Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/521—Chemokines
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P33/00—Antiparasitic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human chemokine polypeptides, sometimes hereinafter referred to as human chemokine beta-11 (Ck/3-11) and human chemokine alpha-1 (Cko-- 1) . The invention also relates to inhibiting the action of such polypeptides.
• Chemokines also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines exhibit 20% to 75% ho ology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C-X-C" subfamily. In the beta subfamily, the two cysteines are in an adjacent position and are, therefore, referred to as the "C-C” subfamily. Thus far, at least eight different members of this family have been identified in humans.
• the intercrine cytokines exhibit a wide variety of functions.
• a hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils and fibroblasts.
• Many chemokines have proinflammatory activity and are involved in multiple steps during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enhanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in inflammation, certain chemokines have been shown to exhibit other activities.
• macrophage inflammatory protein 1 is able to suppress hematopoietic stem cell proliferation
• platelet factor-4 is a potent inhibitor of endothelial cell growth
• Interleukin-3 IL-8 promotes proliferation of keratinocytes
• GRO is an autocrine growth factor for melanoma cells.
• chemokines have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis.
• C-C branch exert their effects on the following cells: eosinophil ⁇ which destroy parasites to lessen parasitic infection and cause chronic inflammation in the airways of the respiratory system,- macrophages which suppress tumor formation in vertebrates; and basophils which release histamine which plays a role in allergic inflammation.
• members of one branch may exert an effect on cells which are normally responsive to the other branch of chemokines and, therefore, no precise role can be attached to the members of the branches.
• polypeptides of the present invention have the conserved cysteine residues, namely Ck3-ll has "C-C” and Ck ⁇ - 1 has "C-X-C” regions, and they have high amino acid sequence homology to known chemokines and have, therefore, been putatively characterized as human chemokines.
• novel polypeptides which are human Ck3-11 and Ck ⁇ -l as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
• nucleic acid molecules encoding such polypeptides, including mR As, DNAs, cDNAs, genomic DNA as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
• nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to Ck
• a process for producing such polypeptides by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a Ckj3-ll or Ckof-1 nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
• a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes for example, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasitic infections, psoriasis, asthma, allergy, to regulate hematopoiesi ⁇ , to stimulate growth factor activity, to inhibit angiogenesis and to promote wound healing.
• antagonists to such polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of certain auto ⁇ immune diseases, atherosclerosis, chronic inflammatory and infectious diseases, histamine and IgE-mediated allergic reactions, prostaglandin-independent fever, bone marrow failure, cancers, silicosis, sarcoidosis, rheumatoid arthritis, shock, hyper-eosinophilic syndrome and fibrosis in the asthmatic lung.
• Figure l displays the cDNA sequence and corresponding deduced amino acid sequence of Ck/3-ll.
• the initial 17 amino acids represent the leader sequence such that the putative mature polypeptide comprises 81 amino acids.
• the standard one-letter abbreviations for amino acids are used.
• Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.) . Sequencing accuracy is predicted to be greater than 97% accurate.
• Figure 2 displays the cDNA sequence and corresponding deduced amino acid sequence of Ck ⁇ -l.
• the initial 22 amino acids represent the leader sequence such that the putative mature polypeptide comprises 87 amino acids.
• the standard one-letter abbreviations for amino acids are used.
• Figure 3 displays the amino acid sequence homology between CkjS-11 (top) and the Rat RANTES polypeptide (bottom) .
• Figure 4 displays the amino acid sequence homology between Ck ⁇ -l and Ovis Aries interleukin-8 (bottom) .
• nucleic acids which encode for the mature polypeptides having the deduced amino acid sequences of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or for the mature polypeptides encoded by the cDNAs of the clones deposited as ATCC Deposit No. 75948 (Ck3-ll) and 75947 (Ck ⁇ -1) on November 11, 1994.
• Polynucleotides encoding Ck3-11 may be isolated from numerous human adult and fetal cDNA libraries, for example, a human fetal spleen cDNA library.
• Ck3-11 is a member of the C-C branch of chemokines. It contains an open reading frame encoding a protein of 98 amino acid residues of which approximately the first 17 amino acids residues are the putative leader sequence such that the mature protein comprises 81 amino acids. The protein exhibits the highest degree of homology to the Rat RANTES polypeptide witn -Ji* identity and 47% similarity over a stretch of 89 amino acids.
• Polynucleotides encoding Ck ⁇ -l may be isolated from numerous human adult and fetal cDNA libraries, for example, human tonsils cDNA library.
• Ck ⁇ -l is a member of the C-X-C branch of chemokines. It contains an open reading frame encoding a protein of 109 amino acid residues of which approximately the first 22 amino acids residues are the putative leader sequence such that the mature protein comprises 87 amino acid ⁇ .
• the protein exhibits the highest degree of homology to interleukin-8 from Sheep (Ovis Aries) with 31% identity and 80% similarity over a stretch of 97 amino acids. It is also important that the four spatially conserved cysteine residues in chemokines are found in the polypeptides.
• the polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
• the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
• the coding sequence which encodes the mature polypeptides may be identical to the coding sequences shown in Figures 1 (SEQ ID No. 1) and 2 (SEQ ID No.
• polynucleotides which encode for the mature polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or for the mature polypeptides encoded by the deposited cDNAs may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non- coding sequence 5' and/or 3' of the coding sequence for the mature polypeptides.
• polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
• the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequences of Figures l (SEQ ID No. 2) and 2 (SEQ ID No. 4) or the polypeptides encoded by the cDNAs of the deposited clones.
• the variant of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant of the polynucleotides.
• the present invention includes polynucleotides encoding the same mature polypeptides as shown in Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or the same mature polypeptides encoded by the cDNA of the deposited clones as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or the polypeptides encoded by the cDNA of the deposited clones.
• Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
• the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequences shown in Figures 1 (SEQ ID No. 1) and 2 (SEQ ID No. 3) or of the coding sequence of the deposited clones.
• an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
• the present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides may be fused in the same reading frame to a polynucleotide sequence which aids in ezxpression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell.
• the polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.
• the polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues.
• a mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.
• the polynucleotides of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence) .
• the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention.
• the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptides fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
• the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
• the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences.
• the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
• stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
• the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptides encoded by the cDNAs of Figures 1 (SEQ ID No. 1) and 2 (SEQ ID No. 3) or the deposited cDNAs.
• the present invention further relates to polypeptides which have the deduced amino acid sequences of Figures l (SEQ ID No. 2 ) and 2 (SEQ ID No. 4) or which have the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptides.
• fragment when referring to the polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or that encoded by the deposited cDNA, means polypeptides which retain essentially the same biological function or activity as such polypeptides.
• an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
• polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.
• the fragment, derivative or analog of the polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4) or that encoded by the deposited cDNAs may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
• Such fragments, derivatives and analogs are deemed to be within
• polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
• isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
• a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
• Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
• the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
• Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
• the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
• the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the Ck/3-11 or Ck ⁇ -l genes.
• the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
• the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
• the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
• Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenoviru ⁇ , fowl pox virus, and pseudorabies.
• any other vector may be used as long as it is replicable and viable in the host.
• the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
• the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
• the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
• promoter for example, LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
• the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
• the vector may also include appropriate sequences for amplifying expression.
• the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
• the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
• bacterial cells such as E. coli. Streptomyces, Salmonella typhimurium
• fungal cells such as yeast
• insect cells such as Drosophila S2 and Spodoptera Sf9
• animal cells such as CHO, COS or Bowes melanoma
• adenoviruses plant cells, etc.
• the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein. More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
• the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
• the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
• regulatory sequences including, for example, a promoter, operably linked to the sequence.
• Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDIO, phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia).
• Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
• any other plasmid or vector may be used as long as they are replicable and viable in the host.
• Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
• Two appropriate vectors are pKK232-8 and pCM7.
• Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
• Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
• the present invention relates to host cells containing the above-described constructs.
• the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
• Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)) .
• constructs in host cells can be used in a conventional manner to produce the gene products encoded by the recombinant sequences.
• polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
• Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
• Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
• recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
• promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
• the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
• the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
• Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
• the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
• Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella tvphimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcu ⁇ , although others may also be employed as a matter of choice.
• useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
• Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemical ⁇ , Uppsala, Sweden) and pGEMl (Pro ega Biotec, Madi ⁇ on, WI, USA) .
• the ⁇ e pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expres ⁇ ed. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
• Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
• Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
• mammalian cell culture systems can also be employed to express recombinant protein.
• mammalian expression system ⁇ include the COS-7 lines of monkey kidney fibrobla ⁇ t ⁇ , described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
• Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any neces ⁇ ary ribo ⁇ ome binding sites, polyadenylation site, splice donor and acceptor site ⁇ , tran ⁇ criptional termination sequences, and 5' flanking nontranscribed ⁇ equence ⁇ .
• DNA sequences derived from the SV40 splice, and polyadenylation site ⁇ may be u ⁇ ed to provide the required nontranscribed genetic elements.
• polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification step ⁇ .
• HPLC high performance liquid chromatography
• polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
• a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
• the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
• Polypeptides of the invention may also include an initial methionine amino acid residue.
• the polynucleotides and polypeptide ⁇ of the pre ⁇ ent invention may be employed a ⁇ re ⁇ earch reagent ⁇ and material ⁇ for di ⁇ covery of treatment ⁇ and diagnostics to human disea ⁇ e.
• the human chemokine polypeptide ⁇ may be employed to inhibit bone marrow ⁇ tem cell colony formation a ⁇ adjunct protective treatment during cancer chemotherapy and for leukemia.
• the human chemokine polypeptides may also be employed to inhibit epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte hyper- proliferation.
• the human chemokine polypeptides may also be employed to treat solid tumors by stimulating the invasion and activation of host defense cells, e.g., cytotoxic T cells and macrophages and by inhibiting the angiogene ⁇ i ⁇ of tumors. They may al ⁇ o be employed to enhance ho ⁇ t defen ⁇ e ⁇ against re ⁇ istant chronic and acute infections, for example, mycobacterial infections via the attraction and activation of microbicidal leukocyte ⁇ .
• the human chemokine polypeptides may also be employed to inhibit T cell proliferation by the inhibition of IL-2 biosynthe ⁇ i ⁇ for the treatment of T-cell mediated auto-immune di ⁇ eases and lymphocytic leukemias.
• Ck3-11 and Ck ⁇ -l may also be employed to stimulate wound healing, both via the recruitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF/3-mediated fibrosi ⁇ .
• Ck/3-11 and Ck ⁇ -l may also be employed to treat other fibrotic disorders, including liver cirrhosis, osteoarthriti ⁇ and pulmonary fibrosis.
• the human chemokine polypeptide ⁇ also increase the presence of eosinophils which have the distinctive function of killing the larvae of parasites that invade tissue ⁇ , a ⁇ in schisto ⁇ omiasis, trichinosis and ascariasis.
• They may also be employed to regulate hematopoiesi ⁇ , by regulating the activation and differentiation of variou ⁇ hematopoietic progenitor cells, for example, to release mature leukocytes from the bone marrow following chemotherapy.
• polynucleotides and polypeptides encoded by such polynucleotides may also be utilized for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors and for designing therapeutics and diagnostics for the treatment of human disease.
• Fragments of the full length Ck/3-11 or Ck ⁇ -l genes may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity.
• Probes of this type generally have at least 20 ba ⁇ es. Preferably, however, the probes have at least bases and generally do not exceed 50 bases, although they may have a greater number of bases.
• the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete genes including regulatory and promotor regions, exon ⁇ , and intron ⁇ .
• An example of a ⁇ creen comprises isolating the coding region of the genes by using the known DNA sequence to synthesize an oligonucleotide probe.
• Labeled oligonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
• This invention is also related to the use of the Ck/3-ll or Ck ⁇ -l gene a ⁇ part of a diagnostic as ⁇ ay for detecting di ⁇ ea ⁇ es or susceptibility to diseases related to the presence of mutations in the Ck/3-11 or Ck ⁇ -l nucleic acid sequences.
• diseases are related to under-expression of the human chemokine polypeptides, for example, tumors and cancers.
• Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
• the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166 (1986)) prior to analysis.
• RNA or cDNA may also be used for the same purpose.
• PCR primers complementary to the nucleic acid encoding Ck/3-11 or Ck ⁇ -l can be used to identify and analyze Ck / 3-11 or Ck ⁇ -l mutations.
• deletions and insertion ⁇ can be detected by a change in size of the amplified product in comparison to the normal genotype.
• Point mutations can be identified by hybridizing amplified DNA to radiolabeled Ck/3-11 or Ck ⁇ -l RNA or alternatively, radiolabeled Ck / 3-11 or Ck ⁇ -l antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNa ⁇ e A digestion or by differences in melting temperatures.
• DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gel ⁇ with or without denaturing agent ⁇ . Small ⁇ equence deletion ⁇ and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distingui ⁇ hed on denaturing formamide gradient gel ⁇ in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985) ) .
• Sequence changes at specific location ⁇ may also be revealed by nuclease protection assays, such a ⁇ RNa ⁇ e and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
• the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA ⁇ equencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphi ⁇ ms (RFLP) ) and Southern blotting of genomic DNA.
• restriction enzymes e.g., Restriction Fragment Length Polymorphi ⁇ ms (RFLP)
• mutations can also be detected by in situ analysis.
• the present invention also relates to a diagnostic assay for detecting altered levels of Ck/3-11 or Ck ⁇ -l protein in various tissues since an over-expression of the proteins compared to normal control ti ⁇ sue samples may detect the presence of a disea ⁇ e or ⁇ u ⁇ ceptibility to a di ⁇ ease, for example, a tumor.
• As ⁇ ay ⁇ u ⁇ ed to detect level ⁇ of Ck / S-ll or Ck ⁇ -l protein in a ⁇ ample derived from a ho ⁇ t are well-known to tho ⁇ e of ⁇ kill in the art and include radioimmunoas ⁇ ays, competitive-binding a ⁇ ay ⁇ , Western Blot analysis, ELISA assays and "sandwich” assay.
• An ELISA as ⁇ ay (Coligan, et al., Current Protocols in Immunology, 1(2), Chapter 6, (1991) ) initially comprises preparing an antibody specific to the Ck/3-11 or Ck ⁇ -l antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody.
• a detectable reagent such as radioactivity, fluorescence or, in this example, a horseradi ⁇ h peroxidase enzyme.
• a sample is removed from a host and incuoateu un * solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein like BSA.
• the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any Ck3-11 or Ck ⁇ -l proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
• the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to
• a competition assay may be employed wherein antibodies specific to Ck/3-11 or Ck ⁇ -l are attached to a solid support and labeled Ck/3-11 or Ck ⁇ -l and a sample derived from the host are passed over the solid support and the amount of label detected, for example by liquid scintillation chromatography, can be correlated to a quantity of Ck/3-11 or Ck ⁇ -l in the sample.
• a “sandwich” assay is similar to an ELISA assay.
• Ck/3-11 or Ck ⁇ -l is passed over a solid support and binds to antibody attached to a solid support.
• a second antibody is then bound to the Ck/3-11 or Ck ⁇ -l.
• a third antibody which is labeled and specific to the second antibody is then passed over the solid support and binds to the second antibody and an amount can then be quantified.
• This invention provides a method for identification of the receptors for the human chemokine polypeptides.
• the gene encoding the receptor can be identified by numerous method ⁇ known to those of skill in the art, for example, ligauid panning and FACS sorting (Coligan, et al., Current Protocol ⁇ in Immun., 1(2), Chapter 5, (1991)) .
• expre ⁇ ion cloning i ⁇ employed wherein polyadenylated RNA is prepared from a cell re ⁇ pon ⁇ ive to the polypeptide ⁇ , and a cDNA library created from thi ⁇ RNA i ⁇ divided into pool ⁇ and u ⁇ ed to transfect COS cells or other cell ⁇ that are not re ⁇ ponsive to the polypeptide ⁇ .
• Tran ⁇ fected cell ⁇ which are grown on glass slides are exposed to the labeled polypeptides.
• the polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site- ⁇ pecific protein kinase.
• the slide ⁇ are subjected to autoradiographic analysis. Positive pools are identified and sub-pool ⁇ are prepared and retran ⁇ fected u ⁇ ing an iterative sub-pooling and rescreening process, eventually yielding a single clones that encodes the putative receptor.
• the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that expre ⁇ the receptor molecule. Cro ⁇ -linked material is re ⁇ olved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptors of the polypeptide ⁇ can be exci ⁇ ed, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid ⁇ equence obtained from micro ⁇ equencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
• This invention provides a method of screening compounds to identify agonists and antagonists to the human chemokine polypeptides of the present invention.
• An agonist is a compound which has similar biological functions of the polypeptides, while antagonist ⁇ block ⁇ uch function ⁇ .
• Chemotaxi ⁇ may be assayed by placing cell ⁇ , which are chemoattracted by either of the polypeptides of the present invention, on top of a filter with pores of sufficient diameter to admit the cells (about 5 ⁇ ) . Solutions of potential agonist ⁇ are placed in the bottom of the chamber with an appropriate control medium in the upper compartment, and thu ⁇ a concentration gradient of the agoni ⁇ t i ⁇ measured by counting cell ⁇ that migrate into or through the porou ⁇ membrane over time.
• the human chemokine polypeptide ⁇ of the present invention are placed in the bottom chamber and the potential antagonist is added to determine if chemotaxis of the cells is prevented.
• a mammalian cell or membrane preparation expressing the receptors of the polypeptides would be incubated with a labeled human chemokine polypeptide, eg. radioactivity, in the presence of the compound. The ability of the compound to block this interaction could then be measured.
• a labeled human chemokine polypeptide eg. radioactivity
• the human chemokines would be absent and the ability of the agonist itself to interact with the receptor could be measured.
• potential Ck/3-11 and Ck ⁇ -l antagonist ⁇ examples include antibodie ⁇ , or in some cases, oligonucleotides, which bind to the polypeptide ⁇ .
• Another example of a potential antagonist i ⁇ a negative dominant mutant of the polypeptide ⁇ . Negative dominant mutant ⁇ are polypeptide ⁇ which bind to the receptor of the wild-type polypeptide, but fail to retain biological activity.
• Antisense constructs prepared using antisense technology are also potential antagonists.
• Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
• the 5' coding portion of the polynucleotide sequence, which encode ⁇ for the mature polypeptide ⁇ of the present invention is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pair ⁇ in length.
• a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple- helix, see Lee et al., Nucl.
• the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptides (antisense - Okano, J. Neurochem. , 56:560 (1991) ; Oligodeoxynucleotides as Antisen ⁇ e Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
• the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expres ⁇ ed in vivo to inhibit production of the human chemokine polypeptides.
• Another potential human chemokine antagonist is a peptide derivative of the polypeptides which are naturally or synthetically modified analogs of the polypeptides that have lost biological function yet still recognize and bind to the receptors of the polypeptides to thereby effectively block the receptors.
• Example ⁇ of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules.
• the antagonists may be employed to inhibit the chemotaxis and activation of macrophage ⁇ and their precur ⁇ or ⁇ , and of neutrophil ⁇ , basophils, B lymphocytes and some T cell subsets, e.g., activated and CD8 cytotoxic T cells and natural killer cells, in certain auto-immune and chronic inflammatory and infective diseases.
• auto-immune diseases include multiple sclerosis, and insulin- dependent diabetes.
• the antagonist ⁇ may also be employed to treat infectious disea ⁇ e ⁇ including ⁇ ilico ⁇ i ⁇ , sarcoidosi ⁇ , idiopathic pulmonary fibrosis by preventing the recruitment and activation of mononuclear phagocytes. They may also be employed to treat idiopathic hyper-eosinophilic syndrome by preventing eosinophil production and migration. Endotoxic shock may also be treated by the antagonist ⁇ by preventing the migration of macrophages and their production of the human chemokine polypeptides of the present invention.
• the antagonist ⁇ may also be employed for treating atherosclerosis, by preventing monocyte infiltration in the artery wall.
• the antagonists may also be employed to treat histamine- mediated allergic reactions and immunological disorders including late phase allergic reactions, chronic urticaria, and atopic dermatitis by inhibiting chemokine-induced mast cell and basophil degranulation and relea ⁇ e of histamine.
• IgE-mediated allergic reactions such as allergic asthma, rhinitis, and eczema may also be treated.
• the antagonist ⁇ may al ⁇ o be employed to treat chronic and acute inflammation by preventing the attraction of monocytes to a wound area. They may also be employed to regulate normal pulmonary acrophage populations, since chronic and acute inflammatory pulmonary diseases are associated with sequestration of mononuclear phagocytes in the lung.
• Antagonists may also be employed to treat rheumatoid arthritis by preventing the attraction of monocytes into synovial fluid in the joints of patients.
• Monocyte influx and activation plays a significant role in the pathogenesi ⁇ of both degenerative and inflammatory arthropathie ⁇ .
• the antagoni ⁇ t ⁇ may be employed to interfere with the deleteriou ⁇ cascades attributed primarily to IL-l and TNF, which prevents the biosynthe ⁇ i ⁇ of other inflammatory cytokine ⁇ . In this way, the antagonists may be employed to prevent inflammation.
• the antagonist ⁇ may al ⁇ o be employed to inhibit pro ⁇ taglandin-independent fever induced by chemokines.
• the antagoni ⁇ ts may also be employed to treat case ⁇ of bone marrow failure, for example, aplastic anemia and myelodysplastic syndrome.
• the antagoni ⁇ ts may also be employed to treat asthma and allergy by preventing eosinophil accumulation in the lung.
• the antagonists may also be employed to treat subepithelial basement membrane fibro ⁇ is which i ⁇ a prominent feature of the asthmatic lung.
• the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., a ⁇ hereinafter described.
• the human chemokine polypeptides and agonists and antagonist ⁇ may be employed in combination with a ⁇ uitable pharmaceutical carrier.
• a ⁇ uitable pharmaceutical carrier Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient.
• a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
• the formulation should suit the mode of administration.
• the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
• As ⁇ ociated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or ⁇ ale of pharmaceutical ⁇ or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
• the polypeptides and agonists and antagonist ⁇ may be employed in conjunction with other therapeutic compound ⁇ .
• compositions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, intratumor, subcutaneous, intrana ⁇ al or intradermal route ⁇ .
• the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.
• the polypeptides will be administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 /*g/kg to about l mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
• human chemokine polypeptides, and agonists or antagonists which are polypeptides may be employed in accordance with the present invention by expres ⁇ ion of such polypeptides in vivo, which is often referred to as "gene therapy. "
• cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
• a polynucleotide DNA or RNA
• cell ⁇ may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
• cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
• a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cell ⁇ in vivo and expression of the polypeptide in vivo.
• the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
• sequences of the present invention are also valuable for chromosome identification.
• the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
• Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
• the mapping of DNAs to chromo ⁇ omes according to the present invention is an important fir ⁇ t ⁇ tep in correlating those sequences with genes associated with disease.
• sequence ⁇ can be mapped to chromo ⁇ ome ⁇ by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly ⁇ elect primer ⁇ that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
• mapping of somatic cell hybrids i ⁇ a rapid procedure for assigning a particular DNA to a particular chromosome.
• ⁇ ublocalization can be achieved with panel ⁇ of fragment ⁇ from ⁇ pecific chromo ⁇ ome ⁇ or pools of large genomic clones in an analogou ⁇ manner.
• Other mapping ⁇ trategie ⁇ that can similarly be used to map to it ⁇ chromosome include in si tu hybridization, pre ⁇ creening with labeled flow- ⁇ orted chromo ⁇ omes and preselection by hybridization to construct chromosome specific-cDNA libraries.
• Fluorescence in situ hybridization (FISH) of a cDNA clones to a metapha ⁇ e chromo ⁇ omal ⁇ pread can be used to provide a precise chromosomal location in one step.
• This technique can be used with cDNA a ⁇ ⁇ hort as 500 or 600 bases,- however, clones larger than that have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
• FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time.
• Verma et al. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .
• a cDNA precisely localized to a chromosomal region associated with the disea ⁇ e could be one of between 50 and 500 potential cau ⁇ ative gene ⁇ . (Thi ⁇ assume ⁇ l megabase mapping resolution and one gene per 20 kb) .
• polypeptides, their fragments or other derivative ⁇ , or analogs thereof, or cells expressing them can be used a ⁇ an immunogen to produce antibodies thereto.
• antibodie ⁇ can be, for example, polyclonal or monoclonal antibodie ⁇ .
• the pre ⁇ ent invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
• Antibodie ⁇ generated again ⁇ t the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptide ⁇ can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expres ⁇ ing that polypeptide.
• any technique which provide ⁇ antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497) , the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lis ⁇ , Inc., pp. 77-96) .
• Plasmids are designated by a lower ca ⁇ e p preceded and/or followed by capital letter ⁇ and/or numbers.
• the starting plasmids herein are either commercially available, publicly available on an unrestricted basi ⁇ , or can be constructed from available plasmid ⁇ in accord with published procedure ⁇ .
• equivalent pla ⁇ mids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
• “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
• the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used a ⁇ would be known to the ordinarily skilled artisan.
• For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
• For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 unit ⁇ of enzyme in a larger volume. Appropriate buffer ⁇ and ⁇ ub ⁇ trate amount ⁇ for particular re ⁇ triction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 * C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
• Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
• Ligase refers to the process of forming phosphodiester bonds between two double ⁇ tranded nucleic acid fragment ⁇ (Maniatis, T. , et al., Id., p. 146). Unles ⁇ otherwi ⁇ e provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
• ligase T4 DNA ligase
• the 5' oligonucleotide primer has the sequence 5' CCCGCATGCCAACTCTGAGTGGCACCA 3' contains a SphI restriction enzyme site (bold) followed by 18 nucleotides of Ck/3-ll coding ⁇ equence (underlined) starting from the second nucleotide of the sequences coding for the mature protein.
• the ATG codon is included in the SphI site.
• the first base i ⁇ from the SphI site and the remaining two bases correspond to the ⁇ econd and third ba ⁇ e of the fir ⁇ t codon (re ⁇ idue 18) of the putative mature protein.
• the 3' sequence 5' CCCGGATCCCAATGCTTGACTCGGACT 3' contains complementary sequences to a BamHl site (bold) and is followed by 18 nucleotide ⁇ of gene specific sequences preceding the termination codon.
• the restriction enzyme site ⁇ correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA) .
• pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a ribosome binding site (RBS) , a 6-His tag and restriction enzyme sites.
• pQE-9 is then digested with SphI and BamHl.
• the amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
• the ligation mixture is then used to transform the E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
• M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
• Transformant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected.
• Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6. IPTG (“Isopropyl-B ⁇ D-thiogalacto pyranoside”) is then added to a final concentration of l mM. IPTG induces by inactivating the lad repressor, clearing the P/0 leading to increased gene expression. Cells are grown an extra 3 to 4 hours.
• Ck/3- 11 is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)).
• Ck/3-ll ( >98% pure) is eluted from the column in 6M guanidine HCl. Protein renaturation out of GnHCl can be accomplished by several protocols (Jaenicke, R. and Rudolph, R.
• step dialysis is utilized to remove the GnHCL.
• the purified protein isolated from the Ni- chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run.
• the protein is allowed to renature while bound to the column and is subsequently eluted with a buffer containing 250 mM Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10% Glycerol.
• soluble protein is dialyzed against a storage buffer containing 5 mM Ammonium Bicarbonate.
• the 5' oligonucleotide primer has the sequence 5' CCCGCATGCCTTCTGGAGGTCTATTACACA 3' contains a SphI re ⁇ triction enzyme site (bold) followed by 21 nucleotides of Ck ⁇ -l coding sequence starting from the second nucleotide of the sequence ⁇ coding for the mature protein.
• the ATG codon is included in the SphI site.
• the first ba ⁇ e i ⁇ from the SphI ⁇ ite and the remaining two ba ⁇ e ⁇ correspond to the second and third base of the first codon (residue 23) of the putative mature protein.
• the 3' sequence 5' CCCGGATCCGGGAAT ⁇ TTCTCTTAAAC 3' contains complementary sequences to a BamHl site (bold) and is followed by 19 nucleotides of gene specific sequence ⁇ preceding the termination codon.
• the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
• pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a ribosome binding site (RBS) , a -His tag and restriction enzyme sites. pQE-9 is then digested with antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a ribosome binding site (RBS) , a -His tag and restriction enzyme sites. pQE-9 is then digested with antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a ribosome binding site (RBS) , a -His tag and restriction enzyme sites. pQE-9 is then digested with antibiotic resistance (Amp r ) , a
• the amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
• the ligation mixture is then used to transform the E. coli M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular
• M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
• Transformants are identified by their ability to grow on LB plate ⁇ and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA i ⁇ isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D. 600 ) of between 0.4 and
• IPTG Isopropyl-B-D-thiogalacto pyranoside
• IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
• Cells are grown an extra 3 to 4 hour ⁇ .
• Cell ⁇ are then harvested by centrifugation.
• the cell pellet is solubilized in the chaotropic agent 6 Molar
• the purified protein isolated from the Ni- chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run.
• the protein is allowed to renature while bound to the column a-nd is sub ⁇ equently eluted with a buffer containing 250 mM Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10% Glycerol. Finally, soluble protein is dialyzed against a storage buffer containing 5 mM Ammonium Bicarbonate.
• the HA tag corre ⁇ pond to an epitope derived from the influenza hemagglutinin protein as previously de ⁇ cribed (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767) .
• the infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
• the plasmid construction strategy is described as follows:
• the PCR product contain ⁇ a HindiII ⁇ ite, Ck/3-11 coding ⁇ equence followed by HA tag fu ⁇ ed in frame, a tran ⁇ lation termination stop codon next to the HA tag, and an Xbal site.
• the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with HindiII and Xbal restriction enzyme and ligated.
• the ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning System ⁇ , La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analy ⁇ i ⁇ for the pre ⁇ ence of the correct fragment.
• COS cells are transfected with the expression vector by DEAE- DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Pre ⁇ , (1989)).
• the expression of the Ck/3-ll HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours with 5 S-cysteine two days post transfection.
• the expres ⁇ ion of pla ⁇ mid, Ck ⁇ -l HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
• a DNA fragment encoding the entire Ck ⁇ -l precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombina-nt protein expression is directed under the CMV promoter.
• the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I.
• HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
• the plasmid construction strategy is described as follows:
• the DNA sequence encoding for Ck ⁇ -l, ATCC # 75947, is constructed by PCR using two primer ⁇ : the 5' primer 5' AAAAAGCTTAGAATGAAGTTCATCTCG 3' contains a Hindi11 site followed by 18 nucleotides of Ck ⁇ -l coding sequence ⁇ tarting from the minu ⁇ 3 po ⁇ ition relative to the initiation codon; the 3' sequence 5' CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTAG GGAATCTTTCTCTT 3' contains complementary sequences to an Xbal site, tran ⁇ lation ⁇ top codon, HA tag and the la ⁇ t 18 nucleotides of the Ck ⁇ -l coding ⁇ equence (not including the stop codon) .
• the PCR product contains a Hindlll site, Ck ⁇ -l coding sequence followed by HA tag fused in frame, a tran ⁇ lation termination ⁇ top codon next to the HA tag, and an Xbal site.
• the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with Hindi11 and an Xbal restriction enzyme and ligated.
• the ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning
• the transformed culture is plated on ampicillin media plates and resistant colonies are selected.
• Plasmid DNA is isolated from tra-nsformants and examined by restriction analysis for the presence of the correct fragment.
• COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Me-niatis, Molecular
• Both cell lysate and culture media are precipitated with a HA specific monoclonal antibody. Proteins precipitated are analyzed by SDS-PAGE.
• the DNA sequence encoding the full length Ck/3-ll protein, ATCC # 75948, is ampli ied using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
• the 5' primer has the sequence 5' CGCGGGATCCGCCATCATG GCCCTGCTACTGGCCCT 3' auid contains a BamHl restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) which is just behind the first 20 nucleotides of the Ck/3-11 gene (the initiation codon for translation "ATG" is underlined) .
• the 3' primer has the sequence 5' CX3GCGGTACCTGGCTGCACGGTCCATAGG 3' and contains the cleavage site for the restriction endonuclea ⁇ e Asp78l and 19 nucleotides complementary to the 3' non-translated sequence of the Ck/3-11 gene.
• the amplified ⁇ equences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment i ⁇ then dige ⁇ ted with the endonucleases BamHl and Asp781 and then purified again on a 1% agarose gel. This fragment i ⁇ de ⁇ ignated F2.
• the vector pRGl (modification of pVL941 vector, discussed below) is used for the expression of the Ck/3-ll protein using the baculoviru ⁇ expression system (for review see: Summers, M.D. auid Smith, G.E. 1987, A manual of methods for baculovirus vector ⁇ auid insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
• Thi ⁇ expre ⁇ ion vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosi ⁇ virus (AcMNPV) followed by the recognition ⁇ ite ⁇ for the restriction endonuclease ⁇ BamHl and A ⁇ p78l.
• the polyadenylation site of the simian viru ⁇ (SV)40 i ⁇ u ⁇ ed for efficient polyadenylation.
• the beta-galactosidase gene from E.coli is inserted in the same orientation a ⁇ the polyhedrin promoter followed by the polyadenylation ⁇ ignal of the polyhedrin gene.
• the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
• baculovirus vectors could be u ⁇ ed in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D. , Virology, 170:31-39).
• the plasmid i ⁇ digested with the restriction enzymes BamHl and Asp781 and then dephosphorylated using calf intestinal phosphata ⁇ e by procedure ⁇ known in the art.
• the DNA i ⁇ then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated V2.
• Fragment F2 and the dephosphorylated pla ⁇ mid V2 are ligated with T4 DNA ligase.
• E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBac-Ck/3-11) with the CK/3-11 gene using the enzyme ⁇ BamHl and Asp781. The sequence of the cloned fragment is confirmed by DNA sequencing.
• the plate is then incubated for 5 hour ⁇ at 27°C. After 5 hour ⁇ the transfection solution i ⁇ removed from the plate and l ml of Grace' ⁇ in ⁇ ect medium ⁇ upplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation continued at 27°C for four days.
• plaque assay After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) i ⁇ u ⁇ ed which allow ⁇ an ea ⁇ y isolation of blue stained plaques. (A detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaither ⁇ burg, page 9- 10) .
• the viruses are added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
• the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace' ⁇ medium.
• the agar i ⁇ removed by a brief centrifugation and the supernatant containing the recombinant baculovirus i ⁇ used to infect Sf9 cell ⁇ ⁇ eeded in 35 mm dishes.
• the supernatants of these culture dishes are harvested and then stored at 4°C.
• Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
• the cells are infected with the recombinant baculoviru ⁇ V-CK/3-11 at a multiplicity of infection (MOD of 2.
• MOD multiplicity of infection
• the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg).
• 42 hour ⁇ later 5 ⁇ Ci of 3i S-methionine and 5 ⁇ Ci 35 S cysteine (Amersham) are added.
• the cell ⁇ are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
• the DNA sequence encoding the full length Ck ⁇ -l protein, ATCC # 75947, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequence ⁇ of the gene:
• the 5' primer ha ⁇ the ⁇ equence 5' GCCGGATCCGCCATC ATGAAGTTCATCTCGACATC 3' and contain ⁇ a BamHl ' restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) which is just behind the first 20 nucleotides of the Ck ⁇ -l gene (the initiation codon for translation "ATG" is underlined) .
• the 3' primer has the sequence 5' CGCGGGTACCGG TGTTCTTAGTGGAAA 3' and contains the cleavage site for the restriction endonuclease Asp781 (in bold) and 17 nucleotides complementary to the 3' non-translated sequence of the Ck ⁇ -l gene.
• the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) .
• the fragment is then digested with the endonucleases BamHl and Asp781 and then purified again on a 1% agarose gel. This fragment is designated F2.
• the vector pRGl (modification of pVL941 vector, discussed below) is used for the expression of the Ck ⁇ -l protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
• Thi ⁇ expres ⁇ ion vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosi ⁇ viru ⁇ (AcMNPV) followed by the recognition site ⁇ for the re ⁇ triction endonucleases BamHl and Asp781.
• the polyadenylation site of the simian virus (SV)40 i ⁇ used for efficient polyadenylation.
• the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
• the polyhedrin sequence ⁇ are flanked at both ⁇ ide ⁇ by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
• Many other baculovirus vector ⁇ could be u ⁇ ed in place of pRGl such as pAc373, pVL941 atnd pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
• the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA i ⁇ de ⁇ ignated V2.
• Fragment F2 and the depho ⁇ phorylated plasmid V2 are ligated with T4 DNA ligase.
• E.coli HB101 cell ⁇ are then transformed and bacteria identified that contained the plasmid (pBac-Ck ⁇ -1) with the Ck ⁇ -l gene using the enzymes BAmHI and Asp781.
• the sequence of the cloned fragment is confirmed by DNA sequencing.
• the plate is rocked back and forth to mix the newly added solution.
• the plate i ⁇ then incubated for 5 hour ⁇ at 27°C.
• the tran ⁇ fection ⁇ olution i ⁇ removed from the plate and 1 ml of Grace' ⁇ in ⁇ ect medium ⁇ upplemented with 10% fetal calf ⁇ erum is added.
• the plate i ⁇ put back into an incubator and cultivation continued at 27°C for four day ⁇ .
• plaque assay performed similar as described by Summers and Smith (supra) .
• an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) i ⁇ used which allows an easy isolation of blue ⁇ tained plaque ⁇ .
• the viruses are added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
• the agar containing the recombinant viruse ⁇ i ⁇ then re ⁇ u ⁇ pended in an Eppendorf tube containing 200 ⁇ l of Grace' ⁇ medium.
• the agar i ⁇ removed by a brief centrifugation and the ⁇ upernatant containing the recombinant baculoviru ⁇ is used to infect Sf9 cell ⁇ seeded in 35 mm dishes. Four days later the supernatant ⁇ of these culture dishes are harvested and then stored at 4°C.
• Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
• the cells are infected with the recombinant baculovirus V-Ck ⁇ -l at a multiplicity of infection (MOD of 2.
• MOD multiplicity of infection
• the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologie ⁇ Inc., Gaither ⁇ burg, MD) .
• the cell ⁇ are further incubated for 16 hour ⁇ before they are harve ⁇ ted by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
• ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
• MOLECULE TYPE PROTEIN
• Gin Pro Trp Val Glu Arg lie lie Gin Arg Leu Gin Arg Thr Ser
• MOLECULE TYPE Oligonucleotide (Xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 10 :

Applications Claiming Priority (1)

Publications (2)

Family

ID=22248655

Family Applications (1)

Country Status (4)

Families Citing this family (17)

Citations (3)

Family Cites Families (2)

• 1995
  • 1995-02-08 JP JP8524230A patent/JPH10513355A/ja not_active Ceased
  • 1995-02-08 EP EP95911695A patent/EP0811059A4/de not_active Withdrawn
  • 1995-02-08 AU AU19167/95A patent/AU1916795A/en not_active Abandoned
  • 1995-02-08 WO PCT/US1995/001780 patent/WO1996024668A1/en not_active Application Discontinuation

Patent Citations (3)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events