EP0804604A2 - Verfahren zum verbesseren der screening-leistungsfähigkeit in fusionierten zellen - Google Patents

Verfahren zum verbesseren der screening-leistungsfähigkeit in fusionierten zellen

Info

Publication number
EP0804604A2
EP0804604A2 EP96905259A EP96905259A EP0804604A2 EP 0804604 A2 EP0804604 A2 EP 0804604A2 EP 96905259 A EP96905259 A EP 96905259A EP 96905259 A EP96905259 A EP 96905259A EP 0804604 A2 EP0804604 A2 EP 0804604A2
Authority
EP
European Patent Office
Prior art keywords
cells
fusion
human
cell line
yac
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96905259A
Other languages
English (en)
French (fr)
Inventor
Aya Jakobovitz
Margaret C. Hardy
Larry Green
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Fremont Inc
Original Assignee
Cell Genesys Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cell Genesys Inc filed Critical Cell Genesys Inc
Publication of EP0804604A2 publication Critical patent/EP0804604A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • C12N5/12Fused cells, e.g. hybridomas
    • C12N5/16Animal cells
    • C12N5/163Animal cells one of the fusion partners being a B or a T lymphocyte
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • C12N5/12Fused cells, e.g. hybridomas
    • C12N5/16Animal cells

Definitions

  • the invention is directed a method to increase the percentage of fused cell colonies which contain a desired genomic feature. More specifically, the invention concerns providing a marker proximal to the desired genomic feature which will permit an immortalizing cell to grow under conditions to which it would otherwise be sensitive.
  • the immortalizing cell line will typically be a "transformed" or tumor cell line. In the fused cell, whatever it was that conferred immortality on the transformed cell is retained in the fused product.
  • the fusion procedure is generally conducted so that only fused cells can survive on a culture medium, thus automatically selecting only the colonies of successfully fused products.
  • This has typically been arranged by using, as the immortalizing cells, cells of a tumor cell line that has phenotypic characteristics making it sensitive to certain medium conditions. Unfused nontransformed cells are unable to grow, because they are not immortal. However, the medium must be chosen to take advantage of the sensitivity of the transformed cell line to the relevant conditions to prevent the growth of colonies of unfused transformed cells.
  • a very commonly used sensitivity is the inability to grow on hypoxanthine-aminopterin-thymidine (HAT) medium, a medium which requires the presence of the enzyme hypoxanthine phosphoribosyl transferase (HPRT) in order for cells to grow.
  • HAT hypoxanthine-aminopterin-thymidine
  • HPRT hypoxanthine phosphoribosyl transferase
  • the immortalizing cell line is deficient in the production of this enzyme by virtue of its own genetic characteristics. If the fusion mixture is cultured on HAT medium, then, the immortal cells are unable to grow because they lack HPRT. Only fused cells are able to grow because they are both immortal and produce HPRT by virtue of the ability of the nontransformed cell to do so.
  • the fusion technique of Kohler and Milstein was an adaptation of cell fusion procedures to obtain immortalized B cells which are capable of secreting monoclonal antibodies with desired characteristics. It was employed by immunizing an animal with the antigen to wnich antibody is desired, harvesting the B cells from the spleen or peripheral blood lymphocytes (PBLs) , fusing the 3 cells with an immortalizing cell line, selecting for fused cells, and screening individual colonies of fused cells for secretion of the desired antibody.
  • PBLs peripheral blood lymphocytes
  • the present invention offers a method to minimize the second reason for obtaining numbers of successful colonies which nevertheless do not contain genes for the desired antibody or other genomic component.
  • the invention provides a modification of the Kohler/Milstein fusion technique which results in a higher percentage of successful fusions containing a desired genomic component. This is especially useful when the genomic component is the set of loci required to produce immunoglobulin.
  • the DNA on which the desired genomic component resides is itself modified to contain a marker which is capable of overcoming the sensitivity of the immortalizing cell intended to be used as a fusion partner.
  • "background" markers such as HPRT, native to the nontransformed cell containing the desired genomic component, are not required to permit growth on medium conditions to which the immortalizing cell line is sensitive. In an ideal case, the marker may not even be present in the background genomic complement of the nontransformed cell.
  • the invention is directed to a method to improve the percentage of colonies of fused cells that contain a desired genomic component, which fused cells are obtained by the fusion of nontransformed animal, especially mammalian or avian, cells containing said desired genomic component with cells of a transformed cell line sensitive to predetermined medium conditions
  • a method comprises: providing said desired genomic component with a marker that overcomes the sensitivity of the cells of the transformed cell line to the medium conditions; mixing said nontransformed animal cells with cells of said transformed cell line under conditions that promote fusion, to obtain a fusion mixture; selecting for fused cell colonies by culturing said fusion mixture under said predetermined medium conditions; and screening successful colonies for the presence of said desired genomic component.
  • the invention is directed to immortalized cell lines produced by the method of the invention and to methods of producing desired products by culturing these cells.
  • Figures 1 A-E include photographs of the results of Southern blot analysis to characterize yHPRT and yeast genomic DNA integrated in ES clones as described in Example 2.
  • A is the human repetitive Alu sequence.
  • B and C are pBR-specific sequences for right and left YAC arms, respectively.
  • D is the yeast Ty repetitive sequence.
  • E is yeast single-copy gene LYS2.
  • Figures 2 A-D are photomicrographs of the results of in si tu hybridization to detect integration of yHPRT and yeast genomic sequences in ES cell chromosomes as described in Example 2.
  • a and B are metaphase spreads from ESY8-7 cells hybridized to biotinylated human genomic sequences.
  • C and D represent metaphase spreads or interphase nuclei from ESY8-6 cells hybridized to biotinylated yeast repeated DNA sequences.
  • Figures 3 A-C demonstrate the stable retention of yHPRT during in vi tro ES cell differentiation and transmission through the mouse germline described in Example 2.
  • Figures 4 A and B are photographs of an electrophoresis gel showing the expression of the human HPRT gene in various mouse tissues as described in Example 2.
  • Figure 5 is a diagram of a mouse breeding scheme as described in Example 3.
  • the invention method is similar to that commonly used to obtain immortalized cells capable of secreting antibodies except that the genomic component, e.g., the loci encoding the heavy and light chains of an antibody are proximal on a DNA sequence to the gene encoding a marker such as HPRT or neomycin gene.
  • the genomic component e.g., the loci encoding the heavy and light chains of an antibody are proximal on a DNA sequence to the gene encoding a marker such as HPRT or neomycin gene.
  • nontransformed cells refers to cells which are incapable of indefinite growth in culture, and are thus not immortal. These cells are not "cell lines" -- i.e., they cannot be repeatedly passaged. Examples of nontransformed cells include most normal animal, preferably mammalian or avian, cells that have already been differentiated and that are not malignant. Most commonly used are B cells, but other nontransformed cells, to the extent that they may be desirable producers of a desired protein could also be used. Thus, suitable nontransformed cells might also include T-lymphocytes, muscle cells, pituitary cells, pancreatic cells, and the like.
  • transformed cells refer to cells that have acquired the ability to passage indefinitely and can thus be established as cell lines.
  • a large number of cell lines is known in the art, including HeLa cells, CHO cells, COS cells and a large number of murine myeloma cell lines.
  • the transformed cells In order to be useful in the method of the invention, the transformed cells must also have a characteristic which confers sensitivity to particular growing conditions, which sensitivity can be reversed by the production of one or more gene products obtainable from a nontransformed fusion partner.
  • Fusion cell line refers to the products of successful fusions -- i.e., fusions wherein an immortalized or transformed cell has successfully fused with a nontransformed cell that contains a desired genomic compound.
  • genomic component refers to a portion of DNA in the genomic complement of the nontransformed cell which is desired to be transferred to the progeny of the fused cell line.
  • the genomic component may be an expression system for a single gene, such as, for example, the gene encoding a growth factor or hormone.
  • the "genomic component" involves more than one expression system for more than one gene.
  • the relevant genomic component consists of an expression system for an immunoglobulin heavy chain and an expression system for an immunoglobulin light chain (or the appropriate portions thereof) wherein the resulting antibody is i munoreactive with a particular target antigen.
  • expression system does not necessarily refer to cloned protein-encoding DNA manipulated so as to be operably linked to heterologous promoters, although such constructs are included.
  • sections of genomic DNA which include both expression control sequences and protein encoding sequences.
  • expression systems for immunoglobulins envisioned in the present invention include both rearranged coding sequences for particular immunoglobulins and unrearranged genomic loci.
  • mice were obtained by inserting the unrearranged human heavy- and light-chain immunoglobulin loci into murine embryonic stem cells (ES cells) using vectors or yeast spheroplasts, wherein the human loci were contained on yeast artificial chromosomes (YACs) and marked with a selection marker. Both the neomycin resistance gene (the "neo" gene) and the HPRT gene are described as markers. The resulting ES cells are selected for uptake of the appropriate YAC by means of the marker used. Through use of the YAC-containing ES cells to obtain chimeric mice and subsequent cross-breeding, mice were obtained which contained unrearranged human heavy- chain and light-chain loci in their genomic complement.
  • YACs yeast artificial chromosomes
  • the markers are contained proximal to the immunoglobulin loci.
  • B cells are harvested and fused with immortalizing cells to obtain colonies producing the desired antibodies.
  • the desired genomic component i.e., the immunoglobulin heavy- and light-chain loci
  • the desired genomic component already contains markers proximal to the relevant component on the same DNA sequence.
  • the successful colonies will include only fusions which contain in their progeny the background HPRT on the X-chromosome.
  • those fusions which do not contain one or both immunoglobulin loci, but only the background HPRT gene will not be weeded out of the pool; and the pool will include fusions with the X-linked HPRT, but neither or only one of the Ig loci.
  • media containing G418 could be used as a selection medium for the B cell/myeloma fusion provided the neo gene was used as a marker or otherwise included on the inserted genome for the ES cell modification.
  • a marker proximal to immunoglobulin loci need not be an incidental result of the use of markers in transforming ES cells in selecting for successful transformants.
  • the marker can be provided, for example, adjacent a desired locus either in addition to another marker with respect to ES cell transformation or can simply be included when the locus is inserted into fertilized eggs by microinjection. In this procedure, no selection is needed; the offspring are simply tested as appropriate to see whether the desired characteristics have been successfully included in the genome. Nevertheless, the loci representing the desired characteristics can readily be provided a desired marker using standard recombinant techniques.
  • the method can further be refined by using multiple markers when multiple genes comprise the genomic component desired to be transmitted to the fused cell progeny.
  • the light chain might be provided with a neo marker and the heavy chain provided with an HPRT marker.
  • a G418-containing HAT medium would be used for selection and surviving progeny must contain at least the immunoglobulin light chain and either the immunoglobulin heavy chain or the X-chromosome-based HPRT marker.
  • the gene for hygromycin resistance can be used as a marker in the method of the invention.
  • a more straightforward illustration of the method of the invention can employ nontransformed cells that have sufficient survival characteristics that they can be selected for successful homologous recombination. B cells are not preferred for use in this illustration since their survival time in culture appears to be unacceptably short. However, some T cell clones and other cells which exhibit useful properties or produce useful products and which are not immortal are able to survive sufficient passages in culture that they are useful candidates for homologous recombination to insert a marker.
  • the nontransformed primary cells are treated under conditions that effect DNA uptake with a vector which contains, for example, the neo-resistance gene bracketed by sequences homologous to those found immediately upstream or downstream of the genomic component disired.
  • a vector which contains, for example, the neo-resistance gene bracketed by sequences homologous to those found immediately upstream or downstream of the genomic component disired.
  • Successful transformants which incorporate the neo gene into the DNA sequence that includes the genomic component by homologous recombination can then be selected by growth on G418-containing medium.
  • the resulting nontransformed primary cells ' then contain G418 resistance encoded proximal to the regions that contain the desired genomic compenent.
  • the immortalizing cell line In the standard fusion protocol, the immortalizing cell line, sensitive to G418, requires successful fusion to survive on G418-containing medium. Successfully fused cells capable of surviving on medium containing G418 must acquire this capability from the nontransformed cell. Since the neo-resistance gene travels with the desired genomic component, it is assured that this component is transferred to the progeny.
  • HPRT is introduced proximal co the desired genomic component. In this case, direct selection after homologous recombination in many primary cells cannot conveniently be used since such cells in general already contain an HPRT gene on the X chromosome.
  • transgenic animals have been prepared by inserting immunoglobulin genes into fertilized eggs or ES cells.
  • HPRT can be introduced directly along with the desired genes.
  • both heavy and light chain encoding genes can be assured to be proximal to the HPRT encoding region.
  • One clone is obtained which is estimated to be about 100 kb.
  • the isolated YAC clone is characterized by pulsed-field gel electrophoresis (Burke ⁇ _£ al- > supra; Brownstein ££. al- # Science. 244: 1348-1351) , using probes for the human heavy chain (Berman ££. al . , supra) .
  • High molecular weight DNA is prepared in agarose plugs from yeast cells containing the YAC of interest (i.e., a YAC containing the aforementioned Spel fragment from the IgH locus) .
  • the DNA is size-fractionated on a CHEF gel apparatus and the YAC band is cut out of the low melting point agarose gel.
  • the gel fragment is equilibrated with polyamines and then melted and treated with agarase to digest the agarose.
  • the polyamine-coated DNA is then injected into the male pronucleus of fertilized mouse embryos which are then surgically introduced into the uterus of a psueudopregnant female as described above.
  • transgenic nature of the newborns is analyzed by a slot-blot of DNA isolated from tails and the production of human heavy chain is analyzed by obtaining a small amount of serum and testing it for the presence of Ig chains with rabbit anti-human antibodies.
  • YAC DNA is transferred into murine ES cells by ES cell: yeast protoplast fusion (Traver fit al- . (1989) Proc. Natl. Acad.- Sci.. USA, £1:5898-5902; Pachnis ££ al- • (1990), ibid 87: 5109-5113) .
  • the neomycin-resistance gene from pMClNeo or HPRT or other mammalian selectable marker and a yeast selectable marker are inserted into nonessential YAC vector sequences in a plasmid.
  • This construct is used to transform a yeast strain containing the IgH YAC, and pMClNeo (or other selectable marker) is integrated into vector sequences of the IgH YAC by homologous recombination.
  • the modified YAC is then transferred into an ES cell by protoplast fusion (Traver e_£ al- (1989); Pachnis fit al- .
  • G418-resistant ES cells or exhibiting another selectable phenotype which contain the intact human IgH sequences are used to generate chimeric mice.
  • a purified YAC is transfected, for example by lipofection or calcium phosphate-mediated DNA transfer, into ES cells.
  • GAG CCT GCT GAA TTC TGG CTG 3' and V6B- 5' GTA ATA CAC AGC CGT GTC CTG G 3' were used to screen DNA pools from the Washington University human YAC library (Washington University, St. Louis, MO) . Positive pools were subsequently screened by colony hybridization and one positive microtiter plate well, A287-C10, was identified. Two different sized (205 kb and 215 kb) VH6-containing YACs were isolated from the microtiter well..
  • the YACs contained sequences from at least 5 VH genes including two VHl genes, one VH2, one VH4 and one - 15 -
  • VH6 gene Analysis of restriction digests indicated that the 205 kb YAC contains a deletion (about 20 kb size) that removes some, but not all of the D gene cluster, with the remainder of the YAC appearing * be intact and in germline configuration.
  • PCR and detailed restriction digest analysis of the 205 kb YAC demonstrated the presence of several different D gene family members. The 215 kb YAC appeared to contain the complete major D gene cluster but had a deletion (about 10 kb) that removed the mu gene. This deletion does not appear to affect the JH cluster or the enhancer located between JH and mu genes.
  • IgH.YAC contained a 230 kb IgH.YAC-with another apparently unrelated YAC.
  • Clone 1 contained in addition the IgH YAC, an approximately 220 kb YAC and clone 3 in addition contained an approximately 400 kb YAC.
  • the IgH YAC contained mu, .the complete D profile (based on a BamHI digest, see below) and JH.
  • the IgH YAC from clone 1 was physically separated from the unrelated YAC by meiotic segregation in a cross between A2 ⁇ 7-C10/AB1380 and YPH857 (genotype - MAT ⁇ ade2 lys2 ur;a3 trpl HISS. CANl Jiifll leu2 cyh2. to yield A287-C10 (230 kb)/MP 313 (host genotype - MAT ⁇ ade2 leu2 lys2 fcisl _L____L trpl canl cyh2) .
  • HPRT A YAC right arm targeting vector called pLUTO
  • the J-mu intronic enhancer which was sequenced from cloned PCR products from the A287-C10 230 kb YAC (primers EnA - 5' TTC CGG CCC CGA TGC GGG ACT GC 3' and EnBl - 5' CCT CTC CCT AAG ACT 3') and determined to be intact, also generated single restriction fragments of approximately the predicted sizes with BamHI, EcoRI and Hindlll when probed with the 480 bp PCR product.
  • the JH region was evaluated with an approximately 6 kb BamHI/HindiII fragment probe spanning DHQ52 and the entire JH region (Ravetch et al., 1981, Cell 27:583-591) .
  • A287-C10 generated restriction fragments of approximately the expected sizes. Furthermore, the same-sized restriction fragments were detected with the enhancer and the JH probes (Ravetch et al., supra: Shin et al. , 1991, su ⁇ ia) • The approximately 18 kb BamHI JH fragment detected in A287-C10 and WI38 also hybridized to a 0.9 kb mu probe sequence (Ravetch et al., supra) .
  • the 3' cloning site of the YAC may be the first EcoRI site 3' of delta (Shin et al., flUE ⁇ a) or another EcoRI site further 3' .
  • VH gene probes for VHl, VH4 and VH6 (Berman et al., siUBi ) , and for VH2 (Takahashi et al., 1984, Proc. Nat. Acad. Sci. USA 81:5194-5198. were used to evaluate the variable gene content of the YAC.
  • A287- C10 contains two VHl genes that approximate the predicted sizes (Shin et al., fiUEEa; Matsuda et al. , 1993, supra) : restriction analysis with the three enzymes gave close to the expected fragment sies; e.g. with EcoRI observed bands are 3.4 and 7.8 kb (expected are 3.4 and 7.2 kb) .
  • YACs Two YACs were identified in a screen of pulsed- field gel (PFG) pools from the Washington University (St. Louis, MO) human YAC library with a probe from the human kappa constant region (CK) gene (2.5 kb EcoRI fragment ATCC No. 59173, Parklaw Dr., Rockville, MD) .
  • the YACs designated A80-C7 (170 kb) and A276-F2 (320 kb) , contain the kappa deleting element, kde. CK, JK and the C-J intronic enhancer and extend 3' beyond kde.
  • the YACs also, contain the Bl, B2 and B3 VK genes determined by hybridization and/or PCR, and possibly other VK sequences.
  • the A80-C7/AB1380 strain housed, in addition to the IgK YAC, . an unrelated YAC of similar size. Therefore, meiotic segregation was used to separate these YACs; A80-C7 was crossed to YPH857 and a meiotic product was obtained which contained only the IgK YAC (MP8-2; host genotype - ⁇ ad___2. Ifitt2. hifll hiflS- lys2 ura3 t_CEl canl cvh2) .
  • the A ⁇ -C7 and A276--F2 YACs have been targeted with pLUTO to incorporate the human HPRT minigene into the YAC right vector arm.
  • the B3 class IV gene (probe is a 123 bp PCR product from the B3- gene) gives a 4.9 kb BamHI and a 2.2 kb Bglll fragment, close to the published values of 4.6 kb and 2.3- kb, respectively (Lorenz et al., Mole . Immunol ' . 25:479-484 (1988)).
  • the 680 kb yHPRT is a YAC- containing a functional copy of the human hypoxanthine phosphorib ⁇ syltransferase (HPRT) gene- cloned from a YAC library, as described in Huxley, et al. (1991) Genomics £:742-750.
  • the yeast strain containing the yHPRT was grown in uracil and tryptophan deficient liquid media, as described in Huxley, et al. (1991) siiS£---
  • the yeast pellet was resuspended in SPEM (1 M sorbitol, 10 mM sodium phosphate pH 7.5, 10 mM EDTA pH 8.0, 30 mM /5-mercaptoethanol) at a concentration of 5 x 10 8 yeast cells/ml.
  • Zymolase 20T was added at a concentration of 150 ⁇ g/ml of yeast cells, and the culture was incubated at 30 ⁇ c until 90% of the cells were spheroplasts (usually for 15-20 minutes)-.
  • the cells were washed twice in STC (1 M sorbitol, 10 mM Tris pH 7.5, 10 mM CaCl 2 ) and resuspended in STC at a concentration of 2.5 x loVml.
  • E14TG2a HPRT-negative ES cell line E14TG2a was cultured on mitomycin C-treated embryonic fibroblast feeder layers as described by Roller, etr al . PNAS (1989) ££i8932-8935.
  • E14TG2a ES cells growing on gelatin*coated dishes were tryp ⁇ inized and washed three times with serum-free DMEM-.
  • a pellet of 2.5xl0 8 yeast spheroplasts- was carefully overlaid with 5xl0 6 ES cells which were spun down onto the yeast pellet.
  • the combined pellet was resuspended in 0.5 ml of either 50% polyethylene glycol (PEG) 1500- or 50%-PEG 4000 (Boeringer Mannheim) containing 10' mM CaC12. After 1.5 minutes incubation at room 'temperature or at 37 ⁇ C, 5 ml of serum- free DMEM were added slowly, and the cells were left-at room temperature for 30 minutes.
  • PEG polyethylene glycol
  • 50%-PEG 4000 Boeringer Mannheim
  • ES cell complete medium 10 ml of ES cell complete medium (as previously described) and were plated onto one 100 mm plate coated with feeder cells. After 24 hours the medium was replaced with fresh medium. Forty-eight hours post-fusion, HAT (ES media containing lxlO" 4 M hypoxanthine, 4x10 "7 M aminopterin, l.6xl0" 5 thymidine) selection was imposed. HAT-resistant ES colonies were observed 7-10 days post-fusion in the plates from both the different fusion conditions used. yHPRT-ES ("ESY”) fusion colonies were picked and plated onto feeder-coated wells, and expanded for further analysis.
  • HAT ES media containing lxlO" 4 M hypoxanthine, 4x10 "7 M aminopterin, l.6xl0" 5 thymidine
  • the Alu probe was a 300 bp BamHI fragment from the BLUR8 Alu element in pBP63A (Pavan et al., Proc. Natl. Acad. Sci. USA 78:1300-1304 (1990)).
  • the right and left vector arm probes were pBR322-derived BamHI-PvuII 1.7 and 2.7 kb fragments, respectively, which correspond to the vector sequences in pYAC4 (scheme a, b (Burke et al., n: Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, ⁇ 3uthri_e and Fink, eds., Academic Press, 124:251-270 (1991)).
  • the difference in the hybridization intensity of these two bands relates to the difference in the amount of homology between these fragments and the probe.
  • the yeast Ty repetitive probe Philippsen et al. , n Gene Expression in Yeast, Proceedings of the Alko Yeast Symposium, Helsinki, Korhola and Vaisanen, ed ⁇ ., Foundation for Biofcechnical and
  • Hybridization with -human HPRT-probe full length 1.6 kb cDNA probe.
  • -demonstrated that all.the clones analyzed contained the same 15, 7 and 5 kb exon-containing fragments o 'the human HPRT gene as the yHPRT YAC.
  • Reprobing the same blots with a human repetitive Alu sequence 300 bp probe indicated that all the clones analyzed contained most, if not all, the Alu-containing fragments present in yHPRT ( Figure 1A) .
  • yHPRT The structural integrity of yHPRT in ESY clones was further evaluated for two clones (ESY 5-2 and 8-7) using pulsed-field gel restriction analysis.
  • yeast carrying yHPRT five Sfi fragments of the following approximate sizes were defined by different probes: 315 kb (Alu, left arm) , 14S kb (Alu, HPRT) ; 95 kb (Alu, right arm) , 70 and 50 kb (Alu only) .
  • the internal. HPRT and Alu-specific fragments were similar in size to the yHPRT fragments.
  • the human probe was generated from human genomic placental DNA (Clontech, Palo Alto, CA) .
  • the yeast probe consisted of a mix of DNA fragments encoding the yeast repeated elements; delta (a 1.08 kb Sau3A fragment of pdelta ⁇ . JGafner et al. , EMBO J. 2:583-591 (1983)) and.
  • Ty (a 1.35 kb EcoRI-Sall fragment of p29 (Hermanson et al., Nuc. Acids. Res. 11:4943-4948 (1991)), the rJ ⁇ N_&fl ⁇ a 4 - 6 *> BgIIIk-A L90 and a 4.4 kb Bglll-B L92 fragment (Keil and Roeder, Cell 12:377-386 (1984)), and the H telomere elements (2.0 and 1.5 kb Bglll-Hindlll fragments of pl98 (Chan and Tye, Cell 11:563-573 (1983)).
  • Hybridization of sequences on- chromosome metaphase spreads with biotinylated probes and detection by Avidin-FITC followed by biotin-anti-Avidin and Avidin-FITC amplification was carried as described by Trask and Pinkel, Methods Cell Biol. l£:383-400 (1990), using a Zeiss_.Axiophot. microscope.. Chromosomes were counterstained with propidium iodide. The photomicrographs shown . are representative of 95% of the metaphase spreads or interphase nuclei scanned in three independent experiments carried out with the human or the yeast probes. A single integration site was detected for the human sequences.
  • Southern blot analysis was performed on DNA extracted from differentiated ESY 5-2, 3-6, 8-5 and 8-6 (20 ⁇ g) and yHPRT in AB1380 (40 ng) using (a) a human Alu probe; (b) yeast Ty sequences.
  • ES clones were induced to form embryoid bodies by culturing them as aggregates in suspension for 10-14 days as described by Martin and Evans, £sll 6_:467- 474 (1975) . Following their reattachment to tissue culture substratum, ESY-derived embryoid bodies gave rise to differentiated cell types.
  • YAC and yeast DNA sequences were stably retained by the differentiated ES clones during 40 days of culture in non-selective medium, demonstrating that the stably integrated foreign DNA did not impair the pluripotency of the ES cells ( Figure 3 B) .
  • the differentiated cultures maintained a functional human HPRT gene as evidenced by their normal growth and differentiation when transferred to- HAT-selective medium.
  • chimeric mice from vHPRT-ES cell lines The ability of ESY cells to- repopulate mice, including the germline, was demonstrated by microinjection of ES cells into mouse blastocysts and the generation of chimeric mice.
  • ESY cells were microinjected into C57BL/6J mouse blastocysts, and chimeric mice were generated as previously described. Chimeric males were mated with C57BL/6J females and gexmline transmission was determined by the presence of agouti offspring.
  • Genomic DNA prepared from the tails of the chimeric mice were analyzed for the presence of the yHPRT DNA in the mouse genome by PCR analysis. The presence of the-YAC left arm-was-analyzed using the-two priming x>ligonucleotides,
  • Chimeric males, with coat color chimerism of 30- 60%, derived from the ESY cell lines ESY3-1 and ESY5-2 were set up for mating for germline transmission evaluation, i.e. to determine whether the genetic modification was passed via the germ cells (sperm or oocytes) to the progeny of the animals.
  • Three of the chimeric ESY3-1 derived males, 394/95-1, 394/95-2 and 411- l transmitted the ES cell genome to their offspring at a frequency of 20%, 30% and 30%, respectively. Southern blot analysis of tail.
  • the Alu profile obtained from- such analysis was - indistinguishable from that of the parent ES3-1 cell line ( Figure 3 C) , . demonstrating- that the 680 kb human insert was transmitted faithfully. through the mouse germline. . Using a human.
  • RNA and PCR amplification of specific cDNA sequences were performed using the cDNA Cycle Kit (Invitrogen) . Specific amplification of a 626 bp fragment from human HPRT cDNA in the presence of murine HPRT cDNA was performed as outlined by Huxley et al, supra. Integrity of all RNA samples was demonstrated by PCR amplification of cDNAs for the mouse 7-interferon receptor.
  • the primers used to amplify a .359 bp fragment were: GTATGTGGAGCATAACCGGAG and CAGG'l'l'l'rGTCTCTAACGTGG.
  • the human HPRT and the 7-interferon receptor primers were designed to eliminate the possibility of obtaining PCR products from genomic DNA contamination. PCR products were analyzed by electrophoresis and visualized with ethidium bromide. The size markers are 1 kb ladder (BRL) . The results of detection of mouse 7-interferon receptor mRNA by RT-PCR in the samples described above are shown in Figure 4B. The. specific- human HPRT mRNA was also detected in the other tissues tested (brain, kidney and heart) derived from the.4?3 mouse.
  • yeast genomic DNA was not detrimental to proper differentiation of ES cells in vitro and in vivo and did not prevent germline transmission or gene expression.
  • xenogeneic DNA can be introduce -into non-human hosts such as mammals, particularly small laboratory animals, that may impart novel phenotypes or novel genotypes.
  • a mammal such as a human
  • ESY clones except 2B, 2D, 100/1500 and 5C.
  • ES ' clones 2B, 3A and 5C were microinjected into C57B/6 blastocysts as described above and chimeric mice (10 from 2B clone, 1 from 3A clone and 1 from 5C clone) were generated.
  • Southern blot analysis of tail DNA from 10 of these chimeric animals indicated the presence of most, if not all, of the apparent 10 ⁇ Alu " fragments, detected in yA287- C10 in yeast, as well as the presence of VH- and D gene fragments.
  • the generated chimeric mice were bred with C57BL16J mice for germline transmission evaluation.
  • a chimeric male 78K-3 derived from the 2B clone transmitted the ES cell genome to its offspring at a frequency of " 100%.
  • Southern blot analysis ' of tail DNA from 4 out of 6 agouti mice pups indicated the presence of human heavy chain sequences.
  • mice containing the human immunoglobulin locus are mated to mice with inactivated murine immunoglobulin genes to generate mice that produce only human antibodies.
  • three generations of breeding are required to create a mouse that is homozygous for inactive murine kappa and heavy chain immunoglobulins, and heterozygous for human heavy and kappa chain immunoglobulin loci.
  • the breeding, scheme is shown in Figure 5.
  • Example 4 Production of Human Monoclonal Antibodies
  • Germline chimeric .mice containing integrated human DNA from the immunoglobulin loci are immunized by injection of an antigen in adjuvant-. The. mice are boosted with antigen 14 days after the primary immunization, repeated after 35 and 56 days.. A bleed is done on the immunized animals to test the titer of serum antibodies against the immunizing antigen. The mouse with the highest titer is sacrificed, and . the spleen removed.
  • Myeloma cells used as the fusion partner for the spleen cells are thawed 6 days prior to the fusion, and grown in tissue culture.
  • the cells are split into fresh medium containing 10% fetal calf serum at a concentration of 5 x 10 s cells/ml.
  • the cells are diluted with an equal volume of medium supplemented with 20% fetal calf serum and 2X OPI (3 mg/ml oxaloacetate, 0.1 mg/ml sodium pyruvate and 0.4 IU/ml insulin) solution.
  • the spleen is aseptically removed, and placed in a dish with-culture medium.
  • the cells are teased apart until the spleen is torn into fine pieces and most cells have been removed.
  • the cells are washed in fresh sterile medium, and the clumps allowed to settle out.
  • the splenocytes are further washed twice by centrifugation in medium without serum. During the second wash, the myeloma cells are also washed in a separate tube. After the final wash the two cell pellets are combined, and centrifuged once together.
  • a solution of 50% polyethylene glycol (PEG) is slowly added to the cell pellet while the cells are resuspended, for a total of two minutefl.
  • 10 ml of prevrarme medium is added to the cell solution, stirring slowly for 3 minutes.
  • the cells are centrifuged and the supernatant removed.
  • the cells are resuspended in 10 ml of medium supplemented with 20% fetal calf serum, IX OPI solution and IX AH solution (58 ⁇ M azaserine, 0.1 mM hypoxanthine) .
  • the fused cells are aliquoted into 96-well plates, and cultured at 37° for one week. Supernat£» r ". is aseptically taken from each well, and put into pools.
  • the cells are transferred from the 96-well plate to 0.5 ml of medium supplemented with 20% fetal calf serum, IX OPI, and IX AH in a 24-well plate. When that culture becomes dense, the cells are expanded into 5 ml, and then into 10 ml. At this stage the cells are sub-cloned so that a single antibody producing cell is in the culture.
  • a chimeric non-human host particularly a murine host
  • a transgenic host can be immunized with immunogens which could not be used with a human host.
  • the resulting- B-cells may then be used for immortalization for the continuous production of the desired antibody.
  • the immortalized cells may be used for isolation of the genes encoding the immunoglobulin or analog and be subjected to further molecular modification by methods such as in-vitro mutagenesis or other techniques to modify the properties of the antibodies. These modified genes may then be returned to the immortalized cells by transfection to provide for a continuous mammalian cellular source of the desired antibodies.
  • the subject invention provides for a convenient source of human antibodies, where the human antibodies are produced in analogous manner to the production of antibodies in a human host.
  • the animal host cells conveniently provide for the activation and rearrangement of human DNA in the host cells for production of human antibodies.
  • human antibodies can be produced to human immunogens, eg. proteins, by immunization of the subject host mammal with human immunogens.
  • the resulting antisera will be specific for the human immunogen and may be harvested from the serum of the host.
  • the immunized host B cells may be used for immortalization, eg. myeloma cell fusion, transfection, etc. to provide immortal cells, eg. hybridomas, to produce monoclonal antibodies.
  • the antibodies, antiserum and monoclonal antibodies will be glycosylated in accordance with the species of the cell producing the antibodies.
  • Rare variable regions- of-the Ig locus may be recruited in producing the antibodies, so that antibodies having rare variable regions may be obtained.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
EP96905259A 1995-01-20 1996-01-19 Verfahren zum verbesseren der screening-leistungsfähigkeit in fusionierten zellen Withdrawn EP0804604A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US37627995A 1995-01-20 1995-01-20
US376279 1995-01-20
PCT/US1996/001169 WO1996022380A2 (en) 1995-01-20 1996-01-19 Method to improve screening efficiency in fused cells

Publications (1)

Publication Number Publication Date
EP0804604A2 true EP0804604A2 (de) 1997-11-05

Family

ID=23484361

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96905259A Withdrawn EP0804604A2 (de) 1995-01-20 1996-01-19 Verfahren zum verbesseren der screening-leistungsfähigkeit in fusionierten zellen

Country Status (6)

Country Link
EP (1) EP0804604A2 (de)
JP (1) JPH10512449A (de)
KR (1) KR19980701536A (de)
AU (1) AU4906696A (de)
CA (1) CA2210986A1 (de)
WO (1) WO1996022380A2 (de)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6682736B1 (en) 1998-12-23 2004-01-27 Abgenix, Inc. Human monoclonal antibodies to CTLA-4
US7109003B2 (en) 1998-12-23 2006-09-19 Abgenix, Inc. Methods for expressing and recovering human monoclonal antibodies to CTLA-4
US7605238B2 (en) 1999-08-24 2009-10-20 Medarex, Inc. Human CTLA-4 antibodies and their uses
CA2589418A1 (en) 1999-08-24 2001-03-01 Medarex, Inc. Human ctla-4 antibodies and their uses
DK2319301T3 (en) 2001-11-30 2017-12-04 Amgen Fremont Inc Transgenic animals with human Ig lambda light chain genes
SI1503794T1 (sl) 2002-04-12 2012-09-28 Medarex Inc Postopek zdravljenja z uporabo ctla-4 antiteles
NZ568016A (en) 2005-12-07 2011-12-22 Medarex Inc CTLA-4 antibody dosage escalation regimens

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2637613B1 (fr) * 1987-06-19 1991-09-27 Transgene Sa Procede de preparation de lignees cellulaires stables pour la production de proteines determinees, a partir d'animaux transgeniques; lignees cellulaires tumorales et proteines obtenues
JP3008208B2 (ja) * 1990-06-01 2000-02-14 武田薬品工業株式会社 新規ハイブリドーマ,その製造法および生理活性物質の製造法
EP0652950B1 (de) * 1992-07-24 2007-12-19 Amgen Fremont Inc. Bildung von xenogenen antikörpern

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9622380A2 *

Also Published As

Publication number Publication date
WO1996022380A2 (en) 1996-07-25
JPH10512449A (ja) 1998-12-02
AU4906696A (en) 1996-08-07
CA2210986A1 (en) 1996-07-25
KR19980701536A (ko) 1998-05-15
WO1996022380A3 (en) 1996-09-12

Similar Documents

Publication Publication Date Title
AU675661B2 (en) Generation of xenogeneic antibodies
US6114598A (en) Generation of xenogeneic antibodies
JP2938569B2 (ja) 異種免疫グロブリンを作る方法及びトランスジェニックマウス
US6162963A (en) Generation of Xenogenetic antibodies
US8110671B2 (en) Isolated human chromosome 14 fragment encoding immunoglobulin genes
JP2022071051A (ja) Adam6マウス
CA2468565C (en) Transgenic animals bearing human iglambda light chain genes
CN107602696B (zh) 人源化的通用轻链小鼠
KR100855998B1 (ko) 비동족형 스위치 영역에 의해 인간 항체의 특정 이소타입을 생산하는 트랜스제닉 동물
TR201903439T4 (tr) İnsanlaştırılmış hafif zincirli fareler.
AU5702298A (en) Transgenic mammals having human Ig loci including plural VH and VK regions nd antibodies produced therefrom
CN101002549A (zh) 能够生产异源抗体的转基因非人动物
JPH11206387A (ja) 異種免疫グロブリンを作る方法及びそのためのトランスジェニックマウス
EP0804604A2 (de) Verfahren zum verbesseren der screening-leistungsfähigkeit in fusionierten zellen
HK40035928A (en) Transgenic animals bearing human ig lambda light chain genes
CA2702329A1 (en) Generation of xenogeneic antibodies
NZ627211B2 (en) Humanized light chain mice

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970813

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 19971017

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ABGENIX, INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19990730