EP0782623A1 - Nucleic acid fragment and products derived therefrom - Google Patents

Nucleic acid fragment and products derived therefrom

Info

Publication number
EP0782623A1
EP0782623A1 EP95931148A EP95931148A EP0782623A1 EP 0782623 A1 EP0782623 A1 EP 0782623A1 EP 95931148 A EP95931148 A EP 95931148A EP 95931148 A EP95931148 A EP 95931148A EP 0782623 A1 EP0782623 A1 EP 0782623A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
plants
leu
acid fragment
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95931148A
Other languages
German (de)
French (fr)
Inventor
Margit Frentzen
Christiane Hanke
Gabriele Peterek
Peter Wolter
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DEUTSCHE SAATVEREDELUNG LIPPSTADT BREMEN GmbH
NORDDEUTSCHE PFLANZENZUCHT HANS-GEORG LEMBKE KG
KWS SAAT SE and Co KGaA
Original Assignee
DEUTSCHE SAATVEREDELUNG LIPPSTADT BREMEN GmbH
NORDDEUTSCHE PFLANZENZUCHT HANS-GEORG LEMBKE KG
KWS Kleinwanzlebener Saatzucht AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DEUTSCHE SAATVEREDELUNG LIPPSTADT BREMEN GmbH, NORDDEUTSCHE PFLANZENZUCHT HANS-GEORG LEMBKE KG, KWS Kleinwanzlebener Saatzucht AG filed Critical DEUTSCHE SAATVEREDELUNG LIPPSTADT BREMEN GmbH
Publication of EP0782623A1 publication Critical patent/EP0782623A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition

Definitions

  • the invention relates to DNA sequences which code for plant acyltransferases, and to the use of these sequences for changing the fatty acid spectrum of lipids.
  • Triacylglycerols Oils and fats (triacylglycerols) are used in a variety of ways in the nutrient and oleochemical-technical fields, although there are different requirements for their quality, i. H. are placed on their fatty acid spectra. In the chemical sector, triacylglycerols with the most homogeneous possible fatty acid spectra are desirable, i. H. all three glycerol positions should be esterified with the same fatty acid if possible. Depending on the intended use, very different fatty acids, such as. B. lauric, oleic, ricinoleic or erucic acid, interesting.
  • the 1-acylglycerol-3-phosphate acyltransferase in particular which catalyzes the incorporation of fatty acids into the central glycerol position of the oil, is critical here.
  • This enzyme has namely in the ripening seeds or fruits of crops, such as. B. rapeseed, soy or corn, a very pronounced specificity and selectivity for unsaturated C ⁇ g fatty acids.
  • crops such as. B. rapeseed, soy or corn
  • a very pronounced specificity and selectivity for unsaturated C ⁇ g fatty acids such as. B. rapeseed, soy or corn
  • it is not active with unusual fatty acids, especially if the sn-1 position is already esterified with such a fatty acid.
  • the properties of l-acylglycerol-3-phosphate acyltransferase thus represent the decisive barrier for an even occupation of all three glycerol positions with unusual fatty acids.
  • acyltransferases which transfer unusual fatty acids to the middle glycerol position, especially if the sn-1 position has already been esterified with such a fatty acid.
  • Genes expressed in a seed-specific manner which encode specific l-acylglycerol-3-phosphate acyltransferases for very long-chain acyl groups and which are thus suitable for the fatty acid spectrum z. B. to unify erucic acid, can be found in Limnanthes species.
  • This task is solved with a nucleic acid fragment according to claim 1. The sequence of such a nucleic acid fragment is shown in FIG. 1 shown.
  • a method has thus been invented to control the fatty acid composition of lipids.
  • Nucleic acid fragments encoding a 1-acylglycerol-3-phosphate acyltransferase (AGPAT) are provided to generate chimeric genes. These chimeric genes can be used to transform plants or microorganisms and thus the fatty acid To change the composition and fatty acid distribution of the glycerolipids and especially the triacylglycerols.
  • the invention relates to an isolated nucleic acid fragment which contains a DNA sequence which codes for a vegetable AGPAT or similar enzyme, the amino acid sequence of which has an identity of at least 35 or more percent to that isolated from Limnanthes douglasii and isolated in FIG. 2 specified sequence has.
  • the isolated nucleic acid fragment is further characterized in that it was isolated from a plant belonging to the class of Dicotyledoneae, that it was isolated from the group of the following plants: Limnanthes, rape, Arabidopsis.
  • nucleic acid fragment obtained in this way from plants does not have a significantly higher similarity in terms of the derived amino acid sequence to the only other sequence known from plants, namely that from maize, than to the three other known sequences from Bacteria and yeast, but that the similarity to yeast is even somewhat greater than that to maize (cf. Table 2).
  • a cDNA clone could be obtained by this method, which originates from plants, that is to say a eukaryote, and codes for an AGPAT, which is involved in the storage lipid synthesis and is specific for very long-chain fatty acids (ie fatty acids with a carbon number of over 18) because the mutant used for the complementation step is a bacterium, ie a prokaryote, and the defect is in membrane biosynthesis.
  • the nucleic acid fragment isolated from Limnanthes douglasii (FIG. 1) is characterized in that the associated genes are expressed in a seed-specific manner and in that it codes for an AGPAT which is specific for very long-chain acyl groups - hereinafter this enzyme is referred to as L-AGPAT .
  • the isolated nucleic acid fragment is primarily characterized in that it can be used to increase the content of trierucine in the oil of transgenic plants and thus to improve its technical usability.
  • Trierucin has the scientific name Trierucoylglycerin.
  • the invention further relates to the use of the nucleic acid fragment for isolating genes or cDNAs which code for other plant acyltransferases, eg. B.
  • PCR polymerase chain reaction
  • the invention also relates to all plasmids, viruses and other vectors which contain the isolated nucleic acid fragment or parts thereof, and to all organisms, in particular plants and parts of plants, which contain these constructs, and also all products which are produced in the transgenic organisms and their material composition through the effect of the above Sequences or parts thereof are changed.
  • plasmids chimeric genes
  • These chimeric genes comprise nucleic acid fragments which code for a vegetable AGPAT or a similar enzyme, the amino acid sequence of which is at least 35 percent or more identical to that shown in FIG.
  • the invention also relates to a method for the production of lipids which have altered contents or altered distributions of very long-chain fatty acids, especially erucic acid. This method involves the following steps:
  • Preferred cells are those from the following group: E. coli, saccharomyces, plant cells.
  • the cell lines and products produced using this method are also the subject of the invention.
  • the invention also relates to a method for the production of vegetable oils and fats which have changed contents or changed distributions of very long-chain fatty acids, especially erucic acid, in their fatty acid spectra.
  • This method involves the following steps:
  • Plant cells from oil plants such as. B. rape, sunflower or flax are preferred.
  • Preferred methods for plant cell transformation are indirect DNA transfer with Ti and Ri plasmids from Agrobacterium, direct DNA transfer, electroporation or ballistic DNA transfer.
  • the invention also relates to the transgenic plants and parts of plants which were produced using this method and to the oils and fats with modified fatty acid spectra obtained from the transgenic plants or parts of plants by pressing and / or extracting.
  • the invention also includes a method of plant breeding to maintain the changed quality of oils and fats from oilseeds.
  • the method involves the following steps:
  • the invention includes a method for isolating further nucleic acid fragments that code for AGPAT and related enzymes. It includes the following steps:
  • nucleic acid fragments produced with the aid of this method and parts thereof are also part of the invention, likewise all chimeric genes which contain these fragments or parts thereof, all transgenic microorganisms, cell lines and transgenic plants and parts thereof which are mentioned above. Contain nucleic acid fragments and finally all products that are made from this transgenic material and whose material composition is changed by the action of the inserted nucleic acid fragments.
  • FIG. 1 DNA sequence of the nucleic acid fragment pCH21, which was isolated from a cDNA expression gene bank of developing embryos from Limnanthes douglasii. It has a length of 1020 base pairs (bp) plus a polyA sequence of 19 bp, a GC content of 41.9% and contains an open reading frame from positions 1 to 852. Start and stop codons are found in the Positions 10 to 12 and 853 to 855.
  • FIG. 2 amino acid sequence in one-letter code the sequence of the DNA-Se ⁇ the nucleic acid fragment has been derived pCH21 and encoding an L-AGPAT with a molecular mass of 27.5 kDa.
  • FIG. 3 Sequence comparison of the 5 'region of the nucleic acid fragment pCH21 with another nucleic acid fragment pCH149 isolated from the cDNA expression gene bank of Limnanthes douglasii developing embryos. The start codon (***) and the stop codon (+++) located upstream in the same reader grid are marked.
  • FIG. 4 Comparison of the amino acid sequences of the AGPAT of E. coli (line 1) and Salmonella typhimurium (line 2), as well as those derived from the cDNAs of yeast (line 3) and those of maize (line 4) with that shown in FIG. 2 indicated. "*" means identical amino acids in all sequences, ".” means similar amino acids in all sequences. The comparison was carried out with the aid of the CLUSTAL program (Higgins & Sharp 1988, Gene 73, 237-244).
  • FIG. 5 Detection of seed-specific expression by Northern blot analysis. Electrophoretically separated mRNA from leaves (lane 1: 1 ⁇ g; lanes 3 and 6: 3 ⁇ g) and ripening seeds (lane 2: 1 ⁇ g; lanes 4 and 5: 3 ⁇ g) from Limnanthes douglasii was hybridized, the range from Nucleotide 10 to nucleotide 741 of the nucleic acid fragment pCH21 shown in FIGJ was used as a radioactively labeled sample.
  • Tab. 2 Comparison of the amino acid idenities of the known AGPATs. Description as in Tab. 1, LIM Limnanthes douglasii.
  • Example A Isolation of cDNAs for an L-AGPAT by means of heterologous complementation. 1. Preparation of PolyA + RNA from Limnanthes douglasii:
  • Limnanthes douglasii created a cDNA expression gene bank in the phage vector Lambda-ZAP (Stratagene) .
  • 2 ⁇ g mRNA were used, which, as described under point 1, were isolated from maturing embryos from Limanthes douglasii.
  • the gene bank was created according to the manufacturer's instructions.
  • the primary bank contains 3.7 x 10 ° independent clones in a volume of 500 ⁇ l.
  • This preparation, called the plasmid cDNA expression bank has a DNA concentration of 1 ⁇ g / ⁇ l.
  • the problem is the isolation of such clones containing AGPAT encoding cDNAs from the bulk of the various clones containing other gene bank cDNAs.
  • the method of heterologous complemen- tation selected. In the heterologous complementation, mutants are used which have a defect in the enzyme whose associated cDNA is sought.
  • the mutants used are generally conditional. So there are permissive conditions under which the growth of the cells is possible and non-permissive conditions under which no growth takes place.
  • the mutant JC201 was used.
  • This mutant has a defect in AGPAT that is thermosensitive.
  • the cells are grown at 37 C culture temperature ⁇ , however, finds no growth, AGPAT activity is no longer detectable in vitro, and it accumulates l-acylglycerol-3-phosphate in the mutant cells.
  • Cells of this mutant were analyzed using the method of Inoue, H., Nojima, H., Okayama, H. et al. (1990): High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23-86 transferred to the state of competence in which they can take up plasmid DNA.
  • each of the competent mutant cells were transformed with 100 ng plasmid DNA from the plasmid cDNA expression library from Limnanthes douglasii (Cohen, S. " N., chang, ACY, Hsu, L. et al. 1972) Nonchraomosomal antibiotic resistance in bacteria: Genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sci. 69, 2110-2114 and under selective conditions on LB plates containing 100 ⁇ g / ml ampicillin at 37 "C incubated. 300 clones were isolated which could grow at 37 ⁇ C. The plasmid DNA was isolated from these clones.
  • This DNA was then individually transformed into competent JC201 and the transformed cells were tested for their ability to grow at the non-permissive temperature of 37 ° C. This was the case with 130 clones. The one to these DNA belonging to 130 clones was again transformed into competent JC201 and the selection was repeated. After this step, 27 clones reproducibly showed the ability to grow at 37 ° C. In another round, the number of positive clones was reduced to 9. This number remained stable in three further rounds of selection.
  • the plasmid DNA isolated from the positive clones was characterized in more detail using the restriction analysis.
  • the plasmid DNA from six of the clones (pCH21, ⁇ CH147, pCH148, pCH149, pCH170 and pCH186), the cDNA of which is about 1 kbp long, were combined into one group on the basis of similar restriction patterns and sequenced from both sides. It was found that the cDNAs contain identical nucleotide sequences and differ only in their 5 'and 3' extent.
  • the cDNA insert of pCH21 was completely sequenced on both strands.
  • the nucleotide sequence is shown in FIG. 1 shown.
  • the cDNA contained has a length of 1039 bp.
  • 852 bp In the same orientation as the lacZ promoter there is a long, open reading frame of 852 bp, which is in the same phase as LacZ 'and therefore potentially forms a fusion protein.
  • Including the stop codon there are 279 base pairs in the 3 'untranslated region and a polyA region of 19 nucleotides.
  • the nucleotide sequence has a GC content of 41.9%, which is typical for plant cDNAs.
  • the sequence of pCH148 and pCH149 which is further extended in the 5 'direction, shows a stop codon in the 5' direction in the reading frame under discussion (FIG. 3). This limits the open reading frame in the 5 'direction, and it can be assumed with certainty that the start codon at position 10 in pCH21 represents the AGPAT start codon.
  • Example B Functional expression of the 1-acylglycerol-3-phosphate acyltransferase from Limnanthes douglasii in E. coli
  • cDNA insert of pCH21 is a 1-acylglycerol-3-phosphate acyltransferase, namely an erucoyl-CoA-specific
  • functional expression studies were carried out in E. coli and analyzed the acyl-CoA specificities of the expression product.
  • the cDNA insert of pCH21 (FIG. 1) was amplified using the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • PCR reaction was carried out in a thermal cycler (Biometra) at the following reaction temperatures and times: 2 min, 95 ° C. for the first time denaturing the DNA, followed by 27 cycles with 20 s each 95 ° C.
  • the 852 bp amplification product was obtained by agarose gel electrophoresis (Sambrook et al. 1989) of primers and by-products were separated, eluted from the gel using the QIAEX gel elution kit (QIA-GEN) according to the company's instructions and ligated into the dephosphorylated vector pUC19 linearized with Sma I using the SUREclone kit (Pharmacia) as indicated by the manufacturer.
  • the plasmid pUCL21 obtained in this way was checked by restriction and sequence analysis. 10 ⁇ g of the plasmid were then digested with Nco I and Bgl II, and the Nco I / Bgl II fragment carrying the cDNA insert was isolated by agarose gel electrophoresis as described above and converted into the vector pQE60 (QIAGEN) linearized with Nco I and Bgl II. ligated to obtain construct PQEL21. pQEL21 and the vector pQE60 were transformed into competent cells of the E. coli mutant JC201 which contained the plasmid pREP4 (QIAGEN) carrying the lac i'l repressor.
  • the E. coli JC201 cells which in addition to the repressor plasmid also contained the construct pQEL21 or the vector pQE60, were grown in LB medium containing ampicillin (100 ⁇ g / 1) and kanamycin (25 ⁇ g / 1) 30 ° C. Overnight cultures were diluted 1:40 in this medium and grown at 30 ⁇ C to an OD 600 of 0.6.
  • Isopropyl ß-D-thiogalactopyranoside-(IPTG) was added to a final concentration of 2 mM and the bacteria after a drei ⁇ hour incubation at 30 C ⁇ by centrifugation at 4500 xg for 10 min harvested.
  • Bacterial cells harvested by sedimentation were washed twice with membrane buffer (50 mM Tris / HCl pH 8.4, 5 mM MgCl2 5 mM dithiotreitol) and resuspended in this buffer so that the Volume of the suspension corresponded to about 1/40 of the culture volume.
  • the bacterial cells were lysed by four ultrasound treatments for 30 s using an ultrasound probe. After separating large cell fragments and "inclusion bodies" by centrifugation at 7500 xg for 10 minutes, the membranes were sedimented from the cell homogenates by centrifugation at 10,000 xg for 1 h.
  • the enzyme test is based on the enzymatic conversion of l-acyl-sn- [U- 1 C] glycerol-3-phosphate with acyl-CoA to 1,2-diacyl-sn- [U- 14 C] glycerol-3-phosphate.
  • the reaction mixture contained 0JM tricin / NaOH pH 8.8, 4 to 40 ⁇ M oleoyl-CoA or erucoyl-CoA, 2.5 ⁇ M 1-oleoyl-sn- [U- 1 C] glycerol-3-phosphate (353 dpm / pmol) and membrane fractions (0.2-3.5 ⁇ g protein) in a total volume of 50 ⁇ l.
  • the mixture was mixed with 50 ⁇ g phosphatidic acid in 240 ⁇ l chloroform: methanol (1: 1) and 100 ⁇ l 1 M KC1, 0.2 MH 3 PO 4 , mixed and 2 min for phase separation Centrifuged at 1000 xg, 90 ⁇ l of the chloroform phase applied to silica gel ready plates and developed in chloroform: pyridine: formic acid (50: 30: 7) for 30 min.
  • the phosphatidic acid band was localized by spraying the developed finished silica gel plate with phosphatide reagent (Dittmer & Lester, J. Lipid Res. 5, 126-127 (1964)), scraped into a scintillation tube and with 5 ml of cocktail (OptiPhase 4HISAFE4, Wallec) offset. The radioactivity of the sample was determined in the scintillation counter.
  • GAT TAC GTC AAA ATG ATA CAC GAC GTC TAT GTC CGC AAC CTA CCT GCG 816 Asp Tyr Val Lys Met Ile His Asp Val Tyr Val Arg Asn Leu Pro Ala 255 260 265

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nutrition Science (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to DNA sequences which code vegetable acyl transferases and the use of these sequences to change the fatty acid spectrum of lipids.

Description

Nukleinsäurefragment und daraus abgeleitete Produkte Nucleic acid fragment and products derived from it
Die Erfindung betrifft DNA-Sequenzen, die für pflanzliche Acyltransferasen kodieren, sowie die Verwendung dieser Sequenzen zur Veränderung des Fettsäurespektrums von Lipiden.The invention relates to DNA sequences which code for plant acyltransferases, and to the use of these sequences for changing the fatty acid spectrum of lipids.
Öle und Fette (Triacylglycerine) finden im Nährmittelbereich und im oleo- chemisch-technischen Bereich vielfältige Verwendung, wobei allerdings unterschiedliche Anforderungen an ihre Qualität, d. h. an ihre Fettsäure¬ spektren gestellt werden. Im Chemiebereich sind Triacylglycerine mit mög¬ lichst homogenen Fettsäurespektren erwünscht, d. h. alle drei Glycerinpo- sitionen sollen möglichst mit derselben Fettsäure verestert sein. Je nach Verwendungszweck sind ganz unterschiedliche Fettsäuren, wie z. B. Laurin-, Öl-, Ricinol- oder Erucasäure, interessant.Oils and fats (triacylglycerols) are used in a variety of ways in the nutrient and oleochemical-technical fields, although there are different requirements for their quality, i. H. are placed on their fatty acid spectra. In the chemical sector, triacylglycerols with the most homogeneous possible fatty acid spectra are desirable, i. H. all three glycerol positions should be esterified with the same fatty acid if possible. Depending on the intended use, very different fatty acids, such as. B. lauric, oleic, ricinoleic or erucic acid, interesting.
Bei . dem Einsatz derartig reiner Rohstoffe fallen weniger Nebenprodukte an, so daß sich der Aufwand für Reinigung und Verarbeitung erheblich verringert und somit die Kosten/Nutzenrelation verbessert. Sobald Öle mit hoher, gleichbleibender Qualität und in ausreichenden Mengen verfügbar sein werden, können sich neue Absatzmärkte und Anwendungsmöglichkeiten eröffnen, die derzeit aus ökonomischer Sicht noch nicht tragfähig sind.At. the use of such pure raw materials results in fewer by-products, so that the effort for cleaning and processing is considerably reduced and thus the cost / benefit ratio is improved. As soon as oils of a high, consistent quality and in sufficient quantities will be available, new sales markets and application possibilities may open up that are currently not yet economically viable.
Um die Qualität pflanzlicher Öle den Erfordernissen der chemischen Indu¬ strie anzupassen, bieten sich generell folgende Wege an: zum einen die Entwicklung leistungsstarker Kulturpflanzen aus Wildpflanzen, deren Sa¬ menöle homogene Fettsäurespektren aufweisen, wie z. B. bestimmte Cuphea- oder Tropaeolum-Arten, zum anderen die Vereinheitlichung der Fettsäure¬ spektren der Öle bereits vorhandener Kulturpflanzen, wie z. B. Raps, Son¬ nenblume oder Sojabohne durch klassische Züchtung bzw. gezielt durch gentechnologische Eingriffe. Da die Domestizierung der Wildpflanzen sehr zeitaufwendig ist und in der Regel die Veränderung einer Vielzahl unter¬ schiedlichster Merkmale erfordert, konzentrieren sich die Bemühungen weltweit auf die Modifizierung der bereits vorhandenen Kulturpflanzen. Es ist bekannt, daß durch den Transfer eines Gens in Sense- bzw. Antisense- orientierung deutliche Veränderungen im Fettsäurespektrum des Rapsöls er¬ zielt werden können. Darüberhinaus ist es durch klassische Züchtung bzw. durch gentechnologische Verfahren gelungen, das Fettsäurespektrum ver¬ schiedener Samenöle hinsichtlich der Ölsäure zu vereinheitlichen.To ensure the quality of vegetable oils with the requirements of the chemical indu stry ¬ adapt to paths generally offer the following to: first, the development of high performance crops from wild plants having their Sat ¬ menöle homogeneous fatty acid spectra such. B. certain Cuphea or Tropaeolum species, on the other hand the standardization of the fatty acid ¬ spectra of the oils of existing crops, such as. As rapeseed, soybean Son ¬ nenblume or by classical breeding or by genetic engineering targeted interventions. Since the domestication of wild plants is very time consuming and requires the change under a variety ¬ schiedlichster features usually efforts are focused worldwide on the modification of existing crops. It it is known that the transfer of a gene in sense or antisense orientation can achieve significant changes in the fatty acid spectrum of the rapeseed oil. In addition, classic breeding and genetic engineering methods have succeeded in standardizing the fatty acid spectrum of various seed oils with regard to oleic acid.
Die Vereinheitlichung des Fettsäurespektrums hinsichtlich anderer indu¬ striell interessanter Fettsäuren, die eine Kettenlänge von mehr oder deut¬ lich weniger als 18 Kohlenstoffatomen aufweisen und die im folgenden als ungewöhnliche Fettsäuren bezeichnet werden, wie z.B. Erucasäure (cis-13- Docosensäure, 22:1) oder Laurinsäure (Dodecansäure 12:0), wurde bisher al¬ lerdings noch nicht erzielt. Aus Fettsäureanalysedaten der Öle und enzyma- tischen Untersuchungen zur Olsynthese geht hervor, daß der Gehalt solcher Fettsäuren im Öl nicht allein durch die Enzymaktivitäten limitiert wird, die an der Synthese dieser Fettsäuren beteiligt sind, sondern auch durch die, die den Fettsäureeinbau in das Öl katalysieren. Vor allem die 1-Acyl- glycerin-3-phosphat-Acyltransferase, die den Fettsäureeinbau in die mittle¬ re Glycerinposition des Öls katalysiert, ist hierbei kritisch. Dieses Enzym besitzt nämlich in den reifenden Samen bzw. Früchten von Kulturpflanzen, wie z. B. Raps, Soja oder Mais, eine sehr ausgeprägte Spezifität und Selek¬ tivität für ungesättigte C^g-Fettsäuren. Es ist aber mit ungewöhnlichen Fettsäuren nicht aktiv, vor allem, wenn die sn-1-Position bereits mit einer solchen Fettsäure verestert ist. Die Eigenschaften der l-Acylglycerin-3- phosphat-Acyltransferase stellen somit die entscheidende Barriere für eine gleichmäßige Besetzung aller drei Glycerinpositionen mit ungewöhnlichen Fettsäuren dar.The standardization of the fatty acid spectrum with regard to other industrially interesting fatty acids which have a chain length of more or significantly less than 18 carbon atoms and which are referred to below as unusual fatty acids, such as e.g. Erucic acid (cis-13-docosenoic acid, 22: 1) or lauric acid (dodecanoic acid 12: 0), however, has not yet been achieved. Fatty acid analysis data of the oils and enzymatic studies on the oil synthesis show that the content of such fatty acids in the oil is not only limited by the enzyme activities that are involved in the synthesis of these fatty acids, but also by those that catalyze the incorporation of fatty acids into the oil . The 1-acylglycerol-3-phosphate acyltransferase in particular, which catalyzes the incorporation of fatty acids into the central glycerol position of the oil, is critical here. This enzyme has namely in the ripening seeds or fruits of crops, such as. B. rapeseed, soy or corn, a very pronounced specificity and selectivity for unsaturated C ^ g fatty acids. However, it is not active with unusual fatty acids, especially if the sn-1 position is already esterified with such a fatty acid. The properties of l-acylglycerol-3-phosphate acyltransferase thus represent the decisive barrier for an even occupation of all three glycerol positions with unusual fatty acids.
Dies ist wahrscheinlich die Ursache dafür, daß es trotz intensiver Zucht¬ programme nicht gelungen ist, z.B. den Erucasäuregehalt im Fettsäurege¬ misch des Rapsöls, das wie das anderer Brassicaceen von Natur aus reich an sehr langkettigen Fettsäuren ist, deutlich über 60% zu steigern. Daher muß Erucasäure, die seit langem im oleochemisch-technischen Bereich ver¬ wendet wird, zunächst kostenaufwendig gereinigt werden, was ihre Einsatz¬ möglichkeiten z. B. in der Kunststoffindustrie und damit ihren Absatzmarkt erheblich limitiert. Im Jahr 1993 lag das Marktvolumen für erucasäurerei- ches Rapsöl (Erucasäuregehalt 45%) in Deutschland z. B. bei ca. 28 000 t. Man erwartet, daß das Marktvolumen um das zehnfache ansteigen kann, sobald Öle mit Erucasäuregehalten um ca. 90% verfügbar werden. Die homogene Besetzung aller drei Glycerinposition mit Erucasäure, wie auch mit anderen ungewöhnlichen Fettsäuren, kann im Öl von Kulturpflan¬ zen, wie z. B. Raps, durch gentechnologische Methoden ermöglicht werden, z. B. durch Transformation mit einem Genkonstrukt daß für eine 1-Acylgly- cerin-3-phosphat-Acyltransferase mit gewünschten Eigenschaften kodiert. Solche Gene finden sich z. B. in bestimmten Wildpflanzen, in denen sie samenspezifisch exprimiert werden. Diese Gene kodieren für Acyltransfera¬ sen, die ungewöhnliche Fettsäuren auf die mittlere Glycerinposition über¬ tragen, vor allem, wenn die sn-1-Position bereits mit einer solchen Fett¬ säure verestert ist. Samenspezifisch exprimierte Gene, die für sehr lang- kettige Acylgruppen spezifische l-Acylglycerin-3-phosphat-Acyltränsferasen kodieren und die somit geeignet sind, das Fettsäurespektrum z. B. hinsicht¬ lich Erucasäure zu vereinheitlichen, finden sich in Limnanthes-Arten.This is probably the reason why, despite intensive breeding programs, it was not possible, for example, to increase the erucic acid content in the fatty acid mixture of rapeseed oil, which, like that of other Brassicaceae, is naturally rich in very long-chain fatty acids, well over 60%. Therefore erucic acid, which has been used in the oleochemical-technical field for a long time, first has to be cleaned in a costly manner. B. in the plastics industry and thus their sales market considerably limited. In 1993 the market volume for rapeseed oil rich in erucic acid (erucic acid content 45%) in Germany was z. B. at about 28,000 t. It is expected that the market volume can increase tenfold as soon as oils with erucic acid contents become available by approx. 90%. The homogeneous occupation of all three glycerol positions with erucic acid, as well as with other unusual fatty acids, can occur in the oil of crops, such as. B. rapeseed, made possible by genetic engineering methods, e.g. B. by transformation with a gene construct that codes for a 1-acylglycerol-3-phosphate acyltransferase with desired properties. Such genes are found e.g. B. in certain wild plants in which they are expressed in a seed-specific manner. These genes code for acyltransferases which transfer unusual fatty acids to the middle glycerol position, especially if the sn-1 position has already been esterified with such a fatty acid. Genes expressed in a seed-specific manner, which encode specific l-acylglycerol-3-phosphate acyltransferases for very long-chain acyl groups and which are thus suitable for the fatty acid spectrum z. B. to unify erucic acid, can be found in Limnanthes species.
Gene, die für l-Acylglycerin-3-phophat-Acyltransferasen kodieren, wurden aus Escherichia coli und Salmonella typhimurium isoliert, deren Aminosäu¬ resequenzen zu 94% identisch sind (Tabelle 1). Weiterhin wurden cDNAs aus Hefe und Mais beschrieben, die eine E. coli-Mutante, die einen Defekt in ihrer l-Acylglycerin-3-phosphat-Acyltransferase aufweist, komplementieren. Diese cDNAs kodieren für Polypeptide, deren Aminosäuresequenzen unter¬ einander und zu denen der bakteriellen Acyltransferasen zu etwa 30% iden¬ tisch sind (Tabelle 1). Ein eindeutiger Nachweis, daß diese cDNAs für 1- Acylglycerin-3-ρhosphat-Acyltransferasen kodieren, steht allerdings noch aus.Genes coding for 1-acylglycerol-3-phosphate acyltransferases were isolated from Escherichia coli and Salmonella typhimurium, the amino acid sequences of which are 94% identical (Table 1). Furthermore, cDNAs from yeast and maize have been described which complement an E. coli mutant which has a defect in its l-acylglycerol-3-phosphate acyltransferase. These cDNAs coding for polypeptides whose amino acid sequences unter¬ each other and to those of the bacterial acyltransferases are schematically about 30% identical ¬ (Table 1). However, there is still no clear proof that these cDNAs code for 1-acylglycerol-3-phosphate acyltransferases.
Es ist Aufgabe der Erfindung, ein Nukleinsäurefragment zur Verfügung zu stellen, mit dem durch Expression in pflanzlichen Systemen die Qualität pflanzlicher Öle und Fette so verändert werden kann, daß ihre Verwertbar¬ keit als oleochemische Rohstoffe verbessert und erweitert wird. Diese Auf¬ gabe wird mit einem Nukleinsäurefragment gemäß Patentanspruch 1 gelöst. Die Sequenz eines solchen Nukleinsäurefragments ist in FIG. 1 dargestellt.It is an object of the invention to provide a nucleic acid fragment with which the quality of vegetable oils and fats can be changed by expression in plant systems in such a way that their usability as oleochemical raw materials is improved and expanded. This task is solved with a nucleic acid fragment according to claim 1. The sequence of such a nucleic acid fragment is shown in FIG. 1 shown.
Es wurde somit ein Verfahren erfunden, die Fettsäurezusammensetzung von Lipiden zu kontrollieren. Nukleinsäurefragmente, die für eine 1-Acylglyce- rin-3-phosphat-Acyltransferase (AGPAT) kodieren, werden bereitgestellt, um chimäre Gene zu erzeugen. Diese chimären Gene können benutzt werden, um Pflanzen oder Mikroorganismen zu transformieren und damit die Fettsäure- Zusammensetzung und Fettsäureverteilung der Glycerolipide und speziell der Triacylglycerine zu verändern.A method has thus been invented to control the fatty acid composition of lipids. Nucleic acid fragments encoding a 1-acylglycerol-3-phosphate acyltransferase (AGPAT) are provided to generate chimeric genes. These chimeric genes can be used to transform plants or microorganisms and thus the fatty acid To change the composition and fatty acid distribution of the glycerolipids and especially the triacylglycerols.
Die Erfindung betrifft ein isoliertes Nukleinsäurefragment, das eine DNA- Sequenz enthält, die für eine pflanzliche AGPAT oder ähnliches Enzym ko¬ diert, deren Aminosäuresequenz eine Identität von mindestens 35 oder ab¬ gestuft mehr Prozent zu der aus Limnanthes douglasii isolierten und in FIG. 2 angegebenen Sequenz besitzt. Das isolierte Nukleinsäurefragment ist weiterhin dadurch charakterisiert, daß es aus einer zur Klasse der Dico- tyledoneae gehörenden Pflanze isoliert wurde, daß es aus der Gruppe der folgenden Pflanzen isoliert wurde: Limnanthes, Raps, Arabidopsis.The invention relates to an isolated nucleic acid fragment which contains a DNA sequence which codes for a vegetable AGPAT or similar enzyme, the amino acid sequence of which has an identity of at least 35 or more percent to that isolated from Limnanthes douglasii and isolated in FIG. 2 specified sequence has. The isolated nucleic acid fragment is further characterized in that it was isolated from a plant belonging to the class of Dicotyledoneae, that it was isolated from the group of the following plants: Limnanthes, rape, Arabidopsis.
Zum einen ist es überraschend, daß ein auf diese Weise aus Pflanzen ge¬ wonnenes Nukleinsäurefragment hinsichtlich der abgeleiteten Aminosäure¬ sequenz keine deutlich höhere Ähnlichkeit zu der einzigen anderen aus Pflanzen bekannten Sequenz, nämlich der aus Mais, aufweist als zu den drei weiteren bekannten Sequenzen aus Bakterien und Hefe, sondern daß die Ähnlichkeit zu Hefe sogar etwas größer ist als die zu Mais (vgl. Tabel¬ le 2).On the one hand, it is surprising that a nucleic acid fragment obtained in this way from plants does not have a significantly higher similarity in terms of the derived amino acid sequence to the only other sequence known from plants, namely that from maize, than to the three other known sequences from Bacteria and yeast, but that the similarity to yeast is even somewhat greater than that to maize (cf. Table 2).
Zum anderen ist es überraschend, daß durch dieses Verfahren ein cDNA- Klon gewonnen werden konnte, der aus Pflanzen, also einem Eukaryoten, stammt und für eine AGPAT kodiert, die an der Speicherlipidsynthese be¬ teiligt ist und spezifisch für sehr langkettige Fettsäuren (d.h. Fettsäuren mit einer Kohlenstoffzahl von über 18) ist, weil die für den Komplementa- tionsschritt verwendete Mutante ein Bakterium, also ein Prokaryot, ist und der Defekt in der Membranbiosynthese vorliegt.On the other hand, it is surprising that a cDNA clone could be obtained by this method, which originates from plants, that is to say a eukaryote, and codes for an AGPAT, which is involved in the storage lipid synthesis and is specific for very long-chain fatty acids (ie fatty acids with a carbon number of over 18) because the mutant used for the complementation step is a bacterium, ie a prokaryote, and the defect is in membrane biosynthesis.
Das aus Limnanthes douglasii isolierte Nukleinsäurefragment (FIG. 1) ist dadurch charakterisiert, daß die zugehörigen Gene samenspezifisch expri- miert werden und daß es für eine AGPAT kodiert, die spezifisch für sehr langkettige Acylgruppen ist - im folgendes wird dieses Enzym als L-AGPAT bezeichnet.The nucleic acid fragment isolated from Limnanthes douglasii (FIG. 1) is characterized in that the associated genes are expressed in a seed-specific manner and in that it codes for an AGPAT which is specific for very long-chain acyl groups - hereinafter this enzyme is referred to as L-AGPAT .
Das isolierte Nukleinsäurefragment ist vor allem dadurch charakterisiert, daß es dazu verwendet werden kann, den Gehalt an Trierucin im Öl trans- gener Pflanzen zu steigern und damit seine technische Verwertbarkeit zu verbessern. Trierucin hat den wissenschaftlichen Namen Trierucoylglycerin. Die Erfindung betrifft weiterhin die Verwendung des Nukleinsäurefrag- ments zur Isolierung von Genen oder cDNAs, die für andere pflanzliche Acyltransferasen kodieren, z. B. Verwendung des Nukleinsäurefragments bzw. Teile davon als Hybridisierungsprobe, Verwendung von aus der Se¬ quenz des Nukleinsäurefragments abgeleiteten Oligonukleotiden in der Po- lymerasekettenreaktion (PCR), und Verwendung von Antikörpern gegen ein Polypeptid, das von dem Nukleinsäurefragment bzw. Derivaten diese Frag¬ ments kodiert wird.The isolated nucleic acid fragment is primarily characterized in that it can be used to increase the content of trierucine in the oil of transgenic plants and thus to improve its technical usability. Trierucin has the scientific name Trierucoylglycerin. The invention further relates to the use of the nucleic acid fragment for isolating genes or cDNAs which code for other plant acyltransferases, eg. B. Use of the nucleic acid fragment or parts thereof as a hybridization sample, use of oligonucleotides derived from the sequence of the nucleic acid fragment in the polymerase chain reaction (PCR), and use of antibodies against a polypeptide derived from the nucleic acid fragment or derivatives of these fragments is encoded.
Die Erfindung betrifft ebenfalls alle Plasmide, Viren und andere Vektoren, die das isolierte Nukleinsäurefragment oder Teile davon enthalten, sowie alle Organismen, insbesondere Pflanzen und Pflanzenteile, die diese Kon- strukte enthalten, sowie alle Produkte, die in den transgenen Organismen hergestellt werden und deren stoffliche Zusammensetzung durch die Wir¬ kung der o.g. Sequenzen oder Teilen davon verändert ist. Von besonderem Interesse sind solche Plasmide (chimäre Gene), die Transkription oder Transkription und Translation (Expression) von pflanzlichen Acyltransfera¬ sen in Wirtszellen, vor allem pflanzlichen Zellen, ermöglichen. Diese Chimä¬ ren Gene umfassen Nukleinsäurefragmente, die für eine pflanzliche AGPAT oder ein ähnliches Enzym kodieren, deren Aminosäuresequenz eine Identität von mindestens 35 oder mehr Prozent zu der in FIG. 2 angegebenen Sequenz besitzt, sowie geeignete Steuersequenzen, die in funktionaler Weise mit dem Fragment verbunden sind, das seinerseits in "Sense" oder "Antisense" eingefügt sein kann. Auf Mikroorganismen, Zellkulturen, Pflanzen und Pflanzenteile, die diese Chimären Gene enthalten, sowie auf daraus gewon¬ nene Produkte, speziell Triacylglycerin, deren stoffliche Zusammensetzung durch Wirkung dieser Chimären Gene in spezifischer Weise verändert ist, wird ebenfalls Schutzanspruch erhoben.The invention also relates to all plasmids, viruses and other vectors which contain the isolated nucleic acid fragment or parts thereof, and to all organisms, in particular plants and parts of plants, which contain these constructs, and also all products which are produced in the transgenic organisms and their material composition through the effect of the above Sequences or parts thereof are changed. Of particular interest are plasmids (chimeric genes) that enable transcription or transcription and translation (expression) of plant acyltransferases in host cells, especially plant cells. These chimeric genes comprise nucleic acid fragments which code for a vegetable AGPAT or a similar enzyme, the amino acid sequence of which is at least 35 percent or more identical to that shown in FIG. 2 has the specified sequence, as well as suitable control sequences, which are functionally linked to the fragment, which in turn can be inserted into "sense" or "antisense". Protection is also claimed for microorganisms, cell cultures, plants and parts of plants which contain these chimeric genes, and for products obtained therefrom, especially triacylglycerol, the composition of which is changed in a specific way by the action of these chimeric genes.
Die Erfindung betrifft auch eine Methode zur Produktion von Lipiden, die veränderte Gehalte oder veränderte Verteilungen sehr langkettiger Fett¬ säuren, speziell Erucasäure, aufweisen. Diese Methode umfaßt folgende Schritte:The invention also relates to a method for the production of lipids which have altered contents or altered distributions of very long-chain fatty acids, especially erucic acid. This method involves the following steps:
(a) Transformation von Zellen mit einem chimären Gen, wie oben beschrie¬ ben,(a) transforming cells with a chimeric gene as described above beschrie ¬ ben,
(b) Isolierung transgener Zellinien (Klone), wie unter (a) beschrieben,(b) isolation of transgenic cell lines (clones) as described under (a),
(c) Selektion von Zellinien aus (b), deren Lipide die gewünschten Fettsäu- remuster aufweisen,(c) selection of cell lines from (b) whose lipids contain the desired fatty acids exhibit remuster,
(d) Verarbeitung der Zellen aus (c), um Lipide mit gewünschten Fettsäure¬ mustern zu erhalten.(d) Processing the cells from (c) in order to obtain lipids with desired fatty acid patterns.
Bevorzugte Zellen sind solche aus der folgenden Gruppe: E.coli, Saccharo- myces, pflanzliche Zellen. Die Zellinien und Produkte, die mit Hilfe dieser Methode hergestellt werden, sind ebenfalls Gegenstand der Erfindung.Preferred cells are those from the following group: E. coli, saccharomyces, plant cells. The cell lines and products produced using this method are also the subject of the invention.
Die Erfindung betrifft ebenso eine Methode zur Produktion pflanzlicher Öle und Fette, die veränderte Gehalte oder veränderte Verteilungen sehr lang- kettiger Fettsäuren, speziell Erucasäure, in ihren Fettsäurespektren auf¬ weisen. Von besonderem Interesse ist hierbei die Produktion pflanzlicher Öle und Fette mit veränderten Gehalten an Trierucin. Diese Methode umfaßt folgende Schritte:The invention also relates to a method for the production of vegetable oils and fats which have changed contents or changed distributions of very long-chain fatty acids, especially erucic acid, in their fatty acid spectra. Of particular interest is the production of vegetable oils and fats with changed levels of trierucine. This method involves the following steps:
(a) Transformation einer Pflanzenzelle mit einem chimären Gen, wie oben beschrieben,(a) transforming a plant cell with a chimeric gene as described above,
(b) Aufzucht fertiler Pflanzen aus Zellen, wie unter (a) beschrieben,(b) growing fertile plants from cells as described under (a),
(c) Selektion von Samen der Nachkommenschaft aus (b), deren Samenöle die gewünschten Fettsäuremuster aufweisen, und(c) selection of progeny seeds from (b) whose seed oils have the desired fatty acid pattern, and
(d) Verarbeitung der Samen aus (c), um Öl mit gewünschten Fettsäuremu¬ stern zu erhalten.(d) Processing the seeds from (c) in order to obtain oil with desired fatty acid patterns.
Pflanzenzellen von Ölpflanzen, wie z. B. Raps, Sonnenblume oder Lein, sind bevorzugt. Bevorzugte Methoden zur Pflanzenzelltransformation sind indi¬ rekter DNA-Transfer mit Ti- und Ri-Plasmiden von Agrobacterium, direkter DNA-Transfer, Elektroporation oder ballistischer DNA-Transfer.Plant cells from oil plants, such as. B. rape, sunflower or flax are preferred. Preferred methods for plant cell transformation are indirect DNA transfer with Ti and Ri plasmids from Agrobacterium, direct DNA transfer, electroporation or ballistic DNA transfer.
Die Erfindung betrifft auch die transgenen Pflanzen und Pflanzenteile, die mit Hilfe dieser Methode hergestellt wurden, und die aus den transgenen Pflanzen bzw. Pflanzenteilen durch Pressen und/oder Extrahieren gewonne¬ nen Öle und Fette mit veränderten Fettsäurespektren.The invention also relates to the transgenic plants and parts of plants which were produced using this method and to the oils and fats with modified fatty acid spectra obtained from the transgenic plants or parts of plants by pressing and / or extracting.
Die Erfindung beinhaltet ebenfalls eine Methode zur Pflanzenzüchtung, um die veränderte Qualität der Öle und Fette von Ölsaaten zu erhalten. Die Methode umfaßt die folgenden Schritte:The invention also includes a method of plant breeding to maintain the changed quality of oils and fats from oilseeds. The method involves the following steps:
(a) Kreuzung der o. g. transgenen Pflanzen mit verschiedenen, anderen Va¬ rietäten,(a) crossing the above transgenic plants with different, other varieties,
(b) Southernblot-Hybridisierungen von Restriktionsendonukleasen verdauter genomischer DNA aus (a) mit markierten Nukleinsäurefragmenten, die für die beanspruchten AGPATs kodieren. Die Erfindung betrifft auch alle mit Hilfe dieser Methode hergestellten Pflanzen und deren Nachkommen, sowie Teile davon und daraus hergestellte Produkte, insbesondere Triacylglycerine, soweit deren stoffliche Zusammen¬ setzung durch die Wirkung der eingefügten Nukleinsäurefragmente verän¬ dert ist.(b) Southern blot hybridizations of restriction endonucleases of digested genomic DNA from (a) with labeled nucleic acid fragments which code for the claimed AGPATs. The invention also relates to all plants and their progeny produced with the aid of this method, as well as parts thereof and products made therefrom, in particular triacylglycerols, insofar as their material composition is changed by the action of the inserted nucleic acid fragments.
Schließlich beinhaltet die Erfindung eine Methode, um weitere Nukleinsäu¬ refragmente zu isolieren, die für AGPAT und verwandte Enzyme kodieren. Sie umfaßt die folgenden Schritte:Finally, the invention includes a method for isolating further nucleic acid fragments that code for AGPAT and related enzymes. It includes the following steps:
Vergleich der Sequenz in FIG. 2 mit anderen Acyltransferase-Aminosäurese- quenzen;Comparison of the sequence in FIG. 2 with other acyltransferase amino acid sequences;
Identifizierung konservierter Bereiche (a); undIdentification of conserved areas (a); and
Herstellung regionsspezifischer Oligonukleotidsonden, um die o.g. Nuklein¬ säurefragmente mit Hilfe sequenzabhängiger Protokolle herzustellen. Die mit Hilfe dieser Methode hergestellten Nukleinsäurefragmente sowie Teile davon sind ebenfalls Teile der Erfindung, gleichermaßen alle Chimä¬ ren Gene, die diese Fragmente oder Teile davon enthalten, alle transgenen Mikroorganismen, Zellinien und transgenen Pflanzen sowie Teile davon, die o. g. Nukleinsäurefragmente enthalten und schließlich auch alle Produkte, die aus diesem transgenen Material hergestellt werden und deren stoffliche Zusammensetzung durch die Wirkung der eingefügten Nukleinsäurefragmente verändert ist.Production of region-specific oligonucleotide probes in order to To produce nucleic acid fragments with the aid of sequence-dependent protocols. The nucleic acid fragments produced with the aid of this method and parts thereof are also part of the invention, likewise all chimeric genes which contain these fragments or parts thereof, all transgenic microorganisms, cell lines and transgenic plants and parts thereof which are mentioned above. Contain nucleic acid fragments and finally all products that are made from this transgenic material and whose material composition is changed by the action of the inserted nucleic acid fragments.
Die Figuren und Tabellen dienen zur Erläuterung der vorliegenden Erfin¬ dung. Sie zeigen:The figures and tables serve to explain the present invention. They show:
FIG. 1. DNA-Sequenz des Nukleinsäurefragments pCH21, das aus einer cDNA- Expressionsgenbank von sich entwickelnden Embryonen von Limnanthes douglasii isoliert wurde. Sie hat eine Länge von 1020 Basenpaaren (bp) plus einer PolyA-Sequenz von 19 bp, einem GC-Gehalt von 41,9% und enthält eine offenes Leseraster von Position 1 bis 852. Start- bzw. Stopcodon fin¬ den sich bei den Positionen 10 bis 12 bzw. 853 bis 855.FIG. 1. DNA sequence of the nucleic acid fragment pCH21, which was isolated from a cDNA expression gene bank of developing embryos from Limnanthes douglasii. It has a length of 1020 base pairs (bp) plus a polyA sequence of 19 bp, a GC content of 41.9% and contains an open reading frame from positions 1 to 852. Start and stop codons are found in the Positions 10 to 12 and 853 to 855.
FIG. 2. Aminosäuresequenz im Ein-Buchstaben-Code, die aus der DNA-Se¬ quenz des Nukleinsäurefragments pCH21 abgeleitet wurde und die für eine L-AGPAT mit einer molekularen Masse von 27,5 kDa kodiert.FIG. 2. amino acid sequence in one-letter code the sequence of the DNA-Se ¬ the nucleic acid fragment has been derived pCH21 and encoding an L-AGPAT with a molecular mass of 27.5 kDa.
FIG. 3. Sequenzvergleich des 5'-Bereichs des Nukleinsäurefragments pCH21 mit dem eines weiteren aus der cDNA-Expressionsgenbank von sich entwik- kelnden Embryonen von Limnanthes douglasii isolierten Nukleinsäurefrag¬ ments pCH149. Das Startcodon (***) und das stromaufwärts im selben Le¬ seraster gelegene Stopcodon (+++) sind markiert.FIG. 3. Sequence comparison of the 5 'region of the nucleic acid fragment pCH21 with another nucleic acid fragment pCH149 isolated from the cDNA expression gene bank of Limnanthes douglasii developing embryos. The start codon (***) and the stop codon (+++) located upstream in the same reader grid are marked.
FIG. 4. Vergleich der Aminosäuresequenzen der AGPAT von E. coli (Zeile 1) und Salmonella typhimurium (Zeile 2), sowie der aus den cDNAs von Hefe (Zeile 3) und der von Mais (Zeile 4) abgeleiteten mit der in FIG. 2 angege¬ benen. "*" bedeutet identische Aminosäuren in allen Sequenzen, "." bedeu¬ tet ähnliche Aminosäuren in allen Sequenzen. Der Vergleich wurde mit Hil¬ fe des Programms CLUSTAL (Higgins & Sharp 1988, Gene 73, 237-244) durch¬ geführt.FIG. 4. Comparison of the amino acid sequences of the AGPAT of E. coli (line 1) and Salmonella typhimurium (line 2), as well as those derived from the cDNAs of yeast (line 3) and those of maize (line 4) with that shown in FIG. 2 indicated. "*" means identical amino acids in all sequences, "." means similar amino acids in all sequences. The comparison was carried out with the aid of the CLUSTAL program (Higgins & Sharp 1988, Gene 73, 237-244).
FIG. 5. Nachweis der samenspezifischen Expression durch Northernblot-Ana- lyse. Elektrophoretisch aufgetrennte mRNA aus Blättern (Spur 1: 1 μg; Spu¬ ren 3 und 6: 3 μg) und reifenden Samen (Spur 2: 1 μg; Spuren 4 und 5: 3 μg) von Limnanthes douglasii wurde hybridisiert, wobei der Bereich von Nukleotid 10 bis Nukleotid 741 des in FIGJ angegebenen Nukleinsäurefrag¬ ments pCH21 als radioaktiv markierte Probe verwendet wurde.FIG. 5. Detection of seed-specific expression by Northern blot analysis. Electrophoretically separated mRNA from leaves (lane 1: 1 μg; lanes 3 and 6: 3 μg) and ripening seeds (lane 2: 1 μg; lanes 4 and 5: 3 μg) from Limnanthes douglasii was hybridized, the range from Nucleotide 10 to nucleotide 741 of the nucleic acid fragment pCH21 shown in FIGJ was used as a radioactively labeled sample.
Tab. 1: Vergleich der Aminosäureidentitäten der bekannten AGPATs. Es be¬ deuten ECO Escherichia coli, SAL Salmonella thyphimurium, SAC Saccharo- myces cerevisiae und ZEA Zea mais. Die Werte wurden mit Hilfe des Pro¬ gramms BESTFIT (Devereux et al. 1984, Nuc. Acids Res. 12, 387-394) ermittelt.Tab. 1: Comparison of the amino acid identities of the known AGPATs. It means ECO Escherichia coli, SAL Salmonella thyphimurium, SAC Saccharomyces cerevisiae and ZEA Zea mais. The values were determined using the BESTFIT program (Devereux et al. 1984, Nuc. Acids Res. 12, 387-394).
Tab. 2: Vergleich der Aminosäureidenditäten der bekannten AGPATs. Be¬ zeichnung wie in Tab. 1, LIM Limnanthes douglasii.Tab. 2: Comparison of the amino acid idenities of the known AGPATs. Description as in Tab. 1, LIM Limnanthes douglasii.
Die Erfindung wird im folgenden an Beispielen erläutert:The invention is illustrated below using examples:
Alle molekularbiologischen Methoden wie DNA (Plasmid)-Isolierung, Agaro- segelelektrophorese, Gelelution, Phenolisierung, DNA-Füllungen, Ligation, Transformation, Klonierung, Polymerasekettenreaktion (PCR), wenn nicht anders angegeben, nach Standardprotokollen von Sambrook et al. (Molecu- lar Cloning, CSH Laboratory Press 1989) durchgeführt.All molecular biological methods such as DNA (plasmid) isolation, agarose gel electrophoresis, gel elution, phenolization, DNA fillings, ligation, transformation, cloning, polymerase chain reaction (PCR), unless otherwise stated, according to standard protocols by Sambrook et al. (Molecular Cloning, CSH Laboratory Press 1989).
Beispiel A: Isolierung von cDNAs für eine L-AGPAT mittels heterologer Komplementation. 1. Präparation von PolyA+RNA aus Limnanthes douglasii:Example A: Isolation of cDNAs for an L-AGPAT by means of heterologous complementation. 1. Preparation of PolyA + RNA from Limnanthes douglasii:
Zur Gewinnung von PolyA+RNA wurden 4 g Embryonen (ca. 10 Tage alt) von Limnanthes douglasii unter flüssigem Stickstoff fein zermörsert und mit 30 ml Extraktionspuffer (100 mM NaCl, 50 mM Tris pH 9,0, 10 mM EDTA, 2 %(w/v) SDS, 200 μg/ml Proteinase K) versetzt. Nach lOminütiger Inkubation bei 37 βC folgten mit jeweils gleichen Volumina zwei Phenol/Chloroform (1:1)- Extraktionen und eine Chloroform-Extraktion. Die Phasentrennung wurde durch Zentrifugation bei 6000 x g erreicht. Nach Zusatz von 1/5 Vol 10 M LiCl2 und einstündiger Inkubation auf Eis wurde eine Zentrifugation bei 6500 x g, 4 βC, für 30 min angeschlossen und der Überstand mit 0,2 g Oli- go-dT-Cellulose (Boehringer) versetzt. Die Cellulose wurde je dreimal mit Waschpuffer 1 (400 mM NaCl, 10 mM Tris pH 7,5, 0,2 %(w/v) SDS) und Wasch¬ puffer 2 (100 mM NaCl, 10 mM Tris pH 7,5) gewaschen und die mRNA mit Elutionspuffer (10 mM Tris pH 7,5) eluiert. Die eluierte mRNA wurde ein zweites Mal über Oligo-dT-Cellulose, wie oben erläutert, gereinigt. Die Ausbeute betrug 20 μg RNA pro 4 g eingesetztem Frischgewicht.To obtain PolyA + RNA, 4 g of Limnanthes douglasii embryos (approx. 10 days old) were finely ground under liquid nitrogen and mixed with 30 ml of extraction buffer (100 mM NaCl, 50 mM Tris pH 9.0, 10 mM EDTA, 2% ( w / v) SDS, 200 μg / ml proteinase K) added. After incubation at 37 lOminütiger β C followed each with two equal volumes of phenol / chloroform (1: 1) - extractions and one chloroform extraction. The phase separation was achieved by centrifugation at 6000 xg. After the addition of 1/5 volume of 10 M LiCl2 and one hour incubation on ice, centrifuging at 6500 xg was, 4 β C, connected for 30 min and the supernatant with 0.2 g olive offset go-dT cellulose (Boehringer). The cellulose was washed three times each with wash buffer 1 (400 mM NaCl, 10 mM Tris pH 7.5, 0.2% (w / v) SDS) and wash buffer 2 (100 mM NaCl, 10 mM Tris pH 7.5) washed and the mRNA eluted with elution buffer (10 mM Tris pH 7.5). The eluted mRNA was purified a second time over oligo-dT cellulose as explained above. The yield was 20 μg RNA per 4 g fresh weight used.
2. Erstellung einer cDNA-Expressionsgenbank von Limnanthes douglasii: Zur Isolierung von cDNAs, die für l-Acylglycerin-3-phosphat-Acyltransfera- sen kodieren, wurde von Limnanthes douglasii eine cDNA-Expressionsgen- bank im Phagenvektor Lambda-ZAP (Stratagene) angelegt. Hierzu wurden 2 μg mRNA eingesetzt, die, wie unter Punkt 1 beschrieben, aus reifenden Embryonen von Limanthes douglasii isoliert wurden. Die Erstellung der Genbank erfolgte nach Angaben des Herstellers. Die Primärbank enthält 3,7 x 10° unabhängige Klone in einem Volumen von 500 μl. 1 x 10° Klone (= 135 μl) der Primärbank wurden entsprechend den Herstellerangaben amplifi- ziert. Diese amplifizierte Bank enthält 2 x 1013 Klone in 200 ml. Davon wurde 1 μl (= 108 Klone) in Phagemids überführt, die in einem Volumen von 3 ml vorlagen. Mit 5 μl Phaegemidsuspension (= 1,66 x 10 Klone) wurden Bakterienzellen transfiziert und aus diesen die entstandene Plasmid-DNA isoliert. Diese als Plasmid-cDNA-Expressionsbank bezeichnete Präparation hat eine DNA-Konzentration von 1 μg/μl.2. Creation of a cDNA expression gene bank from Limnanthes douglasii: To isolate cDNAs which code for l-acylglycerol-3-phosphate acyltransferases, Limnanthes douglasii created a cDNA expression gene bank in the phage vector Lambda-ZAP (Stratagene) . For this purpose, 2 μg mRNA were used, which, as described under point 1, were isolated from maturing embryos from Limanthes douglasii. The gene bank was created according to the manufacturer's instructions. The primary bank contains 3.7 x 10 ° independent clones in a volume of 500 μl. 1 x 10 ° clones (= 135 μl) of the primary bank were amplified according to the manufacturer's instructions. This amplified bank contains 2 × 10 13 clones in 200 ml. 1 μl (= 10 8 clones) of which was transferred into phagemids which were present in a volume of 3 ml. Bacterial cells were transfected with 5 μl of Phaegemids suspension (= 1.66 x 10 clones) and the plasmid DNA formed was isolated therefrom. This preparation, called the plasmid cDNA expression bank, has a DNA concentration of 1 μg / μl.
3. Heterologe Komplementation:3. Heterologous complementation:
Das Problem ist die Isolierung solcher Klone, die AGPAT kodierende cDNAs enthalten, aus der Masse der verschiedenen Klone, die andere cDNAs der Genbank enthalten. Hierzu wurde die Methode der heterologen Komplemen- tation gewählt. Bei der heterologen Komplementation wird auf Mutanten zurückgegriffen, die einen Defekt in dem Enzym aufweisen, dessen zugehö¬ rige cDNA gesucht wird. Die verwendeten Mutanten sind in der Regel kon¬ ditional. Es gibt also permissive Bedingungen, unter denen das Wachstum der Zellen möglich ist, und nicht-permissive Bedingungen, unter denen kein Wachstum stattfindet. Wird nun in eine solche Mutante eine ganze Genbank im Schrotschußverfahren transformiert und werden die transformierten Zel¬ len dann unter nicht-permissiven Bedingungen angezogen, dann kann es in einigen wenigen Fällen zum Wachstum kommen und zwar dann, wenn die eingeführte cDNA für eine AGPAT kodiert, diese cDNA hinreichend voll¬ ständig ist, die Klonierung in der richtigen Orientierung bezüglich des Expressionspromotors und im richtigen Leseraster erfolgte und daß hetero- loge, aus der Genbank also von einem fremdem Organismus stammende Pro¬ tein in den Bakterien hinreichend stabil ist und in den fremden Umge¬ bungsbedingungen enzymatisch aktiv ist. Derartige heterologe Komplemen- tationen sind bislang in einigen Fällen erfolgreich durchgeführt worden, wie in der Literatur belegt ist.The problem is the isolation of such clones containing AGPAT encoding cDNAs from the bulk of the various clones containing other gene bank cDNAs. The method of heterologous complemen- tation selected. In the heterologous complementation, mutants are used which have a defect in the enzyme whose associated cDNA is sought. The mutants used are generally conditional. So there are permissive conditions under which the growth of the cells is possible and non-permissive conditions under which no growth takes place. If an entire gene bank is now transformed into such a mutant using the shotgun method and the transformed cells are then grown under non-permissive conditions, growth can occur in a few cases, specifically when the cDNA introduced codes for an AGPAT, this cDNA is sufficiently complete, the cloning was carried out in the correct orientation with respect to the expression promoter and in the correct reading frame, and that heterologous protein from the gene bank, ie from a foreign organism, is sufficiently stable in the bacteria and in the foreign one Ambient conditions is enzymatically active. Such heterologous complementations have so far been successfully carried out in some cases, as is proven in the literature.
Im vorliegenden Fall wurde die Mutante JC201 eingesetzt. Diese Mutante besitzt einen Defekt in der AGPAT, der thermosensitiv ist. Bei 30 βC kön¬ nen die Zellen wachsen, bei 37 βC Anzuchttemperatur dagegen findet kein Wachstum statt, AGPAT-Aktivität ist in vitro nicht mehr nachweisbar, und es häuft sich l-Acylglycerin-3-phosphat in den Mutantenzellen an. Zellen dieser Mutante wurden nach der Methode von Inoue, H., Nojima, H., Okaya- ma, H. et al. (1990): High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23-86 in den Zustand der Kompetenz überführt, in dem sie Plasmid-DNA aufnehmen können. Für die heteroge Komplementation wurden jeweils 200 μl der kompetenten Mutantenzellen mit 100 ng Plasmid- DNA der Plasmid-cDNA-Expressionsgenbank von Limnanthes douglasii trans¬ formiert Cohen, S." N., chang, A.C.Y., Hsu, L. et al. 1972) Nonchraomosomal antibiotic resistance in bacteria: Genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sei. 69, 2110-2114 und unter selekti- ven Bedingungen auf 100 μg/ml Ampicillin haltigen LB-Platten bei 37 "C inkubiert. Es wurden 300 Klone isoliert, die bei 37 βC wachsen konnten. Aus diesen Klonen wurden die Plasmid-DNA isoliert. Diese DNA wurde dann einzeln in kompentente JC201 transformiert, und die transformierten Zellen wurden auf ihre Fähigkeit getestet, bei der nicht-permissiven Temperatur von 37 CC zu wachsen. Dieses war bei 130 Klonen der Fall. Die zu diesen 130 Klonen gehörende DNA wurde erneut in kompetente JC201 transformiert und die Selektion wiederholt. Nach diesem Schritt zeigten noch 27 Klone reproduzierbar die Fähigkeit, bei 37 °C zu wachsen. In einer weiteren Runde reduzierte sich die Zahl der positiven Klone auf 9. Diese Zahl blieb dann in drei weiteren Selektionsrunden stabil.In the present case, the mutant JC201 was used. This mutant has a defect in AGPAT that is thermosensitive. At 30 C kön¬ β NEN the cells are grown at 37 C culture temperature β, however, finds no growth, AGPAT activity is no longer detectable in vitro, and it accumulates l-acylglycerol-3-phosphate in the mutant cells. Cells of this mutant were analyzed using the method of Inoue, H., Nojima, H., Okayama, H. et al. (1990): High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23-86 transferred to the state of competence in which they can take up plasmid DNA. For the heterogeneous complementation, 200 μl each of the competent mutant cells were transformed with 100 ng plasmid DNA from the plasmid cDNA expression library from Limnanthes douglasii (Cohen, S. " N., chang, ACY, Hsu, L. et al. 1972) Nonchraomosomal antibiotic resistance in bacteria: Genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sci. 69, 2110-2114 and under selective conditions on LB plates containing 100 μg / ml ampicillin at 37 "C incubated. 300 clones were isolated which could grow at 37 β C. The plasmid DNA was isolated from these clones. This DNA was then individually transformed into competent JC201 and the transformed cells were tested for their ability to grow at the non-permissive temperature of 37 ° C. This was the case with 130 clones. The one to these DNA belonging to 130 clones was again transformed into competent JC201 and the selection was repeated. After this step, 27 clones reproducibly showed the ability to grow at 37 ° C. In another round, the number of positive clones was reduced to 9. This number remained stable in three further rounds of selection.
4. Analyse der cDNA der positiven Klone:4. Analysis of the positive clone cDNA:
Die aus den positiven Klonen isolierte Plasmid-DNA wurde mit Hilfe der Restriktionanalyse näher charakterisiert. Die Plasmid-DNA aus sechs der Klone (pCH21, ρCH147, pCH148, pCH149, pCH170 und pCH186), deren cDNA etwa 1 kbp lang ist, wurden aufgrund ähnlicher Restriktionsmuster in ein¬ er Gruppe zusammengefaßt und von den beiden Seiten her ansequenziert. Es erwies sich, daß die cDNAs identische Nukleotidsequenzen beeinhalten und sich lediglich in ihrer 5'- und 3'-Ausdehnung unterscheiden.The plasmid DNA isolated from the positive clones was characterized in more detail using the restriction analysis. The plasmid DNA from six of the clones (pCH21, ρCH147, pCH148, pCH149, pCH170 and pCH186), the cDNA of which is about 1 kbp long, were combined into one group on the basis of similar restriction patterns and sequenced from both sides. It was found that the cDNAs contain identical nucleotide sequences and differ only in their 5 'and 3' extent.
5. pCH21:5. pCH21:
Das cDNA-Insert von pCH21 wurde vollständig auf beiden Strängen sequen¬ ziert. Die Nukleotidsequenz ist in FIG. 1 dargestellt. Die enthaltene cDNA hat eine Länge von 1039 bp. In gleicher Orientierung wie der lacZ-Promoter findet sich ein langes, offenes Leseraster von 852 bp, daß sich in dersel¬ ben Phase wie LacZ' befindet und daher potentiell ein Fusionsprotein bil¬ det. Einschließlich des Stopkodons finden sich 279 Basenpaare im 3'-nicht- translatierten Bereich sowie ein PolyA-Bereich von 19 Nukleotiden. Die Nukleotidsequenz weist einen GC-Gehalt von 41,9% auf, der typisch für pflanzliche cDNAs ist. Die Translation eukaryoter mRNAs beginnt an dem am weitesten 5' gelegenen Startkodon (AUG = ATG in der cDNA). Legt man daß erste in der Sequenz von pCH21 vorkommende ATG zugrunde so ergibt sich aus der folgenden Sequenz ein potentielles Polypeptid von 281 Amino¬ säuren und einem Molekulargewicht von 27,5 kDa. Die Aminosäuresequenz ist in FIG. 2 im Einbuchstabencode dargestelltThe cDNA insert of pCH21 was completely sequenced on both strands. The nucleotide sequence is shown in FIG. 1 shown. The cDNA contained has a length of 1039 bp. In the same orientation as the lacZ promoter there is a long, open reading frame of 852 bp, which is in the same phase as LacZ 'and therefore potentially forms a fusion protein. Including the stop codon, there are 279 base pairs in the 3 'untranslated region and a polyA region of 19 nucleotides. The nucleotide sequence has a GC content of 41.9%, which is typical for plant cDNAs. The translation of eukaryotic mRNAs begins at the 5 'most distant start codon (AUG = ATG in the cDNA). Specifies that one first in the sequence of pCH21 occurring ATG based it is apparent from the following sequence a potential polypeptide of 281 amino acids ¬ and a molecular weight of 27.5 kDa. The amino acid sequence is shown in FIG. 2 shown in single letter code
6. Vollständigkeit des Leserasters:6. Completeness of the reading frame:
Auf Grund der Herstellung von cDNA-Klonen sind diese am 5'-Ende unvoll¬ ständige Kopien der zugehörigen mRNA, die in der Länge ihrer 5'-Enden variieren. Dieses ist auch für die sechs oben erwähnten cDNAs der Fall, die in ihrer Sequenz - wie bereits festgestellt wurde - identisch sind. Es ist also mit Sicherheit davon auszugehen, daß die cDNAs Kopien der mRNA eines Gens darstellen. Da also pCH21 nicht vollständig ist und auch vor dem ersten Startkodon bei Position 10 einen offenen Leserahmen aufweist, stellt sich die Frage, ob es weiter in 5'-Richtung ein weiteres Startkodon gibt, so daß die in FIG. 2 gezeigte Sequenz nicht die vollständige Sequenz die AGPAT darstellt. Die Sequenz von pCH148 und pCH149, die weiter in 5'- Richtung ausgedehnt ist, zeigt aber in dem zur Debatte stehenden Leserah¬ men in 5'-Richtung ein Stopkodon (FIG. 3). Damit ist der offene Leserahmen in 5'-Richtung begrenzt, und es ist mit Sicherheit davon auszugehen, daß das Startkodon bei Position 10 in pCH21 das Startkodon der AGPAT dar¬ stellt.Due to the production of cDNA clones are those at the 5 'end of incomplete ¬ permanent copies of the corresponding mRNA, which vary in the length of their 5' ends. This is also the case for the six cDNAs mentioned above, which - as already stated - are identical in their sequence. It can therefore be assumed with certainty that the cDNAs are copies of the mRNA of a gene. So since pCH21 is not complete and also before If the first start codon has an open reading frame at position 10, the question arises whether there is a further start codon further in the 5 ′ direction, so that the start codon shown in FIG. The sequence shown in Figure 2 is not the complete sequence that AGPAT represents. The sequence of pCH148 and pCH149, which is further extended in the 5 'direction, shows a stop codon in the 5' direction in the reading frame under discussion (FIG. 3). This limits the open reading frame in the 5 'direction, and it can be assumed with certainty that the start codon at position 10 in pCH21 represents the AGPAT start codon.
Beispiel B: Funktionale Expression der l-Acylglycerin-3-phosphat-Acyl- transferase von Limnanthes douglasii in E. coliExample B: Functional expression of the 1-acylglycerol-3-phosphate acyltransferase from Limnanthes douglasii in E. coli
Zum Nachweis, daß es sich beim cDNA-Insert von pCH21 um eine 1-Acylgly- cerin-3-phosphat-Acyltransferase, und zwar um eine Erucoyl-CoA-spezifi- sche, handelt, wurden funktionale Expressionsstudien in E. coli durchge¬ führt und die Acyl-CoA-Spezifitäten des Expressionsproduktes analysiert.To demonstrate that the cDNA insert of pCH21 is a 1-acylglycerol-3-phosphate acyltransferase, namely an erucoyl-CoA-specific, functional expression studies were carried out in E. coli and analyzed the acyl-CoA specificities of the expression product.
1. Konstruktion des Expressionsplasmids pQEL21:1. Construction of the expression plasmid pQEL21:
Mit Hilfe der Polymerasekettenreaktion (PCR) wurde das cDNA-Insert von pCH21 (FIG. 1) amplifiziert. Als Oligonukleotidprimer dienten die folgenden beiden Primer A und B, die an ihren 5'-Enden Restriktionsschnittstellen für Nco I und Bgl II tragen.The cDNA insert of pCH21 (FIG. 1) was amplified using the polymerase chain reaction (PCR). The following two primers A and B, which carry restriction sites for Nco I and Bgl II at their 5 'ends, served as oligonucleotide primers.
Primer A 5' AAGATCTATTTGAGCGATTTGTGC 3' Tm = 66 βCPrimer A 5 'AAGATCTATTTGAGCGATTTGTGC 3' T m = 66 β C
Primer B 5' ACCATGGCCAAAACTAGAACTAGC 3' Tm = 70 °CPrimer B 5 'ACCATGGCCAAAACTAGAACTAGC 3' T m = 70 ° C
Für einen 100 μl PCR-Ansatz wurden 10 ng pCH21, die Primer A und B in 1 μM Konzentration, 5 Units Taq-DNA-Polymerase (Gibco) und 100 μM dNTPs in einem Puffermilieu von 25 mM TAPS (pH 9,3), 2 mM MgCl2, 50 mM KC1, 1 mM DTT, 0,5 mg/ml aktivierte Lachssperm-DNA eingesetzt. Die PCR-Reaktion wurde in einem Thermocycler (Biometra) bei folgenden Reaktionstemperatu¬ ren und -Zeiten durchgeführt: 2 min, 95 "C zum erstmaligen Denaturieren der DNA, gefolgt von 27 Zyklen mit jeweils 20 s 95 βC zum Denaturieren der DNA, 20 s 65 βC zur Hybridisierung der Primer und 1 min, 72 °C zur Amplifikation der DNA. Anschließend wurden alle DNA-Moleküle 3 min bei 72 βC vollständig amplifiziert. Das 852 bp große Amplifikationsprodukt wurde über Agarosegelelektrophorese (Sambrook et al. 1989) von Primern und Nebenprodukten abgetrennt, mit Hilfe des QIAEX-Gelelutionskits (QIA- GEN) nach Firmenvorschrift aus dem Gel eluiert und unter Verwendung des SUREclonekits (Pharmacia), wie durch den Hersteller angegeben, in den mit Sma I linearisierten, dephosphorylierten Vektor pUC19 ligiert. Das so er¬ haltene Plasmid pUCL21 wurde durch Restriktions- und Sequenzanalyse überprüft. Anschließend wurden 10 μg des Plasmids mit Nco I und Bgl II verdaut, daß das cDNA-Insert tragende Nco I/Bgl II-Fragment, wie oben beschrieben, durch Agarosegelelektrophorese isoliert und in den mit Nco I und Bgl II linearisierten Vektor pQE60 (QIAGEN) ligiert, um daß Konstrukt PQEL21 zu erhalten. pQEL21 bzw. der Vektor pQE60 wurden in kompetente Zellen der E. coli-Mutante JC201, die daß den lac i'l-Repressor tragende Plasmid pREP4 (QIAGEN) enthielten, transformiert.For a 100 μl PCR batch, 10 ng pCH21, the primers A and B in 1 μM concentration, 5 units Taq DNA polymerase (Gibco) and 100 μM dNTPs in a buffer medium of 25 mM TAPS (pH 9.3), 2 mM MgCl 2 , 50 mM KC1, 1 mM DTT, 0.5 mg / ml activated salmon sperm DNA was used. The PCR reaction was carried out in a thermal cycler (Biometra) at the following reaction temperatures and times: 2 min, 95 ° C. for the first time denaturing the DNA, followed by 27 cycles with 20 s each 95 ° C. for denaturing the DNA, 20 s 65 β C for hybridization of the primers and 1 min, 72 ° C for amplification of the DNA, then all DNA molecules were completely amplified for 3 min at 72 β C. The 852 bp amplification product was obtained by agarose gel electrophoresis (Sambrook et al. 1989) of primers and by-products were separated, eluted from the gel using the QIAEX gel elution kit (QIA-GEN) according to the company's instructions and ligated into the dephosphorylated vector pUC19 linearized with Sma I using the SUREclone kit (Pharmacia) as indicated by the manufacturer. The plasmid pUCL21 obtained in this way was checked by restriction and sequence analysis. 10 μg of the plasmid were then digested with Nco I and Bgl II, and the Nco I / Bgl II fragment carrying the cDNA insert was isolated by agarose gel electrophoresis as described above and converted into the vector pQE60 (QIAGEN) linearized with Nco I and Bgl II. ligated to obtain construct PQEL21. pQEL21 and the vector pQE60 were transformed into competent cells of the E. coli mutant JC201 which contained the plasmid pREP4 (QIAGEN) carrying the lac i'l repressor.
2. Anzucht der transgenen E. coli-JC201-Zellen:2. Cultivation of the transgenic E. coli JC201 cells:
Die Anzucht der E. coli-JC201-Zellen, die neben dem Repressorplasmid auch das Konstrukt pQEL21 bzw. den Vektor pQE60 enthielten, erfolgte in Ampi- cillin (100 μg/1) und Kanamycin (25 μg/1) haltigem LB-Medium bei 30 °C. Übernachtkulturen wurden in diesem Medium 1:40 verdünnt und bei 30 βC bis zu einer OD600 von 0,6 angezogen. Zur Induktion des Expressionskon- struktes pQEL21 wurde Isopropyl-ß-D-Thiogalaktopyranosid (IPTG) in einer Endkonzentration von 2 mM hinzugefügt und die Bakterien nach einer drei¬ stündigen Inkubation bei 30 βC durch Zentrifugation bei 4500 x g für 10 min geerntet.The E. coli JC201 cells, which in addition to the repressor plasmid also contained the construct pQEL21 or the vector pQE60, were grown in LB medium containing ampicillin (100 μg / 1) and kanamycin (25 μg / 1) 30 ° C. Overnight cultures were diluted 1:40 in this medium and grown at 30 β C to an OD 600 of 0.6. For induction of Expressionskon- struktes pQEL21 Isopropyl ß-D-thiogalactopyranoside-(IPTG) was added to a final concentration of 2 mM and the bacteria after a drei¬ hour incubation at 30 C β by centrifugation at 4500 xg for 10 min harvested.
3. Membranisolierung aus transgenen E. coli-JC201-Zellen:3. Membrane isolation from transgenic E. coli JC201 cells:
Alle folgenden Schritte wurden bei 0-4 °C durchgeführt: Durch Sedimenta¬ tion geerntete Bakterienzellen wurden zweimal mit Membranpuffer (50 mM Tris/HCl pH 8,4, 5 mM MgCl2 5 mM Dithiotreitol) gewaschen und in diesem Puffer so resuspendiert, daß das Volumen der Suspension etwa 1/40 des Kulturvolumens entsprach. Das Lysieren der Bakterienzellen erfolgte durch viermalige Ultraschallbehandlung für 30 s mit Hilfe eines Ultraschallsta¬ bes. Nach Abtrennung großer Zellfragmente und "inclusion bodies" durch lOminütige Zentrifugation bei 7500 x g, wurden die Membranen aus den Zellhomogenaten durch Zentrifugation bei 10000 x g für 1 h sedimentiert, in wenig Membranpuffer resuspendiert und mit Glycerin in einer Endkon¬ zentration von 50% (v/v) bei -20 βC gelagert. Die Proteinbestimmung erfolg¬ te nach der Methode von Bradford (Anal. Biochem. 72, 248-254 (1987)). 4. Enzymtest zur Bestimmung der l-Acylglycerin-3-phosphat-Acyltransfera- seaktivität:All of the following steps were carried out at 0-4 ° C.: Bacterial cells harvested by sedimentation were washed twice with membrane buffer (50 mM Tris / HCl pH 8.4, 5 mM MgCl2 5 mM dithiotreitol) and resuspended in this buffer so that the Volume of the suspension corresponded to about 1/40 of the culture volume. The bacterial cells were lysed by four ultrasound treatments for 30 s using an ultrasound probe. After separating large cell fragments and "inclusion bodies" by centrifugation at 7500 xg for 10 minutes, the membranes were sedimented from the cell homogenates by centrifugation at 10,000 xg for 1 h. resuspended in membrane buffer and little with glycerin in an Endkon¬ concentration of 50% (v / v) stored at -20 C β. The protein was determined using the Bradford method (Anal. Biochem. 72, 248-254 (1987)). 4. Enzyme test for determining the l-acylglycerol-3-phosphate-acyltransferase activity:
Der Enzymtest basiert auf der enzymatischen Umsetzung von l-Acyl-sn-[U- 1 C]glycerin-3-phosphat mit Acyl-CoA zu l,2-Diacyl-sn-[U-14C]glycerin-3- phosphat. Das Reaktionsgemisch enthielt 0J M Tricin/NaOH pH 8,8, 4 bis 40 μM Oleoyl-CoA bzw. Erucoyl-CoA, 2,5 μM 1-Oleoyl-sn- [U-1 C]glycerin-3- phosphat (353 dpm/pmol) und Membranfraktionen (0,2-3,5 μg Protein) in ein¬ em Gesamtvolumen von 50 μl. Nach einer 15minütigen Inkubation bei 30 °C wurde der Ansatz mit 50 μg Phosphatidsäure in 240 μl Chloroform:Methanol (1:1) und 100 μl 1 M KC1, 0,2 M H3P04 versetzt, gemischt und zur Phasen¬ trennung 2 min bei 1000 x g zentrifugiert, 90 μl der Chloroformphase auf Kieselgelfertigplatten aufgetragen und in Chloroform:Pyridin:Ameisensäure (50:30:7) 30 min entwickelt. Die Phosphatidsäurebande wurde durch Besprü¬ hen der entwickelten Kieselgelfertigplatte mit Phosphatidreagenz (Dittmer & Lester, J. Lipid Res. 5, 126-127 (1964)) lokalisiert, in ein Szintillations- röhrchen geschabt und mit 5 ml Cocktail (OptiPhase 4HISAFE4, Wallec) ver¬ setzt. Die Radioaktivität der Probe wurde im Szintillationszähler bestimmt.The enzyme test is based on the enzymatic conversion of l-acyl-sn- [U- 1 C] glycerol-3-phosphate with acyl-CoA to 1,2-diacyl-sn- [U- 14 C] glycerol-3-phosphate. The reaction mixture contained 0JM tricin / NaOH pH 8.8, 4 to 40 μM oleoyl-CoA or erucoyl-CoA, 2.5 μM 1-oleoyl-sn- [U- 1 C] glycerol-3-phosphate (353 dpm / pmol) and membrane fractions (0.2-3.5 μg protein) in a total volume of 50 μl. After a 15-minute incubation at 30 ° C., the mixture was mixed with 50 μg phosphatidic acid in 240 μl chloroform: methanol (1: 1) and 100 μl 1 M KC1, 0.2 MH 3 PO 4 , mixed and 2 min for phase separation Centrifuged at 1000 xg, 90 μl of the chloroform phase applied to silica gel ready plates and developed in chloroform: pyridine: formic acid (50: 30: 7) for 30 min. The phosphatidic acid band was localized by spraying the developed finished silica gel plate with phosphatide reagent (Dittmer & Lester, J. Lipid Res. 5, 126-127 (1964)), scraped into a scintillation tube and with 5 ml of cocktail (OptiPhase 4HISAFE4, Wallec) offset. The radioactivity of the sample was determined in the scintillation counter.
Aus diesen Werten wurden die spezifischen Enzymaktivitäten als pmol ge¬ bildetes l,2-Diacylglycerin-3-phosphat pro min und mg Membranprotein be¬ rechnet. Bei Enzymtests mit Membranfraktionen aus pQE60-haltigen JC201- Zellen war weder mit Oleoyl-CoA noch mit Erucoyl-CoA eine Umsetzung von l-Acyl-sn-[U- C]glycerin-3-phosphat zu l,2-Diacyl-sn-[U- C]glycerin-3- phosphat nachweisbar. Die Membranfraktionen aus pQEL21-haltigen JC201- Zellen katalysierten dagegen diese Umsetzung und zeigten mit Erucoyl-CoA höhere spezifische Enzymaktivität als mit Oleoyl-CoA (200 pmol/min/mg Pro¬ tein mit Erucoyl-CoA und 84 pmol/min/mg Protein mit Oleoyl-CoA). Diese Ergebnisse belegen somit, daß das cDNA-Insert von pCH21 für eine Erucoyl- CoA spezifische l-Acylglycerin-3-phosphat-Acyltransferase kodiert also für die Acyltransferase, die in Limnanthes samenspezifisch exprimiert wird. Diese Ergebnisse werden durch Northern-Blot-Analysen gestützt (FIG. 5). Sie zeigen, daß das zu ρCH21 zugehörige Gen in Samen aber nicht in Blät¬ tern transkribiert wird. SEQUENZPROTOKOLLFrom these values, the specific enzyme activities were calculated as pmol-formed 1,2-diacylglycerol-3-phosphate per min and mg membrane protein. In enzyme tests with membrane fractions from pQE60-containing JC201 cells, there was no conversion of l-acyl-sn- [U- C] glycerol-3-phosphate to 1,2-diacyl-sn- either with oleoyl-CoA or with erucoyl-CoA Detectable [U- C] glycerol-3-phosphate. In contrast, the membrane fractions from pQEL21-containing JC201 cells catalyzed this conversion and showed higher specific enzyme activity with erucoyl-CoA than with oleoyl-CoA (200 pmol / min / mg protein with erucoyl-CoA and 84 pmol / min / mg protein) Oleoyl-CoA). These results thus demonstrate that the cDNA insert of pCH21 for an erucoyl-CoA specific 1-acylglycerol-3-phosphate acyltransferase codes for the acyltransferase, which is expressed in Limnanthes in a seed-specific manner. These results are supported by Northern blot analyzes (FIG. 5). They show that the gene belonging to ρCH21 is transcribed in seeds but not in leaves. SEQUENCE LOG
( 1 ) ALLGEMEINE ANGABEN :( 1. GENERAL INFORMATION :
(1) ANMELDER:(1) LOGIN:
(A) NAME: Norddeutsche Pflanzenzucht Hans-Georg Lembke(A) NAME: Hans-Georg Lembke North German Plant Breeding
KGKG
(B) STRASSE: Hohenlieth(B) ROAD: Hohenlieth
(C) ORT: Holtsee(C) LOCATION: Holtsee
(E) LAND: Deutschland(E) COUNTRY: Germany
(F) POSTLEITZAHL: 24363(F) POSTAL NUMBER: 24363
(A) NAME: Deutsche SaatVeredelung Lippstadt-Bremen GmbH(A) NAME: Deutsche SaatVeredelung Lippstadt-Bremen GmbH
(B) STRASSE: Weissenburger Str. 5(B) STREET: Weissenburger Str. 5
(C) ORT: Lippstadt(C) LOCATION: Lippstadt
(E) LAND: Deutschland(E) COUNTRY: Germany
(F) POSTLEITZAHL: 59524(F) POSTAL NUMBER: 59524
(A) NAME: KWS Klein anzlebener Saatzucht AG, vorm.(A) NAME: KWS Klein anzlebener Saatzucht AG, formerly
Rabbethge und GeiseckeRabbethge and Geisecke
(B) STRASSE: Gri sehlstr. 31(B) STREET: Gri sehlstr. 31
(C) ORT: Einbeck(C) LOCATION: Einbeck
(E) LAND: Deutschland(E) COUNTRY: Germany
(F) POSTLEITZAHL: 37574(F) POSTAL NUMBER: 37574
(ii) BEZEICHNUNG DER ERFINDUNG: Nukleinsaeurefragment und daraus abgeleitete Produkte(ii) NAME OF THE INVENTION: Nucleic acid fragment and products derived therefrom
(iii) ANZAHL DER SEQUENZEN: 10(iii) NUMBER OF SEQUENCES: 10
(iv) COMPUTER-LESBARE FASSUNG:(iv) COMPUTER READABLE VERSION:
(A) DATENTRÄGER: Floppy disk(A) DISK: Floppy disk
(B) COMPUTER: IBM PC compatible(B) COMPUTER: IBM PC compatible
(C) BETRIEBSSYSTEM: PC-DOS/MS-DOS(C) OPERATING SYSTEM: PC-DOS / MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.30 (EPA)(D) SOFTWARE: Patentin Release # 1.0, Version # 1.30 (EPA)
(2) ANGABEN ZU SEQ ID NO: 1:(2) INFORMATION ON SEQ ID NO: 1:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 1039 Basenpaare(A) LENGTH: 1039 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: DoppelStrang(C) STRAND SHAPE: Double strand
(D) TOPOLOGIE: nicht bekannt(D) TOPOLOGY: not known
(ii) ART DES MOLEKÜLS: CDNA(ii) MOLECULE TYPE: CDNA
(ix) MERKMAL:(ix) FEATURE:
(A) NAME/SCHLÜSSEL: CDS(A) NAME / KEY: CDS
(B) LAGE:10..852(B) LOCATION: 10..852
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 1:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GTTCTATTC ATG GCC AAA ACT AGA ACT AGC TCT CTC CGC AAC AGG AGA 48GTTCTATTC ATG GCC AAA ACT AGA ACT AGC TCT CTC CGC AAC AGG AGA 48
Met Ala Lys Thr Arg Thr Ser Ser Leu Arg Asn Arg Arg 1 5 10Met Ala Lys Thr Arg Thr Ser Ser Leu Arg Asn Arg Arg 1 5 10
CAA CTA AAG CCG GCT GTA GCT GCT ACT GCT GAT GAT GAT AAA GAT GGG 96 Gin Leu Lys Pro Ala Val Ala Ala Thr Ala Asp Asp Asp Lys Asp Gly 15 20 25 GTT TTT ATG GTA TTG CTA TCG TGT TTT AAA ATT TTT GTT T.GC TTT GCC 144 Val Phe Met Val Leu Leu Ser Cys Phe Lys Ile Phe Val Cys Phe Ala 30 35 40 45CAA CTA AAG CCG GCT GTA GCT GCT ACT GCT GAT GAT GAT AAA GAT GGG 96 Gin Leu Lys Pro Ala Val Ala Ala Thr Ala Asp Asp Asp Lys Asp Gly 15 20 25 GTT TTT ATG GTA TTG CTA TCG TGT TTT AAA ATT TTT GTT T.GC TTT GCC 144 Val Phe Met Val Leu Leu Ser Cys Phe Lys Ile Phe Val Cys Phe Ala 30 35 40 45
ATA GTG TTG ATC ACC GCG GTG GCA TGG GGA CTA ATC ATG GTC TTG CTC 192 Ile Val Leu Ile Thr Ala Val Ala Trp Gly Leu Ile Met Val Leu Leu 50 55 60ATA GTG TTG ATC ACC GCG GTG GCA TGG GGA CTA ATC ATG GTC TTG CTC 192 Ile Val Leu Ile Thr Ala Val Ala Trp Gly Leu Ile Met Val Leu Leu 50 55 60
TTA CCT TGG CCT TAT ATG AGG ATT CGA CTA GGA AAT CTA TAC GGC CAT 240 Leu Pro Trp Pro Tyr Met Arg Ile Arg Leu Gly Asn Leu Tyr Gly His 65 70 75TTA CCT TGG CCT TAT ATG AGG ATT CGA CTA GGA AAT CTA TAC GGC CAT 240 Leu Pro Trp Pro Tyr Met Arg Ile Arg Leu Gly Asn Leu Tyr Gly His 65 70 75
ATC ATT GGT GGA TTA GTG ATA TGG ATT TAC GGA ATA CCA ATA AAG ATC 288 Ile Ile Gly Gly Leu Val Ile Trp Ile Tyr Gly Ile Pro Ile Lys Ile 80 85 90ATC ATT GGT GGA TTA GTG ATA TGG ATT TAC GGA ATA CCA ATA AAG ATC 288 Ile Ile Gly Gly Leu Val Ile Trp Ile Tyr Gly Ile Pro Ile Lys Ile 80 85 90
CAA GGA TCC GAG CAT ACA AAG AAG AGG GCC ATT TAT ATA AGC AAT CAT 336 Gin Gly Ser Glu His Thr Lys Lys Arg Ala Ile Tyr Ile Ser Asn His 95 100 105CAA GGA TCC GAG CAT ACA AAG AAG AGG GCC ATT TAT ATA AGC AAT CAT 336 Gin Gly Ser Glu His Thr Lys Lys Arg Ala Ile Tyr Ile Ser Asn His 95 100 105
GCA TCT CCT ATC GAT GCT TTC TTT GTT ATG TGG TTG GCT CCC ATA GGC 384 Ala Ser Pro Ile Asp Ala Phe Phe Val Met Trp Leu Ala Pro Ile Gly 110 115 120 125GCA TCT CCT ATC GAT GCT TTC TTT GTT ATG TGG TTG GCT CCC ATA GGC 384 Ala Ser Pro Ile Asp Ala Phe Phe Val Met Trp Leu Ala Pro Ile Gly 110 115 120 125
ACA GTT GGT GTT GCA AAG AAA GAG GTT ATA TGG TAT CCG CTG CTT GGA 432 Thr Val Gly Val Ala Lys Lys Glu Val Ile Trp Tyr Pro Leu Leu Gly 130 135 140ACA GTT GGT GTT GCA AAG AAA GAG GTT ATA TGG TAT CCG CTG CTT GGA 432 Thr Val Gly Val Ala Lys Lys Glu Val Ile Trp Tyr Pro Leu Leu Gly 130 135 140
CAA CTA TAT ACA TTA GCC CAT CAT ATT CGC ATA GAT CGG TCA AAC CCG 480 Gin Leu Tyr Thr Leu Ala His His Ile Arg Ile Asp Arg Ser Asn Pro 145 150 155CAA CTA TAT ACA TTA GCC CAT CAT ATT CGC ATA GAT CGG TCA AAC CCG 480 Gin Leu Tyr Thr Leu Ala His His Ile Arg Ile Asp Arg Ser Asn Pro 145 150 155
GCT GCG GCT ATT CAG TCT ATG AAA GAG GCA GTT CGT GTA ATA ACC GAA 528 Ala Ala Ala Ile Gin Ser Met Lys Glu Ala Val Arg Val Ile Thr Glu 160 165 170GCT GCG GCT ATT CAG TCT ATG AAA GAG GCA GTT CGT GTA ATA ACC GAA 528 Ala Ala Ala Ile Gin Ser Met Lys Glu Ala Val Arg Val Ile Thr Glu 160 165 170
AAG AAT CTC TCT CTG ATT ATG TTT CCA GAG GGA ACC AGG TCG AGA GAT 576 Lys Asn Leu Ser Leu Ile Met Phe Pro Glu Gly Thr Arg Ser Arg Asp 175 180 185AAG AAT CTC TCT CTG ATT ATG TTT CCA GAG GGA ACC AGG TCG AGA GAT 576 Lys Asn Leu Ser Leu Ile Met Phe Pro Glu Gly Thr Arg Ser Arg Asp 175 180 185
GGG CGT TTA CTT CCT TTC AAG AAG GGT TTT GTT CAT CTA GCA CTT CAG 624 Gly Arg Leu Leu Pro Phe Lys Lys Gly Phe Val His Leu Ala Leu Gin 190 195 200 205GGG CGT TTA CTT CCT TTC AAG AAG GGT TTT GTT CAT CTA GCA CTT CAG 624 Gly Arg Leu Leu Pro Phe Lys Lys Gly Phe Val His Leu Ala Leu Gin 190 195 200 205
TCA CAT CTC CCA ATA GTT CCG ATG ATC CTT ACA GGT ACA CAT TTA GCA 672 Ser His Leu Pro Ile Val Pro Met Ile Leu Thr Gly Thr His Leu Ala 210 215 220TCA CAT CTC CCA ATA GTT CCG ATG ATC CTT ACA GGT ACA CAT TTA GCA 672 Ser His Leu Pro Ile Val Pro Met Ile Leu Thr Gly Thr His Leu Ala 210 215 220
TGG AGG AAA GGT ACC TTC CGT GTC CGG CCA GTA CCC ATC ACT GTC AAG 720 Trp Arg Lys Gly Thr Phe Arg Val Arg Pro Val Pro Ile Thr Val Lys 225 230 235TGG AGG AAA GGT ACC TTC CGT GTC CGG CCA GTA CCC ATC ACT GTC AAG 720 Trp Arg Lys Gly Thr Phe Arg Val Arg Pro Val Pro Ile Thr Val Lys 225 230 235
TAC CTT CCT CCT ATA AAC ACT GAT GAT TGG ACT GTT GAC AAA ATC GAC 768 Tyr Leu Pro Pro Ile Asn Thr Asp Asp Trp Thr Val Asp Lys Ile Asp 240 245 250TAC CTT CCT CCT ATA AAC ACT GAT GAT TGG ACT GTT GAC AAA ATC GAC 768 Tyr Leu Pro Pro Ile Asn Thr Asp Asp Trp Thr Val Asp Lys Ile Asp 240 245 250
GAT TAC GTC AAA ATG ATA CAC GAC GTC TAT GTC CGC AAC CTA CCT GCG 816 Asp Tyr Val Lys Met Ile His Asp Val Tyr Val Arg Asn Leu Pro Ala 255 260 265GAT TAC GTC AAA ATG ATA CAC GAC GTC TAT GTC CGC AAC CTA CCT GCG 816 Asp Tyr Val Lys Met Ile His Asp Val Tyr Val Arg Asn Leu Pro Ala 255 260 265
TCT CAA AAA CCA CTT GGT AGC ACA AAT CGC TCA AAT TGAGTCCCTC 862TCT CAA AAA CCA CTT GGT AGC ACA AAT CGC TCA AAT TGAGTCCCTC 862
Ser Gin Lys Pro Leu Gly Ser Thr Asn Arg Ser Asn 270 275 280 TTTGCTCTAA GGTTAGCAGA ATGGATACGT ACTGTTGTCT TGCTGCATGA AAAGTTTAAT 922 CCTTTCTTAT GATATTAGAT TACAGCGTAA GACTTTCATG TTAAAATAGT GTAACAGTGC 982 TTCTGGTTTG TAACTTTTAC AATAAAAGTA TGCTTTTGAA AAAAAAAAAA AAAAAAA 1039Ser Gin Lys Pro Leu Gly Ser Thr Asn Arg Ser Asn 270 275 280 TTTGCTCTAA GGTTAGCAGA ATGGATACGT ACTGTTGTCT TGCTGCATGA AAAGTTTAAT 922 CCTTTCTTAT GATATTAGAT TACAGCGTAA GACTTTCATG TTAAAATAGT GTAACAGTGC 982 TTCTGGTTTAA TAACTAAAGAAAA
(2) ANGABEN ZU SEQ ID NO: 2:(2) INFORMATION ON SEQ ID NO: 2:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 281 Aminosäuren(A) LENGTH: 281 amino acids
(B) ART: Aminosäure (D) TOPOLOGIE: linear(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: Protein(ii) MOLECULE TYPE: Protein
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 2:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Ala Lys Thr Arg Thr Ser Ser Leu Arg Asn Arg Arg Gin Leu Lys 1 5 10 15Met Ala Lys Thr Arg Thr Ser Ser Leu Arg Asn Arg Arg Gin Leu Lys 1 5 10 15
Pro Ala Val Ala Ala Thr Ala Asp Asp Asp Lys Asp Gly Val Phe Met 20 25 30Pro Ala Val Ala Ala Thr Ala Asp Asp Asp Lys Asp Gly Val Phe Met 20 25 30
Val Leu Leu Ser Cys Phe Lys Ile Phe Val Cys Phe Ala Ile Val Leu 35 40 45Val Leu Leu Ser Cys Phe Lys Ile Phe Val Cys Phe Ala Ile Val Leu 35 40 45
Ile Thr Ala Val Ala Trp Gly Leu Ile Met Val Leu Leu Leu Pro Trp 50 55 60Ile Thr Ala Val Ala Trp Gly Leu Ile Met Val Leu Leu Leu Pro Trp 50 55 60
Pro Tyr Met Arg Ile Arg Leu Gly Asn Leu Tyr Gly His Ile Ile Gly 65 70 75 80Pro Tyr Met Arg Ile Arg Leu Gly Asn Leu Tyr Gly His Ile Ile Gly 65 70 75 80
Gly Leu Val Ile Trp Ile Tyr Gly Ile Pro Ile Lys Ile Gin Gly SerGly Leu Val Ile Trp Ile Tyr Gly Ile Pro Ile Lys Ile Gin Gly Ser
85 90 9585 90 95
Glu His Thr Lys Lys Arg Ala Ile Tyr Ile Ser Asn His Ala Ser Pro 100 105 110Glu His Thr Lys Lys Arg Ala Ile Tyr Ile Ser Asn His Ala Ser Pro 100 105 110
Ile Asp Ala Phe Phe Val Met Trp Leu Ala Pro Ile Gly Thr Val Gly 115 120 125Ile Asp Ala Phe Phe Val Met Trp Leu Ala Pro Ile Gly Thr Val Gly 115 120 125
Val Ala Lys Lys Glu Val Ile Trp Tyr Pro Leu Leu Gly Gin Leu Tyr 130 135 140Val Ala Lys Lys Glu Val Ile Trp Tyr Pro Leu Leu Gly Gin Leu Tyr 130 135 140
Thr Leu Ala His His Ile Arg Ile Asp Arg Ser Asn Pro Ala Ala Ala 145 150 155 160Thr Leu Ala His His Ile Arg Ile Asp Arg Ser Asn Pro Ala Ala Ala 145 150 155 160
Ile Gin Ser Met Lys Glu Ala Val Arg Val Ile Thr Glu Lys Asn Leu 165 170 175Ile Gin Ser Met Lys Glu Ala Val Arg Val Ile Thr Glu Lys Asn Leu 165 170 175
Ser Leu Ile Met Phe Pro Glu Gly Thr Arg Ser Arg Asp Gly Arg Leu 180 185 190Ser Leu Ile Met Phe Pro Glu Gly Thr Arg Ser Arg Asp Gly Arg Leu 180 185 190
Leu Pro Phe Lys Lys Gly Phe Val His Leu Ala Leu Gin Ser His Leu 195 200 205Leu Pro Phe Lys Lys Gly Phe Val His Leu Ala Leu Gin Ser His Leu 195 200 205
Pro Ile Val Pro Met Ile Leu Thr Gly Thr His Leu Ala Trp Arg Lys 210 215 220Pro Ile Val Pro Met Ile Leu Thr Gly Thr His Leu Ala Trp Arg Lys 210 215 220
Gly Thr Phe Arg Val Arg Pro Val Pro Ile Thr Val Lys Tyr Leu Pro 225 230 235 240Gly Thr Phe Arg Val Arg Pro Val Pro Ile Thr Val Lys Tyr Leu Pro 225 230 235 240
Pro Ile Asn Thr Asp Asp Trp Thr Val Asp Lys Ile Asp Asp Tyr Val 245 250 255 Lys Met Ile His Asp Val Tyr Val Arg Asn Leu Pro Ala Ser Gin Lys 260 265 270Pro Ile Asn Thr Asp Asp Trp Thr Val Asp Lys Ile Asp Asp Tyr Val 245 250 255 Lys Met Ile His Asp Val Tyr Val Arg Asn Leu Pro Ala Ser Gin Lys 260 265 270
Pro Leu Gly Ser Thr Asn Arg Ser Asn 275 280Pro Leu Gly Ser Thr Asn Arg Ser Asn 275 280
(2) ANGABEN ZU SEQ ID NO: 3:(2) INFORMATION ON SEQ ID NO: 3:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 255 Basenpaare(A) LENGTH: 255 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: Doppelsträng(C) STRAND SHAPE: double strand
(D) TOPOLOGIE: nicht bekannt(D) TOPOLOGY: not known
(ii) ART DES MOLEKÜLS: cDNA(ii) MOLECULE TYPE: cDNA
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 3:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
GTTCTATTCA TGGCCAAAAC TAGAACTAGC TCTCTCCGCA ACAGGAGACA ACTAAAGCCG 60GTTCTATTCA TGGCCAAAAC TAGAACTAGC TCTCTCCGCA ACAGGAGACA ACTAAAGCCG 60
GCTGTAGCTG CTACTGCTGA TGATGATAAA GATGGGGTTT TTATGGTATT GCTATCGTGT 120GCTGTAGCTG CTACTGCTGA TGATGATAAA GATGGGGTTT TTATGGTATT GCTATCGTGT 120
TTTAAAATTT TTGTTTGCTT TGCCATAGTG TTGATCACCG CGGTGGCATG GGGACTAATC 180TTTAAAATTT TTGTTTGCTT TGCCATAGTG TTGATCACCG CGGTGGCATG GGGACTAATC 180
ATGGTCTTGC TCTTACCTTG GCCTTATATG AGGATTCGAC TAGGAAATCT ATACGGCCAT 240ATGGTCTTGC TCTTACCTTG GCCTTATATG AGGATTCGAC TAGGAAATCT ATACGGCCAT 240
ATCATTGGTG GATTA 255 (2) ANGABEN ZU SEQ ID NO: 4:ATCATTGGTG GATTA 255 (2) INFORMATION ABOUT SEQ ID NO: 4:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 300 Basenpaare(A) LENGTH: 300 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: DoppelStrang(C) STRAND SHAPE: Double strand
(D) TOPOLOGIE: nicht bekannt(D) TOPOLOGY: not known
(ii) ART DES MOLEKÜLS: cDNA(ii) MOLECULE TYPE: cDNA
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 4:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
CTAAATCTCT CTTACTGAAT TTTAGGTCAA ACAATCTCAT AGCCGGTTCT ATTCATGGCC 60CTAAATCTCT CTTACTGAAT TTTAGGTCAA ACAATCTCAT AGCCGGTTCT ATTCATGGCC 60
AAAACTAGAA CTAGCTCTCT CCGCAACAGG AGACAACTAA AGCCGGCTGT AGCTGCTACT 120AAAACTAGAA CTAGCTCTCT CCGCAACAGG AGACAACTAA AGCCGGCTGT AGCTGCTACT 120
GCTGATGATG ATAAAGATGG GGTTTTTATG GTATTGCTAT CGTGTTTTAA AATTTTTGTT 180GCTGATGATG ATAAAGATGG GGTTTTTATG GTATTGCTAT CGTGTTTTAA AATTTTTGTT 180
TGCTTTGCCA TAGTGTTGAT CACCGCGGTG GCATGGGGAC TAATCATGGT CTTGCTCTTA 240TGCTTTGCCA TAGTGTTGAT CACCGCGGTG GCATGGGGAC TAATCATGGT CTTGCTCTTA 240
CCTTGGCCTT ATATGAGGAT TCGACTAGGA AATCTATACG GCCATATCAT TGGTGGATTA 300CCTTGGCCTT ATATGAGGAT TCGACTAGGA AATCTATACG GCCATATCAT TGGTGGATTA 300
(2) ANGABEN ZU SEQ ID NO: 5:(2) INFORMATION ON SEQ ID NO: 5:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 146 Aminosäuren(A) LENGTH: 146 amino acids
(B) ART: Aminosäure(B) TYPE: amino acid
(C) STRANGFORM: nicht bekannt(C) STRANDFORM: not known
(D) TOPOLOGIE: nicht bekannt (ii) ART DES MOLEKÜLS: Protein(D) TOPOLOGY: not known (ii) MOLECULE TYPE: Protein
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 5:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
Val Lys Val Gin Leu His Ala Asp Glu Glu Thr Tyr Arg Ser Met Gly 1 5 10 15Val Lys Val Gin Leu His Ala Asp Glu Glu Thr Tyr Arg Ser Met Gly 1 5 10 15
Lys Glu His Ala Leu Ile Ile Ser Asn His Arg Ser Asp Ile Asp Trp 20 25 30Lys Glu His Ala Leu Ile Ile Ser Asn His Arg Ser Asp Ile Asp Trp 20 25 30
Leu Ile Gly Trp Ile Leu Ala Gin Arg Ser Gly Cys Leu Gly Ser Thr 35 40 45Leu Ile Gly Trp Ile Leu Ala Gin Arg Ser Gly Cys Leu Gly Ser Thr 35 40 45
Leu Ala Val His Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly Trp 50 55 60Leu Ala Val His Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly Trp 50 55 60
Ser His Trp Phe Ala Glu Tyr Leu Phe Leu Glu Arg Ser Trp Ala Lys 65 70 75 80Ser His Trp Phe Ala Glu Tyr Leu Phe Leu Glu Arg Ser Trp Ala Lys 65 70 75 80
Asp Glu Lys Thr Leu Lys Trp Gly Leu Gin Arg Leu Lys Asp Phe Pro 85 90 95Asp Glu Lys Thr Leu Lys Trp Gly Leu Gin Arg Leu Lys Asp Phe Pro 85 90 95
Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr Pro 100 105 110Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr Pro 100 105 110
Ala Lys Leu Leu Ala Ala Gin Glu Tyr Ala Ala Ser Gin Gly Leu Pro 115 120 125Ala Lys Leu Leu Ala Ala Gin Glu Tyr Ala Ala Ser Gin Gly Leu Pro 115 120 125
Ala Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser Ala 130 135 140Ala Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser Ala 130 135 140
Val Ser 145Val Ser 145
(2) ANGABEN ZU SEQ ID NO: 6:(2) INFORMATION ON SEQ ID NO: 6:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 303 Aminosäuren(A) LENGTH: 303 amino acids
(B) ART: Aminosäure(B) TYPE: amino acid
(C) STRANGFORM: nicht bekannt(C) STRANDFORM: not known
(D) TOPOLOGIE: nicht bekannt(D) TOPOLOGY: not known
(ii) ART DES MOLEKÜLS: Protein(ii) MOLECULE TYPE: Protein
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 6:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Met Ser Val Ile Gly Arg Phe Leu Tyr Tyr Leu Arg Ser Val Leu Val 1 5 10 15Met Ser Val Ile Gly Arg Phe Leu Tyr Tyr Leu Arg Ser Val Leu Val 1 5 10 15
Val Leu Ala Leu Ala Gly Cys Gly Phe Tyr Gly Val Ile Ala Ser Ile 20 25 30Val Leu Ala Leu Ala Gly Cys Gly Phe Tyr Gly Val Ile Ala Ser Ile 20 25 30
Leu Cys Thr Leu Ile Gly Lys Gin His Leu Ala Gin Trp Ile Thr Ala 35 40 45Leu Cys Thr Leu Ile Gly Lys Gin His Leu Ala Gin Trp Ile Thr Ala 35 40 45
Arg Cys Phe Tyr His Val Met Lys Leu Met Leu Gly Leu Asp Val Lys 50 55 60 Val Val Gly Glu Glu Asn Leu Ala Lys Lys Pro Tyr. Ile Met Ile Ala 65 70 75 80Arg Cys Phe Tyr His Val Met Lys Leu Met Leu Gly Leu Asp Val Lys 50 55 60 Val Val Gly Glu Glu Asn Leu Ala Lys Lys Pro Tyr. Ile Met Ile Ala 65 70 75 80
Asn His Gin Ser Thr Leu Asp Ile Phe Met Leu Gly Arg Ile Phe Pro 85 90 95Asn His Gin Ser Thr Leu Asp Ile Phe Met Leu Gly Arg Ile Phe Pro 85 90 95
Pro Gly Cys Thr Val Thr Ala Lys Lys Ser Leu Lys Tyr Val Pro Phe 100 105 110Pro Gly Cys Thr Val Thr Ala Lys Lys Ser Leu Lys Tyr Val Pro Phe 100 105 110
Leu Gly Trp Phe Met Ala Leu Ser Gly Thr Tyr Phe Leu Asp Arg Ser 115 120 125Leu Gly Trp Phe Met Ala Leu Ser Gly Thr Tyr Phe Leu Asp Arg Ser 115 120 125
Lys Arg Gin Glu Ala Ile Asp Thr Leu Asn Lys Gly Leu Glu Asn Val 130 135 140Lys Arg Gin Glu Ala Ile Asp Thr Leu Asn Lys Gly Leu Glu Asn Val 130 135 140
Lys Lys Asn Lys Arg Ala Leu Trp Val Phe Pro Glu Gly Thr Arg Ser 145 150 155 160Lys Lys Asn Lys Arg Ala Leu Trp Val Phe Pro Glu Gly Thr Arg Ser 145 150 155 160
Tyr Thr Ser Glu Leu Thr Met Leu Pro Phe Lys Lys Gly Ala Phe His 165 170 175Tyr Thr Ser Glu Leu Thr Met Leu Pro Phe Lys Lys Gly Ala Phe His 165 170 175
Leu Ala Gin Gin Gly Lys Ile Pro Ile Val Pro Val Val Val Ser Asn 180 185 190Leu Ala Gin Gin Gly Lys Ile Pro Ile Val Pro Val Val Val Ser Asn 180 185 190
Thr Ser Thr Leu Val Ser Pro Lys Tyr Gly Val Phe Asn Arg Gly Cys 195 200 205Thr Ser Thr Leu Val Ser Pro Lys Tyr Gly Val Phe Asn Arg Gly Cys 195 200 205
Met Ile Val Arg Ile Leu Lys Pro Ile Ser Thr Glu Asn Leu Thr Lys 210 215 220Met Ile Val Arg Ile Leu Lys Pro Ile Ser Thr Glu Asn Leu Thr Lys 210 215 220
Asp Lys Ile Gly Glu Phe Ala Glu Lys Val Arg Asp Gin Met Val Asp 225 230 235 240Asp Lys Ile Gly Glu Phe Ala Glu Lys Val Arg Asp Gin Met Val Asp 225 230 235 240
Thr Leu Lys Glu Ile Gly Tyr Ser Pro Ala Ile Asn Asp Thr Thr Leu 245 250 255Thr Leu Lys Glu Ile Gly Tyr Ser Pro Ala Ile Asn Asp Thr Thr Leu 245 250 255
Pro Pro Gin Ala Ile Glu Tyr Ala Ala Leu Gin His Asp Lys Lys Val 260 265 270Pro Pro Gin Ala Ile Glu Tyr Ala Ala Leu Gin His Asp Lys Lys Val 260 265 270
Asn Lys Lys Ile Lys Asn Glu Pro Val Pro Ser Val Ser Ile Ser Asn 275 280 285Asn Lys Lys Ile Lys Asn Glu Pro Val Pro Ser Val Ser Ile Ser Asn 275 280 285
Asp Val Asn Thr His Asn Glu Gly Ser Ser Val Lys Lys Met His 290 295 300Asp Val Asn Thr His Asn Glu Gly Ser Ser Val Lys Lys Met His 290 295 300
(2) ANGABEN ZU SEQ ID NO: 7:(2) INFORMATION ON SEQ ID NO: 7:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 245 Aminosäuren(A) LENGTH: 245 amino acids
(B) ART: Aminosäure(B) TYPE: amino acid
(C) STRANGFORM: nicht bekannt(C) STRANDFORM: not known
(D) TOPOLOGIE: nicht bekannt(D) TOPOLOGY: not known
(ii) ART DES MOLEKÜLS: Protein(ii) MOLECULE TYPE: Protein
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 7:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
Met Leu Tyr Ile Phe Arg Leu Ile Ile Thr Val Ile Tyr Ser Ile Leu 1 5 10 15 Val Cys Val Phe Gly Ser Ile Tyr Cys Leu Phe Ser Pro Arg Asn Pro 20 25 30Met Leu Tyr Ile Phe Arg Leu Ile Ile Thr Val Ile Tyr Ser Ile Leu 1 5 10 15 Val Cys Val Phe Gly Ser Ile Tyr Cys Leu Phe Ser Pro Arg Asn Pro 20 25 30
Lys His Val Ala Thr Phe Gly His Met Phe Gly Arg Leu Ala Pro Leu 35 40 45Lys His Val Ala Thr Phe Gly His Met Phe Gly Arg Leu Ala Pro Leu 35 40 45
Phe Gly Leu Lys Val Glu Cys Arg Lys Pro Thr Asp Ala Glu Ser Tyr 50 55 60Phe Gly Leu Lys Val Glu Cys Arg Lys Pro Thr Asp Ala Glu Ser Tyr 50 55 60
Gly Asn Ala Ile Tyr Ile Ala Asn His Gin Asn Asn Tyr Asp Met Val 65 70 75 80Gly Asn Ala Ile Tyr Ile Ala Asn His Gin Asn Asn Tyr Asp Met Val 65 70 75 80
Thr Ala Ser Asn Ile Val Gin Pro Pro Thr Val Thr Val Gly Lys Lys 85 90 95Thr Ala Ser Asn Ile Val Gin Pro Pro Thr Val Thr Val Gly Lys Lys 85 90 95
Ser Leu Leu Trp Ile Pro Phe Phe Gly Gin Leu Tyr Trp Leu Thr Gly 100 105 110Ser Leu Leu Trp Ile Pro Phe Phe Gly Gin Leu Tyr Trp Leu Thr Gly 100 105 110
Asn Leu Leu Ile Asp Arg Asn Asn Arg Thr Lys Ala His Gly Thr Ile 115 120 125Asn Leu Leu Ile Asp Arg Asn Asn Arg Thr Lys Ala His Gly Thr Ile 115 120 125
Ala Glu Val Val Asn His Phe Lys Lys Arg Arg Ile Ser Ile Trp Met 130 135 140Ala Glu Val Val Asn His Phe Lys Lys Arg Arg Ile Ser Ile Trp Met 130 135 140
Phe Pro Glu Gly Thr Arg Ser Arg Gly Arg Gly Leu Leu Pro Phe Lys 145 150 155 160Phe Pro Glu Gly Thr Arg Ser Arg Gly Arg Gly Leu Leu Pro Phe Lys 145 150 155 160
Thr Gly Ala Phe His Ala Ala Ile Ala Ala Gly Val Pro Ile Ile Pro 165 170 175Thr Gly Ala Phe His Ala Ala Ile Ala Ala Gly Val Pro Ile Ile Pro 165 170 175
Val Cys Val Ser Thr Thr Ser Asn Lys Ile Asn Leu Asn Arg Leu His 180 185 190Val Cys Val Ser Thr Thr Ser Asn Lys Ile Asn Leu Asn Arg Leu His 180 185 190
Asn Gly Leu Val Ile Val Glu Met Leu Pro Pro Ile Asp Val Ser Gin 195 200 205Asn Gly Leu Val Ile Val Glu Met Leu Pro Pro Ile Asp Val Ser Gin 195 200 205
Tyr Gly Lys Asp Gin Val Arg Glu Leu Ala Ala His Cys Arg Ser Ile 210 215 220Tyr Gly Lys Asp Gin Val Arg Glu Leu Ala Ala His Cys Arg Ser Ile 210 215 220
Met Glu Gin Lys Ile Ala Glu Leu Asp Lys Glu Val Ala Glu Arg Glu 225 230 235 240Met Glu Gin Lys Ile Ala Glu Leu Asp Lys Glu Val Ala Glu Arg Glu 225 230 235 240
Ala Ala Gly Lys Val 245Ala Ala Gly Lys Val 245
(2) ANGABEN ZU SEQ ID NO: 8:(2) INFORMATION ON SEQ ID NO: 8:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 245 Aminosäuren(A) LENGTH: 245 amino acids
(B) ART: Aminosäure(B) TYPE: amino acid
(C) STRANGFORM: nicht bekannt(C) STRANDFORM: not known
(D) TOPOLOGIE: nicht bekannt(D) TOPOLOGY: not known
(ii) ART DES MOLEKÜLS: Protein(ii) MOLECULE TYPE: Protein
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 8:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
Met Leu Tyr Ile Phe Arg Leu Ile Val Thr Val Ile Tyr Ser Ile Leu 1 5 10 15 Val Cys Val Phe Gly Ser Ile Tyr Cys Leu Phe Ser Pro Arg Asn Pro 20 25 30Met Leu Tyr Ile Phe Arg Leu Ile Val Thr Val Ile Tyr Ser Ile Leu 1 5 10 15 Val Cys Val Phe Gly Ser Ile Tyr Cys Leu Phe Ser Pro Arg Asn Pro 20 25 30
Lys His Val Ala Thr Phe Gly His Met Phe Gly Arg Leu Ala Pro Leu 35 40 45Lys His Val Ala Thr Phe Gly His Met Phe Gly Arg Leu Ala Pro Leu 35 40 45
Phe Gly Leu Lys Val Glu Cys Arg Lys Pro Ala Asp Ala Glu Asn Tyr 50 55 60Phe Gly Leu Lys Val Glu Cys Arg Lys Pro Ala Asp Ala Glu Asn Tyr 50 55 60
Gly Asn Ala Ile Tyr Ile Ala Asn His Gin Asn Asn Tyr Asp Met Val 65 70 75 80Gly Asn Ala Ile Tyr Ile Ala Asn His Gin Asn Asn Tyr Asp Met Val 65 70 75 80
Thr Ala Ala Asn Ile Val Gin Pro Pro Thr Val Thr Val Gly Lys Lys 85 90 95Thr Ala Ala Asn Ile Val Gin Pro Pro Thr Val Thr Val Gly Lys Lys 85 90 95
Ser Leu Leu Trp Ile Pro Phe Phe Gly Gin Leu Tyr Trp Leu Thr Gly 100 105 110Ser Leu Leu Trp Ile Pro Phe Phe Gly Gin Leu Tyr Trp Leu Thr Gly 100 105 110
Asn Leu Leu Ile Asp Arg Asn Asn Arg Ala Lys Ala His Ser Thr Ile 115 120 125Asn Leu Leu Ile Asp Arg Asn Asn Arg Ala Lys Ala His Ser Thr Ile 115 120 125
Ala Ala Val Val Asn His Phe Lys Lys Arg Arg Ile Ser Ile Trp Met 130 135 140Ala Ala Val Val Asn His Phe Lys Lys Arg Arg Ile Ser Ile Trp Met 130 135 140
Phe Pro Glu Gly Thr Arg Ser Arg Gly Arg Gly Leu Leu Pro Phe Lys 145 150 155 160Phe Pro Glu Gly Thr Arg Ser Arg Gly Arg Gly Leu Leu Pro Phe Lys 145 150 155 160
Thr Gly Ala Phe His Ala Ala Ile Ala Ala Gly Val Pro Ile Ile Pro 165 170 175Thr Gly Ala Phe His Ala Ala Ile Ala Ala Gly Val Pro Ile Ile Pro 165 170 175
Val Cys Val Ser Asn Thr Ser Asn Lys Val Asn Leu Asn Arg Leu Asn 180 185 190Val Cys Val Ser Asn Thr Ser Asn Lys Val Asn Leu Asn Arg Leu Asn 180 185 190
Asn Gly Leu Val Ile Val Glu Met Leu Pro Pro Val Asp Val Ser Glu 195 200 205Asn Gly Leu Val Ile Val Glu Met Leu Pro Pro Val Asp Val Ser Glu 195 200 205
Tyr Gly Lys Asp Gin Val Arg Glu Leu Ala Ala His Cys Arg Ala Leu 210 215 220Tyr Gly Lys Asp Gin Val Arg Glu Leu Ala Ala His Cys Arg Ala Leu 210 215 220
Met Glu Gin Lys Ile Ala Glu Leu Asp Lys Glu Val Ala Glu Arg Glu 225 230 235 240Met Glu Gin Lys Ile Ala Glu Leu Asp Lys Glu Val Ala Glu Arg Glu 225 230 235 240
Ala Thr Gly Lys Val 245Ala Thr Gly Lys Val 245
(2) ANGABEN ZU SEQ ID NO: 9:(2) INFORMATION ON SEQ ID NO: 9:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 24 Basenpaare(A) LENGTH: 24 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: nicht bekannt(C) STRANDFORM: not known
(D) TOPOLOGIE: linear(D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsäure(ii) MOLECULE TYPE: Other nucleic acid
(A) BESCHREIBUNG: /desc = "sythetische DNA"(A) DESCRIPTION: / desc = "synthetic DNA"
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 9: AAGATCTATT TGAGCGATTT GTGC 24 (2) ANGABEN ZU SEQ ID NO: 10:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: AAGATCTATT TGAGCGATTT GTGC 24 (2) INFORMATION ON SEQ ID NO: 10:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 24 Basenpaare(A) LENGTH: 24 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: nicht bekannt(C) STRANDFORM: not known
(D) TOPOLOGIE: linear(D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsäure(ii) MOLECULE TYPE: Other nucleic acid
(A) BESCHREIBUNG: /desc =- "synthetische DNA"(A) DESCRIPTION: / desc = - "synthetic DNA"
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 10: ACCATGGCCA AAACTAGAAC TAGC 24 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: ACCATGGCCA AAACTAGAAC TAGC 24

Claims

Patentansprüche claims
1. Isoliertes Nukleinsäurefragment, welches eine Nukleinsäuresequenz ent¬ hält, die für die l-Acylglycerin-3-phosphat-Acyltransferase oder ähnliche Enzyme kodiert, deren Aminosäuresequenz eine Identität von mindestens 35% zu der in Figur 2 dargestellten Sequenz besitzt.1. Isolated nucleic acid fragment which contains a nucleic acid sequence which codes for the 1-acylglycerol-3-phosphate acyltransferase or similar enzymes, the amino acid sequence of which is at least 35% identical to the sequence shown in FIG. 2.
2. Isoliertes Nukleinsäurefragment nach Anspruch 1, wobei die Identität der zugehörigen Aminosäuresequenz mindesten 40 %, vorzugsweise 45 %, ins¬ besondere 50 % zu der in Figur 2 aufgeführten Sequenz beträgt.2. The isolated nucleic acid fragment according to claim 1, wherein the identity of the associated amino acid sequence is at least 40%, preferably 45%, in particular 50% of the sequence shown in FIG. 2.
3. Isoliertes Nukleinsäurefragment nach Anspruch 1, wobei die Identität der zugehörigen Aminosäuresequenz mindestens 65 %, vorzugsweise minde¬ stens 90 % zu der in Figur 2 aufgeführten Sequenz beträgt.3. An isolated nucleic acid fragment according to claim 1, wherein the identity of the associated amino acid sequence is at least 65%, preferably at least 90%, of the sequence shown in FIG. 2.
4. Isoliertes Nukleinsäurefragment nach Anspruch 1, dadurch gekennzeich¬ net, daß es sich bei der Aminosäuresequenz um die Sequenz gemäß Figur 2 handelt.4. Isolated nucleic acid fragment according to claim 1, characterized in that the amino acid sequence is the sequence according to FIG. 2.
5. Isoliertes Nukleinsäurefragment nach einem der Ansprüche 1 bis 4, da¬ durch gekennzeichnet, daß es aus Pflanzen isoliert ist.5. Isolated nucleic acid fragment according to one of claims 1 to 4, characterized in that it is isolated from plants.
6. Isoliertes Nukleinsäurefragment nach einem der Ansprüche 1 bis 4, da¬ durch gekennzeichnet, daß es aus dikotyledonen Pflanzen isoliert ist.6. Isolated nucleic acid fragment according to one of claims 1 to 4, characterized in that it is isolated from dicotyledonous plants.
7. Isoliertes Nukleinsäurefragment nach einem der Ansprüche 1 bis 4, da¬ durch gekennzeichnet, daß das Ausgangsmaterial zur Isolierung Triacylgly- cerin synthetisierendes Gewebe ist.7. Isolated nucleic acid fragment according to one of claims 1 to 4, since ¬ characterized in that the starting material for isolation is triacylglycerol-synthesizing tissue.
8. Isoliertes Nukleinsäurefragment nach einem der Ansprüche 1 bis 4, da¬ durch gekennzeichnet, daß das Ausgangsmaterial zur Isolierung reifende Samen sind.8. Isolated nucleic acid fragment according to one of claims 1 to 4, da¬ characterized in that the starting material for isolation are ripening seeds.
9. Isoliertes Nukleinsäurefragment nach einem der Ansprüche 1 bis 4, da¬ durch gekennzeichnet, daß das Ausgangsmaterial zur Isolierung reifende Samen von Limnanthes douglasii sind. 9. Isolated nucleic acid fragment according to one of claims 1 to 4, da¬ characterized in that the starting material for isolation are ripening seeds of Limnanthes douglasii.
10. Isoliertes Nukleinsäurefragment nach einem der Ansprüche 1 bis 9, da¬ durch gekennzeichnet, daß es samenspezifisch exprimiert wird.10. Isolated nucleic acid fragment according to one of claims 1 to 9, characterized in that it is expressed in a seed-specific manner.
11. Plasmide, Viren oder andere Vektoren, dadurch gekennzeichnet, daß sie Nukleinsäurefragmente entsprechend einem der Ansprüche 1 bis 10 enthal¬ ten.11. plasmids, viruses or other vectors, characterized in that it comprises th nucleic acid fragments according to any one of claims 1 to 10 contained ¬.
12. Genomische Klone, dadurch gekennzeichnet, daß sie Gene oder Teile von Genen enthalten, die für eine Sequenz oder Teile der Sequenz entsprechend einem der Ansprüche 1 bis 10 kodieren.12. Genomic clones, characterized in that they contain genes or parts of genes which code for a sequence or parts of the sequence according to one of claims 1 to 10.
13. Chimäres Gen, das in der Lage ist, die Fettsäurezusammensetzung in einer transformierten Zelle zu verändern und ein Nukleinsäurefragment nach einem der Ansprüche 1 bis 10 enthält und das in wirksamer Form mit geeigneten Steuersequenzen verknüpft ist.13. Chimeric gene which is able to change the fatty acid composition in a transformed cell and contains a nucleic acid fragment according to one of claims 1 to 10 and which is linked in an effective form with suitable control sequences.
14. Chimäres Gen, das in der Lage ist, den Gehalt an sehr langkettigen, gesättigten und/oder ungesättigten Fettsäuren in einer transformierten Zel¬ le zu verändern und ein Nukleinsäurefragment nach einem der Ansprüche 1 bis 10 enthält, das in wirksamer Form mit geeigneten Steuersequenzen ver¬ knüpft ist.14. Chimeric gene that is able to change the content of very long-chain, saturated and / or unsaturated fatty acids in a transformed cell and contains a nucleic acid fragment according to one of claims 1 to 10, which is in effective form with suitable control sequences is linked.
15. Chimäres Gen, das in der Lage ist, den Gehalt an Erucasäure in einer transformierten Zelle zu verändern, und ein Nukleinsäurefragment nach einem der Ansprüche 1 bis 10 enthält, das in wirksamer Form mit geeigne¬ ten Steuersequenzen verknüpft ist.15. A chimeric gene that is capable of changing the content of erucic acid in a transformed cell and comprising a nucleic acid fragment of any one of claims 1 to 10, th in active form with geeigne ¬ control sequences associated with it.
16. Chimäres Gen, das in der Lage ist, die Fettsäurezusammensetzung im Triacylglycerin einer transformierten Zelle zu verändern, und ein Nuklein¬ säurefragment nach einem der Ansprüche 1 bis 10 enthält, das in wirksa¬ mer Form mit geeigneten Steuersequenzen verknüpft ist.16. A chimeric gene that is capable of changing the fatty acid composition of triacylglycerol in a transformed cell, and a nucleic acid fragment according to any one of claims 1 to 10 includes, in the mer wirksa ¬ form is linked to appropriate control sequences.
17. Chimäres Gen, das in der Lage ist, den Gehalt an sehr langkettigen Fettsäuren im Triacylglycerin einer transformierten Zelle zu verändern, und ein Nukleinsäurefragment nach einem der Ansprüche 1 bis 10 enthält, das in wirksamer Form mit geeigneten Steuersequenzen verknüpft ist. 17. Chimeric gene, which is able to change the content of very long-chain fatty acids in the triacylglycerol of a transformed cell, and contains a nucleic acid fragment according to one of claims 1 to 10, which is linked in an effective form with suitable control sequences.
18. Chimäres Gen, das in der Lage ist, den Gehalt an Erucasäure im Tria¬ cylglycerin einer transformierten Zelle zu verändern, und ein Nukleinsäu¬ refragment nach einem der Ansprüche 1 bis 10 enthält, das in wirksamer Form mit geeigneten Steuersequenzen verknüpft ist.18. Chimeric gene which is able to change the content of erucic acid in the triacylglycerol of a transformed cell and which contains a nucleic acid fragment according to one of claims 1 to 10, which is linked in an effective form with suitable control sequences.
19. Chimäres Gen gemäß der Ansprüche 13 - 18, das in der Lage ist, die Synthese von Trierocin in einer transformierten Zelle zu ermöglichen, wo¬ bei das Gen ein Nukleinsäurefragment nach einem der Ansprüche 1 - 10 enthält, das in wirksamer Form mit geeigneten Steuersequenzen verknüpft ist.19. Chimeric gene according to claims 13-18, which is able to enable the synthesis of trierocin in a transformed cell, wherein the gene contains a nucleic acid fragment according to one of claims 1-10, which in effective form with suitable Control sequences is linked.
20. Chimäres Gen entsprechend einem der Ansprüche 13 - 19, dadurch ge¬ kennzeichnet, daß die Konstruktion in "Sense" und/oder "Antisense "-Orien¬ tierung vorliegt.20. Chimeric gene according to one of claims 13-19, characterized in that the construction is in "sense" and / or "antisense" orientation.
21. Transformierte Zellen, Pflanzen oder Pflanzenteile, die ein chimäres Gen entsprechend einem der Ansprüche 13 bis 20 enthalten.21. Transformed cells, plants or parts of plants which contain a chimeric gene according to any one of claims 13 to 20.
22. Transformierte Zellen, Pflanzen oder Pflanzenteile entsprechend An¬ spruch 21, dadurch gekennzeichnet, daß sie l-Acylglycerin-3-phosphat-Acyl- transferasen (AGPAT) enthalten, die in diesen natürlicherweise nicht oder in anderer Form oder anderer Konzentration vorkommen.22. Transformed cells, plants or parts of plants according to claim 21, characterized in that they contain l-acylglycerol-3-phosphate acyl transferases (AGPAT) which naturally do not occur in these or in another form or other concentration.
23. Transformierte Zellen, Pflanzen oder Pflanzenteile entsprechend An¬ spruch 21, dadurch gekennzeichnet, daß sie l-Acylglycerin-3-phosphat-Acyl- transferaseaktivitäten enthalten, die in diesen natürlicherweise nicht oder in anderer Höhe oder mit anderer Spezifizität vorkommen.23. Transformed cells, plants or parts of plants according to claim 21, characterized in that they contain l-acylglycerol-3-phosphate-acyl transferase activities which do not occur naturally in these or at a different level or with a different specificity.
24. Transformierte Zellen, Pflanzen oder Pflanzenteile entsprechend An¬ spruch 21 dadurch gekennzeichnet, daß sie für sehr langkettige Acylgrup¬ pen spezifische l-Acylglycerin-3-phosphat-Acyltransferaseaktivitäten (L- AGPAT-Aktivitäten) enthalten, die in diesen natürlicherweise nicht oder in anderer Höhe vorkommen.24. Transformed cells, plants or parts of plants in accordance with claim 21, characterized in that they contain specific l-acylglycerol-3-phosphate-acyltransferase activities (L-AGPAT activities) for very long-chain acyl groups, which naturally do not or in these of a different height.
25. Transformierte Zellen, Pflanzen oder Pflanzenteile entsprechend An¬ spruch 21, dadurch gekennzeichnet, daß sie erucasäurespezifische 1-Acyl- glycerin-3-phosphat-Acyltransferaseaaktivitäten enthalten, die in diesen natürlicherweise nicht oder in anderer Höhe vorkommen. 25. Transformed cells, plants or parts of plants according to claim 21, characterized in that they contain erucic acid-specific 1-acylglycerol-3-phosphate-acyltransferase activities which do not occur naturally or at different levels in these.
26. Öl aus Samen oder Früchten von Pflanzen gewonnen, die ein chimäres Gen entsprechend der Ansprüche 13 bis 20 enthalten.26. Oil obtained from seeds or fruits of plants which contain a chimeric gene according to claims 13 to 20.
27. Öl, das aus Pflanzen oder Planzenteilen entsprechend einem der An¬ sprüche 21 bis 25 gewonnen ist.27. Oil obtained from plants or parts of plants according to one of claims 21 to 25.
28. Verfahren zur Herstellung von l-Acylglycerin-3-phosphat-Acyltransfera- se umfassend:28. A method for producing l-acylglycerol-3-phosphate acyltransferase comprising:
(a) Transformation einer Zelle mit einem Chimären Gen entsprechend einem der Ansprüche 13 bis 20;(a) transforming a cell with a chimeric gene according to any one of claims 13 to 20;
(b) Selektion solcher Zellen, die das Protein in gewünschter Menge produ¬ zieren;(b) selection of those cells which produce the protein in the desired amount;
(c) und vorzugsweise Reinigung des Proteins von anderen Bestandteilen.(c) and preferably purifying the protein from other ingredients.
29. l-Acylglycerin-3-phosphat-Acyltransferase erhältlich durch das Verfah¬ ren gemäß Anspruch 28.29. l-acylglycerol-3-phosphate acyltransferase obtainable by the process according to claim 28.
30. Verfahren zur Herstellung von Pflanzen und/oder Pflanzenöl mit einem veränderten Gehalt an sehr langkettigen Fettsäuren umfassend:30. A method for producing plants and / or vegetable oil with an altered content of very long-chain fatty acids comprising:
(a) Transformation einer Pflanzenzelle einer ölproduzierenden Pflanze mit einem Chimären Gen nach einem der Ansprüche 13 bis 20;(a) transforming a plant cell of an oil-producing plant with a chimeric gene according to any one of claims 13 to 20;
(b) Aufzucht fertiler Pflanzen aus der transformierten Pflanzenzelle nach (a);(b) growing fertile plants from the transformed plant cell according to (a);
(c) Selektion der Nachkommen der Pflanzen entsprechend (b), zur Erlangung des gewünschten Gehalts an sehr langkettigen Fettsäuren;(c) selection of the progeny of the plants according to (b), in order to obtain the desired content of very long-chain fatty acids;
(d) Verarbeitung der Samen der Pflanzen entsprechend (c), um Pflanzen und/oder Pflanzenöl zu erhalten, daß den gewünschten Gehalt an sehr langkettigen Fettsäuren aufweist.(d) processing the seeds of the plants according to (c) in order to obtain plants and / or vegetable oil which has the desired content of very long-chain fatty acids.
31. Verfahren gemäß Anspruch 34, dadurch gekennzeichnet, daß die sehr langkettige Fettsäure Erucasäure ist.31. The method according to claim 34, characterized in that the very long-chain fatty acid is erucic acid.
32. Pflanze und/oder Pflanzenöl erhältlich durch das Verfahren gemäß An¬ spruch 30 oder 31.32. plant and / or vegetable oil obtainable by the process according to ¬ demanding 30 or 31st
33. Verfahren zum Gewinnen von Nukleinsäurefragmenten, die für Acyltrans¬ ferasen und acyltransferaseähnliche Enzyme kodieren, umfassend die fol- genden Schritte:33. A method for obtaining nucleic acid fragments for ferasen Acyltrans ¬ and encode enzymes acyltransferaseähnliche comprising the fol- steps:
(a) Vergleich der Aminosäuresequenz in Figur 2 mit den Aminosäuresequenzen anderer Acyltransferasen;(a) Comparison of the amino acid sequence in FIG. 2 with the amino acid sequences of other acyltransferases;
(b) Identifizierung eines oder mehrerer konservierter Sequenzbereiche mit 4 oder mehr identischen Aminosäuren als Ergebnis von (a);(b) identifying one or more conserved sequence regions with 4 or more identical amino acids as a result of (a);
(c) Herstellung spezifischer Oligonukleotide durch Rückübersetzung der Aminosäuresequenz nach (b);(c) production of specific oligonucleotides by back-translating the amino acid sequence according to (b);
(d) Benutzung dieser Oligonukleotide, um mit Hilfe eines sequenzabhängigen Protokolls Nukleinsäuren herzustellen, die Acyltransferasen oder acyltrans- feraseähnliche Enzyme kodieren.(d) Use of these oligonucleotides to use a sequence-dependent protocol to produce nucleic acids which encode acyltransferases or acyltransferase-like enzymes.
34. Verfahren gemäß Anspruch 33, dadurch gekennzeichnet, daß die Nu¬ kleinsäurefragmente aus Pflanzen, insbesondere zweikeimblättrigen Pflan¬ zen, isoliert werden. 34. The method according to claim 33, characterized in that the nucleic acid fragments from plants, in particular dicotyledonous plants, are isolated.
EP95931148A 1994-09-19 1995-09-15 Nucleic acid fragment and products derived therefrom Withdrawn EP0782623A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE19944433307 DE4433307A1 (en) 1994-09-19 1994-09-19 An isolated nucleic acid fragment and products derived from it
DE4433307 1994-09-19
PCT/DE1995/001278 WO1996009394A1 (en) 1994-09-19 1995-09-15 Nucleic acid fragment and products derived therefrom

Publications (1)

Publication Number Publication Date
EP0782623A1 true EP0782623A1 (en) 1997-07-09

Family

ID=6528573

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95931148A Withdrawn EP0782623A1 (en) 1994-09-19 1995-09-15 Nucleic acid fragment and products derived therefrom

Country Status (7)

Country Link
EP (1) EP0782623A1 (en)
JP (1) JPH10509863A (en)
CN (1) CN1159832A (en)
AU (1) AU702494B2 (en)
CA (1) CA2200357A1 (en)
DE (1) DE4433307A1 (en)
WO (1) WO1996009394A1 (en)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9502468D0 (en) * 1995-02-09 1995-03-29 Gene Shears Pty Ltd DNA Sequence
AU5328598A (en) * 1996-12-18 1998-07-15 Medical Research Council Lysophosphatidic acid acyltransferase gene and its use
US6274790B1 (en) 1997-04-14 2001-08-14 The University Of British Columbia Nucleic acids encoding a plant enzyme involved in very long chain fatty acid synthesis
WO1998046766A1 (en) * 1997-04-14 1998-10-22 The University Of British Columbia Nucleic acids encoding a plant enzyme involved in very long chain fatty acid synthesis
CA2783215C (en) * 1998-03-20 2015-11-17 E.I. Du Pont De Nemours And Company Limnanthes oil genes
US6838594B1 (en) 1998-03-20 2005-01-04 E. I. Du Pont De Nemours And Company Limnanthes oil genes
GB0124574D0 (en) 2001-10-12 2001-12-05 Biogemma Uk Ltd Oil biosynthesis
US11639507B2 (en) 2011-12-27 2023-05-02 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
AU2012324024B2 (en) 2011-12-27 2016-06-16 Nuseed Global Innovation Ltd Processes for producing lipids
US8809026B2 (en) 2011-12-27 2014-08-19 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
CN104745716B (en) * 2015-04-23 2017-03-01 吉林大学 A kind of detection method of cattle AGPAT6 gene mononucleotide polymorphism
CA3035570A1 (en) 2016-09-02 2018-03-08 Commonwealth Scientific And Industrial Research Organisation Plants with modified traits

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK0561569T3 (en) * 1992-03-13 2003-10-06 Agrigenetics Inc Modification of vegetable oils using desaturase
GB9225845D0 (en) * 1992-12-10 1993-02-03 Nickerson Biocem Ltd Modified plants
DE4317260A1 (en) * 1993-01-22 1994-07-28 Max Planck Gesellschaft DNA sequence encoding acetyl-CoA carboxylase
US5910630A (en) * 1994-04-06 1999-06-08 Davies; Huw Maelor Plant lysophosphatidic acid acyltransferases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9609394A1 *

Also Published As

Publication number Publication date
CA2200357A1 (en) 1996-03-28
DE4433307A1 (en) 1996-03-21
AU702494B2 (en) 1999-02-25
CN1159832A (en) 1997-09-17
AU3470195A (en) 1996-04-09
JPH10509863A (en) 1998-09-29
WO1996009394A1 (en) 1996-03-28

Similar Documents

Publication Publication Date Title
DE69113635T2 (en) NUCLEOTIDE SEQUENCES OF THE Soybean ACYL ACP THIOESTERA GENES.
DE69103753T3 (en) NUCLEOTIDE SEQUENCE OF THE GENE FOR STEAROYL ACP DESATURASE FROM SOY.
DE10000978A1 (en) Process for increasing the level of fatty acids in plants and microorganisms
DE69230785T2 (en) Change of fatty acids by a desaturase in transgenic plant tissue
DE60034224T2 (en) NUCLEIC ACID SEQUENCES FOR PROTEINS INVOLVED IN ISOPRENOID SYNTHESIS
EP0765393B1 (en) Dna molecules which code for a plastid 2-oxoglutarate/malate translocator
WO1995006740A2 (en) Medium chain-specific thioesterases
DE69731113T2 (en) THERMOSTABILES PHOSPHATASES
WO1998027201A2 (en) Genes coding for amino acid deacetylases with specificity for n-acetyl-l-phosphinothricin, their isolation and their use
CA2198222A1 (en) Nucleotide sequences of canola and soybean palmitoyl-acp thioesterase genes and their use in the regulation of fatty acid content of the oils of soybean and canola plants
WO1996009394A1 (en) Nucleic acid fragment and products derived therefrom
DE60027407T2 (en) 1-DESOXY-D-XYLULOSE-5-PHOSPHATE REDUCTOISOMERASES AND METHOD OF USE
DE19752647C1 (en) Reduction of the chlorophyll content in oil plant seeds
EP1185670B1 (en) Method of increasing the content of fatty acids in plant seeds
EP1301610B1 (en) Method for influencing the content of sinapine in transgenic plant cells and plants
DE102011113283A1 (en) Increase of lipid content in microalgae by genetic manipulation of a triacylglycerol (TAG) lipase
EP0680511A1 (en) Acetyl-coa-carboxylase-gene
EP0716699A1 (en) Glycerin-3-phosphate-dehydrogenase (gpdh)
EP1412488B1 (en) Method for producing arachidonic acid in transgenic organisms
EP0918849A1 (en) Transgenic plant cells and plants with modified acetyl-coa formation
DE60008962T2 (en) Cloning of an N-methyltransferase involved in caffeine biosynthesis
DE4317260A1 (en) DNA sequence encoding acetyl-CoA carboxylase
DE10028639C2 (en) Process for the preparation of C9 aldehydes, C9 alcohols and their esters
EP1025248A1 (en) Reduction of chlorophyll content in oil plant seeds
EP0948603A1 (en) Sterol glycosyl transferases

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970307

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): DE DK ES FR GB IT NL SE

17Q First examination report despatched

Effective date: 20000217

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20010403