Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
  • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
  • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2799/00—Uses of viruses
  • C12N2799/02—Uses of viruses as vector
  • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
  • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

• This invention relates to newly identified polynucleotides, polypeptide ⁇ encoded by such polynucleotides, the use of such polynucleotides and polypeptide ⁇ , as well as the production of such polynucleotides and polypeptide ⁇ .
• the polypeptide of the present invention has been putatively identified as a Tumor Necrosis Factor receptor, and more particularly as a type 2 Tumor Necrosis Factor Receptor.
• the polypeptide of the present ivention will hereinafter be referred to as "TNF receptor" .
• the invention also relates to inhibiting the receptor.
• TNF- ⁇ and ⁇ are related members of a broad class of polypeptide mediators, which includes the interferons, interleukin ⁇ and growth factors, collectively called cytokines (Beutler, B. and Cerami, A., Annu. Rev. Immunol., 7:625-655 (1989)).
• Tumor necrosis factor (TNF- ⁇ and TNF-/3) was originally discovered as a result of its anti-tumor activity, however, now it is recognized as a pleiotropic cytokine playing important roles in a host of biological processes and pathologies.
• TNF- ⁇ Tumor necrosis factor
• TNF-/3 lymphotoxin- ⁇
• LT-/3 ligands for the Fas receptor
• CD30, CD27, CD40 and 4-1BB receptors have conserved C-terminal sequences and variable N-terminal sequence ⁇ which are often used as membrane anchors, with the exception of TNF-S.
• TNF is produced by a number of cell types, including monocytes, fibroblast ⁇ , T cell ⁇ , natural killer (NK) cells and predominately by activated machrophage ⁇ .
• TNF- ⁇ ha ⁇ been reported to have a role in the rapid necrosis of tumors, immunostimulation, autoimmune disease, graft rejection, producing an anti-viral response, septic shock, cerebral malaria, cytotoxicity, protection against deleterious effects of ionizing radiation produced during a course of chemotherapy, such as denaturation of enzymes, lipid peroxidation and DNA damage (Nata et al, J. Immunol. 136(7):2483 (1987)), growth regulation, vascular endothelium effects ' and metabolic effects.
• TNF- ⁇ al ⁇ o triggers endothelial cells to secrete various factors, including PAI- 1, IL-1, GM-CSF and IL-6 to promote cell proliferation.
• TNF- ⁇ up-regulates various cell adhesion molecules such as E-Selectin, ICAM-1 and VCAM-1.
• TNF- ⁇ and the Fas ligand have also been shown to induce programmed cell death.
• lymphotoxin al ⁇ o referred to as TNF-3
• TNF-3 lymphotoxin
• TNF-3 lymphotoxin
• LT- ⁇ ha ⁇ many activitie ⁇ , including tumor necrosis, induction of an antiviral state, activation of polymorphonuclear leukocyte ⁇ , induction of cla ⁇ I major histocompatibility complex antigens on endothelial cells, induction of adhesion molecules on endothelium and growth hormone stimulation (Ruddle, N. and Homer, R. , Prog. Allergy, 40:162-182 (1988)).
• TNF-R1 The first step in the induction of the various cellular responses mediated by TNF or LT is their binding to specific cell surface or soluble receptors.
• TNF-R2 Two distinct TNF receptors of approximately 55-KDa (TNF-R1) and 75-KDa (TNF- R2) have been identified (Hohman, H.P. et al., J. Biol. Chem., 264:14927-14934 (1989)), and human and mouse cDNAs corresponding to both receptor types have been isolated and characterized (Loetscher, H. et al., Cell, 61:351 (1990)). Both TNF-R ⁇ share- the typical structure of cell surface receptors including extracellular, transmembrane and intracellular region ⁇ .
• TNF-R1 and TNF-R2 share 28% identity and are characterized by four repeated cysteine-rich motifs with significant intersubunit sequence homology.
• the majority of cell types and ti ⁇ ue ⁇ appear to expre ⁇ both TNF receptor ⁇ and both receptors are active in signal transduction, however, they are able to mediate distinct cellular responses.
• TNF-R2 was shown to exclusively mediate human T cell proliferation by TNF as shown in PCT WO 94/09137.
• TNF-R1 dependent response ⁇ include accumulation of C- FOS, IL-6, and mangane ⁇ e ⁇ uperoxide di ⁇ muta ⁇ e mRNA, pro ⁇ taglandin E2 synthe ⁇ i ⁇ , IL-2 receptor and MHC class I and II cell surface antigen expression, growth inhibition, and cytotoxicity.
• TNF-R1 also triggers second messenger systems such as phospholipase A 2 , protein kinase C, pho ⁇ phatidylcholine- ⁇ pecific phospholipa ⁇ e C and sphingomyelina ⁇ e (Pfefferk et al . , Cell, 73:457-467 (1993)).
• the receptor polypeptide of the present invention binds TNF, and in particular, TNF-jS. Further, the TNF receptor may also bind other ligands, including but not limited to Nerve Growth Factor, due to homology to a family of receptors and antigens which are involved in other critical biological processes.
• This family shows highly conserved cysteine re ⁇ idue ⁇ and include ⁇ the low affinity NGF receptor, which plays an important role in the regulation of growth and differentiation of nerve cell ⁇ , the Fas receptor also called APO, a receptor which is involved is signalling for apoptosis and which, based on a study with mice deficient in its function, seems to play an important role in the etiology of a lupus-like disease, the TNF-R1, the B cell antigen CD40, and the T cell activation antigen CD27.
• a novel mature polypeptide which is a putative TNF receptor, as well as fragments, analogs and derivatives thereof.
• the polypeptide of the pre ⁇ ent invention i ⁇ of human origin.
• nucleic acid molecules encoding the polypeptide of the present invention, including RNAs, DNAs, cDNAs, genomic DNA a ⁇ well as antisense analogs thereof and biologically active and diagnostically or therapeutically u ⁇ eful fragments thereof.
• a process for producing such polypeptide ⁇ by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
• a proce ⁇ for utilizing such polypeptide, or polynucleotide encoding such polypeptide to screen for receptor antagonists and/or agonists and/or receptor ligands.
• nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polypeptide of the present invention.
• a process of using such agonists for treating conditions related to insufficient TNF receptor activity for example, to inhibit tumor growth, to stimulate human cellular proliferation, e.g., T-cell proliferation, to regulate the immune response and antiviral responses, to protect against the effects of ionizing radiation, to protect against chlamidiae infection, to regulate growth and to treat immunodeficiencies such as i ⁇ found in HIV.
• a process of using such antagonists for treating conditions a ⁇ ociated with over- expression of the TNF receptor for example, for treating T- cell mediated autoimmune diseases such as AIDS, septic shock, cerebral malaria, graft rejection, cytotoxicity, cachexia, apoptosis and inflammation.
• T- cell mediated autoimmune diseases such as AIDS, septic shock, cerebral malaria, graft rejection, cytotoxicity, cachexia, apoptosis and inflammation.
• Figure 1 ⁇ how ⁇ the cDNA ⁇ equence and corre ⁇ ponding deduced amino acid ⁇ equence of the polypeptide of the pre ⁇ ent invention.
• the initial 21 amino acids represent the putative leader ⁇ equence and are underlined.
• the ⁇ tandard one-letter abbreviations for amino acids are used.
• Sequencing was performed u ⁇ ing a 373 automated DNA ⁇ equencer (Applied Biosystems, Inc.). Sequencing accuracy is predicted to be greater than 97% accurate.
• Figure 2 illustrates an amino acid sequence alignment of the polypeptide of the present invention (upper line) and the human type 2 TNF receptor (lower line).
• gene or "cistron” means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequence ⁇ (introns) between individual coding segments (exons) .
• an i ⁇ olated nucleic acid (polynucleotide) which encode ⁇ for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75899 on September 28, 1994.
• a polynucleotide encoding a polypeptide of the present invention may be obtained from human pulmonary tissue, hippocampus and adult heart.
• the polynucleotide of this invention was discovered in a cDNA library derived from human early passage fibroblasts (HSA 172 cell ⁇ ). It i ⁇ structurally related to the human TNF-R2 receptor. It contains an open reading frame encoding a protein of 390 amino acid residues of which approximately the first 21 amino acids residues are the putative leader ⁇ equence such that the mature protein comprises 369 amino acid ⁇ .
• the protein exhibits the highest degree of homology to a human type 2 TNF receptor with 39% identity and 46% similarity over an 88 amino acid stretch.
• Six conserved cyteine ⁇ present in modules of 40 residues in all TNF receptors are con ⁇ erved in this receptor.
• the TNF receptor of the present invention is a ⁇ oluble receptor and i ⁇ secreted, however, it may also exist as a membrane bound receptor having a transmembrane region and an intra- and extracellular region.
• the polypeptide of the pre ⁇ ent invention may bind TNF and lymphotoxin ligand ⁇ .
• a polynucleotide which may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
• the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
• the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID No. 1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
• the polynucleotide which encode ⁇ for the mature polypeptide of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the depo ⁇ ited cDNA may include: only the coding ⁇ equence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence ⁇ uch as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding ⁇ equence) and non-coding ⁇ equence, such as introns or non-coding sequence 5' and/or 3' of the coding ⁇ equence for the mature polypeptide.
• polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well a ⁇ a polynucleotide which include ⁇ additional coding and/or non-coding sequence.
• the present invention further relates to variants of the hereinabove de ⁇ cribed polynucleotide ⁇ which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
• the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
• the pre ⁇ ent invention include ⁇ polynucleotide ⁇ encoding the same mature polypeptide a ⁇ ⁇ hown in Figure 1 (SEQ ID No. 2) or the same mature polypeptide encoded by the cDNA of the deposited clone a ⁇ well a ⁇ variant ⁇ of such polynucleotide ⁇ which variant ⁇ encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
• nucleotide variant ⁇ include deletion variant ⁇ , substitution variants and addition or insertion variants.
• the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding ⁇ equence shown in Figure 1 (SEQ ID No. 1) or of the coding sequence of the deposited clone.
• an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotide ⁇ , which doe ⁇ not ⁇ ub ⁇ tantially alter the function of the encoded polypeptide.
• the present invention also includes polynucleotide ⁇ , wherein the coding ⁇ equence for the mature polypeptide may be fu ⁇ ed in the ⁇ ame reading frame to a polynucleotide sequence which aids in expres ⁇ ion and ⁇ ecretion of a polypeptide from a ho ⁇ t cell, for example, a leader ⁇ equence which function ⁇ a ⁇ a ⁇ ecretory ⁇ equence for controlling tran ⁇ port of a polypeptide from the cell.
• the polypeptide having a leader sequence i ⁇ a preprotein may have the leader sequence cleaved by the ho ⁇ t cell to form the mature form of the polypeptide.
• the polynucleotide ⁇ may al ⁇ o encode for a proprotein which i ⁇ the mature protein plus additional 5' amino acid residue ⁇ .
• a mature protein having a pro ⁇ equence is a proprotein and is an inactive form of the protein. Once the prosequence i ⁇ cleaved an active mature protein remains. Thu ⁇ , for example, the polynucleotide of the pre ⁇ ent invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
• the polynucleotide ⁇ of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the pre ⁇ ent invention.
• the marker sequence may be a hexa- hi ⁇ tidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial ho ⁇ t, or, for example, the marker ⁇ equence may be a hemagglutinin (HA) tag when a mammalian ho ⁇ t, e.g. COS-7 cell ⁇ , i ⁇ u ⁇ ed.
• HA hemagglutinin
• the HA tag corre ⁇ ponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al.. Cell, 37:767 (1984)).
• the coding sequence may also be fused to a sequence which codes for a fu ⁇ ion protein ⁇ uch a ⁇ an IgG Fc fu ⁇ ion protein.
• the pre ⁇ ent invention further relate ⁇ to polynucleotides which hybridize to the hereinabove-described sequence ⁇ if there i ⁇ at lea ⁇ t 50% and preferably 70% identity between the ⁇ equences.
• the present invention particularly relate ⁇ to polynucleotide ⁇ which hybridize under ⁇ tringent condition ⁇ to the hereinabove-de ⁇ cribed polynucleotide ⁇ .
• stringent conditions means hybridization will occur only if there i ⁇ at lea ⁇ t 95% and preferably at lea ⁇ t 97% identity between the ⁇ equences.
• polypeptide ⁇ which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptide ⁇ which retain ⁇ ub ⁇ tantially the ⁇ a e biological function or activity a ⁇ the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
• the deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organi ⁇ m ⁇ for purposes of Patent Procedure. These deposits are provided merely a ⁇ convenience to tho ⁇ e of ⁇ kill in the art and are not an admission that a deposit i ⁇ required under 35 U.S.C. ⁇ 112.
• the ⁇ equence of the polynucleotide ⁇ contained in the depo ⁇ ited materials, as well as the amino acid sequence of the polypeptide ⁇ encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any de ⁇ cription of sequences herein.
• a license may be required to make, use or sell the deposited materials, and no such license i ⁇ hereby granted.
• the present invention further relates to a polypeptide which ha ⁇ the deduced amino acid ⁇ equence of Figure 1 (SEQ ID No. 2) or which ha ⁇ the amino acid ⁇ equence encoded by the depo ⁇ ited cDNA, a ⁇ well a ⁇ fragment ⁇ , analogs and derivatives of such polypeptide.
• the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
• the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the depo ⁇ ited cDNA may be (i) one in which one or more of the amino acid residues are ⁇ ub ⁇ tituted with a con ⁇ erved or non-conserved amino acid residue (preferably a con ⁇ erved amino acid re ⁇ idue) and ⁇ uch ⁇ ub ⁇ tituted amino acid re ⁇ idue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such a ⁇ a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IbG Fc fusion region peptide or leader or secretory sequence or a sequence which is
• polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
• isolated means that the material i ⁇ removed from its original environment (e.g., the natural environment if it is naturally occurring) .
• a naturally- occurring polynucleotide or polypeptide present in a living animal is not i ⁇ olated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, i ⁇ isolated.
• Such polynucleotide ⁇ could be part of a vector and/or ⁇ uch polynucleotide ⁇ or polypeptides could be part of a composition, and ⁇ till be i ⁇ olated in that ⁇ uch vector or compo ⁇ ition i ⁇ not part of it ⁇ natural environment.
• the present invention al ⁇ o relate ⁇ to vector ⁇ which include polynucleotide ⁇ of the pre ⁇ ent invention, ho ⁇ t cell ⁇ which are genetically engineered with vector ⁇ of the invention and the production of polypeptide ⁇ of the invention by recombinant techniques.
• Ho ⁇ t cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expre ⁇ ion vector.
• the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
• the engineered host cells can be cultured in conventional nutrient media modified a ⁇ appropriate for activating promoter ⁇ , selecting transformant ⁇ or amplifying the nucleic acid sequences of the present invention.
• the culture conditions, ⁇ uch a ⁇ temperature, pH and the like, are tho ⁇ e previou ⁇ ly u ⁇ ed with the ho ⁇ t cell selected for expression, and will be apparent to the ordinarily skilled artisan.
• the polynucleotide ⁇ of the pre ⁇ ent invention may be employed for producing polypeptide ⁇ by recombinant technique ⁇ .
• the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
• Such vectors include chromosomal, nonchromosomal and ⁇ ynthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vector ⁇ derived from combinations of plasmid ⁇ and phage DNA, viral DNA such a ⁇ vaccinia, adenovirus, fowl pox virus, and pseudorabie ⁇ .
• any other vector may be u ⁇ ed a ⁇ long a ⁇ it i ⁇ replicable and viable in the ho ⁇ t.
• the appropriate DNA ⁇ equence may be in ⁇ erted into the vector by a variety of procedure ⁇ .
• procedure ⁇ the DNA sequence i ⁇ inserted into an appropriate restriction endonuclease ⁇ ite( ⁇ ) by procedure ⁇ known in the art.
• procedure ⁇ and other ⁇ are deemed to be within the ⁇ cope of those skilled in the art.
• the DNA sequence in the expres ⁇ ion vector i ⁇ operatively linked to an appropriate expre ⁇ ion control sequence(s) (promoter) to direct mRNA ⁇ ynthesi ⁇ .
• promoters there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P L promoter and other promoter ⁇ known to control expres ⁇ ion of genes in prokaryotic or eukaryotic cells or their viru ⁇ e ⁇ .
• the expres ⁇ ion vector al ⁇ o contain ⁇ a ribo ⁇ ome binding ⁇ ite for tran ⁇ lation initiation and a transcription terminator.
• the vector may al ⁇ o include appropriate sequences for amplifying expres ⁇ ion.
• the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resi ⁇ tance for eukaryotic cell culture, or such a ⁇ tetracycline or ampicillin resistance in E. coli.
• the vector containing the appropriate DNA sequence a ⁇ hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate ho ⁇ t to permit the ho ⁇ t to expre ⁇ s the protein.
• bacterial cell ⁇ ⁇ uch a ⁇ E. coli. Streptomyce ⁇ . Salmonella typhimurium; fungal cell ⁇ , ⁇ uch a ⁇ yeast; insect cells ⁇ uch a ⁇ Drosophila S2 and Spodoptera Sf9; animal cell ⁇ such as CHO, COS or Bowes melanoma; adenoviru ⁇ e ⁇ ; plant cells, etc.
• bacterial cell ⁇ ⁇ uch a ⁇ E. coli. Streptomyce ⁇ . Salmonella typhimurium
• fungal cell ⁇ ⁇ uch a ⁇ yeast
• insect cells ⁇ uch a ⁇ Drosophila S2 and Spodoptera Sf9
• animal cell ⁇ such as CHO, COS or Bowes melanoma
• adenoviru ⁇ e ⁇ plant cells, etc.
• the present invention al ⁇ o include ⁇ recombinant constructs comprising one or more of the sequences as broadly described above.
• the construct ⁇ compri ⁇ e a vector, ⁇ uch a ⁇ a plasmid or viral vector, into which a ⁇ equence of the invention has been inserted, in a forward or reverse orientation.
• the con ⁇ truct further compri ⁇ e ⁇ regulatory sequences, including, for example, a promoter, operably linked to the sequence.
• suitable vector ⁇ and promoter ⁇ are known to those of ⁇ kill in the art, and are commercially available. The following vectors are provided by way of example.
• Bacterial pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, p ⁇ iX174, pblue ⁇ cript SK, pb ⁇ k ⁇ , pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia).
• Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
• Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
• Two appropriate vectors are pKK232-8 and pCM7.
• Particular named bacterial promoter ⁇ include lad, lacZ, T3, T7, gpt, lambda P R P L and trp.
• Eukaryotic promoter ⁇ include CMV immediate early, HSV thymidine kinase, early and late SV40, LTR ⁇ from retroviru ⁇ , and mouse metallothionein-I. Selection of the appropriate vector and promoter i ⁇ well within the level of ordinary ⁇ kill in the art.
• the pre ⁇ ent invention relate ⁇ to ho ⁇ t cell ⁇ containing the above-de ⁇ cribed con ⁇ truct ⁇ .
• the ho ⁇ t cell can be a higher eukaryotic cell, ⁇ uch a ⁇ a mammalian cell, or a lower eukaryotic cell, ⁇ uch a ⁇ a yea ⁇ t cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
• Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran-mediated transfection, or electroporation (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)) .
• the construct ⁇ in ho ⁇ t cell ⁇ can be u ⁇ ed in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
• the polypeptide ⁇ of the invention can be ⁇ ynthetically produced by conventional peptide synthesizers.
• Mature proteins can be expre ⁇ ed in mammalian cell ⁇ , yea ⁇ t, bacteria, or other cell ⁇ under the control of appropriate promoter ⁇ .
• Cell-free tran ⁇ lation ⁇ ystem ⁇ can also be employed to produce such proteins using RNAs derived from the DNA con ⁇ truct ⁇ of the pre ⁇ ent invention.
• Appropriate cloning and expre ⁇ ion vector ⁇ for u ⁇ e with prokaryotic and eukaryotic ho ⁇ t ⁇ are de ⁇ cribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
• Enhancers are cis-acting element ⁇ of DNA, u ⁇ ually about from 10 to 300 bp that act on a promoter to increase its tran ⁇ cription.
• Example ⁇ including the SV40 enhancer on the late ⁇ ide of the replication origin bp 100 to 270, a cyto episcopoviru ⁇ early promoter enhancer, the polyoma enhancer on the late ⁇ ide of the replication origin, and adenoviru ⁇ enhancer ⁇ .
• the heterologous structural sequence is as ⁇ embled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
• the heterologous ⁇ equence can encode a fu ⁇ ion protein including an N-terminal identification peptide imparting desired characteristic ⁇ , e.g., ⁇ tabilization or simplified purification of expres ⁇ ed recombinant product.
• U ⁇ eful expression vector ⁇ for bacterial use are constructed by inserting a structural DNA sequence encoding a de ⁇ ired protein together with ⁇ uitable tran ⁇ lation initiation and termination ⁇ ignal ⁇ in operable reading pha ⁇ e with a functional promoter.
• the vector will compri ⁇ e one or more phenotypic ⁇ electable marker ⁇ and an origin of replication to ensure maintenance of the vector " and to, if desirable, provide amplification within the host.
• Suitable prokaryotic ho ⁇ t ⁇ for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various ⁇ pecie ⁇ within the genera Pseudomonas, Streptomyce ⁇ , and Staphylococcu ⁇ , although other ⁇ may al ⁇ o be employed a ⁇ a matter of choice.
• u ⁇ eful expre ⁇ sion vectors for bacterial u ⁇ e can compri ⁇ e a ⁇ electable marker and bacterial origin of replication derived from commercially available pla ⁇ mid ⁇ compri ⁇ ing genetic element ⁇ of the well known cloning vector pBR322 (ATCC 37017).
• Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemical ⁇ , Upp ⁇ ala, Sweden) and GEM1 (Promega Biotec, Madi ⁇ on, WI, USA).
• the ⁇ e pBR322 "backbone" ⁇ ection ⁇ are combined with an appropriate promoter and the structural sequence to be expressed.
• the ⁇ elected promoter i ⁇ induced by appropriate mean ⁇ e.g., temperature ⁇ hift or chemical induction
• cell ⁇ are cultured for an additional period.
• Cell ⁇ are typically harvested by centrifugation, disrupted by phy ⁇ ical or chemical mean ⁇ , and the resulting crude extract retained for further purification.
• Microbial cell ⁇ employed in expre ⁇ ion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or u ⁇ e of cell ly ⁇ ing agent ⁇ , ⁇ uch method ⁇ are well know to tho ⁇ e skilled in the art.
• mammalian cell culture systems can also be employed to expres ⁇ recombinant protein.
• mammalian expre ⁇ sion systems include the COS-7 lines of monkey kidney fibroblast ⁇ , de ⁇ cribed by Gluzman, Cell, 23:175 (1981), and other cell line ⁇ capable of expre ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell line ⁇ .
• Mammalian expre ⁇ ion vector ⁇ will compri ⁇ e an origin of replication, a suitable promoter and enhancer, and also any neces ⁇ ary ribo ⁇ ome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed ⁇ equence ⁇ .
• DNA ⁇ equence ⁇ derived from the SV40 ⁇ plice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
• polypeptide of the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, a ⁇ nece ⁇ ary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification ⁇ tep ⁇ . *
• polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic ho ⁇ t (for example, by bacterial, yeast, higher plant, in ⁇ ect and mammalian cell ⁇ in culture).
• a prokaryotic or eukaryotic ho ⁇ t for example, by bacterial, yeast, higher plant, in ⁇ ect and mammalian cell ⁇ in culture.
• the polypeptides of the pre ⁇ ent invention may be glyco ⁇ ylated or may be non-glyco ⁇ ylated.
• Polypeptide ⁇ of the invention may al ⁇ o include an initial methionine amino acid re ⁇ idue.
• the TNF receptor of the present invention was assayed for the ability to bind TNF- ⁇ and TNF-3, however, the pre ⁇ ent invention al ⁇ o contemplates the ability of the receptor to bind other TNF-like proteins.
• Monoclonal antibodies specific to TNF- ⁇ and TNF-3 were prepared. These monoclonal antibodies were bound to TNF- ⁇ and TNF-3 and a control ELISA assay was performed to quantify the amount of monoclonal antibody present.
• the TNF receptor was then bound to TNF- ⁇ and TNF-3 in the same way in which the monoclonal antibody was bound and another ELISA assay was performed.
• the TNF receptor was found to bind to TNF - ⁇ just as strongly a ⁇ the monoclonal antibody, while it only bound TNF- ⁇ two-third ⁇ as strongly.
• Fragments of the full length polynucleotide seqeunces of the pre ⁇ ent invention may be u ⁇ ed a ⁇ a hybridization probe for a cDNA library to isolate other genes which have a high sequence similarity to the polynucleotide sequence of the present invention or similar biological activity.
• Probes of thi ⁇ type generally have at least 50 bases, although they may have a greater number of base ⁇ .
• the probe may al ⁇ o be u ⁇ ed a ⁇ marker ⁇ to identify a cDNA clone corre ⁇ ponding to a full length transcript and a genomic clone or clones that contain the complete polynucleotide sequence of the present invention including regulatory and promotor regions, exons, and intron ⁇ /
• Labeled oligonucleotide ⁇ having a ⁇ equence complementary to that of the gene of the pre ⁇ ent invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
• This invention also provides a method of screening compounds to identify compounds which interact with the polypeptide of the pre ⁇ ent invention which compri ⁇ e ⁇ contacting a mammalian cell comprising an isolated DNA molecule encoding and expres ⁇ ing a the polypeptide of the present invention with a plurality of compounds, determining those which activate or block the activation of the receptor, and thereby identifying compounds which specifically interact with, and activate or block the activation of the polypeptide of the pre ⁇ ent invention.
• This invention also contemplates the use of the polynucleotide of the present invention a ⁇ a diagnostic. For example, if a mutation i ⁇ pre ⁇ ent, conditions would result from a lack of TNF receptor activity.
• Mutated genes can be detected by comparing the sequence of the defective gene with that of a normal one. Sub ⁇ equently one can verify that a mutant gene i ⁇ a ⁇ ociated with a disease condition or the susceptibility to a disea ⁇ e condition. That i ⁇ , a mutant gene which lead ⁇ to the underexpre ⁇ sion of the TNF receptor would be a ⁇ ociated with an inability of TNF to inhibit tumor growth.
• Nucleic acids used for diagnosi ⁇ may be obtained from a patient's cell ⁇ which include, but are not limited' to, blood, urine, saliva and tissue biopsy.
• the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166.(1986)) prior to analy ⁇ i ⁇ .
• RNA or cDNA may al ⁇ o be used for the same purpose.
• PCR primer ⁇ complementary to the nucleic acid of the in ⁇ tant invention can be u ⁇ ed to identify and analyze gene mutation ⁇ .
• deletion ⁇ and insertions can be detected by a change in the size of the amplified product in comparison to the normal genotype.
• Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled TNF receptor anti ⁇ en ⁇ e DNA sequences. Perfectly matched sequence ⁇ can be di ⁇ tingui ⁇ hed from mi ⁇ matched duplexe ⁇ by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
• Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method.
• cloned DNA segments may be used a ⁇ probe ⁇ to detect specific DNA segment ⁇ .
• the sen ⁇ itivity of thi ⁇ method is greatly enhanced when combined with PCR.
• a sequencing primary used with double stranded PCR product or a single stranded template molecule generated by a modified PCR product.
• the sequence determination i ⁇ performed by conventional procedure ⁇ with radiolabeled nucleotide ⁇ or by automatic ⁇ equencing procedure ⁇ with fluore ⁇ cent tag ⁇ .
• Sequence changes at the specific locations may be revealed by nuclea ⁇ e protection a ⁇ say ⁇ , ⁇ uch a ⁇ RNa ⁇ e and SI protection or the chemical cleavage method (for example. Cotton et al . , PNAS, 85:4397-4401 (1985)).
• the present invention further relates to a diagnostic assay which detects an altered level of a soluble form of the polypeptide of the present invention where an elevated level in a sample derived from a host i ⁇ indicative of certain diseases.
• Assay ⁇ available to detect level ⁇ of ⁇ oluble receptor ⁇ are well known to tho ⁇ e of skill in the art, for example, radioimmunoassays, competitive-binding assay ⁇ .
• Western blot analy ⁇ i ⁇ , and preferably an ELISA a ⁇ ay may be employed.
• An ELISA a ⁇ ay initially comprises preparing an antibody specific to an antigen to the polypeptide of the present invention, preferably a monoclonal antibody.
• a reporter antibody i ⁇ prepared again ⁇ t the monoclonal antibody.
• a detectable reagent ⁇ uch a ⁇ radioactivity, fluore ⁇ cence or in thi ⁇ example a hor ⁇ eradish peroxidase enzyme.
• a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample.
• any free protein binding ⁇ ite ⁇ on the di ⁇ h are then covered by incubating with a non-specific protein such a ⁇ bovine serum albumen.
• a non-specific protein such as a ⁇ bovine serum albumen.
• the monoclonal antibody i ⁇ incubated in the dish during which time the monoclonal antibodies attach to any proteins of the present invention which are attached to the polystyrene di ⁇ h. All unbound monoclonal antibody is washed out with buffer.
• the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to the polypeptide of the present invention. Unattached reporter antibody is then washed out.
• Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of the protein of interest present in a given volume of patient sample when compared against a standard curve.
• a competition assay may be employed wherein antibodies specific to the polypeptides of the present invention are attached to a solid support. Labeled TNF receptor polypeptides, and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity in the 'sample.
• the soluble form of the receptor may also be employed to identify agonists and antagonists.
• a thymocyte proliferation assay may be employed to identify both ligands and potential agonists and antagonists to the polypeptide of the present invention.
• thymus cells are disaggregated from tissue and grown in culture medium.
• Incorporation of DNA prescursor ⁇ such as 3 H- thymidine or 5-bromo-2' -deoxyuridine (BrdU) is monitored as a parameter for DNA synthesis and cellular proliferation.
• Cells which have incorporated BrdU into DNA can be detected using a monoclonal antibody against BrdU and measured by an enzyme or fluorochrome-conjugated second antibody. The reaction is quantitated by fluorimetry or by spectrophotometry. Two control wells and an experimental well are set up.
• TNF-3 i ⁇ added to all wells, while ⁇ oluble receptor ⁇ of the present invention are added to the experimental well.
• a compound to be screened is added to the experimental well.
• the agoni ⁇ t ⁇ the ability of the compound to enhance thi ⁇ interaction i ⁇ quantified.
• a determination may be made whether a ligand not known to be capable of binding to the polypeptide of the pre ⁇ ent invention can bind thereto comprising contacting a mammalian cell comprising an isolated molecule encoding a polypeptide of the present invention with a ligand under conditions permitting binding of ligands known to bind thereto, detecting the presence of any bound ligand, and thereby determining whether ⁇ uch ligand ⁇ bind to a polypeptide of the pre ⁇ ent invention.
• a soluble form of the receptor may utilized in the above assay where it is secreted in to the extra-cellular medium and contacted with ligands to determine which will bind to the soluble form of the receptor.
• agoni ⁇ t and antagoni ⁇ t ⁇ creening procedures involve, providing appropriate cell ⁇ which expre ⁇ the receptor on the surface thereof.
• a polynucleotide encoding a polypeptide of the present invention i ⁇ employed to tran ⁇ fect cell ⁇ to thereby expre ⁇ the polypeptide.
• Such tran ⁇ fection may be accompli ⁇ hed by procedure ⁇ as hereinabove described.
• such assay may be employed for screening for a receptor antagonist by contacting the cells which encode the polypeptide of the present invention with both the receptor ligand and a compound to be ⁇ creened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.
• the screening may be employed for determining an agonist by contacting such cells with compound ⁇ to be ⁇ creened and determining whether ⁇ uch compound ⁇ generate a ⁇ ignal, i.e., activates the receptor.
• Other screening techniques include the use of cell ⁇ which expre ⁇ the polypeptide of the present invention (for example, transfected CHO cells) in a sy ⁇ tem which mea ⁇ ure ⁇ extracellular pH change ⁇ cau ⁇ ed by receptor activation, for example, as described in Science, Volume 246, pages 181-296 (1989).
• potential agonists or antagonists may be contacted with a cell which expres ⁇ e ⁇ the polypeptide of the present invention and a second messenger response, e.g., signal transduction may be measured to determine whether the potential antagonist or agonist i ⁇ effective.
• a second messenger response e.g., signal transduction
• Another ⁇ creening technique involve ⁇ expre ⁇ ing the receptor polypeptide wherein it i ⁇ linked to pho ⁇ pholipase C or D.
• pho ⁇ pholipase C or D As representative examples of such cell ⁇ , there may be mentioned endothelial cell ⁇ , smooth muscle cells, embryonic kidney cells and the like.
• the screening for an antagonist or agonist may be accomplished a ⁇ hereinabove de ⁇ cribed by detecting activation of the receptor or inhibition of activation of the receptor from the pho ⁇ pholipase second signal.
• Antibodies may be utilized as both an agonist and antagonist depending on which part of the polypeptide of the present invention the antibody binds to.
• the antibody in one instance can bind to the active site and block ligand access.
• monoclonal antibodie ⁇ directed again ⁇ t certain TNF receptor ⁇ can act a ⁇ specific agoni ⁇ t ⁇ when binding to the extra-cellular domain of the receptor.
• oligonucleotides which bind to the TNF receptor may also act as TNF receptor antagonists.
• a potential TNF receptor antagonist may be a soluble form of the TNF receptor which contains the complete extra-cellular region of the TNF receptor and which binds to ligands to inhibit their biological activity.
• Another potential TNF receptor antagonist is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expre ⁇ ion through triple-helix formation or anti ⁇ en ⁇ e DNA or RNA, both of which method ⁇ are based on binding of a polynucleotide to DNA or RNA.
• the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is u ⁇ ed to de ⁇ ign an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
• a DNA oligonucleotide is designed to be complementary to a region of the gene involved in tran ⁇ cription (triple helix -see Lee et al., Nucl. Acids Res., 3:173 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al. , Science, 251: 1360 (1991)), thereby preventing tran ⁇ cription and the production of TNF receptor .
• TNF receptor antagoni ⁇ ts al ⁇ o include a ⁇ mall molecule which bind ⁇ to and occupie ⁇ the TNF receptor thereby making the receptor inaccessible to ligands which bind thereto ⁇ uch that normal biological activity i ⁇ prevented.
• Example ⁇ of ⁇ mall molecule ⁇ include but are not limited to ⁇ mall peptide ⁇ or peptide-like molecule ⁇ .
• the agonists may also be employed to mediate an anti ⁇ viral response, to regulate growth, to mediate the immune respon ⁇ e and to treat immunodeficiencies related to disea ⁇ e ⁇ such as HIV.
• Antagonist ⁇ to the TNF receptor may be employed to treat autoimmune di ⁇ ea ⁇ e ⁇ , for example, graft versus host rejection and allograft rejection, and T-cell mediated autoimmune disea ⁇ e ⁇ ⁇ uch a ⁇ AIDS. It ha ⁇ been ⁇ hown that T-cell proliferation i ⁇ ⁇ timulated via a type 2 TNF receptor. Accordingly, antagonizing the receptor may prevent the proliferation of T-cell ⁇ and treat T-cell mediated autoimmune di ⁇ ea ⁇ e ⁇ .
• the antagoni ⁇ t ⁇ may al ⁇ o be employed to prevent apopto ⁇ i ⁇ , which i ⁇ the ba ⁇ i ⁇ for disease ⁇ ⁇ uch as viral infection, rheumatoid arthritis, ⁇ y ⁇ temic lupu ⁇ erythematosu ⁇ , insulin-dependent diabetes mellitus, and graft rejection. Similarly, the antagoni ⁇ t ⁇ may be employed to prevent cytotoxicity.
• the antagoni ⁇ t ⁇ to the TNF receptor may al ⁇ o be employed to treat B cell cancer ⁇ which are ⁇ timulated by TNF.
• Antagoni ⁇ t ⁇ to the TNF receptor may also be employed to treat and/or prevent septic shock, which remain ⁇ a critical clinical condition.
• Septic ⁇ hock results from an exaggerated host re ⁇ pon ⁇ e, mediated by protein factors ⁇ uch a ⁇ TNF and IL-1, rather than from a pathogen directly.
• lipopoly ⁇ accharide ⁇ have been ⁇ hown to elicit the release of TNF leading to a ⁇ trong and transient increase of its serum concentration.
• TNF causes shock and tissue injury when administered in excessive amounts.
• antagoni ⁇ t ⁇ to the TNF receptor will block the action ⁇ of TNF and treat/prevent septic shock.
• the ⁇ e antagoni ⁇ t ⁇ may al ⁇ o be employed to treat eningococcemia in children which correlate ⁇ with high serum level ⁇ of TNF.
• TNF receptor antagoni ⁇ t ⁇ may al ⁇ o be employed to treat inflammation mediated by ligands to the receptor such as TNF.
• the soluble TNF receptor and agonist ⁇ and antagoni ⁇ t ⁇ may be employed in combination with a suitable pharmaceutical carrier.
• a suitable pharmaceutical carrier includes but i ⁇ not limited to saline, .buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
• a carrier includes but i ⁇ not limited to saline, .buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
• the formulation should suit the mode of admini ⁇ tration.
• the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compo ⁇ ition ⁇ of the invention.
• Associated with ⁇ uch container( ⁇ ) can be a notice in the form pre ⁇ cribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflect ⁇ approval by the agency of manufacture, u ⁇ e or ⁇ ale for human admini ⁇ tration.
• the ⁇ oluble form of the receptor and agoni ⁇ t ⁇ and antagoni ⁇ t ⁇ of the pre ⁇ ent invention may also be employed in conjunction with other therapeutic compound ⁇ .
• the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intrana ⁇ al or intradermal route ⁇ .
• the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage i ⁇ from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the route ⁇ of administration, symptoms, etc.
• TNF receptor and agonist ⁇ and antagoni ⁇ t ⁇ which are polypeptides may also be employed in accordance with the present invention by expres ⁇ ion of such polypeptides in vivo , which is often referred to a ⁇ "gene therapy.”
• cell ⁇ from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cell ⁇ then being provided to a patient to be treated with the polypeptide.
• a polynucleotide DNA or RNA
• cells may be engineered by procedure ⁇ known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
• cell ⁇ may be engineered in vivo for expre ⁇ ion of a polypeptide in vivo by, for example, procedure ⁇ known in the art.
• procedure ⁇ known in the art.
• a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the pre ⁇ ent invention may be admini ⁇ tered to a patient for engineering cells in vivo and expression of the polypeptide in vivo .
• the expression vehicle for engineering cells may be other than a retroviru ⁇ , for example, an adenoviru ⁇ which may be u ⁇ ed to engineer cell ⁇ in vivo after combination with a ⁇ uitable delivery vehicle.
• the ⁇ equence ⁇ of the present invention are also valuable for chromosome identification.
• the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
• there i ⁇ a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual ⁇ equence data (repeat polymorphisms) are presently available for marking chromosomal location.
• the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those ⁇ equence ⁇ with genes as ⁇ ociated with di ⁇ ease.
• sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primer ⁇ that do not ⁇ pan more than one exon in the genomic DNA, thu ⁇ complicating the amplification proce ⁇ s. These primers are then used for PCR screening of somatic cell hybrid ⁇ .containing individual human chromo ⁇ ome ⁇ . Only tho ⁇ e hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
• PCR mapping of somatic cell hybrid ⁇ is a rapid procedure for as ⁇ igning a particular DNA to a particular chromo ⁇ ome.
• Other mapping strategies that can similarly be used to map to it ⁇ chromo ⁇ ome include in situ hybridization, pre ⁇ creening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromo ⁇ ome specific-cDNA libraries.
• Fluore ⁇ cence in situ hybridization (FISH) of a cDNA clone to a metapha ⁇ e chromo ⁇ omal ⁇ pread can be u ⁇ ed to provide a preci ⁇ e chromo ⁇ omal location in one ⁇ tep.
• Thi ⁇ technique can be u ⁇ ed with cDNA a ⁇ ⁇ hort a ⁇ 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. For example, 2,000 bp is good, 4,000 i ⁇ better, and more than 4,000 i ⁇ probably not necessary to get good result ⁇ a reasonable percentage of the time.
• Verma et al. Human Chromosome ⁇ : a Manual of Ba ⁇ ic Technique ⁇ , Pergamon Press, New York (1988).
• the physical po ⁇ ition of the ⁇ equence on the chromosome can be correlated with genetic map data.
• genetic map data are found, for example, in V. McKu ⁇ ick, Mendelian Inheritance in Man (available on line through John ⁇ Hopkin ⁇ University Welch Medical Library).
• the relationship between gene ⁇ and di ⁇ ea ⁇ e ⁇ that have been mapped to the ⁇ ame chromosomal region are then identified through linkage analysi ⁇ (coinheritance of phy ⁇ ically adjacent gene ⁇ ).
• a cDNA precisely localized to a chromosomal region as ⁇ ociated with the di ⁇ ea ⁇ e could be one of between 50 and 500 potential causative genes. (This assumes 1 megaba ⁇ e mapping re ⁇ olution and one gene per 20 kb) .
• the polypeptide ⁇ , their fragment ⁇ or other derivative ⁇ , or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
• These antibodies can be, for example, polyclonal or monoclonal antibodies.
• the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragment ⁇ , or the product of an Fab expression library.
• Various procedures known in the art may be used for the production of ⁇ uch antibodie ⁇ and fragment ⁇ .
• Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptide ⁇ itself. In thi ⁇ manner, even a sequence encoding only a fragment of the polypeptide ⁇ can be used to generate antibodies binding the whole native polypeptide ⁇ . Such antibodie ⁇ can then be u ⁇ ed to i ⁇ olate the polypeptide from tissue expressing that polypeptide.
• any technique which provides antibodie ⁇ produced by continuou ⁇ cell line culture ⁇ can be u ⁇ ed.
• Example ⁇ include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor ' ⁇ t al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodie ⁇ and Cancer Therapy, Alan R. Li ⁇ , Inc., pp. 77-96).
• Technique ⁇ de ⁇ cribed for the production of ⁇ ingle chain antibodie ⁇ (U.S. Patent 4,946,778) can be adapted to produce ⁇ ingle chain antibodie ⁇ to immunogenic polypeptide product ⁇ of thi ⁇ invention.
• Al ⁇ o, tran ⁇ genic mice may be u ⁇ ed to expre ⁇ humanized antibodie ⁇ to immunogenic polypeptide product ⁇ of thi ⁇ invention.
• Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
• the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedure ⁇ .
• equivalent pla ⁇ mid ⁇ to tho ⁇ e described are known in the art and will be apparent to the ordinarily skilled artisan.
• “Digestion” of DNA refers to catalytic cleavage of the DNA with a re ⁇ triction enzyme that act ⁇ only at certain ⁇ equence ⁇ in the DNA.
• the variou ⁇ re ⁇ triction enzyme ⁇ u ⁇ ed herein are commercially available and their reaction condition ⁇ , cofactor ⁇ and other requirement ⁇ were u ⁇ ed a ⁇ would be known to the ordinarily ⁇ killed arti ⁇ an.
• For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment i ⁇ u ⁇ ed with about 2 unit ⁇ of enzyme in about 20 ⁇ l of buffer ⁇ olution.
• DNA fragment ⁇ for plasmid construction, typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and sub ⁇ trate amount ⁇ for particular re ⁇ triction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 * C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction i ⁇ electrophore ⁇ ed directly on a polyacrylamide gel to i ⁇ olate the de ⁇ ired fragment.
• Oligonucleotides refers to either a single ⁇ tranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thu ⁇ will not ligate to another oligonucleotide without adding a pho ⁇ phate with an ATP in the pre ⁇ ence of a kina ⁇ e. A ⁇ ynthetic oligonucleotide will ligate to a fragment that ha ⁇ not been dephosphorylated.
• Ligase refers to the process of forming phosphodie ⁇ ter bonds between two double stranded nucleic acid fragment ⁇ (Maniatis, T., et al.. Id., p. 146). Unle ⁇ otherwise provided, ligation may be accomplished u ⁇ ing known buffer ⁇ and condition ⁇ with 10 unit ⁇ of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
• ligase T4 DNA ligase
• tran ⁇ formation wa ⁇ performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
• the 5' oligonucleotide primer ha ⁇ the ⁇ equence 5' GCCAGAGOATCCGAAACGTTTCCTCCAAAGTAC 3' (SEQ ID No.
• pQE-9 encode ⁇ antibiotic re ⁇ i ⁇ tance (Amp r ), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/0), a ribo ⁇ ome binding ⁇ ite (RBS), a 6- Hi ⁇ tag and re ⁇ triction enzyme ⁇ ite ⁇ .
• pQE-9 is then digested with BamHI and Xbal.
• the amplified sequence ⁇ are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
• the ligation mixture i ⁇ then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
• M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin re ⁇ istance (Kan r ) .
• Transformant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysi ⁇ . Clone ⁇ containing the de ⁇ ired con ⁇ truct ⁇ are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
• the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
• the cell ⁇ are grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6.
• IPTG "Isopropyl-B-D- thiogalacto pyrano ⁇ ide" i ⁇ then added to a final concentration of 1 mM. IPTG induce ⁇ by inactivating the lad repressor, clearing the P/0 leading to increased gene expres ⁇ ion.
• Cell ⁇ are grown an extra 3 to 4 hour ⁇ . Cell ⁇ are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl.
• TNF receptor (0% pure) i ⁇ eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpo ⁇ e of renaturation adju ⁇ ted to 3 molar guanidine HCl, lOOmM ⁇ odium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in thi ⁇ solution for 12 hours the protein is dialyzed to 10 mmolar ⁇ odium phosphate.
• Example 2 Clonin ⁇ and expre ⁇ sion of TNF receptor and extracellular
• the 5' primer ha ⁇ the ⁇ equence 5' GCGCGGATCCATGAACAAGTTGCTGTGCTGC 3' (SEQ ID No. 5) and contain ⁇ a BamHI re ⁇ triction enzyme ⁇ ite (in bold) and which i ⁇ ju ⁇ t behind the first 21 nucleotide ⁇ of the TNF receptor gene (the initiation codon for tran ⁇ lation "ATG" i ⁇ underlined) .
• the 3' primer ha ⁇ the ⁇ equence 5' GCGCTCTAGATTA CCTATCATTTCTAAAAATAAC 3' (SEQ ID No. 6) and 5' GCGCGGTACCTCAGTGGTTTGGGCTCCTCCC 3' (SEQ ID No. 7) and contain ⁇ the cleavage ⁇ ite for the re ⁇ triction endonuclease Xbal and 21 nucleotides complementary to the 3' non- translated sequence of the TNF receptor gene.
• the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean", BIO 101 Inc., La Jolla, Ca.). The fragments were then digested with the endonucleases BamHI and Xbal and then purified again on a 1% agaro ⁇ e gel. Thi ⁇ fragment i ⁇ designated F2.
• the vector pRGl (modification of pVL941 vector, discu ⁇ ed below) wa ⁇ u ⁇ ed for the expre ⁇ ion of the TNF receptor protein ⁇ u ⁇ ing the baculovirus expres ⁇ ion system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vector ⁇ and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555).
• This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosi ⁇ viru ⁇ (AcMNPV) followed by the recognition ⁇ ite ⁇ for the re ⁇ triction endonuclea ⁇ e ⁇ BamHI and Xbal.
• the polyadenylation ⁇ ite of the ⁇ imian viru ⁇ (SV)40 wa ⁇ used for efficient polyadenylation.
• the beta-galacto ⁇ idase gene from E.coli wa ⁇ in ⁇ erted in the same orientation a ⁇ the polyhedrin promoter followed by the polyadenylation ⁇ ignal of the polyhedrin gene.
• the polyhedrin sequences were flanked at both sides by viral sequence ⁇ for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
• Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
• the plasmid wa ⁇ dige ⁇ ted with the restriction enzymes BamHI and Xbal.
• the DNA wa ⁇ then i ⁇ olated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). Thi ⁇ vector DNA i ⁇ de ⁇ ignated V2.
• Fragment F2 and the depho ⁇ phorylated pla ⁇ mid V2 were ligated with T4 DNA ligase.
• E. coli HB101 cell ⁇ were then tran ⁇ formed and cell ⁇ identified that contained the plasmid (pBac TNF receptor) with the TNF receptor genes using the enzymes BamHI and Xbal.
• the sequence of the cloned fragment was confirmed by DNA sequencing.
• the plate was then incubated for 5 hour ⁇ at 27°C. After 5 hour ⁇ the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum wa ⁇ added. The plate wa ⁇ put back into an incubator and cultivation continued at 27°C for four days.
• the viruses were added to the cells and blue stained plaques were picked with the tip ' of an Eppendorf pipette.
• the agar containing the recombinant viru ⁇ es were then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
• the agar wa ⁇ removed by a brief centrifugation and the ⁇ upernatant containing the recombinant baculoviru ⁇ e ⁇ wa ⁇ u ⁇ ed to infect Sf9 cell ⁇ seeded in 35 mm dishes.
• the supematants of these culture dishe ⁇ were harve ⁇ ted and then ⁇ tored at 4°C.
• Sf9 cell ⁇ were grown in Grace' ⁇ medium ⁇ upplemented with 10% heat-inactivated FBS.
• the cell ⁇ were infected with the recombinant baculovirus V-TNF receptor at a multiplicity of infection (MOI) of 2.
• MOI multiplicity of infection
• the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologie ⁇ Inc., Gaither ⁇ burg).
• the cell ⁇ are further incubated for 16 hour ⁇ before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
• Example 3 Expre ⁇ sion of Recombinant TNF receptor in COS cells
• expres ⁇ ion of plasmid, TNF receptor HA i ⁇ derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resi ⁇ tance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation ⁇ ite.
• a DNA fragment encoding the entire TNF receptor precur ⁇ or and a HA tag fu ⁇ ed in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expre ⁇ ion i ⁇ directed under the CMV promoter.
• the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previou ⁇ ly described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767).
• the infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
• the DNA sequence encoding TNF receptor, ATCC # 75899, i ⁇ constructed by PCR using two primers: the 5' primer 5' GCCAGAGGATCCGCCACCATGAACAAGTTGCTGTGCTGC 3' (SEQ ID No. 8) contain ⁇ a BamHI ⁇ ite (bold) followed by 21 nucleotides of TNF receptor coding sequence starting from the initiation codon; the 3' sequence 5' CGGCTTCTAGAATCAAGCGTAGTCTGGGACG TCGTATGGGTACCTATCATTTCTAAAAAT 3' (SEQ ID No.
• the PCR product contains complementary ⁇ equence ⁇ to an Xbal ⁇ ite (bold), translation stop codon, HA tag and the last 18 nucleotides of the TNF receptor coding sequence (not including the ⁇ top codon). Therefore, the PCR product contains a BamHI ⁇ ite, TNF receptor coding ⁇ equence followed by HA tag fu ⁇ ed in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
• the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with BamHI and Xbal restriction enzymes and ligated. The ligation mixture is transformed into E.
• coli ⁇ train SURE (Stratagene Cloning Sy ⁇ tem ⁇ , La Jolla, CA) the tran ⁇ formed culture i ⁇ plated on ampicillin media plate ⁇ and re ⁇ i ⁇ tant colonie ⁇ are ⁇ elected. Pla ⁇ mid DNA is isolated from transformant ⁇ and examined by re ⁇ triction analy ⁇ i ⁇ for the pre ⁇ ence of the correct fragment. For expre ⁇ ion of the recombinant TNF receptor, COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniati ⁇ , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)).
• ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
• GTGTGCGCCC CTTGCCCTGA CCACTACTAC ACAGACAGCT GGCACACCAG TGACGAGTGT 240
• CTATACTGCA GCCCCGTGTG CAAGGAGCTG CAGTACGTCA AGCAGGAGTG CAATCGCACC 300
• Hi ⁇ A ⁇ p A ⁇ n lie Cy ⁇ Ser Gly A ⁇ n Ser Glu Ser Thr Gin Ly ⁇ Cy ⁇
• Gly lie A ⁇ p Val Thr Leu Cy ⁇ Glu Glu Ala Phe Phe Arg Phe Ala
• Leu Trp Arg lie Lys Asn Gly Asp Gin Asp Thr Leu Ly ⁇ Gly Leu
• MOLECULE TYPE Oligonucleotide
• xi SEQUENCE DESCRIPTION: SEQ ID NO:5:

Applications Claiming Priority (1)

Publications (2)

Family

ID=22248816

Family Applications (1)

Country Status (3)

Citations (1)

• 1995
  • 1995-03-15 JP JP8527539A patent/JPH11503007A/ja active Pending
  • 1995-03-15 AU AU21599/95A patent/AU2159995A/en not_active Abandoned
  • 1995-03-15 EP EP95914722A patent/EP0819168A4/de not_active Withdrawn

Patent Citations (1)

Non-Patent Citations (6)

Also Published As

Similar Documents

Legal Events