JP2002159295A - Method of quantitation of hiv-1 rna-dna hybrid and diagnostic kit - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an effective indicator in determining a time of starting an anti HIV-1 treatment, and to provide a means and methodology effective for assaying the indicator. SOLUTION: The objective diagnostic kit is intended to assess the progressiveness and/or anti-HIV-1 treatment effectiveness of a disease involving HIV-1 with the quantity of HIV-1 RNA-DNA hybrid in a sample as the indicator, comprising at least one pair of primers consisting of a downstream primer having a sequence complementary to part of the base sequence of an RNA constituting the HIV-1 RNA-DNA hybrid and an upstream primer having a sequence complementary to part of the base sequence of a DNA constituting the HIV-1 RNA-DNA hybrid and a restriction enzyme capable of cleaving a double-stranded DNA comprising the same base sequence as that of a DNA extended by the above primer pair at either site in the above-mentioned base sequences.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to HIV-1 RN
The present invention relates to a method for quantifying an A-DNA hybrid and a diagnostic kit.

[0002]

2. Description of the Related Art Human immunodeficiency virus (hereinafter referred to as "HI")
V ". ) Is acquired immunodeficiency syndrome (hereinafter referred to as “A
IDS ". ) Causing the virus type 1 (HIV-
Types 1) and 2 (HIV-2) are known. this house,
It is HIV-1 that has caused a pandemic and various subtypes have been found. At present, anti-HIV-1 treatment uses chemotherapy with antiviral agents, particularly multidrug combination therapy (hereinafter, referred to as "combination therapy") in which a patient takes a plurality of antiviral agents.

[0003] Generally, plasma HIV-
1 RNA concentration is an indicator of virus activity,
D4 value (concentration of CD4 + T cells in blood) is considered to be an indicator of immune competence. In anti-HIV-1 treatment, the start of treatment and the effect of treatment are determined based on these two measured values. A decision has been made. However, in many cases of anti-HIV-1 combination therapy, CD4 levels continue to increase despite high plasma HIV-1 RNA levels, which has led to confusion about the relationship between antiretroviral effects and therapeutic effects. Has occurred. In addition, even in a long-term non-developed person of HIV-1, there is a case where the RNA concentration is high even though the CD4 value is at a normal level.
In some cases, it may be difficult to determine whether to start IV-1 treatment. The present inventors have focused on the HIV-1 provirus concentration, improved the quantification method of the HIV-1 provirus concentration to increase the accuracy, and examined the CD4 value and the time course of each virus concentration in patients receiving combination therapy. When the relationship was examined in detail, the provirus concentration was higher than the RNA concentration in CD4.
It has been revealed that the correlation with the rate of change of the value is high (Patent Publication No. 2000-157299). From this, it was found that the HIV-1 provirus concentration was effective as an index of the anti-HIV-1 therapeutic effect. However, there is still no effective index for deciding when to start or change anti-HIV-1 treatment.

[0004]

Accordingly, an object of the present invention is to provide an effective index for deciding when to start or change anti-HIV-1 treatment. Another object of the present invention is to provide a means and methodology effective for measuring the above-mentioned index.

[0005]

Means for Solving the Problems The present inventors have developed HIV-
1 Attention was paid to the concentration of the RNA-DNA hybrid. Then, the HIV-1 RNA-DNA hybrid concentration in the peripheral blood mononuclear cells was quantified, and the CD4 value and each virus concentration (RNA concentration, DN
The relationship between the time-dependent changes in the A concentration (provirus concentration) and the RNA-DNA hybrid concentration was examined in detail.
As a result, the RNA-DNA hybrid concentration
CD4 over A concentration and DNA concentration (provirus concentration)
It was found that the correlation with the value was high. The present invention has been made based on these findings. That is, the present invention provides a diagnostic kit for evaluating the progress of a disease involving HIV-1 and / or the effectiveness of anti-HIV-1 treatment using the amount of HIV-1 RNA-DNA hybrid in a sample as an index. And HIV-1 RNA-D
Downstream primer having a sequence complementary to a part of the base sequence of RNA constituting NA hybrid and HIV-1
At least one pair of primers consisting of an upstream primer having a sequence complementary to a part of the base sequence of the DNA constituting the RNA-DNA hybrid; and 2 containing the same base sequence as the DNA extended by the primer pair.
The above-mentioned kit is provided, which comprises a restriction enzyme capable of cleaving the single-stranded DNA at any site in the base sequence. Diseases involving HIV-1 include AIDS, A
IDS-related syndromes can be mentioned. The diagnostic kit of the present invention may further include a known amount of DNA that competes with the DNA extended by the primer pair.

[0006] The present invention also relates to HIV-1 RNA-D.
Using the NA hybrid as a template, HIV-1 RNA-D
Downstream primer having a sequence complementary to a part of the base sequence of RNA constituting NA hybrid and HIV-1
A method for amplifying DNA by extending the DNA with at least one pair of primers comprising an upstream primer having a sequence complementary to a part of the base sequence of the DNA constituting the RNA-DNA hybrid,
After digesting the double-stranded DNA in the sample with a restriction enzyme capable of cleaving a double-stranded DNA containing the same base sequence as the DNA extended by the primer pair at any site in the base sequence, DNA by primer pair
And amplifying the DNA by elongating the DNA. Furthermore, the present invention provides a method for quantifying an HIV-1 RNA-DNA hybrid in a sample by amplifying the DNA by the above method, separating the amplified DNA, and detecting the amplified DNA.

[0007]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.
FIG. 1 shows a procedure for quantifying an HIV-1 RNA-DNA hybrid according to the method of the present invention. In FIG. 1, solid black bars indicate RNA chains, and gray solid bars indicate DNA chains. In addition, the black inverted triangle mark indicates the site of deletion of the competing DNA, the arrow indicates the direction in which the primer extends the DNA, and the dsDNA indicates 2
Single-stranded DNA and ssDNA indicate RNA-DNA hybrids. Samples such as blood, lymph, cerebrospinal fluid, semen, and lymph nodes are collected from a subject such as an infected person or patient with confirmed HIV-1 infection or receiving anti-HIV-1 treatment. From the collected sample, Ph
After separating mononuclear cells using Ficoll-Paque density gradient centrifugation from armacia, DNIA was separated using QIAamp Blood Kit from QIAGEN.
Extract A. Alternatively, from plasma, QIAam's QIAam
Extract RNA using the p Viral RNA Kit. Then this
A double-stranded DNA is cut by adding a restriction enzyme to the DNA. Specifically, 5 ng of M13mp18 single-stranded DNA was added to 0.5 μg of DNA.
(Takara Shuzo), 4 units of restriction enzymes MseI and MseI buffer, and distilled water to make a total volume of 40 μl.
And react for 1 hour. Then, treat at 65 ° C for 20 minutes,
Deactivate I. A restriction enzyme cuts double-stranded DNA having a sequence that it specifically recognizes, but cannot cut RNA-DNA hybrids having the same sequence. The restriction enzyme used in the present invention is PCR
The restriction enzyme must have a recognition site within the target sequence to be amplified in step (1). Since the HIV-1 virus comprises a sequence rich in adenine and thymine, it is preferable that the restriction enzyme recognizes a sequence rich in adenine and thymine and cleaves double-stranded DNA. In the method of the present invention,
Since DNA is preferably several hundreds to several thousand bp, a restriction enzyme that recognizes four bases and is theoretically considered to cut double-stranded DNA every 256 bp is preferable. Preferred restriction enzymes include MseI, Tsp509I, and RsaI. Of these, MseI is most preferred because it shows high enzyme activity at 37 ° C. The above nucleic acid digested with restriction enzymes is
CR, preferably competitive nested PCR (Bruisten
et al., AIDS 7 (suppl 2): S15-S20 (1993)) to amplify the HIV-1 RNA-DNA hybrid.

[0008] By competitive nested PCR, HIV-
1 A method for measuring the RNA-DNA hybrid concentration will be described below. Competitive PCR can be distinguished by molecular weight or restriction enzyme site.
This is a method of simultaneously amplifying different types of DNA in the same reaction solution. When the DNA to be measured (concentration is unknown) and the competing DNA (concentration is known) serving as an internal standard for quantification are amplified with the same primer pair, the ratio of the amounts of the two reaction products after reaching the plateau becomes two initial values. This reflects the ratio of the template amounts.

[0009] Nested PCR is a method in which a second primer is designed inside a target sequence (a fragment to be amplified) to be amplified by a pair of primers, the first PCR is performed, and the reaction product is diluted. Then, the second PCR is performed as a new template. In the first PCR, unwanted sequences may be amplified in addition to the target sequence. But the first PC
The probability of the presence of the sequence to which the second primer anneals in the undesired fragment amplified by R is extremely low. Therefore, by performing such two PCRs, only the target sequence is selectively amplified.

In the method of the present invention, the competitor DNA used as the internal standard for quantification is a nucleic acid (HIV-1 RN) of the target sequence.
It may be any as long as it competes with a specific region in the A-DNA hybrid). The competitive DNA preferably has a length of 2 kb to several kb and most of the internal nucleotide sequence is homologous to the HIV-1 nucleotide sequence. For example, in a DNA fragment derived from HIV-1,
By introducing a deletion, insertion, or base substitution therein, the original DNA fragment, a restriction enzyme recognition site or a DNA whose migration speed in electrophoresis has changed can be used as a competitive DNA.

[0011] The competitive DNA can be prepared as follows. HIV-1 DNA clone NL4-3 (Adachi et a
l., JOURNAL OF VIROLOGY, Aug., 1986, p. 284-291), and in competitive nested PCR, a certain portion of the base sequence corresponding to the target sequence amplified by the first primer pair is missing. The lost DNA fragment was analyzed by Higuchi, PCR
Protocols: a guide to methods and application (Ada
demic Press, 1990) pp. 177-183.

[0012] The competitive DNA can be quantified as follows. The absorbance of the competitive DNA solution at 260 nM is measured, and the concentration is determined using the fact that the extinction coefficient of DNA is 1 OD = 50 μg / ml. Further, a solution obtained by diluting this solution in two-fold steps is prepared, nested PCR is performed, and agarose gel electrophoresis is performed. As a result, the concentration is calculated from the highest dilution ratio at which the PCR product is detected, and the concentration determined from the absorbance is corrected.

Competitive nested P using competitive DNA
The HIV-1 RNA-DNA hybrid concentration is measured by CR. A known amount (for example, 104 to 1 molecule) of a competitive DNA is diluted at an appropriate magnification (2 to 10 times), and a certain amount of nucleic acid (for example, 0.1 to 1.0 m) extracted from a subject sample is diluted.
1 to 50 μl of nucleic acid extracted from 1 blood sample in 20 to 200 μl of sterile water. Perform nested PCR using appropriate primer pairs. The second primer pair is designed to be inside the target sequence to be amplified by the first primer pair. The target sequence to be amplified by the first primer pair may be any region of the HIV-1 virus, and may be a specific region in the env gene (for example, the hypervariable region of the gp120 site (V1-V5 region, particularly V3 Examples of the sequence of a specific region in the region are exemplified. The length of the target sequence amplified by the first primer pair may be 100 to 4000 bp, preferably 200 to 400 bp. Further, the length of the target sequence amplified by the second primer pair may be shorter than the length of the target sequence amplified by the first primer pair, for example, 50 to 4000 bp, preferably 20 bp
0-400 bp. The length of the primer may be 18 to 30 base pairs, preferably 20 to 25 base pairs. For example, when the sequence of the region from base numbers 6943 to 7369 in the highly variable region V3 of the gp120 site of the HIV-1 virus env gene is used as the target sequence, the following two primer pairs may be used. it can.

First primer pair (outer primers): CACAGTACAATGTACACATG (SEQ ID NO: 1) ACAGTAGAAAAATTCCCCTC (SEQ ID NO: 2) Second primer pair (inner primers): CTGTTAAATGGCAGTCTAGC (SEQ ID NO: 3) AATTTCTGGGTCCCCTCCTG (SEQ ID NO: 4)

When the above primer pair is used, competition D
NA can be produced as follows. HIV-
1 DNA clone NL4-3 (Adachi et al., JOURNAL OF VIR
OLOGY, Aug., 1986, p. 284-291) as a starting material, a DNA fragment in which 7119 to 7241 in the base sequence of base numbers 6201 to 8805 were deleted was obtained by Higuchi, PCR Protocols: a gui
de to methods and application (Adademic Press, 199
0) Prepare using the recombinant PCR method described in pp. 177-183.

In place of the above AATTTCTGGGTCCCCTCCTG (SEQ ID NO: 4), AATTTCTAGATCCCCTCCTG (SEQ ID NO: 5), CACAATTAAAACTGTGCATTACAA (SEQ ID NO: 6), CTGT
Any of GCATTACAATTTCTGG (SEQ ID NO: 7) can be used. PCR procedures and reaction conditions are described in Bruisten
S. et al., AIDS Res Hum Retroviruses 1993, 9: 259-2
65, but the frequency of mutation of the HIV-1 virus is high.
The amplification rate of the HIV-1 RNA-DNA hybrid is slower than A, and the HIV-1 RNA-DNA hybrid concentration may be estimated lower than the actual value. Elimination of the effects of HIV-1 virus mutations
In order to accurately measure the concentration of the IV-1 RNA-DNA hybrid, annealing is first performed at least 48 times at a temperature of 48 ± 4 ° C., preferably 3 to 7 times, and then 64 times.
It may be performed at a temperature of ± 4 ° C. at least once, preferably 20 to 30 times. Both the first PCR (PCR using outer primers) and the second PCR (PCR using inner primers) may use two annealing temperatures.

The reaction products of the PCR are separated by electrophoresis and detected by ethidium bromide staining. The amplified competitive DNA band and the amplified HIV-1 R
Based on the intensity ratio of the bands of the NA-DNA hybrid, the HIV-1 RNA-
Calculate the DNA hybrid concentration. In practice, the measured concentration is corrected using a known concentration of wild-type HIV-1 DNA as a standard.

To compare the correlation between the HIV-1 RNA-DNA hybrid concentration and the CD4 value with the virion RNA concentration or the correlation between the HIV-1 proviral DNA concentration and the CD4 value, virion RNA was used for the same blood sample. The concentration, HIV-1 proviral DNA concentration and CD4 value may also be measured. Virion RNA levels and HIV-1 proviral DNA levels were determined by
It can be measured by the method described in 00-157299. The CD4 value can be measured by laser flow cytometry after reacting the lymphocytes with the OKT4 antibody. In addition, the infectious HIV-1 concentration may be measured. Infectious HIV-1 levels are determined by Kato et al., J Vir.
ol Methods 72: 1-7 (1998). As shown in the examples below, the HIV-1 RNA-DNA hybrid concentration of HIV-1 long-term non-developed blood samples was determined by comparing the HIV-1 RNA concentration and HIV-
It had a higher correlation with CD4 value than one proviral DNA concentration. From this, it can be said that the HIV-1 RNA-DNA hybrid concentration is an index that accurately indicates when to start anti-HIV-1 treatment. HIV-1 R
The NA-DNA hybrid concentration is also effective as an index that indicates exactly when to change anti-HIV-1 treatment.

[0019] The present invention relates to HIV-1 RN in a sample.
Using the amount of A-DNA hybrid as an index, HIV-1
A diagnostic kit for assessing the progress of a disease associated with and / or the efficacy of anti-HIV-1 treatment, comprising:
V-1 RNA Constituting RNA-DNA Hybrid
At least one pair of primers comprising a downstream primer having a sequence complementary to a part of the base sequence of the above and an upstream primer having a sequence complementary to a part of the base sequence of the DNA constituting the HIV-1 RNA-DNA hybrid And the above-mentioned kit comprising a restriction enzyme capable of cleaving a double-stranded DNA containing the same base sequence as the DNA extended by the primer pair at any site in the base sequence. Examples of the primer include a first primer pair (outer primers), a second primer pair (inner primers), and a combination thereof as described above. Examples of the restriction enzyme include the restriction enzymes described above (for example, MseI, Tsp509I, RsaI, and the like). The diagnostic kit of the present invention may further include a known amount of DNA that competes with the HIV-1 RNA-DNA hybrid, as described above. In addition, it may contain a dNTP mixture, a reaction buffer, a DNA polymerase, and the like. In addition, primers and sample HIV-1 DN
To reduce the effects of A base pair mismatch, the normal 1.5 mM magnesium ion concentration in the reaction buffer was increased to 4 mM.
It is desirable to increase to about mM. In this diagnostic kit, the components that make up the kit may be contained individually or in combination or collectively in containers, such as vials, tubes, and the like, and the containers may be compartments for collective storage. It may be stored in a structured supporting means.

[0020]

EXAMPLES The present invention will be described below in more detail with reference to examples, but the scope of the present invention is not limited to these examples. [Example 1] Fourteen long-term non-affected patients who did not receive anti-HIV-1 combination therapy and who visited a hospital in Tokyo. DNA and RNA were extracted from peripheral blood, plasma virion RNA concentration was measured by AMPLICOR manufactured by Roche, and provirus concentration and HIV-1 RNA-DNA hybrid concentration were measured by competitive nested PCR. CD4
The value was measured by laser flow cytometry after reacting the lymphocytes with the OKT4 antibody.

[0021]Method  1. Preparation of competitive HIV-1 DNA fragment HIV-1 DNA clone NL4-3 (Adachi et al., JOURNAL OF
VIROLOGY, Aug., 1986, p.284-291)
First, primer pair TAATAGVACTCACTATAGGGAGAAAGAGCAGAAG
ACAGTGGCA (SEQ ID NO: 8) and AGCTATCTGTTTGTTGTTGGGTCTT
PCR was performed using GTACAATT (SEQ ID NO: 9) to obtain HIV-1 bases.
Numbers 6201 to 7118, 7242 to 7252, and T7 promoter
Synthesize a DNA fragment consisting of Also, primer vs. CCC
AACAACAAACAGATAGCTAGCAAATTAAGA (SEQ ID NO: 10) and TT
PCR was performed using GACCACTTGCCACCCATC (SEQ ID NO: 11).
HIV-1 base numbers 7109 to 7118 and 7242 to 8805
To synthesize a DNA fragment. Next, these two DNA fragments
Primer pair TAATAGVACTCACTATAGGGAGAAAGAGCAGAAGACAG
TGGCA (SEQ ID NO: 8) and TTGACCACTTGCCACCCATC (SEQ ID NO:
No. 11) and perform PCR to bind the two DNA fragments.
By doing so, 7119 out of HIV-1 base numbers 6201 to 8805
T7 promoter upstream of the HIV-1 DNA fragment from which 7241 was deleted
The DNA fragment to which the protein is added is synthesized. This is the experiment
This is the competitive DNA used. PCR conditions are 0.5 units of Taq DNA
Using polymerase (Perkin-Cetus) at 94 ° C for 15 seconds,
A cycle of 30 seconds at 64 ° C. and 60 seconds at 72 ° C. was performed 20 times. Conflict
The DNA concentration was determined by measuring the absorbance at 260 nM,
Determined using the fact that the optical coefficient is 1 OD = 50 μg / ml.
Was. In addition, these solutions were diluted two-fold in multiple steps.
Perform a nested PCR, agarose gel electrophoresis
Movement. As a result, the highest dilution at which the PCR product is detected
Calculate the concentration from the ratio and correct the concentration determined from the absorbance.
Was.

2. HIV-1 D by competitive nested PCR
Measurement of NA concentration The HIV-1 DNA concentration was measured as follows. Competition of 50 copies for 0.5 μg DNA from peripheral blood mononuclear cells from HIV-1 infected people
DNA was added and PCR was performed using primer pairs CACAGTACAATGTACACATG (SEQ ID NO: 1) and ACAGTAGAAAAATTCCCCTC (SEQ ID NO: 2). The PCR conditions were as follows: first, keep at 97 ° C for 5 minutes, then perform 5 cycles of 97 ° C for 15 seconds, 48 ° C for 30 seconds, 72 ° C for 60 seconds, and further 94 ° C for 15 seconds and 60 ° C for 30 seconds. 60 seconds at 72 ° C
The second cycle was performed 25 times. The reaction volume is 100 μl and the volume is 0.
5 units of Taq DNA polymerase (Perkin-Cetus) and 4 mM magnesium chloride were added in addition to the usual buffer.
After the reaction, remove 2 μl of the primer and primer-CTGT
TAAATGGCAGTCTAGC (SEQ ID NO: 3) and AATTTCTGGGTCCCCTCC
A second PCR was performed using TG (SEQ ID NO: 4). The PCR conditions were as follows: first, incubate at 94 ° C for 5 minutes, then at 94 ° C for 15 seconds,
5 cycles of 30 seconds at 72 ° C and 60 seconds at 72 ° C.
Twenty cycles of 15 seconds at 60 ° C, 30 seconds at 64 ° C, and 60 seconds at 72 ° C were performed. The reaction volume was 100 μl, and 0.5 units of Taq DNA polymerase (Perkin-Cetus) and 4
mM magnesium chloride was added. From this PCR reaction solution, 20
Take out the μl, perform electrophoresis on a 2% agarose gel at 120 V for 1 hour, and use a CCD camera (Gel Print 2000i / VGA, Genom
ic Solutions) and image analysis software (Intelligent Quant
Competitor, Genomic Solutions)
The intensities of the A band and the DNA band derived from the infected HIV-1 were quantified. The copy number of HIV-1 DNA present in 0.5 μg DNA from peripheral blood mononuclear cells of the original HIV-1 infected person is 50 × (infected HIV
-1 derived DNA band intensity) / (competitive DNA derived DNA band intensity)
It was calculated by the following equation.

3. H by MseI and competitive nested PCR
IV-1 Measurement of RNA-DNA Hybrid Concentration HIV-1 RNA-DNA hybrid concentration was measured as follows. 0.5 μg DNA from peripheral blood mononuclear cells from HIV-1 infected individuals
5 ng of M13mp18 single-stranded DNA (Takara Shuzo) and 4 units of MseI
(New England BioLab) and MseI buffer,
Further, distilled water was added to make the total volume 40 μl, and the reaction was carried out at 37 ° C. for 1 hour. Then, the cells were treated at 65 ° C. for 20 minutes to inactivate MseI. Using this reactant, the competitive described in 2.
Nested PCR was performed.

4. Patients Fourteen long-term non-retroviral patients who were not treated with an antiretroviral drug who had been visiting a hospital in Tokyo and who received explanation and consent were asked to obtain 10 ml of peripheral blood. Collected. Sodium citrate was used as an anticoagulant.

5. Preparation of Nucleic Acid After separating mononuclear cells from peripheral blood by Ficoll-Paque (Pharmacia) density gradient centrifugation, use QIAamp Blood Kit (QIAG
DNA was prepared using EN. After centrifugation of plasma from peripheral blood, QIAamp Viral RNA Kit (QIAGEN)
Was used to prepare RNA. DNA and RNA are pure water or E
It was dissolved in a buffer containing DTA and stored at -20 ° C until just before use.

6. Measurement of the number of CD-4 positive T cells (CD4 value) [0026] The fluorescent OKT4 antibody was allowed to act on peripheral blood collected from HIV-1 infected individuals by contracting with SRL, and CD4 positive T cells were detected by fluorescent laser cytometry. The cell number was measured.

[0027]result  Six subjects (H2, H31, C27, H67, H31
0 and H200) (cells / μl) and
Figure showing the measurement results of HIV-1 RNA concentration (copy / ml)
2 to 7 respectively. CD for the patient
4 values (cells / μl) and HIV-1 DNA concentration (copy / μl)
g) and HIV-1 RNA-DNA hybrid concentration
(Copy / μg) are shown in FIGS.
You. In addition, for 14 cases,
HIV-1 DNA concentration, HIV-1 based on mean
 RNA-DNA hybrid concentration and HIV-1
Pearson correlation analysis results between RNA concentration and CD4 value
It is shown in FIG. In FIGS. 2 to 7, black diamonds indicate CD4 values (fine
Cells / μl), the black triangle mark indicates HIV-1 RNA concentration (co
P / ml). 8 to 13, the black diamond mark is CD4.
Value (cells / μl), black square mark indicates HIV-1 DNA concentration
Degree (copy / μg), black circle mark indicates HIV-1 RNA-
The DNA hybrid concentration (copy / μg) is shown. FIG.
Medium, CD4 is CD4 value, DNA is HIV-1 DNA concentration
The ssDNA was HIV-1 RNA-DNA hybrid.
The RNA concentration indicates the HIV-1 RNA concentration.

As shown in FIGS.
The RNA-DNA hybrid concentration showed a good correlation with the CD4 value. Low CD4 value, HIV-1 RNA
Higher cases had higher HIV-1 RNA-DNA hybrid concentrations (H2 (FIGS. 2 and 8) and H200 (FIGS. 7 and 13)). In cases where CD4 value is high and HIV-1 RNA concentration is low, HIV-
1 RNA-DNA hybrid concentration was low (H3
1 (FIGS. 3 and 9)). In cases where the HIV-1 RNA concentration is high despite the high CD4 value, HI
V-1 RNA-DNA hybrid concentrations were low (C27 (FIGS. 4 and 10), H67 (FIGS. 5 and 1).
1) and H310 (FIGS. 6 and 12)). As a result of Pearson's correlation analysis, the correlation coefficient between CD4 value and HIV-1 RNA concentration was -0.35 (CD4 value and HIV-1 RN
The correlation coefficient with the logarithm of the A concentration was -0.39), and the correlation coefficient between the CD4 value and the HIV-1 DNA concentration was -0.52. In contrast, CD4 levels and HIV-1 RNA-
The correlation coefficient with the DNA hybrid concentration was -0.62 (FIG. 14). When these correlation coefficients are tested, CD
Only the correlation coefficient between the four values and the HIV-1 RNA-DNA hybrid concentration was statistically significant (P = 0.0
1). From these results, it was found that HIV-1 RNA concentration and HIV-1 DNA concentration
It can be seen that the DNA hybrid concentration has a higher correlation with the CD4 value.

[0029]Consideration  The HIV-1 RNA-DNA hybrid concentration was HI
An index that accurately indicates the degree of progress of V-1 infection
Can be said. This is the HIV-1 RNA-DNA hive.
Lid is a reverse transcription intermediate just after virus infects cells
Body, so its concentration may be
This is considered to be due to the degree. Probably H
IV-1 RNA-DNA hybrid is below detection limit
At the onset of antiretroviral therapy or
No need to change retroviral treatment
You.

[0030]

According to the present invention, an effective index for determining when to start or change anti-HIV-1 treatment is provided. Also provided are effective means and methodologies for measuring the above indicators.

[0031]

[Sequence List] SEQUENCE LISTING <110> KEIO UNIVERSITY <120> Method for determining amount of HIV-1 RNA-DNA hybrid and diagnos kits <130> P00-1266 <140> <141> <160> 11 <170> PatentIn Ver. 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 1 cacagtacaa tgtacacatg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 2 acagtagaaa aattcccctc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 3 ctgttaaatg gcagtctagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 4 aatttctggg tcccctcctg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 5 aatttctaga tcccctcctg 20 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence : Primer <400> 6 cacaattaaa actgtgcatt acaa 24 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 7 ctgtgcatta caatttctgg 20 <210> 8 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 8 taatagvact cactataggg agaaagagca gaagacagtg gca 43 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 9 agctatctgt ttgttgttgg gtcttgtaca att 33 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence : Primer <400> 10 cccaacaaca aacagatagc tagcaaatta aga 33 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 11 ttgaccactt gccacccatc 20

[0032]

[Sequence List Free Text]

[0033]

[SEQ ID NO: 1] SEQ ID NO: 1 shows the nucleotide sequence of a primer.

[0034]

[SEQ ID NO: 2] SEQ ID NO: 2 shows the nucleotide sequence of a primer.

[0035]

[SEQ ID NO: 3] SEQ ID NO: 3 shows the nucleotide sequence of a primer.

[0036]

[SEQ ID NO: 4] SEQ ID NO: 4 shows the nucleotide sequence of a primer.

[0037]

[SEQ ID NO: 5] SEQ ID NO: 5 shows the nucleotide sequence of a primer.

[0038]

[SEQ ID NO: 6] SEQ ID NO: 6 shows the nucleotide sequence of a primer.

[0039]

[SEQ ID NO: 7] SEQ ID NO: 7 shows the nucleotide sequence of a primer.

[0040]

[SEQ ID NO: 8] SEQ ID NO: 8 shows the nucleotide sequence of a primer.

[0041]

[SEQ ID NO: 9] SEQ ID NO: 9 shows the nucleotide sequence of a primer.

[0042]

[SEQ ID NO: 10] SEQ ID NO: 10 shows the nucleotide sequence of a primer.

[0043]

[SEQ ID NO: 11] SEQ ID NO: 11 shows the nucleotide sequence of a primer.

[Brief description of the drawings]

FIG. 1. HIV-1 RNA-DN according to the method of the present invention.
1 shows a schematic diagram of the procedure for A hybrid quantification.

FIG. 2 shows CD4 value and HIV- in subject H2.
1 shows the change over time in RNA concentration.

FIG. 3 shows CD4 value and HIV in subject H31.
-1 shows the change over time in RNA concentration.

FIG. 4. CD4 value and HIV in subject C27
-1 shows the change over time in RNA concentration.

FIG. 5 shows CD4 value and HIV in subject H67.
-1 shows the change over time in RNA concentration.

FIG. 6 shows CD4 value and HI in subject H310.
The change with time of the V-1 RNA concentration is shown.

FIG. 7 shows CD4 value and HI in subject H200.
The change with time of the V-1 RNA concentration is shown.

FIG. 8 shows CD4 value and HIV-1 in subject H2.
3 shows changes over time in DNA concentration and HIV-1 RNA-DNA hybrid concentration.

FIG. 9 shows CD4 value and HIV-1 in subject H31.
3 shows changes over time in DNA concentration and HIV-1 RNA-DNA hybrid concentration.

FIG. 10 shows CD4 value and HIV- in subject C27.
1 shows changes over time in DNA concentration and HIV-1 RNA-DNA hybrid concentration.

FIG. 11 shows the CD4 value and HIV- in subject H67.
1 shows changes over time in DNA concentration and HIV-1 RNA-DNA hybrid concentration.

FIG. 12 shows CD4 value and HIV in subject H310.
1 shows time-dependent changes in -1 DNA concentration and HIV-1 RNA-DNA hybrid concentration.

FIG. 13 shows CD4 value and HIV in subject H200.
1 shows time-dependent changes in -1 DNA concentration and HIV-1 RNA-DNA hybrid concentration.

FIG. 14: HIV-1 DNA for 14 cases.
2 shows the results of Pearson's correlation analysis between the concentration, the HIV-1 RNA-DNA hybrid concentration, and the HIV-1 RNA concentration and the CD4 value.

Claims (4)

[Claims] 1. HIV-1 RNA-DN in a sample
A diagnostic kit for evaluating the progress of a disease associated with HIV-1 and / or the effectiveness of anti-HIV-1 treatment using the amount of A hybrid as an index, comprising:
Downstream primer having a sequence complementary to a part of the base sequence of RNA constituting RNA-DNA hybrid and D constituting HIV-1 RNA-DNA hybrid
At least one pair of primers consisting of an upstream primer having a sequence complementary to a part of the base sequence of NA, and a double-stranded DNA containing the same base sequence as the DNA extended by the primer pair. The above kit comprising a restriction enzyme that can be cleaved at any site. 2. DN extended by said primer pair
The kit according to claim 1, further comprising a known amount of DNA that competes with A. 3. A downstream primer having an HIV-1 RNA-DNA hybrid as a template and having a sequence complementary to a part of a base sequence of RNA constituting the HIV-1 RNA-DNA hybrid, and an HIV-1 RNA-DN.
A method for amplifying DNA by extending DNA with at least one pair of primers comprising an upstream primer having a sequence complementary to a part of the base sequence of DNA constituting A hybrid, After a double-stranded DNA containing the same base sequence as the DNA to be extended is digested with a restriction enzyme capable of cleaving at any site in the base sequence, the DNA is digested with the primer pair. The DNA amplification method as described above, wherein the DNA is amplified by extending the DNA. 4. A method for quantifying an HIV-1 RNA-DNA hybrid in a sample by amplifying the DNA by the method according to claim 3, separating the amplified DNA, and detecting the amplified DNA.