EP0812360A1 - Menschliche geranyl-geranyl-pyrophosphat synthetase - Google Patents

Menschliche geranyl-geranyl-pyrophosphat synthetase

Info

Publication number
EP0812360A1
EP0812360A1 EP95910081A EP95910081A EP0812360A1 EP 0812360 A1 EP0812360 A1 EP 0812360A1 EP 95910081 A EP95910081 A EP 95910081A EP 95910081 A EP95910081 A EP 95910081A EP 0812360 A1 EP0812360 A1 EP 0812360A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
hggps
polynucleotide
dna
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95910081A
Other languages
English (en)
French (fr)
Other versions
EP0812360A4 (de
Inventor
John M. Greene
Craig A. Rosen
Ewen F. Kirkness
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Publication of EP0812360A1 publication Critical patent/EP0812360A1/de
Publication of EP0812360A4 publication Critical patent/EP0812360A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1085Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is Human Geranylgeranyl Pyrophosphate Synthetase, sometimes hereinafter referred to as "hGGPS". The invention also relates to inhibiting the action of such polypeptides.
  • protein prenylation is a process which refers to the covalent modification of a molecule by the attachment of a lipophilic isoprenoid group.
  • Isoprenoids are a diverse family of lipophilic molecules based on a repeating 5-carbon structure. Farnesyl diphosphate, a 15- carbon molecule, and geranylgeranyl diphosphate, a 20-carbon
  • prenylated proteins are post-translationally modified with a prenyl group. Most, if not all, prenylated proteins are modified by the attachment of either a 15-carbon farnesyl or a 20-carbon geranylgeranyl group (Rilling, H.C. et al . , Science, 247:318-320 (1990)) in a thioether linkage to a cysteine residue. In most organisms geranylgeranylation is a more common modification than famesylation, although the relative proportions of farnesyl cysteine and geranylgeranyl cysteine in total cellular protein varies somewhat between organisms and cell types (Epstein, W.w. et al . , PNAS. USA.
  • Prenylated proteins are found in a variety of cellular compartments, including the nucleus, the cytosol, and membrane-bound organelles (Maltese, W.A. and Sheridan, K.M. , J. Cell. Phvsiol.. 133:471-81 (1987)) .
  • prenylated proteins whose identities have been determined belong to one of four protein families: small GTP-binding proteins, lipopeptide pheromones, nuclear lamin ⁇ , and trimeric G-proteins.
  • Most of the known prenylated proteins are members of the Ras superfamily of low-molecular-weight guanine nucleotide-binding proteins. These proteins can be divided into four smaller protein families: the Ras, Rho, Rap and Rab/Ypt families (Chardin, P., Biochimie, 70:865-68 (1988)). These proteins participate in a variety of cellular functions, including control of cell growth and differentiation, cytokinesis, and membrane trafficking. All small GTP-binding proteins contain cysteine residues at or near the carboxyl-terminus that appear to serve as targets for post-translational prenylation.
  • Ras proteins are plasma membrane-localized molecules that regulate cell differentiation and proliferation in mammalian and yeast cells. Ras proteins contain a carboxyl- terminal sequence called a CaaX motif with a cysteine followed by 2 aliphatic residues and a carboxyl-terminal X residue, which can be C, S, M, Q, or A (Taparowsky, E. et al . , Cell. 34:581-86 (1983)). Genetic or pharmacological inhibition of protein prenylation blocks the membrane association and biological activity of both human and yeast Ras proteins (Hancock, J.F. et al . , Cell. 57:1167-77 (1989) and Schafer, W.R. et al . , Science. 245:379-85 (1989)) .
  • a second group of small GTP-binding proteins contains a carboxyl-terminal motif similar to a CaaX box, called a CaaL motif, with a leucine residue in the carboxyl-terminal position.
  • This group includes many proteins implicated in cytokinesis such as the Rap and Rho protein families. Many of these proteins are known to be geranylgeranylated, including G25K, RhoA (Katayama, M. et al . , J. Biol. Chem. , 266:12639-45 (1991), Ral, Rac (Kinsella, B.T. et al . , Biol. Chem..
  • Rap IA and IB (Buss, J.E. et al., Mol. Cell. Biol.. 11:1523-30 (1991) and Kowata, M. et al . , PNAS. USA. 87:8960-64 (1990)).
  • a prenylated carboxyl-terminus is required for the association of Rap IB with membranes.
  • Prenylation and phosphorylation are both required for interaction of Rap IB with a factor known as GDS, which stimulates GDP/GTP exchange (Hata, Y. et al., J. Biol. Chem.. 266:6571-77 (1991)), since prenylated, phosphorylated peptides corresponding to Rap IB carboxyl- terminus can compete with intact Rap IB for interaction with GDS, whereas other peptides lacking either modification cannot.
  • Rho proteins are also localized to the Golgi (McCaffrey, M. et al., J. Cell Biol.. 115:309-19 (1991)), and also appear to require geranylgeranylation for association with membranes and with exchange factors.
  • a third group of small GTP-binding proteins contain the carboxyl-terminal sequences C-C, C-X-C, or C-C-X-X. These proteins include most of the Rab/YPT proteins, which are involved in regulating intracellular trafficking and are present both in the cytoplasm and associated with distinct membrane compartments (Balch, W.E., Trends Biochem. Sci.. 15:469-72 (1990)) . Geranylgeranyla ion of these proteins has been shown to be essential for association of these proteins with membranes.
  • Geranylgeranyl pyrophosphate synthetase is involved in a branch of the cholesterol/steroid pathway of metabolism and catalyzes the trans-addition of three molecules of isopentenyl diphosphate onto dimethyallyl diphosphate to form the C :o geranylgeranyl pyrophosphate (GGPP) .
  • GGPP is used as a prenyl protein modification group to modify proteins and control signal transduction and activation of these proteins and trafficking of these proteins.
  • polypeptide of the present invention has been putatively identified as a human geranylgeranyl pyrophosphate synthetase. This identification has been made as a result of amino acid sequence homology.
  • a novel mature polypeptide which is hGGPS, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • isolated nucleic acid molecules encoding hGGPS including mRNAs, DNAs, cDNAs, genomic DNA as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • a process for producing such polypeptide by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a hGGPS nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
  • antagonists to such polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of neoplasia, for example tumors and cancer cell growth, and to prevent viral proliferation.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to hGGPS sequences.
  • a method of diagnosing a disease or a susceptibility to a disease related to a mutation in hGGPS nucleic acid sequences and the protein encoded by such nucleic acid sequences is provided.
  • FIG. 1 shows the cDNA and corresponding deduced amino acid sequence of the hGGPS polypeptide.
  • the polypeptide shown is the full protein sequence of the polypeptide.
  • the standard one letter abbreviations for amino acids are used.
  • Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.) . Sequencing accuracy is predicted to be greater than 97% accurate.
  • Figure 2 illustrates the amino acid sequence homology between the hGGPS polypeptide and geranylgeranyl pyrophosphate synthetase from Neurospora crassa.
  • Figure 3 depicts an amino acid sequence homology between GGPS from Neurospora crassa, and hGGPS of the present invention. Where amino acids are identical the abbreviation for the amino acid is shown on a line below labeled consensus.
  • nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75900 on September 28, 1994.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained from osteoclastoma, 8 week embryos and microvascular endothelial cells.
  • the polynucleotide of this invention was discovered in a cDNA library derived from human fetal heart. It is structurally related to the polyprenyl synthetase family. It contains an open reading frame encoding a protein of 300 amino acid residues. The protein exhibits the highest degree of homology to GGPS from Neurospora crassa with 54% identity and 72% similarity over a 265 amino acid stretch.
  • hGGPS contains both conserved aspartate motifs that denote this family of proteins, namely LLIDDEIDNSKLRRG and LGLFFQIRDDYAN (see Figure 1) .
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID No. 1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure l (SEQ ID No. l) or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide,* the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure l
  • nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure l (SEQ ID No. 1) or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
  • the deposit (s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
  • the present invention further relates to an hGGPS polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) .
  • a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code
  • one or more of the amino acid residues includes a substituent group
  • the mature polypeptide is fused with another compound, such as a compound to increase the half-
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the hGGPS genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40,* bacterial plasm-ids; phage DNA; baculovirus,* yeast plasmids,* vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter for example, LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli. Streptomvces. Salmonella typhimurium.
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS or Bowes melanoma,* adenoviruses
  • plant cells etc.
  • the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plas id or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia) .
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are PKK232-8 and PCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L. , Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)) .
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, PKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Pro ega Biotec, Madison, Wl, USA) .
  • PKK223-3 Pharmacia Fine Chemicals, Uppsala, Sweden
  • GEM1 Pro ega Biotec, Madison, Wl, USA
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the hGGPS polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • the hGGPS polypeptide may be employed in a method of screening compounds to identify those which block (antagonists) the activity of hGGPS and the resultant formation of GGPP.
  • a method of screening compounds to identify those which block (antagonists) the activity of hGGPS and the resultant formation of GGPP.
  • subtle specificity may reside in the recognition of different protein substrates, which may be employed in assays which assess binding of GGPS to these proteins or peptide substrates or in enzymatic readouts.
  • an assay may be configured using a substrate analog.
  • antagonist activity may be determined by measuring the amount of GGPP synthesized from a molar excess of isopentenyl diphosphate, dimethylallyl diphosphate in the presence of hGGPS and a compound to be screened.
  • the reaction is carried out in the presence of a reaction mixture and under reaction conditions which facilitate the formation of GGPP.
  • the substrates listed above are for illustration only and numerous substrates may be employed in the assay.
  • the ability of the compound to be screened to antagonize the properties of hGGPS are determined by measuring the amount of GGPP synthesized and comparing that amount to the amount of GGPP synthesized in the absence of the compound.
  • GGPP may be purified by HPLC and a Lowry assay may be used to measure the amount of protein.
  • the GGPP may also be identified by amino acid sequence analysis.
  • Human GGPS is produced and functions intra-cellularly, therefore, any antagonists must be intra-cellular.
  • Potential antagonists to hGGPS include antibodies which are produced intra-cellularly.
  • an antibody identified as antagonizing hGGPS may be produced intra-cellularly as a single chain antibody by procedures known in the art, such as transforming the appropriate cells with DNA encoding the single chain antibody to prevent the function of hGGPS.
  • Another potential hGGPS antagonist is an antisense construct prepared using antisense technology.
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the hGGPS polypeptide (Antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of hGGPS.
  • Potential hGGPS antagonists also include small molecules, which are able to pass through the cell membrane, and bind to and occupy the catalytic site of the polypeptide thereby making the catalytic site inaccessible to substrate such that normal biological activity is prevented.
  • small molecules include but are not limited to small peptides or peptide-like molecules.
  • hGGPS polypeptides and antagonists which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
  • the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • hGGPS Once the hGGPS polypeptide is being expressed intra- cellularly via gene therapy, it may be employed to modify central signal transduction protein and, therefore, treat many diseases.
  • hGGPS may be employed to increase the presence of GGPP and restore the proper morphologic phenotype to cells, since in the absence of protein prenylation, cells develop a round, refractile morphology. This is due to the selective loss of actin cables without gross changes in the microtubular lattice or intermediate filament structure.
  • HMG-CoA Reductase inhibitors such as lovastatin
  • hGGPS may also be employed to treat rhabdomyolysis, which is a side effect of HMG-CoA Reductase inhibitor treatment, where muscle cell shape is controlled.
  • the hGGPS polypeptide may also be employed to suppress programmed cell death or apoptosis.
  • Lovastatin an inhibitor of mevalonate synthesis, causes cells to exhibit alterations in growth and morphology and thus the cells eventually are induced to die via apoptosis.
  • Mevalonate is the precursor of isoprenoid lipids. This points to the involvement of isoprenylated proteins in the mechanisms suppressing cell death.
  • the hGGPS antagonists may be employed to prevent neoplastic transformation of cells which lead to cancer.
  • Certain proteins which do not have the prenyl group from the prenyl pyrophosphate transferred to the cysteine residue of the Caa box of these proteins cannot effect interaction with the membrane so that neoplastic transformation of cells is prevented.
  • certain proto-oncogene products must have prenylation to express their oncogenic potential.
  • the hGGPS antagonists may be employed to treat prevent viral envelope precursors from reaching the Golgi compartment by blocking the isoprenylation of rab proteins required for endoplasmic reticulum to Golgi transport.
  • the antagonists in the case of antagonists capable of passing through a cell membrane, may be employed in a composition with a pharmaceutically acceptable carrier, e.g. , as hereinafter described.
  • Fragments of the full length hGGPS gene may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity.
  • Probes of this type generally have at least 20 bases. Preferably, however, the probes have at least 30 bases and generally do not exceed 50 bases, although they may have a greater number of bases.
  • the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete hGGPS gene including regulatory and promotor regions, exons, and introns.
  • An example of a screen comprises isolating the coding region of the hGGPS gene by using the known DNA sequence to synthesize an oligonucleotide probe.
  • Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • This invention is also related to the use of the hGGPS gene as part of a diagnostic assay for detecting diseases or susceptibility to diseases related to the presence of mutated hGGPS nucleic acid sequences.
  • diseases are related to abnormal cell morphology, cell death and human choroideremia, an X-linked form of retinal degeneration is caused by a mutation in the geranylgeranyl transferase gene.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PC (Saiki et al . , Nature, 324:163-166 (1986)) prior to analysis.
  • RNA or cDNA may also be used for the same purpose.
  • PCR primers complementary to the nucleic acid encoding hGGPS can be used to identify and analyze hGGPS mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled hGGPS RNA or alternatively, radiolabeled hGGPS antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis.
  • DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985)) .
  • Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and Si protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)) .
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., Restriction Fragment Length Polymorphisms (RFLP)
  • mutations can also be detected by in si tu analysis.
  • the present invention also relates to a diagnostic assay for detecting altered levels of hGGPS protein in various tissues since an over-expression of the proteins compared to normal control tissue samples is indicative of an increase in membrane localization of oncogenic/signal transduction proteins which in turn may mark increased growth of cells involved in cancer.
  • Assays used to detect levels of hGGPS protein in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassays, competitive-binding assays, Western Blot analysis, ELISA assays and "sandwich" assay.
  • An ELISA assay (Coligan, et al., Current Protocols in Immunology, 1(2), Chapter 6, (1991)) initially comprises preparing an antibody specific to the hGGPS antigen, preferably a monoclonal antibody.
  • a reporter antibody is prepared against the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or, in this example, a horseradish peroxidase enzyme.
  • a sample is removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein like BSA.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hGGPS proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to hGGPS. Unattached reporter antibody is then washed out.
  • Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of hGGPS protein present in a given volume of patient sample when compared against a standard curve.
  • a competition assay may be employed wherein antibodies specific to hGGPS are attached to a solid support and labeled hGGPS and a sample derived from the host are passed over the solid support and the amount of label detected, for example by liquid scintillation chromatography, can be correlated to a quantity of hGGPS in the sample.
  • a “sandwich” assay is similar to an ELISA assay.
  • hGGPS is passed over a solid support and binds to antibody attached to a solid support.
  • a second antibody is then bound to the hGGPS.
  • a third antibody which is labeled and specific to the second antibody is then passed over the solid support and binds to the second antibody and an amount can then be quantified.
  • the hGGPS polypeptides and antagonists may be employed in combination with a suitable pharmaceutical carrier.
  • a suitable pharmaceutical carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the pharmaceutical compositions may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated regions is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in si tu hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 500 or 600 bases,* however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time.
  • Verma et al. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
  • the polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
  • equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37'C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al., Nucleic Acids Res., 8:4057 (1980).
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated. "Ligation” refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • the DNA sequence encoding hGGPS is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed hGGPS nucleic acid sequence. Additional nucleotides corresponding to hGGPS are added to the 5' and 3' sequences respectively.
  • the 5' oligonucleotide primer has the sequence 5' AGAGGAT ⁇ GCCa ⁇ TGGAGAAGACTCAAGAA 3' (SEQ ID No. 3) contains a Bam HI restriction enzyme site (underlined) followed by 18 nucleotides of hGGPS coding sequence starting from the presumed terminal amino acid of the processed protein.
  • the 3' sequence 5' CGTTGG rAGC ITATTCATl rL'l C l'lOGA 3' contains complementary sequences to Nhel site and is followed by 18 nucleotides of hGGPS.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA) .
  • pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6-His tag and restriction enzyme sites.
  • pQE-9 is then digested with Bam HI and Xbal.
  • the amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture is then used to transform E. coli Ml5 strain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6. IPTG (“Isopropyl-B-D-thiogalacto pyranoside”) is then added to a final concentration of 1 mM.
  • O.D. 600 optical density 600
  • IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized hGGPS is purified from this solution by chromatography on a Nickel- Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)).
  • hGGPS (90% pure) is eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 molar glutathione (oxidized) . After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.
  • the DNA sequence encoding the full length hGGPS protein, ATCC # 75900, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
  • the 5' primer has the sequence 5' GCCAGAGGATCCGCCACCATG GAGAAGACTCAAGAAACA 3' (SEQ ID No. 5) and contains a BamHI restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just behind the first 21 nucleotides of the hGGPS gene (the initiation codon for translation "ATG" is underlined) .
  • the 3' primer has the sequence 5' CJGTTGGCTAGCC ⁇ TATTCAT TTTCTTCTTTGGA 3' (SEQ ID No. 6) and contains the cleavage site for the restriction endonuclease Nhel and 18 nucleotides complementary to the 3' non-translated sequence of the hGGPS gene.
  • the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) .
  • the fragment is then digested with the endonucleases BamHI and Nhel and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pA2 (modification of pVL94l vector, discussed below) is used for the expression of the hGGPS protein using the baculovirus expression system (for review see*. Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHI and Xbal.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D. , Virology, 170:31-39) .
  • the plasmid is digested with the restriction enzymes BamHI and Xbal .
  • the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
  • E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBac hGGPS) with the hGGPS gene using the enzymes BAmHI and Pstl. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • 5 ⁇ g of the plasmid pBac-hGGPS is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Feigner et al . Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)) .
  • l ⁇ g of BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBachGGPS are mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) .
  • plaque assay After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the viruses are added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
  • the supernatants of these culture dishes are harvested and then stored at 4°C.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-hGGPS at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 3S S cysteine (Amersham) are added.
  • the cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • Example 3 Expression of Recombinant hGGPS in COS cells
  • the expression of plasmid, hGGPS HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: l) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire hGGPS precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767) .
  • the infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding hGGPS is constructed by PCR using two primers: the 5' primer 5' GCCAGAGGATCCATGGAGAAGACTCAAGAAACA 3' (SEQ ID No. 7) contains a BamHI site followed by 21 nucleotides of hGGPS coding sequence starting from the initiation codon,* the 3' sequence 5' CGGCTGCTAGCCTC ⁇ AGCGTAGTCTGGGACGTCGTATGGGTATTCATT TTCTTCTTTGGA 3' (SEQ ID No. 8) contains complementary sequences to an Nhel site, translation stop codon, HA tag and the last 18 nucleotides of the hGGPS coding sequence (not including the stop codon) .
  • the PCR product contains a BamHI site, hGGPS coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Nhel site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with BamHI and Nhel restriction enzyme and ligated.
  • the ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
  • hGGPS For expression of the recombinant hGGPS, COS cells are transfected with the expression vector by DEAE- DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniati ⁇ , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)) .
  • the expression of the hGGPS-HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)) . Cells are labelled for 8 hours with 3S S-cysteine two days post transfection.
  • Culture media are then collected and cells are lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)) . Both cell lysate and culture media are precipitated with a HA specific monoclonal antibody. Proteins precipitated are analyzed on 15% SDS-PAGE gels.
  • RIPA buffer 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5
  • RNAzolTM B system Biotecx Laboratories, Inc. Houston, TX
  • About 10 ⁇ g of total RNA isolated from each human tissue specified is separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)) .
  • the labeling reaction is done according to the Stratagene Prime-It kit with 50ng DNA fragment.
  • the labeled DNA is purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. Boulder, CO) .
  • the filter is then hybridized with radioactive labeled full length hGGPS gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at 65 * C. After wash twice at room temperature and twice at 60"C with 0.5 x SSC, 0.1% SDS, the filter is then exposed at -70'C overnight with an intensifying screen.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:6:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP95910081A 1995-01-11 1995-01-11 Menschliche geranyl-geranyl-pyrophosphat synthetase Withdrawn EP0812360A4 (de)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1995/000421 WO1996021736A1 (en) 1995-01-11 1995-01-11 Human geranylgeranyl pyrophosphate synthetase

Publications (2)

Publication Number Publication Date
EP0812360A1 true EP0812360A1 (de) 1997-12-17
EP0812360A4 EP0812360A4 (de) 2000-08-09

Family

ID=22248491

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95910081A Withdrawn EP0812360A4 (de) 1995-01-11 1995-01-11 Menschliche geranyl-geranyl-pyrophosphat synthetase

Country Status (4)

Country Link
EP (1) EP0812360A4 (de)
JP (1) JPH10512145A (de)
AU (1) AU1830895A (de)
WO (1) WO1996021736A1 (de)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8691555B2 (en) 2006-09-28 2014-04-08 Dsm Ip Assests B.V. Production of carotenoids in oleaginous yeast and fungi
US9909130B2 (en) 2005-03-18 2018-03-06 Dsm Ip Assets B.V. Production of carotenoids in oleaginous yeast and fungi

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3120684B2 (ja) * 1995-02-14 2000-12-25 トヨタ自動車株式会社 ゲラニルゲラニル二リン酸を合成する変異型ファルネシル二リン酸合成酵素及びそれをコードするdna
AU4794199A (en) * 1998-07-23 2000-02-14 Genset A nucleic acid encoding a geranyl-geranyl pyrophosphate synthetase (ggpps) and polymorphic markers associated with said nucleic acid

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Database BIOSIS,, abstract no. PREV199598033927 & Acta Biochimica Polonica vol. 41, 1994, p. 293 - 302, Sagami et al *
Kuzuguchi et al, J. Biol. Chem. vol. 274,1999, p. 5888-5994 *
No further relevant documents disclosed *
Sagami et al, Arch. Biochem. Biophys. vol. 2997, 1992, p. 314 - 320 *
Sagami et al, J.Biol. Chem. vol. 269, 1994, p. 20561-20566 *
See also references of WO9621736A1 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9909130B2 (en) 2005-03-18 2018-03-06 Dsm Ip Assets B.V. Production of carotenoids in oleaginous yeast and fungi
US8691555B2 (en) 2006-09-28 2014-04-08 Dsm Ip Assests B.V. Production of carotenoids in oleaginous yeast and fungi
US9297031B2 (en) 2006-09-28 2016-03-29 Dsm Ip Assets B.V. Production of carotenoids in oleaginous yeast and fungi

Also Published As

Publication number Publication date
JPH10512145A (ja) 1998-11-24
AU1830895A (en) 1996-07-31
WO1996021736A1 (en) 1996-07-18
EP0812360A4 (de) 2000-08-09

Similar Documents

Publication Publication Date Title
AU708972B2 (en) Tumor necrosis factor-gamma
AU708829B2 (en) Human tissue inhibitor of metalloproteinase-4
CA2210444C (en) Keratinocyte growth factor-2
US20090197278A9 (en) Antibodies to hADA2
US6284504B1 (en) Human DNA ligase III
US5786193A (en) Human geranylgeranyl pyrophosphate synthethase
US5650313A (en) Ubiquitin conjugating enzymes 8 and 9
EP0812360A1 (de) Menschliche geranyl-geranyl-pyrophosphat synthetase
US5849286A (en) Ubiquitin conjugating enzymes 7,8 and 9
US6319700B1 (en) Human choline acetyltransferase
EP0814661A1 (de) Ubiquitin-konjugierte enzyme 7, 8 und 9
US6063376A (en) Human deoxycytidine kinase 2
US5914258A (en) Human deoxycytidine kinase 2
US5859200A (en) Human amine transporter
EP0815199A1 (de) Menschliche deoxycytidinkinase
US5945321A (en) Ubiquitin conjugating enzymes 7, 8 and 9
US5798223A (en) Polynucleotides encoding human amine transporter and methods of using the same
WO1996015147A1 (en) Human stanniocalcin-alpha
EP0815220A1 (de) Menschlicher amintransporter
WO1996012791A1 (en) Human abh
WO1996012501A1 (en) Human hypoxanthine-(guanine) phosphoribosyl transferase-2
EP1284292A2 (de) Menschliches B-Zell Translokationsgen-3
AU1174795A (en) Human DNA ligase IV
US20020058610A1 (en) Mammary transforming protein
WO1996015806A1 (en) Human choline acetyltransferase

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970811

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched

Effective date: 20000626

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20020213

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050301