the composition required as a dose will depend cn the route o~ administration, the type o~ animal being treated, and the physical characteristics o~ the speci~ia animal under consideration. The dose can be tailored to achieve optimal e~icacy but will depend on such ~actors as weight, diet, concurrent medication and other ~actors which those skilled in the medical arts will recognize.
In practicing the methods of the invention, the products or compositions can be used alone or in combination with one another, or in combination with other therapeutic or diagnostic agents. These products can be utilized ln vivo, ordinarily in a m~mm~l, pre~erably in a human, or in vitro. In emp~oying them ln vivo, the products or compositions can be administered to the m~mm~ 1 in a variety o~ ways, including parenterally, intravenously, ~ubcutaneously, intramuscularly, colonically, rectally, nasally or intraperitoneally, employing a variety o~ dosage ~orms.
As will be readily apparent to one skilled in the art, the useful in vlvo dosage to be administered and the particular mode o~ administration will vary depending upon the age, weight and m~mm~l ian species treated, the particular compounds employed,land the speci~ic use ~or which these compounds are employed.
The determination o~ ef~ective dosage levels, that is the dosage levels necessary to achieve the desired result, will be within the ambit o~ one skilled in the art. Typically, human clinical applications o~ products are commenced at lower dosage levels, with'dosage level being increased until the desired e~ect is achieved.
In non-human ~n;m~l studies, application~ G~ products are commenced at higher dosage levels, witk dosage being decreased until the desired e~ect is no longer achieved or adverse side e~ects disappear.
CA 02222~62 1997-11-27 The dosage for the products of the present invention can range broadly depending upon the desired affects and the therapeutic indication. Typically, dosages may be 7 between about 10 ~g/kg and 100 mg/kg body weight, 5 preferably between about 100 ~g/kg and 10 mg/kg body weight. ~m; n; stration is preferably oral on a daily basis.
The exact formulation, route of administration and dosage can be chosen by the individual physician in view 10 of the patient's condition. (See e.q. Fingl et al., in The Pharmacoloqical Basis of Thera~eutics, 1975, Ch. 1 p. 1). It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity, or to organ dys-functions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxi-city). The magnitude of an administrated dose in the management of the disorder of interest will vary with the severity o~ the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency, will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may be used in veterinary medicine.
Depending on the specific conditions being treated, such agents may be formulated and administered systemically or locally. Techniques ~or formulation and administration may be found in Reminqton's Pharmaceu-tical Sciences, 18th ed., Mack Publishing Co., Easton, PA (1990). Suitable routes may include oral, rectal, transdermal, vaginal, transmucosal, or intestinal admin-istration; parenteral delivery, including intramuscular,subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, CA 02222~62 1997-11-27 WO 96/41013 , PCTrUS96/09~38 intraperitoneal, intranasal, or intraocular injections, just to name a ~ew.
For injection, the agents o~ the invention may be formulated in aqueous solutions, pre~erably in physio-logically compatible bu~fers such as Hanks'r, solution,Ringer's solution, or physiological saline bu~fer. For such transmucosal administration, penetrant~ appropriate to the barrier to be permeated are used in the ~ormula-tion. Such penetrants are generally known ln the art.
Use of pharmaceutically acceptable carriers to ~ormulate the compounds herein disclosed ~or the prac-tice o~ the invention into dosages suitable for systemic administration is within the scope of the i~vention.
With proper choice o~ carrier and suitable manu~acturing practice, the compositions o~ the present invention, in particular, those formulated as solutions, may be admin-istered parenterally, such as by intravenous injection.
The compounds can be ~ormulated readily uslng pharmaceu-tically acceptable carriers well known in the art into dosages suitable for oral administration. Such carriers enable the compounds o~ the invention to be ~ormulated as tablets, pills, capsules, liquids, gels syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
Agents intended to be administered intracellularly may be administered using techniques well known to those o~ ordinary skill in the art. For example, such agents may be encapsulated into liposomes, then ~m; n; stered as described above. Liposomes are spherical lipid bilayers with aqueous interiors. A11 molecules present in an aqueous solution at the time of liposome ~ormation are incorporated into the aqueous interior. The liposomal contents are both protected ~rom the external microenvi-ronment and, because liposomes fuse with cell membranes, are e~ficiently delivered into the cell cytoplasm.
Additionally, due to their hydrophobicity, small organic molecules may be directly administered in_racellularly.
CA 02222~62 1997-11-27 W O 96t41013 PCTAUS96/09638 Pharmaceutical compositions suitable ~or use in the present invention include compositions wherein the active ingredients are contained in an e~ective amount to achieve its intended purpose. Determination o~ the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which ~acilitate processing of the active compounds into preparations which can be used pharmaceutically. The preparations ~ormulated for oral administration may be in the form o~
tablets, dragees, capsules, or solutions. The pharmaceutical compositions of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levitating, emulsi~ying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical formulations for parenteral administration include aqueous solutions o~ the active compounds in water-soluble ~orm. Additionally, suspen-sions o~ the active compounds may be prepared as appro-priate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic ~atty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injec-tion suspensions may contain substances which increase the viscosity o~ the suspension, such as sodium carboxy-methyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility o~ the compounds to - allow ~or the preparation o~ highly concentrated solutions.
Pharmaceutical preparations ~or oral use can be obtained by combining the active compounds with solid excipient, optionally grinding a resulting mixture, and CA 02222~62 1997-11-27 WO 96/41013 PCT~US96/09638 processing the mixture of granules, a~ter adding suit-able auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose,lsucrose, mannitol, or sorbitoli cellulose preparatiohs such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellu-lose, hydroxypropylmethyl-cellulose, sodium carboxy-methylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings.
For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dye-stuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and G plasticizer, such as glycerol or=sorbitol. The push-fit capsules can contain the active ingredients in admixture with ~iller such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In so~t capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraff-n, or liquid polyethylene glycols. In addition, stabil_zers may be added.
All publications referenced are incorpprated by reference herein, including the nucleic acid sequences and amino acid sequences listed in each publication.
CA 02222~62 1997-11-27 W O 96/41013 PCT~US96/09638 All the compounds disclosed and re~erred to in the publications mentioned above are incorporated by re~erence herein, including those compounds disclosed and re~erred to in articles cited by the publications mentioned above.
Other embodiments o~ this invention are disclosed in the ~ollowing claims.
PCTnJS96/09638 EX Vivo Formatlon of Osteoclasts l RAP(t)MNC
(~,6 ~ontrol) Sh~m C)YX OVX OVX
+~BE2 +Ke~xlfen Exp~ 00 147.8~ 84,3c gg3c EXpt.2 100 ~4.0b 11~ 4C 78~2a ~Sign~Kant~different from sham. pc0.02.
bSignifi~n~differentfirom~h~m,p<O.~.
C~osigni(i~n~d~ere~etr~m~m.
i Table 1 Bone marrow from sham (control), OVX
(ovariectomized rats), OVX plus estrogen, and OVX plus keoxifene treated rats were evaluated for osteoclastic potential in the coculture assay. Bone marrow was combined with primary osteoblasts in the presence o~
1,25-dihydroxyvitamin D3 and parathyroid hcrmone for 8 days and scored for the number of tartrate acid phosphatase resistant multinucleated cells (TRAP + MNC).
The number of TRAP + MNC in the sham operatled animals was set at 100~.
CA 02222~62 1997-11-27 W O96/41013 PCTrUS96/09638 List of Candidate Com~ounds ~ CANDIDATE COMPOUNDS REFERENCES
1) Compounds Modulating *p.1213 ff, and Glucocorticoids references therein WO/92tl6546, WO92/16658, US 4,981,787 . US 5,071,773 R. Evans, Science 240:889-895 (1988) 2) Estrogens-agonists & antagonists *p. 1193 ff and references therein 3) Androgens-agonists & antagonists *p. 1208 ff, and references therein US 4,144,270 US 3,847,988 US 3,995,060 4) Progestins-agonists & antagonists *p. 1200 ff, and references therein Non-steroid progestins PCT/US93/03909 5) Mineralocorticoids-agonists & *p. 1213 ff, and antagonists references therein 6) Nonsteroidal anti-inflammatory **
drugs *Intracellular receptor general reference Comprehensive Medicinal Chemistry "The Rational Design, Mechanistic Study and Therapeutic Applications of Chemical Compounds," C.
Hamsch, P.G. Sammes, John B. Taylor and John C. Emmett Vol. 3-Membrane and Receptors, Pregammon Press, Oxford, Ch. 16.3 Steroid Hormone Receptors pp. 1176-1226.
**Negrel et al., Biochem. J 257:399-405 (1989)
Claims (21)
1. Method for identifying a receptor agonist or antagonist, comprising the steps of:
(A) providing a cell comprising a first nucleic acid encoding an intracellular receptor and a second nucleic acid encoding a reporter gene operatively linked to a promoter, wherein said intracellular receptor comprises a first TAF region and a second TAF region, said first TAF region is able to activate transcription from said promoter, said second TAF region is not able to activate transcription from said promoter but retains the functional context of said second TAF region, and said reporter gene is transcribed when said promoter is activated by said first TAF region;
furthermore, said cell is unable to exhibit transcription from said promoter in the presence of a receptor containing said second TAF region alone but able to exhibit transcription from said promoter in the presence of a receptor containing said first TAF region;
(B) contacting said cell with an agent under conditions in which contact of said cell with a known agonist or antagonist of said intracellular receptor increases or decreases the transcription of said reporter gene from said promoter, respectively; and (C) measuring the level of increase or decrease of the expression product of said reporter gene as an indication of the agonist or antagonist activity of said agent.
(A) providing a cell comprising a first nucleic acid encoding an intracellular receptor and a second nucleic acid encoding a reporter gene operatively linked to a promoter, wherein said intracellular receptor comprises a first TAF region and a second TAF region, said first TAF region is able to activate transcription from said promoter, said second TAF region is not able to activate transcription from said promoter but retains the functional context of said second TAF region, and said reporter gene is transcribed when said promoter is activated by said first TAF region;
furthermore, said cell is unable to exhibit transcription from said promoter in the presence of a receptor containing said second TAF region alone but able to exhibit transcription from said promoter in the presence of a receptor containing said first TAF region;
(B) contacting said cell with an agent under conditions in which contact of said cell with a known agonist or antagonist of said intracellular receptor increases or decreases the transcription of said reporter gene from said promoter, respectively; and (C) measuring the level of increase or decrease of the expression product of said reporter gene as an indication of the agonist or antagonist activity of said agent.
2. The method of claim 1, wherein said second TAF
region is mutated.
region is mutated.
3. The method of claim 1, wherein said receptor is selected from the group consisting of ER, GR, AR, PR, MR, RAR, RXR and PPAR.
4. The method of claim 2, wherein said first TAF
region is a TAF1 region selected from ER, GR, AR or PR, and said second TAF region is a TAF2 region selected from ER, GR, AR or PR.
region is a TAF1 region selected from ER, GR, AR or PR, and said second TAF region is a TAF2 region selected from ER, GR, AR or PR.
5. The method of claim 2, wherein said first TAF
region is a TAF2 region selected from ER, GR, AR or PR, and said second TAF region is a TAF1 region selected from ER, GR, AR or PR.
region is a TAF2 region selected from ER, GR, AR or PR, and said second TAF region is a TAF1 region selected from ER, GR, AR or PR.
6. The method of claim 1, wherein said agent is a human hormone agonist or antagonist.
7. The method of claim 1, wherein said agent is a compound other than keoxifene with a keoxifene-like transcriptional profile.
8. The method of claim 1, wherein said cell is selected from the group consisting of HepG2, MCF-10, CV1 and HeLa.
9. The method of claim 1, wherein said cell is a liver cell.
10. The method of claim 1, wherein said promoter is selected from the group consisting of C3, MMTV, TAT and C'9.
11. The method of claim 1, wherein said promoter is a C3 promoter.
12. Method for identifying a receptor agonist, comprising the steps of:
(A) providing a cell comprising (i) a first nucleic acid encoding an intracellular receptor having a functional first TAF
region and a functional second TAF region; and (ii) a second nucleic acid encoding a reporter gene operatively linked to a promoter, which is activated in the presence of an agonist that acts through one of said TAF regions but not both;
furthermore, said cell is able to exhibit transcription from said promoter in the presence of a receptor containing both said TAF regions, but unable to exhibit transcription from said promoter in the presence of a receptor having said first TAF or said second TAF
region alone;
(B) contacting said cell with a potential agonist under conditions in which contact of said cell with a known agonist of said receptor increases transcription from said promoter and the level of the product of said reporter construct; and (C) measuring the level of increase of said product of said reporter construct as an indication of the agonist activity of said potential agonist.
(A) providing a cell comprising (i) a first nucleic acid encoding an intracellular receptor having a functional first TAF
region and a functional second TAF region; and (ii) a second nucleic acid encoding a reporter gene operatively linked to a promoter, which is activated in the presence of an agonist that acts through one of said TAF regions but not both;
furthermore, said cell is able to exhibit transcription from said promoter in the presence of a receptor containing both said TAF regions, but unable to exhibit transcription from said promoter in the presence of a receptor having said first TAF or said second TAF
region alone;
(B) contacting said cell with a potential agonist under conditions in which contact of said cell with a known agonist of said receptor increases transcription from said promoter and the level of the product of said reporter construct; and (C) measuring the level of increase of said product of said reporter construct as an indication of the agonist activity of said potential agonist.
13. The method of claim 12, wherein said cell is a liver cell, and said promotor is a C3 promotor.
14. The method of claim 12, wherein said agent is a compound other than keoxifene with a keoxifene-like transcriptional profile.
15. A method for treating a patient with an estrogen related disease comprising administering to said patient a chemical compound other than keoxifene having a keoxifene like transcriptional profile.
16. The method of claim 15, wherein said disease is osteoporosis.
17. The method of claim 15, wherein said disease is uterine cancer.
18. The method of claim 15, wherein said disease is breast cancer.
19. The method of claim 15, wherein said treating comprises administering a pharmaceutically acceptable amount of said compound to said patient.
20. The method of claim 19, wherein said administering is performed orally.
21. The method of claim 15, wherein said compound has greater potency than keoxifene.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US48243695A | 1995-06-07 | 1995-06-07 | |
US08/482,436 | 1995-06-07 |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2222562A1 true CA2222562A1 (en) | 1996-12-19 |
Family
ID=23916062
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA 2222562 Abandoned CA2222562A1 (en) | 1995-06-07 | 1996-06-06 | Method for screening for receptor agonists and antagonists |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP0832295A1 (en) |
AU (1) | AU6263996A (en) |
CA (1) | CA2222562A1 (en) |
WO (1) | WO1996041013A1 (en) |
Families Citing this family (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2780512B1 (en) * | 1998-06-25 | 2003-10-17 | Lipha | USE OF RECEIVERS OF THE REV-ERB FAMILY FOR SCREENING OF SUBSTANCES USEFUL IN THE TREATMENT OF LYSID METABOLISM DYSFUNCTIONS |
WO2000034788A1 (en) * | 1998-12-08 | 2000-06-15 | Board Of Regents, The University Of Texas System | Methods for detection of antiestrogen-resistant breast cancer |
WO2002049634A2 (en) * | 2000-12-20 | 2002-06-27 | Boehringer Ingelheim Pharma Gmbh & Co. Kg | Dissociated glucocorticoid receptor antagonists for the treatment of clucocorticoid associated side-effect |
US7026484B2 (en) | 2001-02-23 | 2006-04-11 | Ligand Pharmaceuticals Incorporated | Tricyclic androgen receptor modulator compounds and methods |
KR20030046896A (en) * | 2001-12-07 | 2003-06-18 | 학교법인 포항공과대학교 | Transformant having a recombinant reporter gene whose expression being regulated by glucocorticoid and method for screening analogue and inhibitor of glucocorticoid using same |
DE10305212A1 (en) * | 2003-02-07 | 2004-08-19 | Florian Prof. Dr.med. Lang | Use of the sgk gene family for the diagnosis and therapy of cataracts and glaucoma |
US7858044B2 (en) | 2003-04-30 | 2010-12-28 | Nexus Biosystems, Inc. | Multi-well plate providing a high-density storage and assay platform |
EP1656142A4 (en) | 2003-08-22 | 2011-06-22 | Ligand Pharm Inc | 6-cycloamino-2-quinolinone derivatives as androgen receptor modulator compounds |
DK1976509T3 (en) | 2006-01-18 | 2015-03-23 | Evolva Sa | PPAR modulators |
EP1932921A1 (en) * | 2006-12-13 | 2008-06-18 | Novartis AG | Simple mutant-based differential screening method for compounds modulating a specific target |
US20100273824A1 (en) | 2007-01-18 | 2010-10-28 | Evolva Sa | Substituted 1,3-dioxanes and their uses |
JP2010516702A (en) | 2007-01-18 | 2010-05-20 | エヴォルヴァ エスアー | Substituted 1,3-dioxane prodrugs and their use |
CN113801889B (en) * | 2021-09-18 | 2023-04-07 | 中国农业科学院农业质量标准与检测技术研究所 | Cell screening model, construction method and application thereof, saccharomycete, preparation method and application thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5071773A (en) * | 1986-10-24 | 1991-12-10 | The Salk Institute For Biological Studies | Hormone receptor-related bioassays |
CA2160135A1 (en) * | 1993-04-07 | 1994-10-13 | Donald P. Mcdonnell | Method for screening for receptor agonists |
-
1996
- 1996-06-06 AU AU62639/96A patent/AU6263996A/en not_active Abandoned
- 1996-06-06 CA CA 2222562 patent/CA2222562A1/en not_active Abandoned
- 1996-06-06 WO PCT/US1996/009638 patent/WO1996041013A1/en not_active Application Discontinuation
- 1996-06-06 EP EP96921406A patent/EP0832295A1/en not_active Withdrawn
Also Published As
Publication number | Publication date |
---|---|
WO1996041013A1 (en) | 1996-12-19 |
AU6263996A (en) | 1996-12-30 |
EP0832295A1 (en) | 1998-04-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Edwards | Regulation of signal transduction pathways by estrogen and progesterone | |
Meyer et al. | Steroid hormone receptors compete for factors that mediate their enhancer function | |
Boersma et al. | Estrogen Receptors alpha and beeta Two Receptors of a Kind | |
Porter et al. | Role of estrogen receptor/Sp1 complexes in estrogen-induced heat shock protein 27 gene expression. | |
Madauss et al. | A structural and in vitro characterization of asoprisnil: a selective progesterone receptor modulator | |
Smith et al. | Coregulator function: a key to understanding tissue specificity of selective receptor modulators | |
Nuñez et al. | Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor | |
Reese et al. | Mutagenesis of cysteines in the hormone binding domain of the human estrogen receptor. Alterations in binding and transcriptional activation by covalently and reversibly attaching ligands | |
Leonhardt et al. | Agonist and antagonists induce homodimerization and mixed ligand heterodimerization of human progesterone receptors in vivo by a mammalian two-hybrid assay | |
JP3131649B2 (en) | Orphan receptor | |
Sedlák et al. | Two panels of steroid receptor luciferase reporter cell lines for compound profiling | |
Curtis et al. | Uterine estrogen receptor interaction with estrogen-responsive DNA sequences in vitro: effects of ligand binding on receptor-DNA complexes | |
Khan et al. | An overview on Estrogen receptors signaling and its ligands in breast cancer | |
CA2222562A1 (en) | Method for screening for receptor agonists and antagonists | |
Yi et al. | Differences in the abilities of estrogen receptors to integrate activation functions are critical for subtype-specific transcriptional responses | |
Gass et al. | The antagonists RU486 and ZK98299 stimulate progesterone receptor binding to deoxyribonucleic acid in vitro and in vivo, but have distinct effects on receptor conformation | |
Yang et al. | The F-domain of estrogen receptor-alpha inhibits ligand induced receptor dimerization | |
WO2000001813A2 (en) | Peptide inhibitors of androgen-independent activation of androgen receptor | |
CA2160135A1 (en) | Method for screening for receptor agonists | |
Eng et al. | Probing the structure and function of the estrogen receptor ligand binding domain by analysis of mutants with altered transactivation characteristics | |
JP2004506430A (en) | Inhibition of SXR-mediated transactivation by the anti-neoplastic agent ET-743 | |
King | Oestrogen-receptors: an overview of recent advances in their structure and function | |
WO1997044490A1 (en) | Specific co-activator for human androgen receptor | |
Schafer et al. | Estrogen receptor α mediated induction of the transforming growth factor α gene by estradiol and 4-hydroxytamoxifen in MDA-MB-231 breast cancer cells | |
Coleman et al. | SRA coactivation of estrogen receptor-α is phosphorylation-independent, and enhances 4-hydroxytamoxifen agonist activity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FZDE | Dead |