EP0796347A2 - Detection of nucleic acids in cells by thermophilic strand displacement amplification - Google Patents

Detection of nucleic acids in cells by thermophilic strand displacement amplification

Info

Publication number
EP0796347A2
EP0796347A2 EP96931542A EP96931542A EP0796347A2 EP 0796347 A2 EP0796347 A2 EP 0796347A2 EP 96931542 A EP96931542 A EP 96931542A EP 96931542 A EP96931542 A EP 96931542A EP 0796347 A2 EP0796347 A2 EP 0796347A2
Authority
EP
European Patent Office
Prior art keywords
target sequence
amplification
amplification primer
seq
restriction endonuclease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96931542A
Other languages
German (de)
French (fr)
Inventor
Kenton L. Lohman
Natalie V. Ostrerova
Mark Van Cleve
Robert Alan Reid
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Becton Dickinson and Co
Original Assignee
Becton Dickinson and Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/531,747 external-priority patent/US5631147A/en
Priority claimed from US08/531,749 external-priority patent/US5733752A/en
Application filed by Becton Dickinson and Co filed Critical Becton Dickinson and Co
Publication of EP0796347A2 publication Critical patent/EP0796347A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/702Specific hybridization probes for retroviruses
    • C12Q1/703Viruses associated with AIDS
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6841In situ hybridisation

Definitions

  • the present invention relates to amplification of nucleic acids and in particular to amplification of nucleic acids in morphologically intact cells
  • Nucleic acid amplification techniques have provided powerful tools for detection and analysis of small amounts of nucleic acids The extreme sensitivity of such methods has lead to attempts to develop them for early diagnosis of infectious and genetic diseases, isolation of genes for analysis, and detection of specific nucleic acids in forensic medicine
  • Nucleic acid amplification techniques can be grouped according to the temperature requirements of the procedure
  • the polymerase chain reaction (PCR), ligase chain reaction (LCR) and transcription-based amplification require repeated cycling of the reaction between high (85°C - 100°C) and low (30°C - 40°C) temperatures to regenerate single stranded target molecules for amplification
  • methods such as Strand Displacement Amplification (SDA), self- sustained sequence replication (3SR) and the Q ⁇ replicase system are isothermal reactions which can be performed at a constant temperature
  • the temperature of the reaction is raised after primer extension to separate the newly-synthesized strand from the template The temperature is then lowered to reanneal the primers and repeat the extension process
  • the steps ofthe PCR reaction therefore occur in discrete phases or cycles as a result of the temperature constraints of the reaction
  • SDA Strand Displacement Amplification
  • extension of primers, displacement of single stranded extension products, annealing of primers to the extension products (or the original target sequence) and subsequent extension of the primers occur concurrently in the reaction mix.
  • Conventional SDA (performed at lower temperatures, usually about 35-45°C) is described by G T Walker, et al ( 1992a Proc. Natl. Acad. Sci.
  • thermophilic version of the SDA reaction (tSDA, described below) has recently been developed, and is performed at a higher, but still constant, temperature using thermostable polymerases and restriction endonucleases
  • Targets for amplification by SDA may be prepared by fragmenting larger nucleic acids using the endonuclease used in the SDA reaction
  • target nucleic acids having appropriate restriction endonuclease recognition sites for nicking in the SDA reaction can be generated as described by Walker, et al ( 1992b, supra) and in U S Patent No 5,270, 184
  • the individual steps of the target generation reaction occur concurrently and continuously, generating target sequences with the terminal recognition sequences required for nicking by the restriction enzyme in SDA
  • generated target sequences automatically and continuously enter the SDA cycle and are amplified
  • in situ methods provide information as to which cells in a population contain a particular nucleic acid and further permit analysis of the nucleic acid in the context of the biochemical and morphological characteristics of the cell
  • In situ amplification methods have primarily been developed for the PCR (O Basgara and R Pomerantz 1993 AIDS Research and Human Retroviruses 9(1), 69-76, G. Nuovo, et al 1992 Diag. Molec. Pathol. 1(2), 98-102; M. J. Embleton, et al 1992. Nuc. Acids Res. 20(15), 3831-3837, J Emmetson, et al
  • An amplification primer is a primer for amplification of a target sequence by hybridization and extension of the primer.
  • the 3' end ofthe amplification primer is a target binding sequence which hybridizes at the 3' end of the target sequence
  • the amplification primer further comprises a recognition site for a restriction endonuclease 5' to the target binding sequence, generally near its 5' end.
  • the restriction endonuclease recognition site is a nucleotide sequence recognized by a restriction endonuclease which will nick a double stranded recognition site for the restriction endonouclease when the recognition site is hemimodified, as described by Walker, et al.
  • a hemimodified recognition site is a double stranded recognition site for a restriction endonuclease in which one strand contains at least one derivatized nucleotide which prevents cutting of one of the strands of the duplex by the restriction endonuclease
  • “Nicking” refers to this modified activity, in which only one strand of the duplex is cut by the restriction endonuclease, in contrast to typical double- stranded cleavage
  • Any hemimodified restriction endonuclease recognition site which is nickable by a restriction endonuclease is suitable for use in SDA
  • Amplification primers for SDA are designated S ⁇ and S2 by Walker, et al ( 1992b), supra Alpha-thio modified deoxyribonucleoside triphosphates are abbreviated "dNTP ⁇ S,” “dATP ⁇ S,” “dCTP ⁇ SJ etc
  • a “bumper" or external primer is a primer which anneals to a target sequence upstream of an amplification primer, such that extension of the external primer displaces the downstream primer and its extension product, i.e , a copy of the target sequence comprising the restriction endonuclease recognition site contributed by the amplification primer is displaced
  • the bumper primers therefore consist only of target binding sequences and are designed so that they anneal upstream of the amplification primers and displace them when extended External primers are designated B ] and B2 by Walker, et al ( 1992b), supra Extension of external primers is one method for displacing the extension products of amplification primers, but heating may also be suitable in certain cases
  • the terms target or target sequence refer to nucleic acid sequences (DNA and/or RNA) to be amplified These include the original nucleic acid sequence to be amplified and its complementary second strand as well as either strand of a copy of the original target sequence produced by amplification ofthe target sequence
  • Amplification products, extension products or amplicons are oligo or polynucleotides which comprise copies of the target sequence produced during amplification of the target sequence
  • Thermophilic Strand Displacement Amplification has been adapted for amplification of nucleic acid target sequences in situ in cells in suspension, on slides or in tissues, with speed, sensitivity and specificity which is superior to conventional in situ SDA Excellent specimen morphology is preserved in spite of exposure to temperatures significantly higher than in conventional in situ SDA, as demonstrated by normal light scatter parameters on flow cytometry
  • In situ amplification by tSDA also remains compatible with immunochemical techniques in spite of the increased reaction temperature, so both amplification of target sequences and immunological staining can be performed on the same specimen This is in contrast to the //; situ PCR, in which the repeated temperature cycling may make the cellular antigens of interest undetectable by immunochemical techniques
  • the inventive methods for in situ tSDA generally comprise a brief fixation of the cells or tissue, followed by permeabilization and addition of the reagents required for tSD A When the target sequence is DNA the cells or tissues are heated briefly p ⁇ or to amplification to denature the target sequence Because of the thermostability
  • Fig 1 shows the flow cytometric results for amplification of an HIV target sequence and an HLA-DQ ⁇ exon 3 target sequence by /// situ tSD A
  • tSDA in situ provides the significantly improved sensitivity, speed and specificity of in vitro (solution) tSDA protocols without significant loss of cellular structure and mo ⁇ hology
  • a sample of cells e g , cells in suspension or tissue sections
  • a fixative which maintains the morphological integrity of the cell but does not cross-link or precipitate cellular proteins so extensively that penetration of primers and other reagents is prevented
  • Treatment with protease after fixation to obtain penetration of primers and reagents into the fixed cells is therefore generally not required
  • Either cross-linking or precipitating fixatives may be used in the practice of the invention Examples include paraformaldehyde, 4% glutaraldehyde, ethanol acetic acid fixatives, Camoy's fixative (acetic acid, ethanol, chloroform), 1% osmium tetroxide, Bouin's fixative (1.21% picric acid, 1 1% formaldehyde, 5 6% acetic acid), Zenker's fixative (5 0% mercu ⁇ c chloride, 2 5% potassium dichlorate, 5 0% acetic acid, 1 0% sodium sulfate), and acetic acid/methanol fixatives
  • the use of FACSTM Lysing Solution allows lysis, fixation and permeabilization using a single reagent
  • the preferred fixative for use in the invention is 1 -4% paraformaldehyde, which is preferably used to treat the cells or tissues for about 1 min to 1 hr It is generally useful to permeabilize the fixed cells prior to
  • RNA or DNA target sequences may be amplified directly using the inventive methods
  • a reverse transcriptase may be added to the tSDA reaction as it is in reverse transcription PCR (rtPCR - G J Nuovo, et al 1992 Diag Molec. Pathol 1, 98-102, G J Nuovo. et al 1991 Am. J. Pathol. 58, 518-523, G J Nuovo, et al 1991 Am. J. Pathol.
  • RNA polymerases used in tSDA have now been found to exhibit reverse transc ⁇ ptase activity They can polymerize DNA copies of a target sequence using either RNA or DNA as the template, with inco ⁇ oration of dNTP ⁇ S and displacement from a nick RNA target sequences may therefore be reverse transcribed by the same polymerase which performs the DNA amplification portion of the tSDA reaction, without the need to add a separate reverse transcriptase RNA may be amplified in the cells (i e , without substantial amplification of DNA targets) by eliminating the heat denaturation step or treating with DNase p ⁇ or to initiating the tSDA reaction The double stranded DNA in the cells then remains double stranded and unavailable as a template, whereas p ⁇ mers can hybridize to available single stranded RNA and begin specific amplification of RNA target sequences by generating cDNA The cDNA in turn serves as a template for further
  • both DNA and RNA target sequences will be amplified
  • In situ reverse transcription of RNA by the DNA polymerases used in tSDA is generally less efficient than DNA synthesis, but has unexpectedly been found in some cases to be more efficient than conventional reverse transcriptases
  • RNA targets are usually present in the cell in greater numbers than the corresponding DNA target, and the high efficiency of amplification of the cDNAs which are generated quickly overcomes and compensates for any reduced efficiency in the reverse transc ⁇ ption step of the reaction
  • Amplification of both RNA and DNA targets is preferred for most diagnostic applications of the invention because this gives the greatest number of amplifiable target sequences per cell and, as a result, the greatest sensitivity and largest number of potentially positive cells per sample.
  • the fixed cells or tissues may be heated in the SDA reaction mixture (e g , dNTPs, KiPO MgCl2, BSA, DMSO, external primers, amplification primers, and enzymes if they are sufficiently heat-stable) If the polymerase and restriction endonuclease are not sufficiently heat stable at the temperature of denaturation, they may be added subsequently when the sample has been cooled to the desired reaction temperature If the target is not heat denatured, the SDA reaction mixture including the restriction endonuclease and polymerase(s) may simply be added to the cell sample at the selected reaction temperature to initiate amplification
  • targets for amplification by tSDA may be prepared by fragmenting larger nucleic acids by restriction with an endonuclease which does not cut the target sequence
  • target nucleic acids having the selected restriction endonuclease recognition cleavage sites for nicking in the amplification reaction be generated as described by Walker, et al. ( 1992, Nuc. Acids Res., supra) and in U.S. Patent No. 5,270, 184
  • dUTP may be inco ⁇ orated into SDA amplicons in place of dTTP without significant inhibition of the amplification reaction
  • UDG uracil DNA glycosylase
  • UDG may be heat-inactivated
  • the higher temperature of the reaction itself > 50°C
  • SDA requires a polymerase which lacks 5'— >3' exonuclease activity, initiates polymerization at a single stranded nick in double stranded nucleic acids, and displaces the strand downstream of the nick while generating a new complementary strand using the unnicked strand as a template.
  • Polymerase displacement activity is essential to the amplification reaction, as it makes the target available for synthesis of additional copies and generates the single stranded extension product to which a second amplification primer may hybridize in exponential amplification reactions. More processive polymerases are preferred, as they may maximize the length of target sequence which can be amplified
  • thermophilic polymerases Little was previously known about the activities of thermophilic polymerases at temperatures which would be appropriate for tSDA Further, the activities of thermophilic polymerases at temperatures compatible with activity for thermophilic restriction endonucleases was not known Screening assays were therefore developed to identify candidate restriction endonucleases and polymerases, if any existed
  • the polymerase screening system is an extension assay which tests the ability of the polymerase to displace a downstream strand initiating at a single stranded nick in a double stranded template It also tests for the presence or absence of 5' ⁇ 3' exonuclease activity 5'- 3' exonuclease activity, if present in an otherwise suitable thermophilic polymerase, can be inactivated by routine methods known in the art (WO 92/06200) One of the most common methods for selectively inactivating exonuclease activity in a polymerase is to clone the gene for the polymerase, identify
  • displacement ofthe single strand from a double stranded nucleic acid and initiation at a nick is staged by annealing two primers immediately adjacent to each other on an intact sequence complementary to both primers
  • the primers are labeled at their 5' ends, usually with 32p if a polymerase has strand displacement activity, is able to initiate polymerization at the "nick" formed by the adjacent hybridized primers and lacks 5' ⁇ 3' exonuclease activity, both primers are extended and two extension products will be detected.
  • the polymerase lacks 5'— >3' exonuclease activity but cannot initiate extension at the nick (e.g., it requires a gap) and/or if it lacks displacement activity, only the extension product ofthe downstream primer will be detected A polymerase which initiates at a nick but has 5'— >3' exonuclease activity will generate only the extension product of the upstream primer.
  • the extension assay also requires that the polymerase be capable of incorporating an ⁇ -thio dNTP (dNTP ⁇ S), which is included in the reaction
  • dNTP ⁇ S ⁇ -thio dNTP
  • Upstream and downstream primers and their respective extension products are generally identified by size on gels with autoradiography
  • eleven thermophilic DNA polymerases initially screened in the extension assay six were identified as having all of the required characteristics for use in the invention exo" Vent (New England Biolabs), exo" Deep Vent (New England Biolabs), Bst (BioRad), exo” Pfu (Stratagene), Bca (Panvera), and Sequencing Grade Taq (Promega).
  • thermophilic polymerases Tth (Boehringer), Tfl (Epicentre), REPLINASE (DuPont) and REPLITHERM (Epicentre) strand displace from a nick, but also have 5' ⁇ 3' exonuclease activity
  • Tth Boehringer
  • Tfl Epicentre
  • REPLINASE DuPont
  • REPLITHERM Epicentre
  • Most of the thermophilic polymerases identified to date are active between about 50°C and 75°C, with optimal activity at about 65°C-75°C and reduced activity at about 50°C-65°C.
  • thermophilic restriction endonucleases As the thermostability of thermophilic restriction endonucleases is generally limited to less than 65°C, thermophilic polymerases with optimal activity at lower temperatures (e.g., Bst and Bca) are more compatible with thermophilic restriction endonucleases in the reaction and are therefore preferred.
  • thermophilic polymerases with optimal activity at lower temperatures e.g., Bst and Bca
  • restriction endonucleases which are active at higher temperatures compatible with the usual optimum temperatures for polymerase activity may be identified and are also useful in the invention
  • Restriction endonucleases suitable for SDA must cleave only one of the strands of a double stranded hemimodified recognition/cleavage site for the restriction endonuclease ("nicking"). This nicking activity is of great importance, as it is nicking which perpetuates the reaction and allows subsequent rounds of target amplification to initiate. Because restriction enzymes generally produce double strand breaks, cleavage of one of the two strands in the duplex cleavage site must be selectively inhibited.
  • nucleotide analogs e.g., deoxynucleoside phosphorothioates
  • nucleotide analogs may be incorporated into the primer during its synthesis, thus eliminating both the need to add nucleotide analogs to the amplification reaction and the requirement that the polymerase be capable of incorporating such nucleotide analogs.
  • thermophilic restriction endonucleases As nucleotide analog substitutions do not induce nicking by all restriction endonucleases, a means for assaying the nicking characteristics of restriction endonoucleases was required in order to identify suitable enzymes which might exist among the many available thermophilic restriction endonucleases. Therefore, a screening system for identifying thermophilic restriction endonucleases with the desired properties was devised based on the ability of a modified deoxynucleotide incorporated into one strand of the double stranded restriction endonuclease recognition/cleavage site to protect one of the two strands from cleavage by the endonuclease.
  • strand protection assav a single stranded template comprising the rest ⁇ ction endonuclease recognition/cleavage site and a pnmer complementary to a portion of the template other than the recognition/cleavage site are synthesized
  • the template and the primer are then labeled, typically with a radiolabel
  • the pnmer and template are hyb ⁇ dized and modified dNTPs are inco ⁇ orated by extension ofthe pnmer, producing a fully double stranded molecule containing a hemimodified restriction endonuclease recognition/cleavage site
  • This product is treated with the restriction endonuclease under conditions appropnate for double- stranded cleavage
  • Electrophoretic analysis of the reaction products under denatunng conditions is used to determine, by the size of the fragments generated, whether or not the recognition/cleavage site was nicked, cleaved
  • thermophilic endonucleases were identified which had partial or low nicking activity under the initial screening conditions of the strand protection assay (e g , Tthl l II, BsiYI and BsoFI) While reduced nicking activity would not prevent SDA, nicking by a restnction endonuclease may be optimized by adjusting the the reaction conditions (e g , by optimizing the buffer or adjusting the reaction temperature), making them more efficient in tSDA
  • sequences flanking a restriction endonuclease recognition/cleavage site may affect the degree of endonuclease activity
  • altering the flanking sequences of the templates may also improve nicking activity for endonucleases which nicked only partially Thermophilic SDA is performed essentially as conventional SDA, with substitution of the desired thermostable polymerase and thermostable restriction endonuclease
  • the temperature of the reaction will be adjusted to the higher temperature suitable for the selected
  • Preferred restriction endonucleases for use in tSDA are BsrI, BstNI, BsmAI, BslI and BsoBI (New England BioLabs), and BstOI (Promega)
  • the preferred thermophilic polymerases are Bca and Bst
  • amplification ofthe target sequence is generally allowed to proceed at about 50-65°C for about 1 min. to 2 hr., preferably about 10 min. to 1 hr.
  • dNTP deoxyribonucleoside triphosphate
  • FITC fluorescein isothiocyanate
  • the additional dNTP analog may also, optionally, serve as a tag or label to be used for detecting amplification products
  • Inco ⁇ oration of dNTP analogs such as dig also has the advantage of providing an enhanced signal, as each incorporated label moiety can generate a signal bv binding to anti-dig antibodies conjugated to alkaline phosphatase (AP- ⁇ - dig)
  • Incorporation of such dNTP analogs is particularly advantageous for //; situ SDA because the amplified target sequence is generally smaller than a PCR amplicon It has been observed however, that even though SDA amplicons are generally smaller than PCR amplicons, there is less leakage associated with in situ conventional SDA than with in situ PCR Because of the higher temperature of /// situ tSDA, it was anticipated that amplicon leakage might be increased, possibly to the level observed in m situ PCR In practice, however, although there may be a slight increase in amplicon leakage at the elevated temperatures, there is still significantly less amplicon leakage in m
  • the amplicons produced may be detected by any of the methods known in the art for detection of specific nucleic acid sequences
  • amplification products may be detected m situ or after release of amplicons from the cells by specific hybridization to an oligonucleotide detector probe
  • the detector probe is a short oligonucleotide which includes a detectable label, I e , a moiety which generates or can be made to generate a detectable signal
  • the label may be inco ⁇ orated into the oligonucleotide probe by nick translation, end-labeling or dunng chemical synthesis of the probe
  • Many directly and indirectly detectable labels are known in the art for use with oligonucleotide probes
  • Directly detectable labels include those labels which do not require further reaction to be made detectable, e g , radioisotopes, fluorescent moieties and dyes Fluorescent labels such as fluorescein isothiocyanate (FITC) or radioisotopes such as 2
  • the cells or tissues are exposed to the labeled probe under reaction conditions appropriate for specific hybridization of the probe to single stranded amplification products
  • the detector probe will be selected such that it hybridizes to a nucleotide sequence in the amplicon which is between the binding sites of the two amplification primers
  • a detector probe may also have the same nucleotide sequence as either of the amplification primers Suitable methods for detection by in situ hybridization to a detector probe are described by J B Lawrence, et al ( 1989 Cell 57, 493-502), J B Lawrence, et al. ( 1990 Proc. Natl. Acad. Sci. USA 87, 5420-5424) and in U.S Patent No 4,888,278
  • amplification products may be detected in situ or after release from the cells by primer extension as described by Walker, et al ( 1992b), supra
  • an oligonucleotide primer comprising a detectable label is hybridized to the amplification products and extended by addition of polymerase
  • the primer may be 5' end-labeled, preferably using 32 P or a fluorescent label
  • extension of the hybridized primer may inco ⁇ orate a dNTP analog comprising a directly or indirectly detectable label
  • extension of the primer may inco ⁇ orate a dig-derivatized dNTP, which is then detected after extension by reaction with AP- ⁇ -dig and a suitable AP substrate.
  • the primer to be extended may either be the same as an amplification primer or it may be a different primer which hybridizes to a nucleotide sequence in the amplicon which is between the binding sites of the amplification primers
  • the detectable label may also be incorporated directly into amplicons during target sequence amplification
  • one ofthe dNTPs in the conventional SDA reaction may be completely or partially replaced with a dNTP analog which comprises a dNTP conjugated to a directly or indirectly detectable label
  • dUTP conjugated to the desired label may be substituted for dTTP in the SDA reaction
  • the polymerase then inco ⁇ orates the label directly into the amplification products generated by extension of the amplification primer
  • the label may be directly or indirectly detectable
  • the label conjugated to the dNTP is a fluorescent label which may be detected directly in the amplicons by fluorescence microscopy or flow cytometry.
  • the label conjugated to the dNTP is biotin or digoxigenin, which may be detected by reaction with streptavidin/FITC and fluorescence microscopy or flow cytometry
  • Secondary amplification products are copies of the target sequence generated by hybridization and extension of a signal primer on the target sequence
  • the secondary amplification products comprise an internal segment of the amplified target sequence and a detectable label which is associated with the signal primer
  • At least the 3' end of the signal pnmer comprises a sequence which hybridizes to the target sequence It may also include features which facilitate capture or immobilization of the secondary amplification products, so that they may be isolated for detection, quantitation or further manipulation
  • Concurrent generation of secondary amplification products in the in situ tSDA reaction provides another detection method which is homogeneous and may be performed concurrently with amplification
  • the lengthy m situ probe hybridization step is eliminated, and concentrations of signal pnmer are lower than for hybridization probes The lower concentration itself reduces background and also allows higher st ⁇
  • the label of the hybridized detector probe, extended primer, amplicon or secondary amplification product is then detected, preferably m situ, as an indication of the presence of amplified target sequences
  • This may require the addition of reagents to the cells to develop the signal of an indirectly detectable label such as AP, biotm or dig
  • Microscopic analysis of the cells is preferred when the detectable label is an enzyme
  • Microscopic analysis may be either by visual observation of the cells or tissues (fluorescence or light microscopy), or automated image analysis using instruments such as DISCOVERY (Becton Dickinson Image
  • the cells may be suspended in scintillation fluid and the signal detected by scintillation counting
  • a directly detectable fluorescent label allows fluorescence analysis of cells in suspension by flow cytometry (e g , FACSCAN, Becton
  • amplification products may be released from celis prior to detection as described above or visualized after gel electrophoresis as bands of amplification products, e g , by EtBr staining, hyb ⁇ dization of a detector probe or primer extension When a radiolabel is used for the primer or detector probe, amplification products mav be visualized bv autoradiography of the gels
  • Conventional methods of prepa ⁇ ng cells for in situ amplification and analysis by flow cytometry involve isolation of pe ⁇ pheral blood mononuclear cells from whole blood (PBMCs - e g , by FICOLL gradient centnfugation) prior to antibody staining and
  • a pair of amplification primers specific for exon 3 ofthe HLA-DQ ⁇ gene was designed in a similar manner, using human placental DNA for evaluation of the candidate amplification primer pairs in vitro As the HLA genes are present in all cells, this target was to be used as a positive control for in situ tSDA Because leakage of the amplicons was found not to be a significant problem, slightly smaller target regions were selected for the initial identification of candidate primers (about 75- 100 bp) Three "left-side" amplification primers and three " ⁇ ght- side” amplification primers were initially designed and tested expe ⁇ mentally in pairwise combinations In a buffer system optimized as described above, the following primer set gave the best amplification results, detecting less than five copies of the HLA-DQ ⁇ exon 3 target sequence in m vitro tSDA
  • the target binding sequence confers target specificity on the amplification primer
  • the target binding sequences of the amplification p ⁇ mers of the invention are therefore also useful in nucleic acid amplification protocols other than SDA, e g , PCR and 3SR Specifically, any amplification protocol which utilizes cyclic, specific hyb ⁇ dization of primers to the target sequence, extension ofthe primers using the target sequence as a template and displacement of the extension products from the target sequence may employ the target binding sequences of the amplification primers ofthe invention
  • the amplification primers may consist of the target binding sequences only Amplification methods which require different specialized, non-target binding sequences than those shown in the
  • SEQUENCE LISTING (e g , 3SR) may employ amplification p ⁇ mers comprising the target binding sequences of the amplification p ⁇ mers listed and the sequence or structure required by the selected amplification method as is known in the art
  • a different restriction endonuclease recognition site appropnate for tSDA may also be substituted for the rest ⁇ ction endonuclease recognition site shown in the SEQUENCE LISTING, using methods known in the art
  • EXAMPLE 1 The HLA-DQ ⁇ exon 3 target was amplified and detected /// situ in human acute myelogenous leukemia (AML) cells (KG- la) using the selected primer set described above The cells were first fixed for 30 min in 4% paraformaldehyde and washed three times in IX phosphate buffered saline (PBS) They were then permeabilized with 0 01% saponin for 20 min.
  • AML human acute myelogenous leukemia
  • Tube 1 amplified KGla cells were probed with the HLA-DQ ⁇ exon 3-specific detector probe.
  • Tube 2 was a negative control in which the restriction endonuclease was omitted from the amplification reaction, preventing tSDA Tubes 3 and 4 corresponded to Tubes 1 and 2, but were probed with the ⁇ -specific detector probe, which is unrelated to the target sequence All samples which were amplified in the presence of all necessary enzymes and were detected with the HLA-DQ ⁇ exon 3 -specific probe showed specific amplification of the intended target in situ The experiment was repeated to include incubation of unamplified cells with amplicons generated //; situ This was to evaluate the transfer of amplicons to negative cells, either by sticking of amplicons to the cell suiface or uptake of the amplicons by negative cells Following in situ amplification, the reaction was centrifuged to sediment the cells The supematant was incubated for 15 min at 70°C to eliminate BsoBI activity and added to fixed, permeabil
  • Tube 1 Tubes 2 and 3 represented the complete amplification reaction with specific detection Tube 3 shows the signal resulting from in situ tSDA under the same conditions as in Tube 2 but with a three-fold increase in polymerase concentration
  • Tube 4 tSDA amplicons generated in situ were incubated with unamplified cells, which were then hybridized, washed and detected as in the amplified samples
  • Tube 4 was included to determine how much of the positive signal in Tube 2 is due to non-specific sticking of amplicons to unamplified cells
  • Tubes 5-8 correspond to the reaction conditions of Tubes 1 -4, except that the unrelated gag detector probe was hybridized as a negative control
  • specific in situ amplification ofthe target clearly occurred in those samples which contained all necessary enzymes and were detected with the specific HLA-DQ ⁇ exon 3 probe False positive signal generation caused by a mechanism in which amplicons which may be found in the supematant are taken up by unampl
  • the experiments were repeated using signal primers labeled with fluorescein Signal primers were added to the amplification reaction at a concentration of 100 nM
  • the fluorescent probe was thereby extended by polymerase and displaced from the target by extension of the upstream amplification primer
  • the samples were washed twice with 150-200 ⁇ L of phosphate buffered saline for five minutes each wash Washing removed smaller, unextended signal primers from the cells, while the longer target amplification-specific fluorescent signal primers were retained by those cells in which amplification had occurred
  • the washed cells were visualized by fluorescence microscopy, where a strong fluorescent signal was observed in positive cells and negative cells were non-fluorescent
  • signal primer extension is also compatible with detection and/or counting of fluorescent cells by flow cytometry
  • the amplification products were detected in a colorimetric assay Cells were fixed in 4% paraformaldehyde for 20 min ,
  • Venous blood was collected in EDTA VACUTAINERTM blood collection tubes (Becton Dickinson Vacutainer Systems) DNP-conjugated anti-CD4 (L120) and biotinylated anti-CD3 (Leu 4) antibodies were added to 50 ⁇ L of whole blood and allowed to stain for 20 min. at room temperature To lyse red blood cells. 1 0 mL of I X FACSTM Lysing Solution (Becton Dickinson Immunocytometry Systems) was added to each tube for 10 min The cells were fixed in 4% paraformaldehyde for 20 mm.
  • amplification products were detected by incorporation of a fluorescein labeled signal primer during amplification
  • the amplification reaction buffer additionally included 100 nM of specific or unrelated 5' fluorescein labeled signal primer
  • the initial heating step, addition of the enzyme mixture and amplification were performed as described above
  • cells were washed with IX SSC at room temperature for 30 min
  • Antibody staining of cell surface markers was developed with anti-DNP-phycoerythrin (PE) and Cy5/PE labeled streptavidin Cells were washed once with IX PBS and resuspended in IX PBS for flow cytometric analysis.
  • PE anti-DNP-phycoerythrin
  • a cell line containing the HIV genome (H9+) was mixed with normal whole blood and processed as described above and gag target sequences were amplified using the selected primer set described above Additional oligonucleotides which may be used as detector probes or signal primers were also designed for use as alternatives to SEQ ID NO:5.
  • H9+ cells were clearly distinguishable as a population separate from lymphocytes, monocytes and granulocytes with higher forward scatter than any of the white blood cell populations
  • the HLA-DQ ⁇ exon 3 and HIV gag targets were amplified by in situ tSDA using the primer sets described above and detected by detector probe hybridization or incorporation of a signal primer Histogram plots of FLl vs cell counts are shown in Fig 1
  • the HLA-DQ ⁇ exon 3 positive control showed a substantial shift of peak fluorescence to the right (approximately 100 channels) as compared to negative control reactions in which no enzyme was added or unrelated probes or signal primers were used for detection
  • the HIV amplification reaction showed a similar fluorescence peak shift on histogram plots of FLl vs cell counts
  • venous blood was collected in EDTA VACUTAINERTM blood collection tubes and PBMCs were isolated by centrifugation through FICOLL-PAQUETM The collected cells were washed with I X PBS, and monocytes and B cells were removed using Human T cell
  • the T cell en ⁇ ched fraction was stained with DNP conjugated ant ⁇ -CD4 and biotinylated ant ⁇ -CD3 antibody for 20 min at room temperature After 20 min fixation in 4% paraformaldehyde in PBS, the cells were washed with PBS and counted The cells were permeabilized with 10 ⁇ g/mL saponin and washed twice with 35 mM KPO4 5 X 10 5 cells were resuspended in 5 ⁇ L KPO4 buffer and transferred to 0 5 mL microcent ⁇ fuge tubes In situ tSDA, detection of amplification products and immunophenotyping were performed as described above for the FACSTM Lysing Solution sample preparation method The experimental results were virtually identical for the two sample preparation methods
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • AIDS & HIV (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Thermophilic Strand Displacement Amplification (tSDA) for amplification of nucleic acid target sequences in situ in cells in suspension, on slides or in tissues is described. Excellent specimen morphology is preserved, and either DNA targets, RNA targets, or both may be selectively amplified. In situ amplification by tSDA is compatible with immunochemical techniques, so that both amplification of target sequences and immunological staining can be performed on the same specimen.

Description

DETECTION OF NUCLEIC ACIDS IN CELLS BY THERMOPHILIC STRAND DISPLACEMENT AMPLIFICATION
FIELD OF THE INVENTION
The present invention relates to amplification of nucleic acids and in particular to amplification of nucleic acids in morphologically intact cells
BACKGROUND OF THE INVENTION
Nucleic acid amplification techniques have provided powerful tools for detection and analysis of small amounts of nucleic acids The extreme sensitivity of such methods has lead to attempts to develop them for early diagnosis of infectious and genetic diseases, isolation of genes for analysis, and detection of specific nucleic acids in forensic medicine Nucleic acid amplification techniques can be grouped according to the temperature requirements of the procedure The polymerase chain reaction (PCR), ligase chain reaction (LCR) and transcription-based amplification require repeated cycling of the reaction between high (85°C - 100°C) and low (30°C - 40°C) temperatures to regenerate single stranded target molecules for amplification In contrast, methods such as Strand Displacement Amplification (SDA), self- sustained sequence replication (3SR) and the Qβ replicase system are isothermal reactions which can be performed at a constant temperature
In the PCR, the temperature of the reaction is raised after primer extension to separate the newly-synthesized strand from the template The temperature is then lowered to reanneal the primers and repeat the extension process The steps ofthe PCR reaction therefore occur in discrete phases or cycles as a result of the temperature constraints of the reaction In contrast, in Strand Displacement Amplification (SDA), extension of primers, displacement of single stranded extension products, annealing of primers to the extension products (or the original target sequence) and subsequent extension of the primers occur concurrently in the reaction mix. Conventional SDA (performed at lower temperatures, usually about 35-45°C) is described by G T Walker, et al ( 1992a Proc. Natl. Acad. Sci. USA 89, 392-396 and 1992b Nwc. Acids. Res. 20, 1691- 1696). A thermophilic version of the SDA reaction (tSDA, described below) has recently been developed, and is performed at a higher, but still constant, temperature using thermostable polymerases and restriction endonucleases
Targets for amplification by SDA may be prepared by fragmenting larger nucleic acids using the endonuclease used in the SDA reaction However, when the target is not flanked by the necessary restriction endonuclease recognition sites for fragmentation, target nucleic acids having appropriate restriction endonuclease recognition sites for nicking in the SDA reaction can be generated as described by Walker, et al ( 1992b, supra) and in U S Patent No 5,270, 184 As in SDA, the individual steps of the target generation reaction occur concurrently and continuously, generating target sequences with the terminal recognition sequences required for nicking by the restriction enzyme in SDA As all of the components of the SDA reaction are present in the target generation reaction, generated target sequences automatically and continuously enter the SDA cycle and are amplified
In situ methods of nucleic acid analysis allow detection and localization of specific nucleic acid sequences within morphologically intact cells These methods have conventionally been based on direct hybridization of labeled probes, for example as described in U S Patent
No. 4,888,278 However, such direct hybridization methods, while specific for the nucleic acid of interest, may not be sufficiently sensitive to detect very low copy numbers of the nucleic acid in all cases As a means for detecting very low copy numbers, in situ amplification of the target sequence prior to tn situ detection has been of great interest In situ nucleic acid amplification methods have the potential to be more sensitive than conventional solution amplification because the cell may concentrate the amplification product, thereby allowing detection of fewer molecules than is possible when amplification products are free to diffuse or when they are diluted by the contents of cells which do not contain the sequence of interest
Because the nucleic acid need not be extracted from the cell prior to detection of the target sequence, in situ methods provide information as to which cells in a population contain a particular nucleic acid and further permit analysis of the nucleic acid in the context of the biochemical and morphological characteristics of the cell In situ amplification methods have primarily been developed for the PCR (O Basgara and R Pomerantz 1993 AIDS Research and Human Retroviruses 9(1), 69-76, G. Nuovo, et al 1992 Diag. Molec. Pathol. 1(2), 98-102; M. J. Embleton, et al 1992. Nuc. Acids Res. 20(15), 3831-3837, J Emmetson, et al
1993 Proc. Natl. Acad. Sci. USA 90, 357-361 , P Kom inoth, et al 1992 Diag. Molec.
Pathol. 1(2), 85-97; P Chile, et al 1992. J. Histochem. Cytochem. 40(3), 333-341 ,
Haase, et al 1990 Proc. Natl. Acad. Sci. USA 87, 4971-4975, O Basgara, et al 1992
New Engl. J. Med. 326(21), 1385-1391 ; Patterson, et al 1993 Science 260, 976-979) However, the multiple cycles of heating and cooling, and stringent hybridization conditions required by the PCR to achieve its sensitivity are not well tolerated by tissues and cells Diffusion of the amplified sequences out of the cells may be increased by the repeated heating, resulting in increased diffuse signal throughout the sample To attempt to reduce the loss of PCR products from the cell, extensive fixation ( 15 hours to days) with cross-linking fixatives is often employed for in situ amplification by the PCR This treatment often necessitates protease treatment of the fixed cells prior to amplification (G Nuovo, et al 1992 Diag. Molec. Pathol. 1(2), 98-102)
Conventional low temperature SDA, performed in situ, has been found to have many advantages over m situ PCR, including 1 ) improved maintenance of cell structure which allows immunophenotyping for cell identification, and 2) significantly improved retention of amplicons within the cell It was uncertain, however, what effect the increased temperature of in situ tSDA would have on these features While the increase in temperature (generally about 15- 20°C as compared to conventional SDA) might provide the advantages of increased specificity and speed ofthe reaction, it could also significantly increase cell destruction, possibly to a level which would interfere or prevent accurate immunophenotyping and cell identification The marked increase in reaction temperature could also increase diffusion of amplicons out of the cell where they could be taken up by negative cells and produce a false positive signal It was unexpectedly found, however, that cell structure following in situ tSDA remained substantially intact as evidenced by normal forward and side light scatter properties on flow cytometry Thus, immunophenotyping is compatible with the temperatures and protocols of in situ tSDA Applicants hypothesize that maintaining the cells at the higher temperatures may be less damaging than subjecting them to repeated cycles of heating and cooling as in PCR It was also unexpectedly discovered that diffusion of amplicons was not generally significantly increased, also possibly because the cells may sustain less damage when maintained at a constant high temperature than when subjected to thermocycling The following terms are defined herein as follows
An amplification primer is a primer for amplification of a target sequence by hybridization and extension of the primer. For SDA, the 3' end ofthe amplification primer is a target binding sequence which hybridizes at the 3' end of the target sequence The amplification primer further comprises a recognition site for a restriction endonuclease 5' to the target binding sequence, generally near its 5' end. The restriction endonuclease recognition site is a nucleotide sequence recognized by a restriction endonuclease which will nick a double stranded recognition site for the restriction endonouclease when the recognition site is hemimodified, as described by Walker, et al. (1992a), supra A hemimodified recognition site is a double stranded recognition site for a restriction endonuclease in which one strand contains at least one derivatized nucleotide which prevents cutting of one of the strands of the duplex by the restriction endonuclease "Nicking" refers to this modified activity, in which only one strand of the duplex is cut by the restriction endonuclease, in contrast to typical double- stranded cleavage Any hemimodified restriction endonuclease recognition site which is nickable by a restriction endonuclease is suitable for use in SDA Amplification primers for SDA are designated S \ and S2 by Walker, et al ( 1992b), supra Alpha-thio modified deoxyribonucleoside triphosphates are abbreviated "dNTPαS," "dATPαS," "dCTPαSJ etc
A "bumper" or external primer is a primer which anneals to a target sequence upstream of an amplification primer, such that extension of the external primer displaces the downstream primer and its extension product, i.e , a copy of the target sequence comprising the restriction endonuclease recognition site contributed by the amplification primer is displaced The bumper primers therefore consist only of target binding sequences and are designed so that they anneal upstream of the amplification primers and displace them when extended External primers are designated B ] and B2 by Walker, et al ( 1992b), supra Extension of external primers is one method for displacing the extension products of amplification primers, but heating may also be suitable in certain cases The terms target or target sequence refer to nucleic acid sequences (DNA and/or RNA) to be amplified These include the original nucleic acid sequence to be amplified and its complementary second strand as well as either strand of a copy of the original target sequence produced by amplification ofthe target sequence
Amplification products, extension products or amplicons are oligo or polynucleotides which comprise copies of the target sequence produced during amplification of the target sequence
SUMMARY OF THE INVENTION
Thermophilic Strand Displacement Amplification (tSDA) has been adapted for amplification of nucleic acid target sequences in situ in cells in suspension, on slides or in tissues, with speed, sensitivity and specificity which is superior to conventional in situ SDA Excellent specimen morphology is preserved in spite of exposure to temperatures significantly higher than in conventional in situ SDA, as demonstrated by normal light scatter parameters on flow cytometry In situ amplification by tSDA also remains compatible with immunochemical techniques in spite of the increased reaction temperature, so both amplification of target sequences and immunological staining can be performed on the same specimen This is in contrast to the //; situ PCR, in which the repeated temperature cycling may make the cellular antigens of interest undetectable by immunochemical techniques The inventive methods for in situ tSDA generally comprise a brief fixation of the cells or tissue, followed by permeabilization and addition of the reagents required for tSD A When the target sequence is DNA the cells or tissues are heated briefly pπor to amplification to denature the target sequence Because of the thermostability of the enzymes involved, heating may optionally take place in a mixture of reagents which includes the enzymes Alternatively, the enzymes may be added after denaturation, upon cooling the sample to the desired reaction temperature The tSDA reaction is typically incubated at 50-65°C for 1 min to 2 hr , although higher temperatures are possible if compatible with the selected enzymes If no prior heating is required to denature the target sequence, all of the SDA reaction components are simply added directly to the fixed, permeabilized cells at the desired reaction temperature to initiate amplification After washing to remove unused primers and enzymes, the amplification products are detected /// situ or after release from the cells
DESCRIPTION OF THE DRAWINGS
Fig 1 shows the flow cytometric results for amplification of an HIV target sequence and an HLA-DQα exon 3 target sequence by /// situ tSD A
DETAILED DESCRIPTION OF THE INVENTION
The inventive methods for in situ nucleic acid amplification by tSDA are based on the discovery that tSDA in situ provides the significantly improved sensitivity, speed and specificity of in vitro (solution) tSDA protocols without significant loss of cellular structure and moφhology In general, a sample of cells (e g , cells in suspension or tissue sections) suspected of containing nucleic acid target sequences is fixed with a fixative which maintains the morphological integrity of the cell but does not cross-link or precipitate cellular proteins so extensively that penetration of primers and other reagents is prevented Treatment with protease after fixation to obtain penetration of primers and reagents into the fixed cells is therefore generally not required
Either cross-linking or precipitating fixatives may be used in the practice of the invention Examples include paraformaldehyde, 4% glutaraldehyde, ethanol acetic acid fixatives, Camoy's fixative (acetic acid, ethanol, chloroform), 1% osmium tetroxide, Bouin's fixative (1.21% picric acid, 1 1% formaldehyde, 5 6% acetic acid), Zenker's fixative (5 0% mercuπc chloride, 2 5% potassium dichlorate, 5 0% acetic acid, 1 0% sodium sulfate), and acetic acid/methanol fixatives The use of FACS™ Lysing Solution allows lysis, fixation and permeabilization using a single reagent The preferred fixative for use in the invention is 1 -4% paraformaldehyde, which is preferably used to treat the cells or tissues for about 1 min to 1 hr It is generally useful to permeabilize the fixed cells prior to amplification, e g , using detergents such as NP40. TRITON or saponin Under certain circumstances, fixing may be optional That is, tSDA may be performed in situ in unfixed cells, especially when RNA targets are to be selectively amplified and no preliminary heat denaturation step is required (see below)
It is an important feature of the present invention that either RNA or DNA target sequences, or both, may be amplified directly using the inventive methods To amplify only RNA, a reverse transcriptase may be added to the tSDA reaction as it is in reverse transcription PCR (rtPCR - G J Nuovo, et al 1992 Diag Molec. Pathol 1, 98-102, G J Nuovo. et al 1991 Am. J. Pathol. 58, 518-523, G J Nuovo, et al 1991 Am. J. Pathol. 139, 1239-1244) However, several of the DNA polymerases used in tSDA have now been found to exhibit reverse transcπptase activity They can polymerize DNA copies of a target sequence using either RNA or DNA as the template, with incoφoration of dNTPαS and displacement from a nick RNA target sequences may therefore be reverse transcribed by the same polymerase which performs the DNA amplification portion of the tSDA reaction, without the need to add a separate reverse transcriptase RNA may be amplified in the cells (i e , without substantial amplification of DNA targets) by eliminating the heat denaturation step or treating with DNase pπor to initiating the tSDA reaction The double stranded DNA in the cells then remains double stranded and unavailable as a template, whereas pπmers can hybridize to available single stranded RNA and begin specific amplification of RNA target sequences by generating cDNA The cDNA in turn serves as a template for further amplification Specific amplification of RNA target sequences may also be accomplished by treating the cells with RNase-free DNase prior to initiating SDA As fixation aids in maintaining the integrity ofthe cells dunng heating, fixing may not be needed when there is no preliminary heat denaturation step It may still be useful, however, to permeabilize the unfixed cells or tissues Treatment of the cells or tissues with RNase pπor to heat denaturation of double stranded DNA degrades potential RNA target sequences and allows specific amplification of the corresponding DNA target sequences NaOH (about 0 IM) may also be used to selectively degrade RNA and denature DNA for DNA-specific amplification
If the heat denaturation step is included (without RNase treatment) prior to annealing of the SDA primers, both DNA and RNA target sequences will be amplified In situ reverse transcription of RNA by the DNA polymerases used in tSDA is generally less efficient than DNA synthesis, but has unexpectedly been found in some cases to be more efficient than conventional reverse transcriptases However, RNA targets are usually present in the cell in greater numbers than the corresponding DNA target, and the high efficiency of amplification of the cDNAs which are generated quickly overcomes and compensates for any reduced efficiency in the reverse transcπption step of the reaction Amplification of both RNA and DNA targets is preferred for most diagnostic applications of the invention because this gives the greatest number of amplifiable target sequences per cell and, as a result, the greatest sensitivity and largest number of potentially positive cells per sample.
If the target is to be heat denatured prior to amplification, the fixed cells or tissues may be heated in the SDA reaction mixture (e g , dNTPs, KiPO MgCl2, BSA, DMSO, external primers, amplification primers, and enzymes if they are sufficiently heat-stable) If the polymerase and restriction endonuclease are not sufficiently heat stable at the temperature of denaturation, they may be added subsequently when the sample has been cooled to the desired reaction temperature If the target is not heat denatured, the SDA reaction mixture including the restriction endonuclease and polymerase(s) may simply be added to the cell sample at the selected reaction temperature to initiate amplification
As for conventional SDA, targets for amplification by tSDA may be prepared by fragmenting larger nucleic acids by restriction with an endonuclease which does not cut the target sequence However, for both in situ tSDA and m situ conventional SDA it is generally preferred that target nucleic acids having the selected restriction endonuclease recognition cleavage sites for nicking in the amplification reaction be generated as described by Walker, et al. ( 1992, Nuc. Acids Res., supra) and in U.S. Patent No. 5,270, 184
To prevent cross-contamination of one SDA reaction by the amplification products of another, dUTP may be incoφorated into SDA amplicons in place of dTTP without significant inhibition of the amplification reaction The uracil-containing nucleic acids may then be specifically recognized and inactivated by treatment with UDG (uracil DNA glycosylase) Therefore, if dUTP is incorporated into SDA amplicons in a prior reaction, any subsequent SDA reactions can be treated with UDG prior to amplification of double stranded targets, and any dU containing DNA from previously amplified reactions will be rendered unamplifiable The target DNA to be amplified in the subsequent reaction does not contain dU and will not be affected by the UDG treatment UDG may then be inhibited by treatment with Ugi (uracil DNA glycosylase inhibitor) prior to amplification of the target. Altematively, UDG may be heat-inactivated In tSD A, the higher temperature of the reaction itself (> 50°C) can be used to concurrently inactivate UDG and amplify the target. SDA requires a polymerase which lacks 5'— >3' exonuclease activity, initiates polymerization at a single stranded nick in double stranded nucleic acids, and displaces the strand downstream of the nick while generating a new complementary strand using the unnicked strand as a template. Polymerase displacement activity is essential to the amplification reaction, as it makes the target available for synthesis of additional copies and generates the single stranded extension product to which a second amplification primer may hybridize in exponential amplification reactions More processive polymerases are preferred, as they may maximize the length of target sequence which can be amplified
Little was previously known about the activities of thermophilic polymerases at temperatures which would be appropriate for tSDA Further, the activities of thermophilic polymerases at temperatures compatible with activity for thermophilic restriction endonucleases was not known Screening assays were therefore developed to identify candidate restriction endonucleases and polymerases, if any existed The polymerase screening system is an extension assay which tests the ability of the polymerase to displace a downstream strand initiating at a single stranded nick in a double stranded template It also tests for the presence or absence of 5'→3' exonuclease activity 5'- 3' exonuclease activity, if present in an otherwise suitable thermophilic polymerase, can be inactivated by routine methods known in the art (WO 92/06200) One of the most common methods for selectively inactivating exonuclease activity in a polymerase is to clone the gene for the polymerase, identify the portion of the gene sequence which encodes the protein domain responsible for exonuclease activity, and inactivate it by m vitro mutagenesis Altematively, exonuclease activity may be inactivated by treating the polymerase with protease to isolate fragments which exhibit only the desired polymerization and displacing activities Therefore, a thermophilic polymerase identified in the extension assay which is active at a suitable temperature, initiates extension at a nick and incoφorates modified dNTPs but has 5'— 3' exonuclease activity can be made suitable for tSDA by elimination ofthe exonuclease activity
In the extension assay for polymerases, displacement ofthe single strand from a double stranded nucleic acid and initiation at a nick is staged by annealing two primers immediately adjacent to each other on an intact sequence complementary to both primers The primers are labeled at their 5' ends, usually with 32p if a polymerase has strand displacement activity, is able to initiate polymerization at the "nick" formed by the adjacent hybridized primers and lacks 5'→3' exonuclease activity, both primers are extended and two extension products will be detected. If the polymerase lacks 5'— >3' exonuclease activity but cannot initiate extension at the nick (e.g., it requires a gap) and/or if it lacks displacement activity, only the extension product ofthe downstream primer will be detected A polymerase which initiates at a nick but has 5'— >3' exonuclease activity will generate only the extension product of the upstream primer. The extension assay also requires that the polymerase be capable of incorporating an α -thio dNTP (dNTPαS), which is included in the reaction Upstream and downstream primers and their respective extension products are generally identified by size on gels with autoradiography Of eleven thermophilic DNA polymerases initially screened in the extension assay, six were identified as having all of the required characteristics for use in the invention exo" Vent (New England Biolabs), exo" Deep Vent (New England Biolabs), Bst (BioRad), exo" Pfu (Stratagene), Bca (Panvera), and Sequencing Grade Taq (Promega). Others may be routinely identified using the foregoing extension assay without the exercise of inventive skill, and all such polymerases would be suitable for use in tSDA The polymerases Tth (Boehringer), Tfl (Epicentre), REPLINASE (DuPont) and REPLITHERM (Epicentre) strand displace from a nick, but also have 5'→3' exonuclease activity These polymerases are useful in the methods of the invention after removal of the exonuclease activity, e.g., by genetic engineering. Most of the thermophilic polymerases identified to date are active between about 50°C and 75°C, with optimal activity at about 65°C-75°C and reduced activity at about 50°C-65°C. However, as the thermostability of thermophilic restriction endonucleases is generally limited to less than 65°C, thermophilic polymerases with optimal activity at lower temperatures (e.g., Bst and Bca) are more compatible with thermophilic restriction endonucleases in the reaction and are therefore preferred However, restriction endonucleases which are active at higher temperatures compatible with the usual optimum temperatures for polymerase activity may be identified and are also useful in the invention
Restriction endonucleases suitable for SDA must cleave only one of the strands of a double stranded hemimodified recognition/cleavage site for the restriction endonuclease ("nicking"). This nicking activity is of great importance, as it is nicking which perpetuates the reaction and allows subsequent rounds of target amplification to initiate. Because restriction enzymes generally produce double strand breaks, cleavage of one of the two strands in the duplex cleavage site must be selectively inhibited. This is usually accomplished by introducing nucleotide analogs (e.g., deoxynucleoside phosphorothioates) into one strand of the DNA during synthesis so that either the modified strand or the unmodified strand is no longer susceptible to cleavage In cases where the unmodified strand is protected from cleavage, nucleotide analogs may be incorporated into the primer during its synthesis, thus eliminating both the need to add nucleotide analogs to the amplification reaction and the requirement that the polymerase be capable of incorporating such nucleotide analogs.
As nucleotide analog substitutions do not induce nicking by all restriction endonucleases, a means for assaying the nicking characteristics of restriction endonoucleases was required in order to identify suitable enzymes which might exist among the many available thermophilic restriction endonucleases. Therefore, a screening system for identifying thermophilic restriction endonucleases with the desired properties was devised based on the ability of a modified deoxynucleotide incorporated into one strand of the double stranded restriction endonuclease recognition/cleavage site to protect one of the two strands from cleavage by the endonuclease. This is referred to as the analog-induced nicking assay or the strand protection assay In the strand protection assav a single stranded template comprising the restπction endonuclease recognition/cleavage site and a pnmer complementary to a portion of the template other than the recognition/cleavage site are synthesized The template and the primer are then labeled, typically with a radiolabel The pnmer and template are hybπdized and modified dNTPs are incoφorated by extension ofthe pnmer, producing a fully double stranded molecule containing a hemimodified restriction endonuclease recognition/cleavage site This product is treated with the restriction endonuclease under conditions appropnate for double- stranded cleavage Electrophoretic analysis of the reaction products under denatunng conditions is used to determine, by the size of the fragments generated, whether or not the recognition/cleavage site was nicked, cleaved or uncut The size of the fragments on electrophoresis is also used to determine which ofthe two strands of the recognition/cleavage site (I e , modified or unmodified) was protected from cleavage The strand protection assay may be routinely adapted to screen additional restriction endonucleases for utility in the invention, without the exercise of inventive skill Using the strand protection assay, twenty-eight thermophilic restriction endonucleases were tested (Accl, Aspl, Bsal, BsaBI, BsiYI, BslI, two degenerate sites of BsmI, BsmAI, BsmFI, BsmHI, BspWI, four degenerate sites of BsoBl, BsoFI, two degenerate sites of BsrI, BsrBRI, two degenerate sites of BsrDI, Bst71I, two degenerate sites of BstNI, BstOI, BstXl, Dpnl, Haell, MamI, MboII, Mval, Mwol, Sfil, and Tthl 111) Of the twenty-eight, eleven had at least one restπction endonuclease recognition/cleavage site which was nicked upon introduction of at least one α-thio dNTP Accl, BslI, Bs I, BsmAI, BsoBI, BsrI, BsrDI, BstNI, BstOI, BstXl, and Mwol One ofthe recognition sites of BsmI exhibited protection of the unmodified strand when dCTPαS was incoφorated When tested for thermostability at 50-65°C, all but one of the eleven (Accl) were sufficiently stable or could be sufficiently stabilized by addition of common stabilizers such as double-stranded DNA or BSA These endonucleases were therefore compatible with the thermophilic polymerases in the tSDA reaction
In addition, several thermophilic endonucleases were identified which had partial or low nicking activity under the initial screening conditions of the strand protection assay (e g , Tthl l II, BsiYI and BsoFI) While reduced nicking activity would not prevent SDA, nicking by a restnction endonuclease may be optimized by adjusting the the reaction conditions (e g , by optimizing the buffer or adjusting the reaction temperature), making them more efficient in tSDA In addition, as it is known that sequences flanking a restriction endonuclease recognition/cleavage site may affect the degree of endonuclease activity, altering the flanking sequences of the templates may also improve nicking activity for endonucleases which nicked only partially Thermophilic SDA is performed essentially as conventional SDA, with substitution of the desired thermostable polymerase and thermostable restriction endonuclease Of course, the temperature of the reaction will be adjusted to the higher temperature suitable for the selected thermophilic enzymes and the conventional restriction endonuclease recognition/cleavage site will be replaced by the appropriate restriction endonuclease recognition/cleavage site for the selected thermostable endonuclease Also in contrast to conventional SDA, the practitioner may include the enzymes in the reaction mixture prior to the initial heat denaturation step if they are sufficiently stable at that temperature. Preferred restriction endonucleases for use in tSDA are BsrI, BstNI, BsmAI, BslI and BsoBI (New England BioLabs), and BstOI (Promega) The preferred thermophilic polymerases are Bca and Bst
To develop an optimized SDA system capable of high amplification factors (e.g., 10 - 10^), evaluation and optimization of the buffer systems is recommended This is also the case when evaluating a new restriction enzyme/poly merase pairing for use in thermophilic SDA Such optimization methods may be applied to determine an appropriate buffer for any restriction endonuclease/polymerase combination for tSDA, requiring only routine testing without the exercise of inventive skill In most cases the KPO4/MgCl2 buffer typically employed in conventional SDA is suitable for tSDA, either as described or with some routine modification ofthe concentrations ofthe components
In in situ tSDA, the reagents for amplification are applied to unfixed cells or cells which have been fixed and permeabilized as described above After initiation of the reaction, amplification ofthe target sequence is generally allowed to proceed at about 50-65°C for about 1 min. to 2 hr., preferably about 10 min. to 1 hr. It has been discovered that the time required for in situ amplification by tSDA or conventional SDA is significantly less than the time required to obtain a comparable level of target amplification in situ by the PCR In certain cases it may be advantageous to increase the concentration of reagents (especially primers) for in situ tSDA as compared to in vitro tSDA to ensure that sufficient amounts enter the cells for efficient amplification Leakage of amplicons from the cells has been a problem in certain in situ nucleic acid amplification methods. Such leakage is believed to be the result of the complex interaction of a variety of parameters, e.g., size of the amplicon, temperature, temperature cycling and the degree to which the cell has been permeabilized To facilitate retention of amplicons within the cell, a deoxyribonucleoside triphosphate (dNTP) analog comprising the dNTP conjugated to a moiety such as digoxigenin ("dig"), biotin or fluorescein isothiocyanate (FITC) may optionally be incoφorated into the amplification products along with the dNTPαS. The additional dNTP analog may also, optionally, serve as a tag or label to be used for detecting amplification products Incoφoration of dNTP analogs such as dig also has the advantage of providing an enhanced signal, as each incorporated label moiety can generate a signal bv binding to anti-dig antibodies conjugated to alkaline phosphatase (AP-α- dig) Incorporation of such dNTP analogs is particularly advantageous for //; situ SDA because the amplified target sequence is generally smaller than a PCR amplicon It has been observed however, that even though SDA amplicons are generally smaller than PCR amplicons, there is less leakage associated with in situ conventional SDA than with in situ PCR Because of the higher temperature of /// situ tSDA, it was anticipated that amplicon leakage might be increased, possibly to the level observed in m situ PCR In practice, however, although there may be a slight increase in amplicon leakage at the elevated temperatures, there is still significantly less amplicon leakage in m situ tSDA than there is in in situ PCR
Following target amplification, the amplicons produced may be detected by any of the methods known in the art for detection of specific nucleic acid sequences For example, amplification products may be detected m situ or after release of amplicons from the cells by specific hybridization to an oligonucleotide detector probe The detector probe is a short oligonucleotide which includes a detectable label, I e , a moiety which generates or can be made to generate a detectable signal The label may be incoφorated into the oligonucleotide probe by nick translation, end-labeling or dunng chemical synthesis of the probe Many directly and indirectly detectable labels are known in the art for use with oligonucleotide probes Directly detectable labels include those labels which do not require further reaction to be made detectable, e g , radioisotopes, fluorescent moieties and dyes Fluorescent labels such as fluorescein isothiocyanate (FITC) or radioisotopes such as 2P are preferred for use in labeling probes for direct detection of target sequences amplified in situ Indirectly detectable labels include those labels which must be reacted with additional reagents to be made detectable, e g , enzymes capable of producing a colored reaction product, biotin, avidin, digoxigenin, antigens haptens or fluorochromes The signal from enzyme labels is generally developed by reacting the enzyme with its substrate and any additional reagents required to generate a colored enzymatic reaction product Biotin (or avidin) labels may be detected by binding to labeled avidin (or labeled biotin) or labeled anti-biot (or labeled anti-avidin) antibodies Digoxigenin and hapten labels are usually detected by specific binding to a labeled anti-digoxigenm (anti-dig) or anti-hapten antibody Enzymes are preferred for use as indirectly detectable labels in the present invention Most preferred is alkaline phosphatase (AP) because it is stable and has been used extensively for labeling in tissues and cells The presence of AP may be detected by reaction with a substrate The preferred substrates for detection of AP are Vector Red/Vector Blue (Vector Labs, CA), 5-bromo-4-chloro-3-ιndolyl phosphate (BCIP)/nιtro blue tetrazolium (NBT) (Sigma Chemical Company, St Louis, MO) or Nuclear Fast Red (Sigma Chemical Company) Vector Red has the added advantage of fluorescence. allowing visualization of a positive signal either by conventional light microscopy or by fluorescence microscopy Methods for developing the colored reaction product of AP with these substrates are known in the art
To detect amplified target sequences by hybridization to a detector probe, the cells or tissues are exposed to the labeled probe under reaction conditions appropriate for specific hybridization of the probe to single stranded amplification products In general, the detector probe will be selected such that it hybridizes to a nucleotide sequence in the amplicon which is between the binding sites of the two amplification primers However, a detector probe may also have the same nucleotide sequence as either of the amplification primers Suitable methods for detection by in situ hybridization to a detector probe are described by J B Lawrence, et al ( 1989 Cell 57, 493-502), J B Lawrence, et al. ( 1990 Proc. Natl. Acad. Sci. USA 87, 5420-5424) and in U.S Patent No 4,888,278
Alternatively, amplification products may be detected in situ or after release from the cells by primer extension as described by Walker, et al ( 1992b), supra In the primer extension method an oligonucleotide primer comprising a detectable label is hybridized to the amplification products and extended by addition of polymerase For detection the primer may be 5' end-labeled, preferably using 32P or a fluorescent label Alternatively, extension of the hybridized primer may incoφorate a dNTP analog comprising a directly or indirectly detectable label For example, extension of the primer may incoφorate a dig-derivatized dNTP, which is then detected after extension by reaction with AP-α-dig and a suitable AP substrate. The primer to be extended may either be the same as an amplification primer or it may be a different primer which hybridizes to a nucleotide sequence in the amplicon which is between the binding sites of the amplification primers
The detectable label may also be incorporated directly into amplicons during target sequence amplification For example, one ofthe dNTPs in the conventional SDA reaction may be completely or partially replaced with a dNTP analog which comprises a dNTP conjugated to a directly or indirectly detectable label For example, dUTP conjugated to the desired label may be substituted for dTTP in the SDA reaction The polymerase then incoφorates the label directly into the amplification products generated by extension of the amplification primer The label may be directly or indirectly detectable Preferably, the label conjugated to the dNTP is a fluorescent label which may be detected directly in the amplicons by fluorescence microscopy or flow cytometry. In an altemative preferred embodiment, the label conjugated to the dNTP is biotin or digoxigenin, which may be detected by reaction with streptavidin/FITC and fluorescence microscopy or flow cytometry Secondary amplification products are copies of the target sequence generated by hybridization and extension of a signal primer on the target sequence The secondary amplification products comprise an internal segment of the amplified target sequence and a detectable label which is associated with the signal primer At least the 3' end of the signal pnmer comprises a sequence which hybridizes to the target sequence It may also include features which facilitate capture or immobilization of the secondary amplification products, so that they may be isolated for detection, quantitation or further manipulation Concurrent generation of secondary amplification products in the in situ tSDA reaction provides another detection method which is homogeneous and may be performed concurrently with amplification The lengthy m situ probe hybridization step is eliminated, and concentrations of signal pnmer are lower than for hybridization probes The lower concentration itself reduces background and also allows higher stπngency washing which further reduces background To generate secondary amplification products, at least one signal pnmer is included in the in situ tSDA reaction mixture The signal pnmer(s) hybndizes to the target sequence downstream of the hybndization site of an amplification primer and is extended by polymerase in a manner similar to extension of the amplification pnmer Extension of the amplification primer displaces the downstream extension product of the signal pnmer from the target sequence The opposite amplification pnmer can then hybridize to the extended, displaced signal primer and itself be extended by polymerase, resulting in incoφoration of the signal primer into a longer duplex indicative of target amplification As any remaining unextended signal pπmers are small, they can be washed out of the cell while the extended signal primers are retained withm it Target amplification-specific signal thereby becomes associated with the cells where the target is present and is substantially absent from cells where there is no target
The label of the hybridized detector probe, extended primer, amplicon or secondary amplification product is then detected, preferably m situ, as an indication of the presence of amplified target sequences This may require the addition of reagents to the cells to develop the signal of an indirectly detectable label such as AP, biotm or dig Microscopic analysis of the cells is preferred when the detectable label is an enzyme Microscopic analysis may be either by visual observation of the cells or tissues (fluorescence or light microscopy), or automated image analysis using instruments such as DISCOVERY (Becton Dickinson Image
Cytometry, Leiden, Holland) to evaluate the number and signal intensity of positive cells When the label is a radiolabel, the cells may be suspended in scintillation fluid and the signal detected by scintillation counting Use of a directly detectable fluorescent label allows fluorescence analysis of cells in suspension by flow cytometry (e g , FACSCAN, Becton
Dickinson Immunocytometry Systems, San Jose, CA) A shift in peak fluorescence to the πght on a plot of cell number vs fluorescence intensity is indicative of an increased number of cells containing the target sequence Conversely, a shift in peak fluorescence to the left on the plot is indicative of a reduced number of cells containing the target sequence Alternatively, amplification products may be released from celis prior to detection as described above or visualized after gel electrophoresis as bands of amplification products, e g , by EtBr staining, hybπdization of a detector probe or primer extension When a radiolabel is used for the primer or detector probe, amplification products mav be visualized bv autoradiography of the gels Conventional methods of prepaπng cells for in situ amplification and analysis by flow cytometry involve isolation of peπpheral blood mononuclear cells from whole blood (PBMCs - e g , by FICOLL gradient centnfugation) prior to antibody staining and/or amplification An additional step to isolate T cells from the PBMCs may also be necessary Such conventional protocols require approximately two days to obtain flow cytometric results for a whole blood sample It has now been discovered that a whole blood sample can be fixed and amplified in situ with flow cytometπc analysis in a single day using FACS™ Lysing Solution (Becton Dickinson Immunocytometry Systems, San Jose, California) to prepare the sample This lysing reagent comprises diethylene glycol, heparin, citrate buffer and formaldehyde, pH 7 2 Because of the presence of formaldehyde, FACS™ Lysing Solution provides the advantage of reducing the biohazard from biological samples In the new sample preparation protocol, the sample is simply lysed with FACS™ Lysing Solution, then fixed, permeabilized, and amplified in situ as described above When cells in suspension or in tissues are to be analyzed both by m situ tSDA and immunostaining, it is preferred that the antibody be bound to the epitope or antigen of interest pπor to lysis and fixation, and that the antibody be conjugated to an indirectly detectable label, e g , biotin The antibody-conjugate is then stabilized on the cells by fixation After in situ tSDA, the bound antibody is detected by reaction with appropriate signal developing reagents, e g , streptavidin conjugated to a fluorochrome or anti-biottn conjugated to a fluorochrome The fluorochrome for detection of target amplification and the fluorochrome of the antibody may be separately detectable on flow cytometry, allowing the practitioner to simultaneously determine the presence of target in a cell and identify the type of cell in which the target is found The new sample preparation protocol may be further shortened by inclusion of a fluorescently labeled signal primer in the amplification reaction As descnbed above, the signal pnmer is extended and rendered double stranded dunng the amplification reaction in a target amplification-specific manner, eliminating the need for additional post-amplification steps to detect amplification products
Design of amplification pπmers for SDA generally requires synthesis of multiple pπmers directed to the target region of interest, followed by testing of pairwise combinations of pnmers in SDA reactions to determine the amplification efficiency of each pair This is because the parameters which affect SDA pnmer performance are not well understood We have found that apparently insignificant changes in the target binding regions of amplification pnmers for SDA can have a significant and unpredictable effect on amplification efficiency and that the melting point of the target binding region is not necessarily related to priming efficiency In the development of in situ tSDA, a first pair of amplification primers was designed which was specific for the gag gene of HIV A target region of the gag gene which did not contain a recognition site for the SDA restriction endonuclease was selected The target region was also selected on the basis of having two regions of approximately 50 bp each which were approximately 100 bp apart and relatively invariant Primer design software was then used to determine the melting point of the target binding of each primer candidate and to assess the potential for formation of primer dimers Primers were modified or discarded according to these preliminary results A final list of eight candidate "left-side" amplification primers (directed to the 3' end of the target on the first strand) and nine candidate "right-side" amplification primers (directed to the 3' end of the target on the second strand) was compiled for experimental testing Bumper primers and detector probes were designed taking into account only the melting point and suitable placement with respect to the amplification primers The amplification efficiency of pairwise combinations of "left-side" and "right-side" primers was determined experimentally in in vitro tSDA using a plasmid clone of the gag target, Bca polymerase and BsoBI Amplicons were detected and quantified by hybridization and extension of a 32_p labeled detector probe, followed by gel electrophoresis The amplification primer pair with the best amplification efficiency tn vitro was selected for further development in in situ tSDA. In a buffer system optimized as described above, this primer set detected less than ten copies of the gag target sequence in tn vitro tSDA (BsoBI sites are italicized, target binding sequences are underlined)
Left-Side Amplification Primer (SEQ ID NO 1 )
ACCGCATCGAATGCATGTC ΓGGGTGGTAAAAGTAGTAGAAG TM 41°C Right Side Amplification Primer (SEQ ID NO 2)
CGATTCCGCTCCAGACTTrrC GGGTGTTTAGCATGGTGTT TM 55°C Bumper Primers
AAATGGTACATCAGGCC TM 57°C (SEQ ID NO:3) GCAGCTTCCTCATTGAT TM 58°C (SEQ ID NO 4) Detector Probe (SEQ ID NO: 5)
GGTGGCTCCTTCTGATAATG TM 63°C
A pair of amplification primers specific for exon 3 ofthe HLA-DQα gene was designed in a similar manner, using human placental DNA for evaluation of the candidate amplification primer pairs in vitro As the HLA genes are present in all cells, this target was to be used as a positive control for in situ tSDA Because leakage of the amplicons was found not to be a significant problem, slightly smaller target regions were selected for the initial identification of candidate primers (about 75- 100 bp) Three "left-side" amplification primers and three "πght- side" amplification primers were initially designed and tested expeπmentally in pairwise combinations In a buffer system optimized as described above, the following primer set gave the best amplification results, detecting less than five copies of the HLA-DQα exon 3 target sequence in m vitro tSDA
Left-Side Amplification Pnmer (SEQ ID NO 6)
ACCGCATCGAATGCATGTC7TGGGTGGTCAACATCACATGGC TM 60°C Right-Side Amplification Primer (SEQ ID NO 7)
CGATTCCGCTCCAGACTTC7TGGGTGAGAGGAAGCTGGTC T 53°C Bumper Pπmers
GTCTTGTGGACAACATCTTTCC TM 64°C (SEQ ID NO 8) TAACTGATCTTGAAGAAGGAATGATC TM 59°C (SEQ ID NO 9) Dectector Probe (SEQ ID NO 10)
AATGGGCACTCAGTCACAGA TM 65°C The target binding sequence confers target specificity on the amplification primer The target binding sequences of the amplification pπmers of the invention are therefore also useful in nucleic acid amplification protocols other than SDA, e g , PCR and 3SR Specifically, any amplification protocol which utilizes cyclic, specific hybπdization of primers to the target sequence, extension ofthe primers using the target sequence as a template and displacement of the extension products from the target sequence may employ the target binding sequences of the amplification primers ofthe invention For amplification methods which do not require any specialized, non-target binding sequence, such as the restriction endonuclease recognition site of the amplification pπmers shown in the attached SEQUENCE LISTING (e g , PCR), the amplification primers may consist of the target binding sequences only Amplification methods which require different specialized, non-target binding sequences than those shown in the
SEQUENCE LISTING (e g , 3SR) may employ amplification pπmers comprising the target binding sequences of the amplification pπmers listed and the sequence or structure required by the selected amplification method as is known in the art In addition, a different restriction endonuclease recognition site appropnate for tSDA may also be substituted for the restπction endonuclease recognition site shown in the SEQUENCE LISTING, using methods known in the art
The following expeπmental examples are provided to illustrate certain embodiments of the invention, but are not to be construed as limiting the invention as defined by the appended claims
EXAMPLE 1 The HLA-DQα exon 3 target was amplified and detected /// situ in human acute myelogenous leukemia (AML) cells (KG- la) using the selected primer set described above The cells were first fixed for 30 min in 4% paraformaldehyde and washed three times in IX phosphate buffered saline (PBS) They were then permeabilized with 0 01% saponin for 20 min. and washed three times with IX PBS Five microliters of fixed, permeabilized cells (108 cells/ml in 35 mM KPj pH 7 6) were added to 40 μL of 35 mM KPj, pH 7 6, 3 mM MgCl2, 50 μM each dGTP, TTP and dATP, 1 4 mM dCTPαS, 500 nM amplification primers, 50 nM bumper primers and 15% glycerol After gentle mixing, the samples were incubated at 95°C for 2 min and transferred to a THERMAL-LOK™ temperature block maintained at the reaction temperature (52°C) Five microliters of the enzyme cocktail were then added (0 5 μL 10 NEB 2, 0.36 μL of 22 unit/ml Bca, 1 0 μL of 160 unit/ml BsoBI and 3 14 μL water) and mixed to start the amplification reaction Final reaction volume was 50 μL After 30 min , the reaction was stopped by placing on ice and amplification products were detected Radiolabeled detector probes (2 X 106 cpm) were added to the amplification reaction and hybridized to the amplification products //; situ for 3 min at 95°C, followed by 60 min. at 37°C After washing twice for 25 min in 200 μL of I X SSC, the cells were counted in scintillation fluid The results of one such experiment were as follows
TUBE IN SITU
HYBRIDIZATION
SIGNAL
(cpm)
1 9510 tn situ tSDA, specific detector probe
2 556 negative control, specific detector probe
3 828 in situ tSDA, unrelated detector probe
4 769 negative control, unrelated detector probe
In Tube 1, amplified KGla cells were probed with the HLA-DQα exon 3-specific detector probe. Tube 2 was a negative control in which the restriction endonuclease was omitted from the amplification reaction, preventing tSDA Tubes 3 and 4 corresponded to Tubes 1 and 2, but were probed with the ^α^-specific detector probe, which is unrelated to the target sequence All samples which were amplified in the presence of all necessary enzymes and were detected with the HLA-DQα exon 3 -specific probe showed specific amplification of the intended target in situ The experiment was repeated to include incubation of unamplified cells with amplicons generated //; situ This was to evaluate the transfer of amplicons to negative cells, either by sticking of amplicons to the cell suiface or uptake of the amplicons by negative cells Following in situ amplification, the reaction was centrifuged to sediment the cells The supematant was incubated for 15 min at 70°C to eliminate BsoBI activity and added to fixed, permeabilized KG la cells which had previously been heated to 95°C for 2 min The mixture was incubated at 52°C for 30 min and the cells were then hybridized, washed and counted as above with both specific and non-specific (unrelated) detector probes The results are shown below
TUBE IN SITU
HYBRIDIZATION
SIGNAL
(cpm)
1 2924 negative control, specific probe
2 16284 in situ tSDA, specific probe
- j* 17548 3X polymerase, specific probe
4 5582 cell incubation, specific probe
5 871 negative control, unrelated probe
6 31 1 in situ tSDA-, unrelated probe
7 501 3X polymerase, unrelated probe
8 453 cell incubation, unrelated probe
Restπction endonuclease was omitted from the negative control reaction in Tube 1 Tubes 2 and 3 represented the complete amplification reaction with specific detection Tube 3 shows the signal resulting from in situ tSDA under the same conditions as in Tube 2 but with a three-fold increase in polymerase concentration In Tube 4, tSDA amplicons generated in situ were incubated with unamplified cells, which were then hybridized, washed and detected as in the amplified samples Tube 4 was included to determine how much of the positive signal in Tube 2 is due to non-specific sticking of amplicons to unamplified cells Tubes 5-8 correspond to the reaction conditions of Tubes 1 -4, except that the unrelated gag detector probe was hybridized as a negative control As in the previous experiment, specific in situ amplification ofthe target clearly occurred in those samples which contained all necessary enzymes and were detected with the specific HLA-DQα exon 3 probe False positive signal generation caused by a mechanism in which amplicons which may be found in the supematant are taken up by unamplified cells may occur to some extent, but the substantially higher signal in tubes 2 and 3 clearly shows that /// situ SDA is taking place The majority of signal is target-specific and not due to amplicon transfer
In an alternative detection system, the experiments were repeated using signal primers labeled with fluorescein Signal primers were added to the amplification reaction at a concentration of 100 nM The fluorescent probe was thereby extended by polymerase and displaced from the target by extension of the upstream amplification primer After stopping the amplification reaction on ice, the samples were washed twice with 150-200 μL of phosphate buffered saline for five minutes each wash Washing removed smaller, unextended signal primers from the cells, while the longer target amplification-specific fluorescent signal primers were retained by those cells in which amplification had occurred In these experiments, the washed cells were visualized by fluorescence microscopy, where a strong fluorescent signal was observed in positive cells and negative cells were non-fluorescent However, signal primer extension is also compatible with detection and/or counting of fluorescent cells by flow cytometry In a third series of similar experiments, the amplification products were detected in a colorimetric assay Cells were fixed in 4% paraformaldehyde for 20 min , washed three times in I X PBS and permeabilized in 0 01 % saponin for 10 min After washing in SDA buffer (35 mM KPO pH 7.5, 15% glycerol, 4 mM MgOAc), 5 μL of the cell suspension (5 X 105 cells) were added to 40 μL of SDA buffer with primers and dNTPs as above The target was amplified using the HLA-DQα exon 3 primer set as before, adding 5 μL of the enzyme mixture after target denaturation, to make a final reaction volume of 50 μL The mouse cells served as a negative cell line because, in spite of the homology between human HLA and mouse MHC, the mouse MHC target is not amplified in this amplification system Analysis of gene sequence databases revealed that homology between mouse and human in the binding regions of the primers used here is poor, and negativity was confirmed by failure to amplify purified mouse DNA in PCR using these primers After denaturing for 2 min at 94°C, digoxigenin- labeled detector probes ( 1-10 nM) were hybridized for 2 hr at 33°C Hybridization was followed by three post-hybridization washes in I X SSC at room temperature and buffer exchange to 100 mM TRIS pH 7.5/150 mM NaCl An anti-digoxigenin antibody (Fc fragment) conjugated to alkaline phosphatase (AP) was then incubated with the cells for 2-4 hr. at room temperature After a TRIS/NaCl wash to remove unbound antibody from negative cells and exchange to the alkaline phosphatase buffer ( 100 mM TRIS pH 9 5/100 mM NaCl/50 mM MgCl2), NBT/BCIP was used to develop color in those cells in which amplification had occurred The cells were cytospun onto slides and visualized by microscopy The human cells gave a strong colorimetric signal when the HLA-DQα exon 3 detector probe was hybridized in amplified cells Hybridization to HLA-DQα exon 3 detector probe in unamplified cells gave a O 97/11196 PC17US96/14648
negative or a very faint but still clearly negative colonmetπc response Other negative controls included absence of amplification (i.e , no addition of SDA enzymes), absence of detector probes, and non-specific detector probe (i e., gag or chick β-actin detector probe in amplified cells), all of which were also negative in the assay In mouse cells alone, neither the HLA-DQ α exon 3 or gag probes produced any significant color, but, when human and mouse cells were mixed during the amplification reaction, the colorimetric signal in the mouse cells was increased However, evidence suggests that this is an artifact of the colorimetric detection system itself and that the negative cells are non-specifically taking up the dye
EXAMPLE 2
Venous blood was collected in EDTA VACUTAINER™ blood collection tubes (Becton Dickinson Vacutainer Systems) DNP-conjugated anti-CD4 (L120) and biotinylated anti-CD3 (Leu 4) antibodies were added to 50 μL of whole blood and allowed to stain for 20 min. at room temperature To lyse red blood cells. 1 0 mL of I X FACS™ Lysing Solution (Becton Dickinson Immunocytometry Systems) was added to each tube for 10 min The cells were fixed in 4% paraformaldehyde for 20 mm. at room temperature and permeabilized by addition of 0.5 mL of IX FACS™ Lysing Solution and 0.025% TWEEN-20 Cells were washed twice with 35 mM KPO4, resuspended in 5 μL of 35 mM KPO4 buffer and transferred to 0.5 mL microcentrifuge tubes.
For in situ tSDA, 40 μL of 35 mM KPO4, 1 4 mM dCTPαS, 200 μM each dATP, dGTP and dTTP, 4 mM Mg acetate, 15% glycerol, 0 05 μM each bumper primer and 0 5 μM each amplification primer was added to the prepared blood sample The samples were heated at 95°C for 3 min. and then at 52°C to 55°C for 3 min to anneal the primers After primer annealing, 5 μL of an enzyme mix (0 5 μL 10X NEB 2 buffer, 160 units BsoBI, 8 units Bca polymerase) was added to start the amplification reaction The tubes were incubated at 55°C for 30 min Amplification products were detected in situ by hybridization to fluorescein labeled detector probes. Hybridization was performed at 95°C for 5 min., followed by 33°C to 37°C for 60 min. in 25 μL of SDA reaction buffer containing 100-150 ng of specific or unrelated detector probe
Alternatively, amplification products were detected by incorporation of a fluorescein labeled signal primer during amplification In this case, the amplification reaction buffer additionally included 100 nM of specific or unrelated 5' fluorescein labeled signal primer The initial heating step, addition of the enzyme mixture and amplification were performed as described above After m situ hybridization of the detector probe, or after completion of tSDA in the presence ofthe signal primer, cells were washed with IX SSC at room temperature for 30 min Antibody staining of cell surface markers was developed with anti-DNP-phycoerythrin (PE) and Cy5/PE labeled streptavidin Cells were washed once with IX PBS and resuspended in IX PBS for flow cytometric analysis. On dot plots of side scatter vs forward scatter (SSC vs FSC), white blood cells were shown to be unaffected by the experimental treatments That is, cells which had undergone in situ tSDA of the HLA-DQα exon 3 target (using the primer set described above) with CD4/CD3 immunophenotyping displayed typical populations of lymphocytes, granulocytes and monocytes The lymphocyte population also appeared normal on fluorescence dot plots of CD4 vs. CD3 These experiments demonstrated that FACS™ Lysing Solution and immunophenotyping were both compatible with in situ tSDA
For detection of HIV by in situ tSDA, a cell line containing the HIV genome (H9+) was mixed with normal whole blood and processed as described above and gag target sequences were amplified using the selected primer set described above Additional oligonucleotides which may be used as detector probes or signal primers were also designed for use as alternatives to SEQ ID NO:5.
AGCCACCCCACAAGATTT (SEQ ID NO 1 1) GTAATACCCATGTTTTCAGCAT (SEQ ID NO 12) AAATCTTGTGGGGTGGCT (SEQ ID NOJ3) ATGCTGAAAACATGGGTATTAC (SEQ ID NO 14)
On dot plots of SSC vs FSC, the H9+ cells were clearly distinguishable as a population separate from lymphocytes, monocytes and granulocytes with higher forward scatter than any of the white blood cell populations The HLA-DQα exon 3 and HIV gag targets were amplified by in situ tSDA using the primer sets described above and detected by detector probe hybridization or incorporation of a signal primer Histogram plots of FLl vs cell counts are shown in Fig 1 The HLA-DQα exon 3 positive control showed a substantial shift of peak fluorescence to the right (approximately 100 channels) as compared to negative control reactions in which no enzyme was added or unrelated probes or signal primers were used for detection The HIV amplification reaction showed a similar fluorescence peak shift on histogram plots of FLl vs cell counts These experiments confirmed that amplification was occurring m situ and demonstrated that an amplified HIV target could be detected in lysed whole blood by flow cytometry The magnitude of the peak shifts for detector probe and signal primer detection methods was similar.
Altematively, venous blood was collected in EDTA VACUTAINER™ blood collection tubes and PBMCs were isolated by centrifugation through FICOLL-PAQUE™ The collected cells were washed with I X PBS, and monocytes and B cells were removed using Human T cell
->-> enrichment columns (R&D Systems) The T cell enπched fraction was stained with DNP conjugated antι-CD4 and biotinylated antι-CD3 antibody for 20 min at room temperature After 20 min fixation in 4% paraformaldehyde in PBS, the cells were washed with PBS and counted The cells were permeabilized with 10 μg/mL saponin and washed twice with 35 mM KPO4 5 X 105 cells were resuspended in 5 μL KPO4 buffer and transferred to 0 5 mL microcentπfuge tubes In situ tSDA, detection of amplification products and immunophenotyping were performed as described above for the FACS™ Lysing Solution sample preparation method The experimental results were virtually identical for the two sample preparation methods
SEQUENCE LISTING
(1) GENERAL INFORMATION: d) APPLICANT. Lohman, Kenton L
Ostrerova, Natalie V Van Cleve, Mark Reid, Robert A.
(ii) TITLE OF INVENTION: DETECTION OF NUCLEIC ACIDS IN CELLS BY THERMOPHILIC STRAND DISPLACEMENT AMPLIFICATION
(ill) NUMBER OF SEQUENCES: 14
(iv) CORRESPONDENCE ADDRESS.
(A) ADDRESSEE: Richard J. Rodrick, Becton Dickinson and
Company
(B) STREET: 1 Becton Drive (C) CITY: Franklin Lakes
(D) STATE: NJ
(E) COUNTRY: US
(F) ZIP: 07417 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNE /AGENT INFORMATION:
(A) NAME: Fugit, Donna R.
(B) REGISTRATION NUMBER: 32,135
(C) REFERENCE/DOCKET NUMBER: P-3462
(2) INFORMATION FOR SEQ ID NO:1 : d) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mιεc_bιndιng (B) LOCATION: 25..42
(D) OTHER INFORMATION: /standard_name= "TARGET BINDING SEQUENCE"
(ix) FEATURE: (A) NAME/KEY: mιsc_feature
(B) LOCATION: 19..24
(D) OTHER INFORMATION: /standard_name= "RESTRICTION ENDONUCLEASE RECOGNITION SITE" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1 : ACCGCATCGA ATGCATGTCT CGGGTGGTAA AAGTAGTAGA AG 42
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: misc_binding
(B) LOCATION: 25..41 (D) OTHER INFORMATION: /standa d_name= "TARGET BINDING
SEQUENCE"
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 19..24
(D) OTHER INFORMATION: /standa d_name= "RESTRICTION ENDONUCLEASE RECOGNITION SITE"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
CGATTCCGCT CCAGACTTCT CGGGGTGTTT AGCATGGTGT T 41
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
AAATGGTACA TCAGGCC 17 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GCAGCTTCCT CATTGAT 17 (2) INFORMATION FOR SEQ ID NO:5-
(l) SEQUENCE CHARACTERISTICS
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS- single
(D) TOPOLOGY: linear (n) MOLECULE TYPE. DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GGTGGCTCCT TCTGATAATG 20
(2) INFORMATION FOR SEQ ID NO:6: (l) SEQUENCE CHARACTERISTICS.
(A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS. single
(D) TOPOLOGY, linear
(il) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mιsc_bιndιng
(B) LOCATION: 25..42
(D) OTHER INFORMATION: /standard_name= "TARGET BINDING SEQUENCE"
(ix) FEATURE:
(A) NAME/KEY: mιsc_feature
(B) LOCATION: 19..24
(D) OTHER INFORMATION: /standard_name= "RESTRICTION ENDONUCLEASE RECOGNITION SITE"
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: ACCGCATCGA ATGCATGTCT CGGGTGGTCA ACATCACATG GC 42
(2) INFORMATION FOR SEQ ID NO:7:
(l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 baεe pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS. single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mιsc_bιndmg
(B) LOCATION: 25..40 (D) OTHER INFORMATION: /standard_name= "TARGET BINDING
SEQUENCE"
(ix) FEATURE:
(A) NAME/KEY misc feature (B) LOCATION: 19..24
(D) OTHER INFORMATION: /standard_name= "RESTRICTION ENDONUCLEASE RECOGNITION SITE"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7 :
CGATTCCGCT CCAGACTTCT CGGGTGAGAG GAAGCTGGTC 40 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs <B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GTCTTGTGGA CAACATCTTT CC 22
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: TAACTGATCT TGAAGAAGGA ATGATC 26
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: AATGGGCACT CAGTCACAGA 20
(2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A), LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll: AGCCACCCCA CAAGATTT 1 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 baεe pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: GTAATACCCA TGTTTTCAGC AT 22
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13 AAATCTTGTG GGGTGGCT
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: ATGCTGAAAA CATGGGTATT AC 22

Claims

WHAT IS CLAIMED IS
1 A method for in situ amplification of a target sequence comprising the steps of a) in a sample of cells, hybridizing a first amplification primer 3 Jo a first strand of the target sequence in situ, the first amplification primer comprising a restriction endonuclease recognition site 5' to a first target binding sequence, and hybridizing a first external primer to the first strand of the target sequence upstream ofthe amplification primer, b) extending the first amplification primer and the first extemal primer in the presence of i) a thermophilic polymerase, the polymerase being active between about
50°C and 75°C, having strand displacing activity and lacking 5'— 3' exonuclease activity, ii) an α-thio deoxynucleoside triphosphate, and iii) a thermophilic restriction endonuclease which nicks the restriction endonuclease recognition site when the restriction endonuclease recognition site is hemimodified by incoφoration of the α-thio deoxynucleoside triphosphate, the restriction endonuclease being active between about 50°C and 75°C, thereby producing a first amplification primer extension product comprising the restriction endonuclease recognition site, and displacing the first amplification primer extension product from the first strand ofthe target sequence by extension ofthe first extemal primer, c) making the first amplification primer extension product and the restriction endonuclease recognition site double stranded by synthesizing a first complementary strand, thereby nicking the double stranded restriction endonuclease recognition site with the restriction endonuclease, d) extending from the nick using the polymerase, thereby displacing a copy of the target sequence from the double stranded first amplification primer extension product, e) repeating the nicking, extending and displacing steps such that the target sequence is amplified in situ
2 The method of Claim 1 wherein the double stranded restriction endonuclease recognition site is nicked using Accl, BslI, BsmI, BsmAI, BsoBI, BsrI, BsrDI, BstNI, BstOI, BstXl, or Mwol.
3 The method of Claim 1 wherein the thermophilic polymerase is selected from the group consisting of exo" Vent, exo" Deep Vent, Bst, exo' Pfu, Bca, and Sequencing Grade Taq 4 The method of Claim 1 further comprising detecting the amplified target sequence
5 The method of Claim 4 wherein the amplified target sequence is detected /// situ
6 The method of Claim 5 wherein the amplified target sequence is detected by flow cytometry
7 The method of Claim 5 wherein the amplified target sequence is detected by microscopy
8 The method of Claim 5 wherein the amplified target sequence is detected by means of a secondary amplification product produced by hybridization and extension of a signal primer on the target sequence during amplification
9 The method of Claim 1 wherein the target sequence is double stranded, further comprising the steps of a) hybridizing a second amplification primer 3' to a second strand of the target sequence in situ, the second amplification primer comprising the restriction endonuclease recognition site 5' to a second target binding sequence, and hybridizing a second external primer to the target sequence upstream ofthe second amplification primer, c) extending the second amplification primer and the second external primer, thereby producing a second amplification primer extension product comprising the restriction endonuclease recognition site, and displacing the second amplification primer extension product from the second strand of the target sequence by extension of the second external primer, d) making the second amplification primer extension product and the restriction endonuclease recognition site double stranded by synthesizing a second complementary strand, thereby nicking the double stranded restriction endonuclease recognition site with the restriction endonuclease, e) extending from the nick using the polymerase, thereby displacing a copy of the target sequence from the double stranded second amplification primer extension product, and, f) repeating the nicking, extending and displacing steps such that the target sequence is amplified //; situ 10 A method for amplifying a double stranded HIV gag target sequence comprising the steps of a) hybridizing a first amplification pnmer comprising the target binding sequence of SEQ ID NO 1 3' to the target sequence on a first strand of the target sequence and hybridizing a second amplification primer compnsing the target binding sequence of SEQ ID NO.2 3' to the target sequence on a second strand ofthe target sequence, b) extending the first and second amplification primers with polymerase to produce first and second amplification primer extension products, c) displacing the first and second amplification primer extension products from the target sequence, and, d) repeating the hybridizing, extending and displacing steps such that the target sequence is amplified
1 1 The method of Claim 10 wherein the first and second amplification primers each comprise a recognition site for a restriction endonuclease which is nicked by the restriction endonuclease when the restriction endonuclease recognition site is hemimodified by incoφoration of an α-thio deoxynucleoside triphosphate, the restriction endonuclease recognition site being 5' to the target binding sequence, and wherein a) extemal primers are hybridized to the target sequence upstream of the first and second amplification primers, and, b) the first amplification primer, the second amplification primer, and the extemal primers are extended in the presence of the restriction endonuclease and the α-thio deoxynucleoside triphosphate to produce first and second amplification primer extension products which are displaced from the target sequence by extension ofthe exte al primers
12 The method of Claim 10 wherein the double stranded target sequence is amplified in a Polymerase Chain Reaction
13 A method for amplifying a double stranded HIV gag target sequence comprising the steps of a) hybridizing a first amplification primer consisting of SEQ ID NO 1 3' to the target sequence on a first strand of the target sequence and hybridizing a second amplification primer consisting of SEQ ID NO.2 3' to the target sequence on a second strand of the target sequence, and hybridizing extemal primers upstream of the first and second amplification primers, b) extending the first and second amplification primers and the external primers in the presence of a 5'→3' exonuclease deficient polymerase with strand displacing activity, the polymerase being active between about 50°C and 75°C, an α-thio deoxynucleoside triphosphate, and BsoBI, thereby producing first and second amplification primer extension products comprising BsoBI recognition sites which are displaced from the first and second strands of the target sequence by extension ofthe extemal primers, c) making the first and second amplification primer extension products and the BsoBI recognition sites double stranded by synthesizing complementary strands, thereby nicking the double stranded BsoBI recognition sites with the BsoBI, d) extending from the nicks using the polymerase, thereby displacing a copy of the target sequence from the double stranded first and second amplification primer extension products, and, e) repeating the nicking, extending and displacing steps such that the target sequence is amplified
14 The method of Claim 13 further comprising detecting the amplified target sequence using SEQ ID NO 5, SEQ ID NO 1 1 , SEQ ID NO 12, SEQ ID NO 13 or SEQ ID NO 14
15 A method for amplifying a double stranded HLA-DQα exon 3 target sequence comprising the steps of a) hybridizing a first amplification primer comprising the target binding sequence of SEQ ID N0 6 3' to the target sequence on a first strand of the target sequence and hybridizing a second amplification primer comprising the target binding sequence of SEQ ID NO 7 3' to the target sequence on a second strand of the target sequence, b) extending the first and second amplification primers with polymerase to produce first and second amplification primer extension products, c) displacing the first and second amplification primer extension products from the target sequence, and, d) repeating the hybridizing, extending and displacing steps such that the target sequence is amplified
16 The method of Claim 15 wherein the first and second amplification primers each comprise a recognition site for a restriction endonuclease which is nicked by the restriction endonuclease when the restriction endonuclease recognition site is hemimodified by incoφoration of an α-thio deoxynucleoside triphosphate, the restriction endonuclease recognition site being 5' to the target binding sequence, and wherein a) external pπmers are hybridized to the target sequence upstream of the first and second amplification primers, and. b) the first amplification primer, the second amplification primer and the external primers are extended in the presence of the restriction endonuclease and the α-thio deoxynucleoside triphosphate to produce first and second amplification primer extension products which are displaced from the target sequence by extension of the external primers
17 The method of Claim 15 wherein the target sequence is amplified in a Polymerase Chain Reaction
18 A method for amplifying a double stranded HLA-DQα exon 3 target sequence comprising the steps of a) hybridizing a first amplification primer consisting of SEQ ID NO 6 3' to the target sequence on a first strand of the target sequence and hybridizing a second amplification primer consisting of SEQ ID NO 7 3' to the target sequence on a second strand of the target sequence, and hybridizing external primers upstream of the first and second amplification primers, b) extending the first and second amplification primers and the external primers in the presence of a 5'— >3' exonuclease deficient polymerase with strand displacing activity, the polymerase being active between about 50°C and 75°C, an α-thio deoxynucleoside triphosphate, and BsoBI, thereby producing first and second amplification primer extension products comprising BsoBI recognition sites which are displaced from the first and second strands ofthe target sequence by extension ofthe extemal primers, c) making the first and second amplification primer extension products and the BsoBI recognition sites double stranded by synthesizing complementary strands, thereby nicking the double stranded BsoBI recognition sites with BsoBI, d) extending from the nicks using the polymerase, thereby displacing a copy of the target sequence from the double stranded first and second amplification primer extension products, and, e) repeating the nicking, extending and displacing steps such that the target sequence is amplified
19 An oligonucleotide comprising the target binding sequence of SEQ ID NO 1 , the target binding sequence of SEQ ID NO.2, the target binding sequence of SEQ ID NO 6 or the target binding sequence of SEQ ID NO 7 An oligonucleotide consisting of SEQ ID NO 5. SEQ ID NO 10, SEQ ID NO 1 1 , SEQ 12, SEQ ID NO 13. or SEQ ID NO 14
EP96931542A 1995-09-21 1996-09-12 Detection of nucleic acids in cells by thermophilic strand displacement amplification Withdrawn EP0796347A2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US08/531,747 US5631147A (en) 1995-09-21 1995-09-21 Detection of nucleic acids in cells by thermophilic strand displacement amplification
US531749 1995-09-21
US531747 1995-09-21
US08/531,749 US5733752A (en) 1993-12-10 1995-09-21 Detection of nucleic acids in cells by thermophilic strand displacement amplification
PCT/US1996/014648 WO1997011196A2 (en) 1995-09-21 1996-09-12 Detection of nucleic acids in cells by thermophilic strand displacement amplification

Publications (1)

Publication Number Publication Date
EP0796347A2 true EP0796347A2 (en) 1997-09-24

Family

ID=27063626

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96931542A Withdrawn EP0796347A2 (en) 1995-09-21 1996-09-12 Detection of nucleic acids in cells by thermophilic strand displacement amplification

Country Status (6)

Country Link
EP (1) EP0796347A2 (en)
JP (2) JP3092163B2 (en)
AU (1) AU702896B2 (en)
BR (1) BR9606653A (en)
CA (1) CA2204641A1 (en)
WO (1) WO1997011196A2 (en)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5916779A (en) * 1995-09-21 1999-06-29 Becton, Dickinson And Company Strand displacement amplification of RNA targets
US6187567B1 (en) * 1999-09-01 2001-02-13 Akzo Nobel N.V. Methods and reagents for in situ amplification
JP2002159295A (en) * 2000-11-27 2002-06-04 Keio Gijuku Method of quantitation of hiv-1 rna-dna hybrid and diagnostic kit
US20040219544A1 (en) * 2001-04-13 2004-11-04 Stefanie Finn Amplification and detection of mycoplasma pneumoniae
CA2492220C (en) 2001-07-15 2014-03-18 Keck Graduate Institute Nucleic acid amplification using nicking agents
CA2492007A1 (en) 2001-07-15 2003-01-30 Keck Graduate Institute Amplification of nucleic acid fragments using nicking agents
US7291488B2 (en) * 2003-04-25 2007-11-06 Becton, Dickinson & Company Detection of herpes simplex virus types 1 and 2 by nucleic acid amplification
CN1918305B (en) * 2004-02-09 2010-12-01 扶桑药品工业株式会社 Method of detecting nucleic acid and utilization therof
FR2878254B1 (en) * 2004-11-22 2010-08-20 Bio Rad Pasteur COMPOSITION FOR AMPLIFICATION OF NUCLEIC ACIDS
WO2011028887A2 (en) 2009-09-03 2011-03-10 Becton, Dickinson And Company Methods and compositions for direct chemical lysis
CN112391450A (en) * 2020-11-19 2021-02-23 四川大学 High-specificity and high-sensitivity nucleic acid detection method based on modified dNTP

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1284931C (en) * 1986-03-13 1991-06-18 Henry A. Erlich Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids
US5043272A (en) * 1989-04-27 1991-08-27 Life Technologies, Incorporated Amplification of nucleic acid sequences using oligonucleotides of random sequence as primers
GB9116042D0 (en) * 1991-07-24 1991-09-11 Royal Free Hosp School Med Diagnostic method
US5270184A (en) * 1991-11-19 1993-12-14 Becton, Dickinson And Company Nucleic acid target generation
AU686616B2 (en) * 1993-03-26 1998-02-12 Gen-Probe Incorporated Detection of human immunodeficiency virus type 1
US5523204A (en) * 1993-12-10 1996-06-04 Becton Dickinson And Company Detection of nucleic acids in cells by strand displacement amplification
CA2185239C (en) * 1994-03-16 2002-12-17 Nanibhushan Dattagupta Isothermal strand displacement nucleic acid amplification

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9711196A3 *

Also Published As

Publication number Publication date
CA2204641A1 (en) 1997-03-27
JPH10500313A (en) 1998-01-13
AU702896B2 (en) 1999-03-11
JP2000300281A (en) 2000-10-31
BR9606653A (en) 1997-11-04
WO1997011196A2 (en) 1997-03-27
JP3092163B2 (en) 2000-09-25
AU7019296A (en) 1997-04-09
WO1997011196A3 (en) 1997-05-09
MX9703730A (en) 1997-09-30

Similar Documents

Publication Publication Date Title
US5733752A (en) Detection of nucleic acids in cells by thermophilic strand displacement amplification
US5631147A (en) Detection of nucleic acids in cells by thermophilic strand displacement amplification
EP0878553B1 (en) Strand displacement amplification of RNA targets
EP0428197B1 (en) Methods of extracting nucleic acids and PCR amplification without using a proteolytic enzyme
EP1513958B1 (en) Compositions for detecting hepatitis b virus
JP2005511030A (en) Nucleic acid amplification method
GB2293238A (en) Primers for replication and/or amplification reactions
AU702896B2 (en) Detection of nucleic acids in cells by thermophilic strand displacement amplification
WO2002052041A2 (en) 5&#39; nuclease nucleic acid amplification assay having an improved internal control
EP1400601A1 (en) Method for detection of multiple nucleic acid sequence variations
WO2021168427A1 (en) Compositions and methods for rapid detection of sars-cov-2
US5968739A (en) Nucleic acid primers and probes for detecting Legionella pneumophila
EP0753074B1 (en) Method for reducing background signals in dna replication/detection assays
EP1252331B1 (en) Methods and compositions for detection of mycobacterium avium complex species
CN101415844B (en) Assay for SARS coronavirus by amplification and detection of nucleocapsid RNA sequence
CA2305858A1 (en) Detection of nucleic acids in cells by thermophilic strand displacement amplification
MXPA97003730A (en) Detection of nucleic acids in cells by the method of amplification of the hebra by displacement, in a thermofil reaction
EP0550883A2 (en) Method and reagents for determining the presence of giardia lamblia
CN117230219A (en) Nucleic acid composition, kit and detection method for detecting isoniazid drug-resistant gene mutation of mycobacterium tuberculosis
Nuovo 20 In Situ Amplification of cDNA
EP1662966A2 (en) Assay for sars coronavirus by amplification and detection of the replicase sequence

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970520

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE ES FI FR GB IT LI NL SE

RBV Designated contracting states (corrected)

Designated state(s): AT BE CH DE ES FI FR GB IT LI NL SE

17Q First examination report despatched

Effective date: 20000522

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20010529