WO2000014272A1

WO2000014272A1 - Measurement of persistent-latent hiv viral load

Info

Publication number: WO2000014272A1
Application number: PCT/AU1999/000715
Authority: WO
Inventors: Peng Li; Nicholas Vandegraaff; Raman Sharma
Original assignee: Medvet Science Pty Ltd
Priority date: 1998-09-02
Filing date: 1999-09-02
Publication date: 2000-03-16
Also published as: AUPP561098A0

Abstract

A method of assaying for measuring the persistent and/or latent retroviral load in a host mammal or human includes performing PCR on a sample of cells. An internal viral primer is used as well as degenerate primer set that straddles the border between one of the ends of the integrated retroviral genome and the chromosomal DNA. The degenerate primer set comprises a plurality of primers each primer comprising an LTR binding portion complementary to an end of an LTR region of the integrated retroviral nucleic acid but not of sufficient length and or homology to anneal on its own, and a non-viral binding portion, conjoined with the LTR binding portion and comprising a sequence that does not permit binding of a retroviral sequence abutting the end of the LTR when the retrovirus is not integrated. The non-viral binding portion of the degenerate primer set is generated in a random sequence relative to other members of the degenerate primer set.

Description

MEASUREMENT OF PERSISTENT-LATENT HIV VIRAL LOAD

FIELD OF THE INVENTION

This invention relates to the measurement of the persistent and/or latent viral load in retroviral infected individuals, and has particular application for patients infected with HIV.

BACKGROUND OF THE INVENTION

Most HIV infected patients in this country are on antiretro viral therapy. With Highly Active Anti-Retroviral Therapy (HAART), it is now possible to achieve sustained control of HIV replication in vivo. However, the long term outlook for such patients is not clear. The sharp decline in plasma HIV viral load in patients receiving HAART represents effective control of only the productive viral replication in lytically infected CD4 T cells. When de novo infection of activated CD4 T cells is inhibited by drugs, virus particles in the blood stream (plasma viral load) are quickly cleared and the lytically infected cells die after a short period of time. Complete elimination of this pool of HIV could be achieved within a few months of HAART (1-4). What determines the long-term outcome of viral infection at this stage is the persistent-latent viral load of the patient.

The persistent-latent viral load is made of persistent and latent compartments. The persistent viral load compartment is a population of long-lived cells infected with, or otherwise harbouring, HIV. Productively infected tissue macrophages and HIV particles trapped on the surface of follicular dendritic cells in lymphoid tissues are the major components contributing to the persistent viral load. The duration of HAART needed for elimination of this pool of HIV has been mathematically calculated as 2-3 years (4-5). The true magnitude of difficulties involved in elimination of HIV infected macrophages and related cells, however, remains unknown (5a). The latent viral load compartment is primarily made of HIV infected resting CD4 T cells of the memory phenotype. It is assumed these cells were infected by HIV when they were in an activated state, thereby allowing HIV to complete reverse transcription, nuclear transportation of the preintegration complex and integration to establish a provirus. However, these cells then apparently reverted to a resting state containing latent provirus before substantial viral expression occurred, thereby avoiding lytic death or being cleared by the host immune system. Similar to cells latently infected with other viruses, these cells can be re-activated to produce infectious HIV after many years of HAART (6-9). It has been estimated that 5 to 10 years of continuous HAART is needed for loss of this HIV pool by wearing out the lifespan of the latently infected CD4 T memory cells (10).

The toxicity, cost, and complexity in complying with current HAART are all unacceptably high with a 5-10 year continuous treatment program. As a result, alternative anti-HIV therapies in addition to HAART are being actively pursued. Examples of these include induced-elimination and induced-remission. The former proposes to give HIV patients, while they are on HAART, immune-activation treatments (eg., certain cytokines and antibodies). These treatments may activate the HTV latently infected CD4 T cells to produce the virus, and thereby to steer these cells to the normal death paths of productively infected cells. The latter proposes to boost anti-HIV immune responses in the patients, for example, with a therapeutic anti-HIV vaccine. The enhanced anti- HTV immunity may accelerate the suppression of the latently infected CD4 T cells to a level below activation threshold, leading to remission (10).

It is now clear that, in addition to the standard plasma HIV viral load tests, an assay for specific and quantitative measurement of the persistent-latent forms of HIV in patients on HAART is needed. Such an assay would benefit current clinical management of HIV patients and would be of great benefit when used to assess the feasibility and effectiveness of alternative and additional therapies aimed at reducing the persistent- latent viral load in patients.

PRIOR ART Using inverse PCR, the frequency of CD4 T cells containing integrated HTV sequences has been estimated in the order of <0.05% (6). The frequency of resting CD4 memory T cells harbouring reactivable, competent HIV provirus, as detected by in vitro re-activation and co-culture, has been estimated as low as 10^~5 - 10^~6, although this estimate was made in patients who strictly adhered to aggressive HAART and responded well with a rapid decline of plasma viral load to continuously undetectable levels (9). The specific detection of the integrated viral DNA requires that the free viral DNA be ignored and only the viral-cellular junction sequences be detected in the assay.

Current methods for specific detection of integrated retroviral sequences are all based on PCR. The inverse PCR method depends on self-ligation and formation of circular DNA molecules which contain the integration junction of the viral-cellular sequences (6,11). This method is cumbersome and non-quantitative. The Johns Hopkins Group who first used this assay apparently abandoned it and adapted a different method in their later publications in quantitative studies on HIV integrated DNA (7, 7a). The second method makes use of the Alu family of dispersed repeat sequences in human chromosomal DNA for one primer and an outward virus sequence as another primer. The Alu-PCR (12) and the nested Alu-PCR (7), all suffer from the fact that the average spacing of Alu repeat sequence with random distribution in the human genome is 8 kp (13). An Alu primer in the Alu-PCR assay with only one direction means the PCR needs to cover, on average, 8 - 16 Kb fragments of DNA - a very serious drawback for any assay. The third published assay for integrated retroviral sequences is the linker-primer PCR for studying HTLV-1 integration junctions. This method involves digestion of chromosomal DNA with restriction enzyme NlalLI which is a frequent 4-base cutter and produces a 4 base over-hang (sticky end). A linker-primer is then ligated to the NlalJI fragments via the overhang. Fragments spanning the viral-cellular junction are subsequently enriched by single primer (linear) PCR and subsequently PCR amplified and detected using a viral probe (14). This method is time consuming and reproducibility is poor.

There are also a number of patents on the detection of viruses in the patent literature. One example is US patent 5750347 by Bagasra et al which teaches an in situ PCR technique whereby cells are fixed to a teflon coated microscope slide and the proportion of cells containing HIV nucleic acid can be detected. This method, however, does not discriminate between HIV that is integrated or not integrated.

A number of patents are also directed to proposals for measuring latent viral load and include the following.

Adams et al in US Patent No 5576176 teach the measuring of the ratio of short TAR transcripts and long transcripts produced to determine whether HIV is becoming activated or not. This, however, is a measure of the transcriptional activity and not a true quantitative measure of latent viral load.

Kozal et al US 5856086 refers to a method of monitoring the HIV load during treatment of patients, for example with AZT. The method measures circulating HIV viral load by measuring circulating HIV RNA copy number.

Kondo et al in US 5783383 relates to CMV (Cytomegalovirus) and latency specific transcripts, polypeptides and antibodies against such polypepetides which may be used for diagnostic purposes. OBJECT OF THE INVENTION

An object of the invention is to provide a quantitative measure of persistent-latent viral load of a retrovirus, or at least provide the public with a useful choice.

SUMMARY OF THE INVENTION

The present invention arises from the finding that it is possible to use a degenerate primer (DP) that straddles the boundary of integrated retrovirus DNA and host DNA to measure only integrated forms of a retrovirus by PCR (DP-PCR).

A first aspect of this invention results in the use of PCR to provide a quantitative assay of persistent-latent retroviral load in a host animal or human by using a viral primer including a sequence hybridising with an internal portion of viral DNA and a degenerate primer set comprising a plurality of primers each primer comprising an LTR binding portion complementary to an end of an LTR region of the integrated retroviral nucleic acid but not of sufficient length and or homology to anneal on its own, and a non- viral binding portion, conjoined with the LTR binding portion and comprising a sequence selected to not be sufficiently complementary so as not to permit binding of a retroviral sequence abutting the end of the LTR region when the retrovirus is not integrated. Members of the degenerate primer set having a non- viral binding portion generated in a random sequence relative to other members of the degenerate primer set.

In a first form of the invention the non-viral binding portion might be selected so as to not bind to an adjacent portion of linear and the 1 LTR circular form. In this first form therefore the viral portion of the degenerate primer set might be selected to bind an end portion of U3, and the non- viral portion of the degenerate primer set might be selected to not hybridise with the abutting portion of the PPT region in the linear and the 1 LTR circular form. The PPT (Polypurine tract) is purine rich and therefore the primer could be selected to also be purine rich. In particular it can be seen below that the primer set will be low in G's.

It will be understood that this particular invention has particular application for HIV and in particular HIV-1. The sequence of a primer that would interfere most with the measurement of only integrated viral DNA because it bind most efficiently to linear and 1LTR free HIV DNA is as follows:

5' AAAAGGGGGGAC.TGGAAGGG Accordingly any primer should avoid the first 12 nucleotides and accordingly for HIV- 1 the degenerate primer set might take the form of DPI, a 21mer set as follows:

5' BBBBHHHHHHBD.TGGAAGGGC

The three non specified amino acids are random chosen using a DNA synthesising machine the dot = cellular- viral junction

It can thus be seen the viral portion is formed for total homology with the target LTR sequence, on it own it is of a length not able to provide adequate annealing under the conditions of the PCR, and the further homologies are needed for adequate annealing. Whilst it is to be understood that the viral portion of the primer set is preferred to have total homology, it may still be possible to have one or perhaps more non-homologus bases and still achieve an adequate result and the primer need not only have an LTR binding portion comprising 9 nucleotides. Similarly the non- viral binding portion is shown as being 12 nucleotides long but it might be of a differing length.

Additionally it will be understood that the above primer set can be varied to conform to the particular sequences present for other retro viruses.

Alternatively in this first form the viral primer might be selected to bind to an end portion of U5, and the degenerate primer set might be selected to not hybridise with the abutting portion of the PBS sequence.

In a second form of this first aspect of the invention the non- viral binding portion might be selected so as to not bind to an adjacent portion of the linear form or the 1 LTR circular from or the 2 LTR circular form. In this first form therefore the degenerate primer set might be selected to not hybridise with the abutting portion of the PPT region in the linear form or the 1 LTR circular form or the abutting portion of the U3 region of the 2LTR circular form.

Again primers that would interfere most are primers capable of annealing to the free DNA including linear, 1 LTR circular and 2 LTR circular which interfering primers might respectively be as follows:

TAAAAGAAAAAGGGGAC.TGGAAGGGC

TGTGGAAAATCTCTAGCA.TGGAAGGGC To minimise interference in this second form of the first aspect the primer could be a 27mer as follows:

VYSYYYBBBSWMWMYHKK.TGGAAGGGC

This as with all other primers can be modified so as to progressively delete bases from either end to empirically determine which give the best result.

Again with this form variations of the primer set out for the first form also apply, and it will be understood that the above primer can be varied to conform to the particular sequences present for other retro viruses.

Variations of the degenerate primers can be constructed as set out below.

Degenerate primers are made of two parts non-rival and viral portions, variations of each of these is possible by deletion of one or more based from either end of the primer moving toward the cellular juncation shown by a dot.

for binding to U3 but not binding 1LTR and free linear HIV

BHBBBBHHHHHHHHBD.TGGAAGGGCTAATT (SEQ ID No. 1) Non- viral portion Viral portion

for binding to U3 but not binding 2LTR or 1LTR and free linear HIV BBBSWMWMYHKK.TGGAAGGGCTAATT (SEQ ID No. 2) or

BBNBDMDHYHKK.TGGAAGGGCTAATT (SEQ ID No.3) Non-viral portion Viral portion

for binding to U5 but not binding 1LTR and free linear HIV HVDDDVHVVDHHHDHDDBD.TGCTAGAGATTT (SEQ ID No.4)

for binding to U5 but not binding 2LTR or 1LTR and free linear HIV

VVKHWWDMRDKK.TGCTAGAGATTT (SEQ ID No. 5) or VVDHWWDMVDKB.TGCTAGAGATTT (SEQ ID No. 6)

One problem which may arise in Degenerate Primer PCR (DP-PCR) derives from the fact that a DP is not a single primer. It is instead, a pool of millions of different sequences (DP variants). In the case of DPI, the number of variants could reach 1.6 million. Only a limited number of the variants will participate in the first few rounds of PCR. As normal, subsequent PCR will be dominated by the replicon sequences. A result of this is the preferential use of the DP variants that had participated in the first few round of PCR and incorporated in the replicons. As these few variants are only a tiny fraction of the total, further PCR will lead to a depletion of these sequences in the test tubes. This will inevitably limit the sensitivity of DP-PCR. To overcome this problem a Nested Degenerate Primer PCR could be employed It might be preferred thus to take a nested approach, whereby the above reaction takes place, but after some initial amplification, the reaction mixture is significantly diluted, and a second pair of primers is introduced, which primers provide complementarity with viral DNA which has been amplified, and a second round of amplification takes place. Free viral DNA will not be amplified in this second round of amplification because the dilution will be significant enough to have eliminated copies of unamplified free viral DNA sufficiently not to cause interference in the second round of amplification.

Another assistance in this is where the restriction enzyme Bsrl is used. Restriction enzyme Bsrl cuts at ACTGn! (here n stands for any nucleotide). Of the relevant sequences (excluding internal sites and sites within the 3' LTR), Bsrl cuts integrated HIV proviral DNA at nt 151 and nt 9089 (in the HXB2 sequence). It cuts free HIV DNA at an extra site. This is because the free HIV DNA possesses an additional AC dinucleotide 5' to the beginning of the integrated provirus. The terminal ACTGCAAGG of the free HIV DNA (including 1LTR and 2LTR circular DNA) thus has an additional Bsrl site, ACTGGA1AGG. The AC dinucleotide is removed by HIV integrase during integration and formation of the provirus. Restriction of Bsrl before amplification and using an overlapping primer of any of the types set out above will minimise false signals, when the viral portion of the degenerate primer binds U3. Additionally the method might use Bsrl with a modified degenerate primer. The modified degenerate primer includes variants of the viral portion as comprehended herein, but the non- viral portion need not be constructed so as to avoid binding to adjacent nucleic acid found in the 1LTR, 2LTR or free linear forms. That is because these forms have the u3 terminal portion severed from adjacent portion, and thus the primer cannot bind, it can only bind when any other sequence is adjacent to the U3 terminal portion whereby one or more of primer set have a non-viral portion capable of binding to adjacent cellular DNA such that the entire primer binds. Thus in this form of the invention the non- iral portion of the degenerate primer can be randomly generated. Therefore in an alternative form the invention could be said to reside in a method of assaying the persistent and/or latent retroviral load in a host mammal or human including the steps of taking a sample of cells of the host or animal digesting nucleic acid thereof with restriction enzyme Bsrl and then performing amplification on the so digested nucleic acid thereof, said amplification being performed using a first viral primer comprising a sequence hybridising with an internal portion of viral DNA binding between sequence 5 and 151 and a degenerate primer set consisting of a plurality of primers each primer comprising an LTR binding portion complementary to an end of the U3 LTR region of the integrated retroviral nucleic acid but not of sufficient length and/or homology to anneal on its own, and a non- viral binding portion, conjoined with the LTR binding portion and comprising a nucliec sequence generated in a random sequence relative to other members of the degenerate primer set, said method further comprising the step of labelling the amplification product, and measuring the label.

The retrovirus might be selected from any one of the group being important medically and might be an animal pathogen, or a human pathogen perhaps a lentivirus, or an HIV virus or an onco virus such as HTLV-1, the virus might be selected from the group comprising HIV-1, HIV-2, HTLV-1 and HTLV-2.

To perform the assay it will be normal to take a sample of cells, and these will most conveniently be a sample of blood cells. These will be collected and lysed under conditions suitable for DNA extraction. DNA will be extracted, all the above being performed using known methodologies. The PCR will be performed on the isolated DNA.

The following table sets out the base codes for the sequences used herein:

Symbol Meaning

A A; adenine

C C; cytosine

G G; guanine T T; thymine

U U; uracil

M A or C

R A or G

W A or T S C or G

Y C or T K G orT

V A or C or G; not T H A or C or T; not G

D A or G or T; not C

B C or G or T; not A

N (A or C or G or T) or unknown

It will be understood also that in a second aspect the invention might be said to reside in a primer complement for measuring latent retrovirus the primer complement being any of the forms as defined or described in this specification.

BRIEF DESCRIPTION OF THE DRAWINGS

For a better understanding the invention will now be described with reference to a number of examples which are explained with reference to a number of drawings wherein,

Figure 1 is a collection of line drawings showing various forms of DNA that

HIV-1 retrovirus can take, and this also reflects DNA forms that retroviruses generally can take. These include linear DNA, 1LTR circular DNA, 2LTR circular DNA and integrated proviral DNA.

Figure 2 is an autoradiogram showing specific amplification of integrated HIV

DNA by DP-PCR. The autoradiogram shows the results of PCR probing and detection of the presence of a mimicked integrated HIV genome. In each case, 33000 copies of pBS-HB2 (cc) and 33000 copies of construct mimicking linear HIV form (lin) were subject to amplification over a range of MgCl2 concentrations using an annealing temperature of 60-61°C. Primers used in Figures 2 to 5: prototype degenerate primer set RDM#2, 5' HHHHHHHHTGGAAGGGC, PBS-, 5' GGTCCCTGTTCGGGCGC (n.t. 654-638 HXB2 sequence).

Probe for Southern (Figure 2) or dot (Figures 3-5) blot detection: 5'GGTACTAGCTTGTAGCACCATCC (n.t. 151-129 HXB2 sequence)

Figure 3 is an autoradiogram showing the specificity of DP-PCR in the presence of cellular DNA. In this experiment, 1 x 10⁵ copies of either the linear HIV construct or the pBS-HXB2 construct were mixed with 300ng (lxlO⁵ cell equivalents) of HUT-78 DNA. DP- PCR was performed, the products spotted onto Nylon membrane and hybridized with a viral probe. The presence of the dot at position 3 compared to the absence of a dot at position 1 indicates the specificity of the assay for integrated HIV forms. Primers and probe were as for Figure 2.

Figure 4 is an autoradiogram showing quantitation standards for DP-PCR

Proviral Assay. Indicated amounts of pBS-HXB2 construct were mixed with 1500ng (5xl0⁵ cell equivalents) of HUT-78 chromosomal DNA and subject to DP-PCR. Products of the DP-

PCR were spotted onto Nylon membrane and hybridized with a viral probe. The primer and probe were as for Figure 2.

Figure 5 is an autoradiogram showing quantitative DP-PCR of integrated HIV Sequence in H3B Cells. Serial 5 fold dilutions of H3B chromosomal

DNA was made and integrated HIV DNA detected by DP-PCR and dot blot bybridization. 1500ng of chromosomal DNA was present at all times (5xl0⁵ cell equivalents). Primers and probe were as for Figure 2.

Figure 6 is an autoradiogram showing the results of a nested PCR amplification on a one thousandth dilution of the first round degenerative PCR using primers U3.1(+) and U3PNV. 1 to 10⁵ copies of cc and 10⁵ of lin constructs are tested in the presence of 300ng of cellular DNA from HUT78 cells or 8E5 cells (about 10⁵ cells). HUT: HUT78 cellular DNA which does not contain HIV sequence. 8E5: 8E5 cellular DNA which contains 1 copy of integrated HIV DNA per cell. Primer sequences: DPI 8: 5' BBHHHHHHBD.TGGAAGGG 3' PBS(-): 5'GGTCCCTGTTCGGGCGC.

U₃.ι(+): 5' GGAAGGGCTAATTCACTCC. U₃PNV: 5' GGTACTAGCTTGTAGCACCATCC.

DETAILED DESCRIPTION OF THE INVENTION.

As briefly discussed above, in order to be a measure of persistent-latent viral load this assay must ignore free, unintegrated viral DNA in the infected cells and quantitatively detect the viral-cellular integration junction sequences. Reference is now made to Figure 1. Free, unintegrated HIV DNA in infected cells exists in linear and circular forms. Of the circular forms, the one LTR circle is by far the dominant (about 90%), and the two LTR circle is the minor (about 10%), species (15,16). Thus the array of DNA sequences relevant to viral-cellular junctions in HIV infected cells are as follows using HIV-HXB2 as an example:

A 5' integrated HIV sequences:

...nnnnnnnnnn . TGGAAGGGCTAATTC... cellular > . < viral U

B 3' integrated HTV sequences:

...GGAAAATCTCTAGCA . nnnnnnn... viral U₅ > . < cellular

C Viral sequences flanking 3' U₃:

..AAAAGAAAAGGGGGGAC .TGGAAGGGCTAATTC. viral PPT > . < viral U₃ (in linear and both forms of circular viral DNA)

D Viral sequences flanking 5'U₅:

..GGAAAATCTCTAGCA . GTGGCGCCCGAACA... viral U5 > . < viral PBS (in linear and both forms of circular viral DNA)

E Viral sequences at U₃-U₅ junction..

....AGTGTGGAAAATCTCTAGCA . TGGAAGGGCTAATTC... viral U5 > . < viral U3 (in two LTR circular viral DNA)

(n: any nucleotide, dot: cellular- viral junction)

We can choose either A or B as a target then C or D would be the major interfering sequences; while E would be a minor interfering sequences in either case. Figure 1 shows the locations of sequences A, B, C, D and E in relation to various forms of HIV DNA. A group of degenerate primer sets (DPs) has been synthesised. The principles of DP-PCR can be illustrated by two of the degenerate primer sets DPI and DP2.

DPI (12+9) 5' BBBBHHHHHHBD.TGGAAGGGC (21 mer)

DP2 ( 18+9) VYS YYYBBBSWMWMYHKK.TGGAAGGGC (27 mer)

The 9 nucleotides viral sequence (TGGAAGGGC) alone, when annealed to a target (or interfering) sequence, would form a duplex with estimated melting temperature of about 30°C (17). The 12-base degenerate sequence in DPI is designed not to anneal to the highly conserved viral PPT sequence (18) in the major interfering (linear and one LTR circular) viral DNA. The 18-base degenerate sequence in DP2 is designed not to anneal to any interfering free viral DNA (linear or circular forms). Retroviral integration occurs randomly with regard to cellular sequences (19,20), therefore the target cellular sequences 5' to the cellular- viral junctions (the 'n's in A) are expected to partially anneal to the degenerate sequence part of DPI and DP2. Pairing a portion of bases in the 12 degenerate nucleotides in DPI or in the 18 degenerate nucleotides in DP2 would allow non-perfect annealing-priming events to the target, but not the interfering, sequences at a temperature higher than 30°C. With a particular DP, this temperature, together with other PCR conditions, can be easily determined experimentally by using control constructs and DNA preparations containing the target and interfering sequences.

As has briefly discussed above a wide variety of primer sets could be used as the degenerate primer. Some variations of the DPI sets which have been shown to be able to distinguish integrated HIV sequences from unintegrated HIV sequences are listed below.

DPI (12+9) BBBBHHHHHHBD.TGGAAGGGC (21mer) DPI (10+9) BBHHHHHHBD.TGGAAGGGC (19mer)

DPI (8+9) HHHHHHBD.TGGAAGGGC (17mer)

DPI (14+9) BHBBBBHHHHHHBD.TGGAAGGGC (23mer)

RDM#2 HHHHHHHH.TGGAAGGGC (17mer)

DP4 (12+8) BBNBDMDHYHKK.TGGAAGGG (20mer)

Of the above primer DP4 is currently the best one of this set for use in non-stringent degenerate hybridisation. In the above the host specific portion of the primer set is varied, however, the virus specific portion might also be varied.

EXAMPLE 1 Materials & Methods

DNA Isolation techniques. Genomic DΝA (HUT-78 and H3B) was isolated using the Qiagen Blood and Cell Culture Kit using the supplied buffer and recommended protocol. Construct pBS-HXB2(cc) was a plasmid clone derived from the λHXB2 (21) retaining the cellular flanking sequences adjacent to both HIV LTR's. HIV linear construct (lin) was constructed by removing the cellular flanking sequences (see below). In both cases, constructs were isolated by the Qiagen plasmid maxiprep kit using the supplied buffers and the recommended protocol.

Generation of Linear Construct. Linearisation of the pBS-HXB2(cc) construct with Xbal (ΝEB) and subsequent digestion with Mung Bean Νuclease (ΝEB) gave a construct with closely resembles the terminal 5' LTR in the linear form. This form lacks the 5'-AC-3' bases at the ends (as it is derived from an integrated form) and instead carries a terminal 5'-A-3' as confirmed by sequence analysis (PRISM™ Ready Reaction DyeDeoxy™ Terminator Cycle Sequencing Kit).

Specific Amplification of Integrated HIV DNA. Degenerate oligonucleotide primers RDM#2 5ΗHHHHHHH.GGAAGGGC-3' and PBS(-) were obtained in a desalted form from Bresatec (Adelaide) and 500ng and 200ng were used respectively in all PCRs. All PCRs were performed in 20 μl using lxPCR Buffer II (Perkin-Elmer), 0.2mM dΝTPs, MgC^ (4.5mM or as indicated) and 1U of Amplitaq (Perkin-Elmer). Samples were overlaid with 25 μl of PCR oil and then subjected to denaturation at 94°C for 3 min, 30 cycles of 30 sec denaturation at 94°C, 1 min annealing at 61°C and 45 sec extension at 72°C with 10 min at 72°C for the final extension step.

Analysis of PCR Products. lOμl of PCR was either run down a PAGE gel (8%) and then subjected to electroblot procedure or run through a dot-blot apparatus (Biorad) onto Hybond™-Ν+ nylon transfer membrane. DNA was then detected by Southern hybridisation using ³²P end-labelled viral probe (U3PNV 5'- GGTACTAGCTTGTAGCACCATCC-3'; Bresatec, de-salted). Products were visualised using Phophorimage analysis.

Results Using a construct mimicking linear HIV DNA and pBS-HXB2 which is a plasmid clone of HIV containing cellular flanking sequences at both ends, it was shown:

(a) At 60°C-61 °C and high MgCl₂ concentration, only pBS-HXB2 (cc, mimicking integrated HIV DNA), but not the linear HIV DNA construct (lin) was detected by DP-PCR (Figure 2)

(b) The same is true in the presence of 300 ng cellular DNA background, although the signal intensity is "diluted" (Figure 3).

(c) DP-PCR can be quantitative in different cellular context (Figure 4 and Figure 5).

These results show that the DP-CR is simple and more robust than both the Alu-PCR and the linker-primer PCR.

It is thought that the potential of this method is superior to others for a number of reasons including the short and defined nature of the amplicon.

The DP-PCR can be applied to genomic DNA preparations of known numbers of cells (e.g. T cells or macrophage cells) isolated from the blood of HlV-infected patients to determine the integrated viral load. Results would be obtained by cross-referencing the signal obtained from the patient sample with a standard curve constructed by spiking known copies of the pBS-HXB2 construct onto a fixed amount of HUT-78 DNA. The result would ultimately be expressed as integrated viral DNA copy number per million cells.

EXAMPLE 2

Nested Degenerate Primer PCR (NDP-PCR)

One problem which may arise in Degenerate Primer PCR (DP-PCR) derives from the fact that a DP is not a single primer. It is instead, a pool of millions of different sequences (DP variants). In the case of DPI, the number of variants could reach 1.6 million. Only a limited number of the variants will participate the few rounds of PCR.

As normal, subsequent PCR will be dominated by the replicon sequences. A result of this is the preferential use of the DP variants that had participated in the first few round of PCR and incorporated in the replicons. As these fit variants are only a tiny fraction of the total, further PCR will lead to a depletion of these sequences in the test tubes.

This will inevitably limit the sensitivity of DP-PCR. To overcome this problem a

Nested Degenerate Primer PCR could be employed Stringent ND-PCR

Nested Degenerate Primer PCR (NDP-PCR) could use a stringent DP-PCR, then a nested PCR in the viral region. The DP-PCR uses freshly prepared chromosomal DNA and may use DPI (12+9) primer set BBBBHHHHHHBDTGGAAGGGC (21mer, estimated annealing temperature: 30 degrees plus) and a viral specific primer PBS1 GGTTTCCCTTTCGCTTTCAG (20mer, nt 673-653, estimated annealing temperature: 60 degrees). This requires a 30 degree contribution from the 12 degenerate bases of DP 1(12+9) to enable the primer pair to work with specificity at around 60 degrees. After the DP-PCR, the product will be diluted 20 times and a 1-2 percent of the diluted DP-PCR product (total dilution factor 1,000-2,000) is subject to the nested PCR. This dilution, which might be tested empirically, should ensure that only the DP-PCR amplified, integrated HIV DNA sequence, but not the non-amplified free HIV DNA sequences can be detected in the following nested PCR. The nested PCR may use viral PI primer TGGAAGGGCTAATTCACTC, (19mer, nt 1-19, estimated annealing temperature: 56 degrees) and viral PBS primer GGTTTCCCTTTCGCTTTCA (19mer, nt 673-654, estimated annealing temperature: 56 degrees). The product of the NDP- PCR will be quantified against quantitation standard curves generated under identical NDP-PCR conditions.

Relaxed NDP-PCR.

The stringent first DP-PCR may limit the sensitivity. A more relaxed DP-PCR can be performed using the same DPI (12+9) primer set BBBBHHHHHHBDTGGAAGGGC (21 mer, estimated annealing temperature: 30 degrees plus) and a shortened viral primer PBS2 GTTTCCCTTTCGCTTTC (17mer, nt 672-656, estimated annealing temperature: 50 degrees). This requires only a 20 degrees contribution from the 12 degenerate bases of DPI (12+9) to enable the primer pair to work with specificity at around 50 degrees. The DP-PCR product is similarly diluted and verified. The nested PCR may be performed using similar primers and conditions outlined in the first example. The product of the NDP-PCR will be quantified against quantitation standard curves generated under identical NDP-PCR conditions.

Hypotehtical example of a method of quantification

Quantitation standards spanning a range of 10 copiees to 6250 copies would be spiked onto 10⁵ cell equivalents of HUT-78 DNA and a standard curve constructed from the resulting signals. The signal measurement is the P³² pixel reading on a phosphura Imager. NDP-PCR would concurrently be performed on genomic DNA extracted from 10⁵ T cells isolated from the blood of an infected individual and the results obtained by cross-reference with the standard curve. The result would be extrapolated and expressed in terms of integrated viral DNA copy number per million cells.

EXAMPLE 3

Nested DP-PCR

Figure 6 shows the results of the use of Nested DP-PCR. The primers used were

U3.1(+) and U3PNV. 1 to 10⁵ copies of closed circular and 10⁵ copies of linear constructs were tested in the presence of 300ng of cellular DNA from HUT78 cells or

8E5 cells (about 10⁵ cells).

The results shown in figure 6 demonstrate (1) DP-PCR is capable of distinguishing between integrated and linear HIV genomes in the presence of large amounts of cellular DNA and (2) nested DP-PCR can increase the sensitivity to about 10 copies of integrated viral DNA in 10⁵ cells, the signal observed in the linear dot is probably the result of PCR amplification of original input DNA carried over in the l/1000th dilution, indicating optimisation of the netted DP-PCR conditions is required. HUT: HUT78 cellular DNA which does not contain HIV sequence. 8E5: 8E5 cellular DNA which contains 1 copy of integrated HIV DNA per cell. Primer sequences: DP18: 5' BBHHHHHHBD.TGGAAGGG 3" PBS(-): 5'GGTCCCTGTTCGGGCGC. U₃.ι(+): 5' GGAAGGGCTAATTCACTCC.

U₃PNV: 5' GGTACTAGCTTGTAGCACCATCC.

EXAMPLE 4

DP PCR with digestion with the endonuclease Bsrl

DNA sample can be restricted with Bsrl first before being amplified. This would cut HIV DNA at 9089 (PPT-U3 border region, in all forms of free viral DNA - including linear, 1 LTR circular and 2 LTR circular) and the right hand part of integrated viral DNA) and at nt7 in the beginning of linear as well as circular unintegrated viral DNA due to the presence of AC dinucleotides, but not the integrated viral DNA.

The amplification could be carried out either with Degenerate Primed PCR or with the nested variant. The degenerate primer set used is one that has a viral portion designed to bind to U3 and a non-viral portion designed to not bind to a portion of viral nucleic acid abutting the U3. In addition to these, however, another overlapping primer might be used, wherein each nucleotide of the non-viral portion of the degenerate primer is chosen from all four nucleotides. That is because after Bsrl digestion the only non- digested region abutting terminal U3 is host DNA in its integrated form. The viral portion of the degenerate primer set is chosen not to hybridise on its own, and therefore the only means by which amplification occurs is where one or more of the degenerate primer set also binds the non- viral abutting host DNA.

lin the case when the degenerate primer set used is one that has a viral portion designed to bind to U3 and a non-viral portion designed to not bind to a portion of viral nucleic acid abutting the U3, digestion by Bsrl would further decrease the chance for the free viral DNA to stably anneal to the degenerate primer, and therefore could increase the specificity of the DP-PCR. Nested PCR will be carried out using primers in the first 150 bases in the viral sequence after dilution of the DP-PCR product.

REFERENCES

I . Wei et / (1995) Nature 373:117-122. 2. Ho et al (1995) Nature 373:123-126.

3 . Perelson et al (1996) Science , 271: 1582-1586.

4. Perelson et al (1997) Nature , 387: 188-191.

5. Cavert et al (1997) Science , 276: 960-964. 5a. Cohen (1998). Science 279: 1854-1855. 6. Chun et al (1997) Nature 387: 183-188.

7. Chun et al (1997) Proc. Nat/. Acaa". S . f/SA 94: 13193-13197. 7a. Chun et al (1998) Proc. Natl. Acad. Sci. USA 95:8869-8873

8. Wong et al (1997) Science, 278: 1291-1295.

9. Finzi et al (1997) Science 278: 1295-1300. 10. Ho (1998) Science 280: 1866-1867.

I I . Chun et al (1995). Nature Medicine 1: 1284-1290.

12. Sonza et al (1996) J. Virol. 70: 3863-3869.

13. Jelinek and Schmid (1982) Ann. Rev. Biochem. 51: 813-44.

14. Wattel et al (1995) J.Virol. 69: 2863-2868. 15. Li and Burrell (1992) AIDS Res. Hum. Retroviruses. 8: 253-259.

16. Li et al (1992) J. Gen. Virol. 73: 955-959.

17. Meinkoth and Wahl, G. (1984) Anal Biochem. 138: 267-284.

18. Llyinskii and Desrosiers (1998) EMBO J. 17: 3766-3774.

19. Brown (1990) Curr. Top. Microbiol. Immunol. 157: 19-48. 20. Brown (1997) In Retroviruses, pp 161-203. Eds. Coffin,et al. C.S.H. Laboratory Press, New York.

21. Shaw et al (1984) Science 226:1165-1171

Claims

1. A method of assaying the persistent and/or latent retroviral load in a host mammal or human including the steps of taking a sample of cells of the host or animal and performing amplification on the nucleic acid thereof, said amplification being performed using a first viral primer comprising a sequence hybridising with an internal portion of viral DNA and a degenerate primer set consisting of a plurality of primers each primer comprising an LTR binding portion complementary to an end of an LTR region of the integrated retroviral nucleic acid but not of sufficient length and/or homology to anneal on its own, and a non-viral binding portion, conjoined with the LTR binding portion and comprising a sequence selected to be sufficiently non- complementary so as not to permit binding of a retroviral sequence abutting the end of the LTR region under the conditions of the amplification when the retrovirus is not integrated, each of the degenerate primer set having a non- viral binding portion generated in a random sequence relative to other members of the degenerate primer set, said method further comprising the step of labelling the amplification product, and measuring the label.

2. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein the non-viral binding portion is selected so as to not bind to an adjacent portion of linear and the 1 LTR circular form.

3. A method of assaying the persistent and/or latent retroviral load as in claim 2 wherein the viral portion of the degenerate primer set is selected to bind an end portion of U3, and the non-viral portion of the degenerate primer set is selected to not hybridise with the abutting portion of the PPT region in the linear and the 1 LTR circular form.

4. A method of assaying the persistent and/or latent retroviral load as in claim 3 wherein the each of the non- viral portion of degenerate primer are purine rich.

5. A method of assaying the persistent and/or latent retroviral load as in claim 2 wherein the viral portion of the primer is selected to bind to an end portion of U5, and the degenerate primer set is selected to not hybridise with the abutting portion of the PBS sequence.

6. A method of assaying the persistent and/or latent retroviral load as in claim 3 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of 5 GGAAG3', 5 GGAAGG3', 5 GGAAGGG3', 5 GGAAGGGC3' 5 GGAAGGGCT3', 5 GGAAGGGCTA3', 5 GGAAGGGCTAA3', 5 GGAAGGGCTAAT3' or single base mismatches thereof.

7. A method of assaying the persistent and/or latent retroviral load as in claim 6 wherein the degenerate portion comprises a sequence of solely non-G residues being at least 8 bases in length.

8. A method of assaying the persistent and/or latent retroviral load as in claim 6 wherein the degenerate portion is selected from the groups consisting of

5'BBBBHHHHHHBD3', 5'BBBHHHHHHBD3', 5'BBHHHHHHBD3', 5╬òHHHHHHBD3', 5╬ùHHHHHBD3' or single base mismatches thereof.

9. A method of assaying the persistent and/or latent retroviral load as in claim 5 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of 5 GCTAGAGATTT3', 5 GCTAGAGATT3', 5 GCTAGAGAT 3', 5 GCTAGAGA3', 5' TGCTAGAG3', or single base mismatches thereof.

10. A method of assaying the persistent and/or latent retroviral load as in claim 5 wherein the degenerate portion is selected from the groups consisting of

5╬ùVDDDVHVVDHH3' VDDDVHVVDHH3' DDDVHVVDHH3' DDVHVVDHH3' DVHVVDHH3' or single base mismatches thereof.

11. A method of assaying the persistent and/or latent retroviral load as in claim 3 wherein the non- viral binding portion of the primer is selected to also not bind to the sequence adjacent U3 when in the 2LTR form.

12. A method of assaying the persistent and or latent retroviral load as in claim 11 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of 5 GGAAG3', 5'TGGAAGG3', 5 GGAAGGG3', 5 GGAAGGGC3' 5 GGAAGGGCT3', 5 GGAAGGGCTA3', 5 GGAAGGGCTAA3', 5 GGAAGGGCTAAT3' or single base mismatches thereof.

13. A method of assaying the persistent and/or latent retroviral load as in claim 11 wherein the degenerate portion is selected from the groups consisting of 5╬ÑYBBBSWMWMYHKK3', 5╬ÑBBBSWMWMYHKK3', 5╬òBBSWMWMYHKK3', 5╬òBSWMWMYHKK3', 5╬òSWMWMYHKK3', 5'SWMWMYHKK3', 5╬òBNBDMDHYHKK3', 5╬òNBDMDHYHKK3', 5'NBDMDHYHKK3', 5╬òDMDHYHKK3', or single base mismatches thereof.

14. A method of assaying the persistent and/or latent retroviral load as in claim 5 wherein the non- viral binding portion of the primer is selected to also not bind to the sequence adjacent U5 when in the 2LTR form.

15. A method of assaying the persistent and/or latent retroviral load as in claim 14 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of 5'TGCTAGAGATTT3', 5 GCTAGAGATT3', 5'TGCTAGAGAT 3', 5TGCTAGAGA3', 5' TGCTAGAG3', or single base mismatches thereof.

16. A method of assaying the persistent and/or latent retroviral load as in claim 14 wherein the degenerate portion is selected from the groups consisting of 5╬ÑVKHWWDMRDKK3', 5╬ÑKHWWDMRDKK3', 5'KHWWDMRDKK3', 5╬ùWWDMRDKK3', 5╬ÑVDHWWDWVDKB3', 5'VDHWWDWVDKB3', 5'DHWWDWVDKB3', 5╬ùWWDWVDKB3', or single base mismatches thereof.

17. A method of assaying the persistent and or latent retroviral load as in claim 3 wherein the method includes the step of restriction enzyme digesting with Bsrl prior to amplification, and the first viral primer being selected to bind between U3 and the first adjacent viral Bsrl site at position 151.

18. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein the amplification is a nested amplification, the nested amplification comprising the further step of diluting the amplification product, and providing a second viral primer comprising a sequence hybridising with an internal portion of viral DNA, a adding further first viral primer, and amplifying further a portion of the amplified product, said dilution being significant enough to reduce the concentration of unamplified free viral DNA to not be readily detectable following labelling.

19. A method of assaying the persistent and or latent retroviral load as in claim 1 wherein the retrovirus is a human pathogen or animal pathogen.

20. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein the retrovirus is selected from the group comprising HIV-1, HIV-2, HTLV-1 and HTLV-2.

21. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein the virus is an HIV.

22. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein the viral portion of the degenerate set of primers is greater than six bases.

23. A method of assaying the persistent and/or latent retroviral load as in claim 2 wherein the viral portion of the degenerate set of primers is greater than five bases.

24. A method of assaying the persistent and/or latent retroviral load as in claim 3 wherein the non-viral portion of the degenerate set of primers is greater than five bases.

25. A method of assaying the persistent and/or latent retroviral load as in claim 4 wherein the viral portion of the degenerate set of primers is greater than twelve bases.

26. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein the sample of cells is taken from blood, other tissues or other body fluids of the animal or human.

27. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein DNA is isolated from the cells of the sample.

28. A method of assaying the persistent and/or latent retroviral load as in claim 1 wherein the amplification is polymerase chain reaction

29. A method of assaying the persistent and/or latent retroviral load in a host mammal or human including the steps of taking a sample of cells of the host or animal digesting nucleic acid thereof with restriction enzyme Bsrl and then performing amplification on the so digested nucleic acid thereof, said amplification being performed using a first viral primer comprising a sequence hybridising with an internal portion of viral DNA binding between sequence 5 and 151 and a degenerate primer set consisting of a plurality of primers each primer comprising an LTR binding portion complementary to an end of the U3 LTR region of the integrated retroviral nucleic acid but not of sufficient length and or homology to anneal on its own, and a non- viral binding portion, conjoined with the LTR binding portion and comprising a nucliec sequence generated in a random sequence relative to other members of the degenerate primer set, said method further comprising the step of labelling the amplification product, and measuring the label.

30. A degenerate primer set for assaying the persistent and/or latent viral load said degenerate primer set comprising a plurality of primers each primer consisting of an LTR binding portion complementary to an end of an LTR region of the integrated retroviral nucleic acid but not of sufficient length and or homology to anneal on its own, and a non- viral binding portion, conjoined with the LTR binding portion and comprising a sequence selected to be sufficiently non-complementary so as not to permit binding of a retroviral sequence abutting the end of the LTR region under the conditions of the amplification when the retrovirus is not integrated, each of the degenerate primer set having a non-viral binding portion generated in a random sequence relative to other members of the degenerate primer set.

31. A degenerate primer set as in claim 30 wherein the non- viral binding portion is selected so as to not bind to an adjacent portion of linear and the 1 LTR circular form.

32. A degenerate primer set as in claim 31 wherein the viral portion of the degenerate primer set is selected to bind an end portion of U3, and the non-viral portion of the degenerate primer set is selected to not hybridise with the abutting portion of the PPT region in the linear and the 1 LTR circular form.

33. A degenerate primer set as in claim 32 wherein the each of the non-viral portion of degenerate primer are purine rich.

34. A degenerate primer set as in claim 30 wherein the viral portion of the primer is selected to bind to an end portion of U5, and the degenerate primer set is selected to not hybridise with the abutting portion of the PBS sequence.

35. A degenerate primer set as in claim 32 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of 5 GGAAG3', 5 GGAAGG3', 5 GGAAGGG3', 5 GGAAGGGC3' 5 GGAAGGGCT3', 5 GGAAGGGCTA3', 5 GGAAGGGCTAA3', 5'TGGAAGGGCTAAT3' or single base mismatches thereof.

36. A degenerate primer set as in claim 35 wherein the degenerate portion comprises a sequence of solely non-G residues being at least 8 bases in length.

37. A degenerate primer set as in claim 35 wherein the degenerate portion is selected from the groups consisting of 5╬òBBBHHHHHHBD3', 5╬òBBHHHHHHBD3', 5╬òBHHHHHHBD3', 5╬òHHHHHHBD3', 5╬ùHHHHHBD3' or single base mismatches thereof.

38. A degenerate primer set as in claim 34 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of

5 GCTAGAGATTT3', 5 GCTAGAGATT3', 5'TGCTAGAGAT 3', 5 GCTAGAGA3', 5' TGCTAGAG3', or single base mismatches thereof.

39. A degenerate primer set as in claim 34 wherein the degenerate portion is selected from the groups consisting of 5╬ùVDDDVHVVDHH3' VDDDVHVVDHH3'

DDDVHVVDHH3' DDVHVVDHH3' DVHVVDHH3' or single base mismatches thereof.

40. A degenerate primer set as in claim 33 wherein the non-viral binding portion of the primer is selected to also not bind to the sequence adjacent U3 when in the 2LTR form.

41. A degenerate primer set as in claim 40 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of 5 GGAAG3', 5'TGGAAGG3', 5 GGAAGGG3', 5 GGAAGGGC3' 5 GGAAGGGCT3', 5'TGGAAGGGCTA3', 5 GGAAGGGCTAA3', 5 GGAAGGGCTAAT3' or single base mismatches thereof.

42. A degenerate primer set as in claim 40 wherein the degenerate portion is selected from the groups consisting of 5╬ÑYBBBSWMWMYHKK3",

5╬ÑBBBSWMWMYHKK3', 5'BBBSWMWMYHKK3', 5╬òBSWMWMYHKK3', 5'BSWMWMYHKK3', 5'SWMWMYHKK3', 5╬òBNBDMDHYHKK3', 5╬òNBDMDHYHKK3', 5'NBDMDHYHKK3', 5╬òDMDHYHKK3', or single base mismatches thereof.

43. A degenerate primer set as in claim 35 wherein, the viral portion of the degenerate set of primers is selected from the group consisting of 5'TGCTAGAGATTT3', 5 GCTAGAGATT3', 5'TGCTAGAGAT 3', 5 GCTAGAGA3', 5' TGCTAGAG3', or single base mismatches thereof.

44. A degenerate primer set as in claim 35 wherein the degenerate portion is selected from the groups consisting of 5'VVKHWWDMRDKK3', 5'VKHWWDMRDKK3', 5'KHWWDMRDKK3', 5╬ùWWDMRDKK3', 5NVDHWWDWVDKB3', 5╬ÑDHWWDWVDKB3', 5OHWWDWVDKB3', 5╬ùWWDWVDKB3', or single base mismatches thereof.

45. A degenerate primer set as in claim 30 wherein the retrovirus is a human pathogen or animal pathogen.

46. A degenerate^* primer set as in claim 30 wherein the retrovirus is selected from the group comprising HIV-1, HIV-2, HTLV-1 and HTLV-2.

47. A degenerate primer set as in claim 30 wherein the virus is an HIV.

48. A degenerate primer set as in claim 30 wherein the viral portion of the degenerate set of primers is greater than six bases.

49. A degenerate primer set as in claim 31 wherein the viral portion of the degenerate set of primers is greater than five bases.

50. A degenerate primer set as in claim 33 wherein the non-viral portion of the degenerate set of primers is greater than six bases.

51. A degenerate primer set as in claim 34 wherein the viral portion of the degenerate set of primers is greater than five bases.