EP0779926A1 - Plantes transgeniques exprimant les genes de l'oxydase de l'acide 1-aminocyclopropane-1-carboxylique - Google Patents

Plantes transgeniques exprimant les genes de l'oxydase de l'acide 1-aminocyclopropane-1-carboxylique

Info

Publication number
EP0779926A1
EP0779926A1 EP95922249A EP95922249A EP0779926A1 EP 0779926 A1 EP0779926 A1 EP 0779926A1 EP 95922249 A EP95922249 A EP 95922249A EP 95922249 A EP95922249 A EP 95922249A EP 0779926 A1 EP0779926 A1 EP 0779926A1
Authority
EP
European Patent Office
Prior art keywords
plant
nucleotide sequence
acc oxidase
dna
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95922249A
Other languages
German (de)
English (en)
Inventor
Maury L. Boeshore
Rosaline Z. Deng
Kim J. Carney
Glen E. Ruttencutter
John F. Reynolds
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seminis Vegetable Seeds Inc
Original Assignee
Asgrow Seed Co LLC
Seminis Vegetable Seeds Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Asgrow Seed Co LLC, Seminis Vegetable Seeds Inc filed Critical Asgrow Seed Co LLC
Publication of EP0779926A1 publication Critical patent/EP0779926A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8249—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving ethylene biosynthesis, senescence or fruit development, e.g. modified tomato ripening, cut flower shelf-life
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/17—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced ascorbate as one donor, and incorporation of one atom of oxygen (1.14.17)
    • C12Y114/17004—Aminocyclopropanecarboxylate oxidase (1.14.17.4), i.e. ethylene-forming enzyme

Definitions

  • This invention relates to the plant enzyme ACC oxidase which is essential for the production of ethylene in •higher plants. More particularly, the invention relates to the DNA sequence of a Brassica oleracea ACC oxidase, DNA constructs containing this sequence, plant cells containing the constructs and plants derived therefrom.
  • ACC oxidase also known as ethylene forming enzyme
  • ethylene is related to various events in plant growth and development including fruit ripening, seed germination, abscission, and leaf and flower senescence.
  • Ethylene production is strictly regulated by the plant and is induced by a variety of external factors, including the application of auxins, wounding, anaerobic conditions, viral infection, elicitor treatment, chilling, drought
  • RNA messenger RNA
  • antisense RNA an RNA sequence which is complementary to a sequence of bases in the mRNA in question: complementary in the sense that each base (or the majority of bases) in the antisense sequence (read in the 3' to 5' sense) is capable of pairing with the corresponding base (G with C, A with U) in the mRNA sequence read in the 5' to 3' sense.
  • RNA Ribonucleic acid
  • RNA Ribonucleic acid
  • Such antisense RNA may be produced in the cell by transformation with an appropriate DNA construct arranged to transcribe backwards part of the coding strand (as opposed to the template strand) of the relevant gene (or of a DNA sequence showing substantial homology therewith) .
  • SAM S-adenosylmethionine synthetase
  • SAM S-adenosylmethionine
  • ACC aminocyclopropane-1-carboxylic acid
  • WO 92/04456 reports the isolation of a gene encoding the ACC synthase gene derived from zucchini and transgenic plants in which ethylene production is modified to control changes associated with fruit ripening.
  • WO 92/11371 reports a gene encoding an ethylene forming enzyme gene derived from melon and transgenic plants in which ethylene production is modified to control changes associated with fruit ripening, improved fruit quality, improved flavor and texture, and the possibility of production over a longer harvest period.
  • WO 92/11372 reports a peach gene encoding ethylene forming enzyme and plants transformed with the peach ethylene forming enzyme gene construct. These constructs modify ethylene-associated ripening changes, reduced rate of deterioration after harvest, and allowed storage for longer periods.
  • Smith et al. (1986) Planta 168:94-100 reported the rapid appearance of an mRNA correlated with ethylene synthesis encoding a protein of molecular weight 35000.
  • the present invention provides recombinant materials which permit control of the level of ACC oxidase in plants, specifically, Brassica oleracea and Cucumis - 6 -
  • GTOMA genomic clone
  • Klee et al. (1991) The Plant Cell 3:1187-1193) reports the overexpression of a Pseudoj ⁇ onas ACC deaminase gene in transgenic tomato plants to inhibit ethylene production during fruit ripening.
  • Fig. 4 illustrates a flow chart showing the engineering steps used to install the ACC oxidase cDNA coding sequence, both in the sense and the antisense orientation, into plant expression vectors and the subsequent insertion into binary plasmids;
  • Fig. 5 illustrates a flow chart showing thr engineering steps used to install the B. oleracea ACC oxidase genomic DNA coding sequence, both in the sense and the antisense orientation, into plant expression vectors and the subsequent insertion into binary plasmids.
  • Fig. 6 illustrates an RNA blot of total RNA extracted from R 0 transgenic melon plants (leaves) hybridized with B . oleracea ACC oxidase sense RNA probe.
  • Fig. 7 illustrates an RNA blot of total RNA extracted from R, transgenic melon progeny of line 4168-10 hybridized with B. oleracea ACC oxidase sense RNA probe.
  • Fig. 8 illustrates an RNA blot of total RNA extracted form R, transgenic melon progeny of lines 4168-19 and 4168-20 hybridized with B . oleracea ACC oxidase sense RNA probe.
  • Fig. 9 illustrates a comparison of melon ACC oxidase nucleotide sequence with B . oleracea nucleotide sequence. Sequences were aligned with the use of the Pileup Program in the UWGCG program package. 8 -
  • the invention is also directed to DNA in purified and isolated form comprising a DNA sequence encoding the enzyme ACC oxidase of Brassica oleracea and Cucui ⁇ is melo.
  • the invention is also directed to expression systems effective in expressing the DNA encoding said ACC oxidase and to recombinant hosts transformed with this expression system.
  • the invention is further directed to methods to control ACC oxidase production and, thus, the growth and development of Brassica oleracea and Cucumis melo plants, using the coding sequences for ACC oxidase in an antisense construct or by replacing the ACC oxidase gene by a mutated form thereof.
  • the invention thus provides a method for controlling the maturation and aging of Brassica oleracea and Cucumis melo plants which allows one to influence, e.g., lengthen, the shelflife of these plants.
  • Fig. l illustrates the amino acid sequence of B. oleracea ACC oxidase [SEQ ID N0:l], the cDNA sequence of B. oleracea ACC oxidase [SEQ ID NO:2] and the restriction enzyme cloning sites for PCR oligomer reaction primers;
  • Fig. 2 illustrates the cDNA and amino acid sequences of B . oleracea ACC oxidase [SEQ ID NOS:l and 2] compared to the cDNA and amino acid sequences of B . juncea ACC oxidase [SEQ ID NOS:9 and 10];
  • Fig. 3 illustrates the PCR oligomer reaction primers and the novel restriction enzyme cloning sites for each of the primers used for the amplification of the DNA nucleotide sequence of the B. oleracea ACC oxidase gene [SEQ ID NO:8] from the portion of the B. oleracea genome containing the DNA sequence of the B . oleracea variants undoubtedly occur as well.
  • artificially induced mutations are also included so long as they do not destroy activity.
  • conservative amino acid substitutions can be made for most of the amino acids in the primary structure as shown without effecting destruction of activity.
  • the definition of ACC oxidase used herein includes those variants which are derived by direct or indirect manipulation of the disclosed sequence.
  • the primary structure may be altered by post-translational processing or by subsequent chemical manipulation to result in a derivatized protein which contains, for example, glycosylation substituents, oxidized forms of, for example, cysteine or proline, conjugation to additional moieties, such as carriers, solid supports, and the like. These alterations do not remove the protein from the definition of ACC oxidase so long as its capacity to convert ACC to ethylene is maintained.
  • an enzyme as "ACC oxidase” can be confirmed by its ability to effect the production of ethylene in an assay performed as follows: 5 ng to 0.5 mg of enzyme protein in a 500-uL volume is added to 2.5 mL of assay buffer [50mM Tris-HCl (pH 7.2), 10% (v/v) glycerol, 0.1 mM FeS0 4 , 10 mM ascorbate, 1 mM ACC, and 1 mM 2-oxoglutarate] in 25-mL Erlenmeyer flasks. The vials are sealed with serum caps and incubated for 1 hr at 23°C shaking gently.
  • Air in the headspace is analyzed by gas chromatography on a Varian 3400 gas chromatograph equipped with a flame ionization detector and an 80% Porapak N/20% Porapak Q column. Ethylene production is quantitated by comparison with a 97.7 ppm ethylene gas mixture in helium (Alltech Associates) . A unit is defined as 1 nL/hr. Pirrung et al. (1993) Biochemistry 32:7445-7450, teach the purification and 10
  • recombinant refers to a nucleic acid sequence which has been obtained by manipulation of genetic material using restriction enzymes, ligases, and similar recombinant techniques as described by, for example, Sambrook et al. , Molecular Cloning: A
  • ACC oxidase includes enzymes which are capable of catalyzing the conversion of ACC to ethylene.
  • the amino acid sequence of the oxidase may or may not be identical with the amino acid sequence which occurs natively in higher plants.
  • An example of such a native sequence is shown in Fig. l [SEQ ID N0:1] which occurs in broccoli.
  • Naturally occurring allelic Initial Isolation of the ACC Oxidase cDNA
  • PCR primers can then be used to amplify the ACC oxidase gene from the cDNA template.
  • oligonucleotides used to prime the PCR were modeled after sequences of a cDNA clone of the ACC oxidase gene found in Brassica juncea (Pua et al. (1992) Plant Mol. Biology 19:541-544).
  • ACC oxidase With the ACC oxidase gene available because of PCR amplification, ACC oxidase can be produced in a variety of recombinant systems. Specifically, the ACC oxidase can be expressed in transgenic plants both in enhanced amounts and in an antisense mode to control the aspects of plant development which are ethylene sensitive, and in particular, to delay plant senescence.
  • a variety of expression systems and hosts can be used for the production of this enzyme.
  • a variety of prokaryotic hosts and appropriate vectors is known in the art; most commonly used are E. coli or other bacterial hosts such as B. subtilis or - 12 -
  • ACC oxidase in broccoli is shown in Fig. 1 [SEQ ID NO:l].
  • Preferred forms of the ACC oxidase of the invention include that illustrated herein, and those derivable therefrom by systematic mutation of the genes. Such systematic mutation may be desirable to enhance the ACC oxidase properties of the enzyme, to enhance the characteristics of the enzyme which are ancillary to its activity, such as stability, or shelf life, or may be desirable to provide inactive forms useful in the control of ACC oxidase activity in vivo.
  • ACC oxidase refers to a protein having the activity assessed by the assay set forth above; a “mutated ACC oxidase” refers to a protein which does not necessarily have this activity, but which is derived by mutation of a DNA encoding in ACC oxidase.
  • derived from mutation is meant both direct physical derivation from a DNA encoding the starting material ACC oxidase using, for example, site specific mutagenesis or indirect derivation by synthesis of DNA having a sequence related to, but deliberately different from, that of the ACC oxidase.
  • oligonucleotides of the required length can be constructed wholly or partially from their individual constituent nucleotides. petunia, and has been shown to confer expression in protoplasts of both dicots and monocots.
  • the CaMV 35S promoter has been demonstrated to be active and may be used in at least the following monocot and dicot plants with edible parts: blackberry, Rubus; blackberry/raspberry hybrid, Rubus, and red raspberry; carrot, Daucus carota ; maize; potato, Solanum tuberosum; rice, Oryza sativa; strawberry, Fragaria x ananas sa; and tomato, Lycopersicon esculentum.
  • Nos nopaline synthase
  • the nopaline synthase (Nos) promoter has been shown to be active and may be used in at least the following monocot and dicot plants with edible parts: apple, Malus pumila; cauliflower, Brassica oleracea; celery, Apiu graveolens; cucumber, Cucumis sativus; eggplant, Solanum melongena; lettuce, Lactuca sativa; potato, Solanum tuberosum; rye, Secale cereale; strawberry, Fragaria x ananas sa; tomato, Lycopersicon esculentum; and walnut, Juglans regia.
  • Organ-specific promoters are also well known.
  • the E8 promoter is only transcriptionally activated during tomato fruit ripening, and can be used to target gene expression in ripening tomato fruit (Deikman and Fischer, EMBO J (1988) 7:3315) .
  • the activity of the E8 promoter is not limited to tomato fruit, but is thought to be compatible with any system wherein ethylene activates biological processes.
  • Other organ-specific promoters appropriate for a desired target organ can be isolated using known procedures. These control sequences are generally associated with genes uniquely expressed in the desired organ. In a typical higher plant, each organ has thousands of mRNAs that are absent from other organ systems (reviewed in Goldberg, Trans.. R. Soc. London (1986) B314:343). 14 -
  • Pseudomonas and typical bacterial promoters include the trp, lac, tac, and beta-lactamase promoters.
  • a readily controllable, inducible promoter, the lambda-phage promoter can also be used.
  • a large number of control systems suitable for prokaryote expression is known in the art.
  • Transcription initiation regions include the various opine initiation regions, such as ocotopine, mannopine, nopaline and the like.
  • Plant viral promoters can also be used, such as the cauliflower mosaic virus 35S promoter.
  • plant promoters such as ribulose-l,3-diphosphate carboxylase, flower organ-specific promoters, heat shock promoters, seed-specific promoters, promoters that are transcriptionally active in associated vegetable tissue, etc. can also be used.
  • CaMV 35S promoter has been shown to be highly active in many plant organs and during many stages of development when integrated into the genome of transgenic plants including tobacco and Such sequences are often found within 400 bp of transcription initiation site, but may extend as far as 2000 bp or more.
  • the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in this natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
  • any of a number of promoters which direct transcription in plant cells is suitable.
  • the promoter can be either constitutive or inducible.
  • Promoters of bacterial origin include the octopine synthase promoter, the nopaline synthase promoter and other promoters derived from native Ti plasmids (Herrera-Estrella et al., Nature (1983) 303:209-213).
  • Viral promoters include the 35S and 19S RNA promoters of cauliflower mosaic virus (O'Dell et al. , Nature (1985) 313:810-812.
  • Plant promoters include the ribulose-1,3-diphosphate carboxylase small subunit promoter and the phaseolin promoter.
  • the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination.
  • the termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
  • DNA sequences which direct polyadenylation of the RNA are also commonly added to 16
  • the gene coding for ACC oxidase in hand is ligated to a promoter using standard techniques now common in the art.
  • the expression system may be further optimized by employing supplemental elements such as transcription terminators and/or enhancer elements.
  • the recombinant expression cassette will contain in addition to the ACC oxidase-encoding sequence, a plant promoter region, a transcription initiation site (if the coding sequence to be transcribed lacks one) , and a transcription termination sequence.
  • Unique restriction enzyme sites at the 5' and 3' ends of the cassette are typically included to allow for easy insertion into a pre ⁇ existing vector.
  • Promoter sequence elements include the TATA box consensus sequence (TATAAT) , which is usually 20-30 base pairs (bp) upstream of the transcription start site. In most instances, the TATA box is required for accurate transcription initiation. By convention, the start site is called +1. Sequences extending in the 5' (upstream) direction are given negative numbers and sequences extending in the 3' (downstream) direction are given positive numbers.
  • TATAAT TATA box consensus sequence
  • a promoter element with a series of adenines surrounding the trinucleotide G (or T)NG (Messing, J. et al., in Genetic Engineering in Plants. Kosage, Meredith and Hollaender, eds. (1983) pp. 221-227).
  • T trinucleotide G
  • Other sequences conferring tissue specificity, response to environmental signals, or maximum efficiency of transcription may also be found in the promoter region.
  • vectors can also be constructed that contain in-frame ligations between the sequence encoding the ACC oxidase protein and sequences encoding other molecules of interest resulting in fusion proteins, by techniques well known in the art.
  • transgenic plants are prepared which contain the desired expression system.
  • a number of techniques are available for transformation; in general, only dicots can be transformed using Agrobacterium-mediated infection.
  • the vector is microinjected directly into plant cells by use of micropippettes to mechanically transfer the recombinant DNA (Crossway, Mol. Gen. Genetics (1985) 202:179-185) .
  • the genetic material is transferred into the plant cell using polyethylene glycol (Krens, et al. Nature (1982) 296:72-74) . or high velocity ballistic penetration by small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface, is used (Klein, et al., Nature (1987) 327:70-73) .
  • protoplasts are fused with other entities which contain the DNA whose introduction is desired. These entities are minicells, cells, lysosomes or other fusible lipid- surfaced bodies (Fraley, et al., Proc. Natl. Acad. Sci. USA (1982) 79_:1859-1863.
  • DNA may also be introduced into the plant cells by electroporation (Fromm et al., Proc. Natl. Acad. Sci. USA (1985) £2.:5824) .
  • plant protoplasts are electroporated in the presence of plasmids containing the expression cassette.
  • Polyadenylation is of importance for expression of the ACC oxidase-encoding RNA in plant cells.
  • Polyadenylation sequences include, but are not limited to the AgrroJbacterium octopine synthase signal (Gielen et al. , EMBO J (1984) 3:835- 846) or the nopaline synthase signal (Depicker et al., Mol. and Appl. Genet. (1982) 1:561-573).
  • the resulting expression system or cassette is ligated into or otherwise constructed to be included in a recombinant vector which is appropriate for higher plant transformation.
  • the vector will also typically contain a selectable marker gene by which transformed plant cells can be selected for and identified in culture.
  • the marker gene will encode antibiotic resistance. These markers include resistance to G418, hygromycin, bleomycin, kanamycin, and gentamicin. After transforming the plant cells, those cells having the vector will be identified by their ability to grow on a medium containing the particular antibiotic.
  • Replication sequences, of bacterial or viral origin are generally also included to allow the vector to be cloned in a bacterial or phage host, preferably a broad host range prokaryotic origin of replication is included.
  • a selectable marker for bacteria should also be included to allow selection of bacterial cells bearing the desired construct. Suitable prokaryotic selectable markers also include resistance to antibiotics such as kanamycin or tetracycline.
  • DNA sequences encoding additional functions may also be present in the vector, as is known in the art.
  • T-DNA sequences will also be included for subsequent transfer to plant chromosomes.
  • SUBSTITUTE SHEET (RULE 26 or Ri plasmid, in which the disease-causing genes have been deleted, can be used as a vector for the transfer of the gene constructs of this invention into an appropriate plant cell.
  • telomeres are recombinant Ti and Ri plasmids in general follows a method typically used with the more common bacterial vectors, such as pBR322. Additional use can be made of accessory genetic elements sometimes found with the native plasmids and sometimes constructed from foreign sequences. These may include but are not limited to "shuttle vectors", (Ruvkum and Ausubel, Nature (1981) 29.8:85-88), promoters (Lawton et al., Plant Mol. Biol. (1987) 9_:315-324) and structural genes for antibiotic resistance as a selection factor (Fraley et al., Proc. Natl. Acad. Sci. (1983) 80:4803- 4807) .
  • shuttle vectors (Ruvkum and Ausubel, Nature (1981) 29.8:85-88)
  • promoters Lawton et al., Plant Mol. Biol. (1987) 9_:315-324)
  • the shuttle vector containing the gene of interest is inserted by genetic recombination into a non-oncogenic Ti plasmid that contains both the cis- acting and trans-acting elements required for plant transformation as, for example, in the pMLJl shuttle vector of DeBlock et al., EMBO J (1984) 3:1681-1689 and the non-oncogenic Ti plasmid pGV2850 described by Zambryski et al., EMBOJ (1983) 2:2143-2150.
  • the gene of interest is inserted into a shuttle vector containing the cis- acting elements required for plant transformation.
  • Electroporated plant protoplasts reform the cell wall, divide and regenerate.
  • a plant cell For transformation mediated by bacterial infection, a plant cell is infected with Agrobacterium tumefaciens or Agrobacterium rhizogenes previously transformed with the DNA to be introduced.
  • AgrroJbacterium is a representative genus of the gram-negative family Rhizobiaceae. Its species are responsible for crown gall ⁇ A . tumefaciens) and hair root disease (A . rhizogenes) .
  • the plant cells in crown gall tumors and hairy roots are induced to produce amino acid derivatives known as opines, which are catabolized only by the bacteria.
  • the bacterial genes responsible for expression of opines are a convenient source of control elements for chimeric expression cassettes.
  • assaying for the presence of opines can be used to identify transformed tissue.
  • Heterologous genetic sequences can be introduced into appropriate plant cells, by means of the Ti plasmid of A . tumefaciens or the Ri plasmid of A . rhizogenes.
  • the Ti or Ri plasmid is transmitted to plant cells on infection by Agrobacterium and is stably integrated into the plant genome (Schell, J. , Science (1987)
  • Ti and Ri plasmids contain two regions essential for the production of transformed cells.
  • One of these, named transferred.DNA (T-DNA) is transferred to plant nuclei and induces tumor or root formation.
  • the other, termed the virulence (vir) region is essential for the transfer of the T-DNA but is not itself transferred.
  • the T-DNA will be transferred into a plant cell even if the vir region is on a different plasmid (Hoekema, et al., Nature (1983) 303:179-189).
  • the transferred DNA region can be increased in size by the insertion of heterologous DNA without its ability to be transferred being affected.
  • a modified Ti Plant regeneration from cultured protoplasts is described in Evans et al.
  • Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts or a petri plate containing transformed explants is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently root. Alternatively, somatic embryo formation can be induced in the callus tissue. These somatic embryos germinate as natural embryos to form plants.
  • the culture media will generally contain various amino acids and plant hormones, such as auxin and cytokinins. It is also advantageous to add glutamic acid and proline to the medium, especially for such species as corn and alfalfa. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is usually reproducible and repeatable.
  • a large number of plants have been shown capable of regeneration from transformed individual cells to obtain transgenic whole plants.
  • regeneration has been shown for dicots as follows: apple, Malus pumila; blackberry, Rubus; Blackberry/raspberry hybrid, Rubus; red raspberry, Rubus; carrot, Daucus carota, cauliflower, Brassica oleracea; celery, Apium graveolens; cucumber, Cucumis 22
  • Identification of transformed cells or plants is generally accomplished by including a selectable marker in the transforming vector, or by obtaining evidence of successful bacterial infection.
  • Plant cells which have been transformed can also be regenerated using known techniques. ACC OXIDASE GENE OBTAINED FROM B. OLERACEA CDNA CLONES
  • Oligo dT-cellulose chromatography was then used to enrich for polyA + RNA.
  • the procedure involved mixing total broccoli floret RNA (this includes messenger RNA or polyA + RNA) with oligo dT-cellulose in 20mM NaCl and Tris buffer.
  • the oligo-dT cellulose was washed to eliminate non-polyadenylated RNAs from the cellulose.
  • polyA + RNA was eluted from the cellulose by elution in Tris buffer that includes no NaCl.
  • Single-stranded cDNA was synthesized using the polyA + RNA template from Example 2.
  • a 50uL reaction included 1 X First Strand cDNA Synthesis Buffer (GIBCO BRL, Gaithersburg, Maryland), 1 ug polyA + RNA, 1 mM dNTP's - 24 -
  • the regenerated plants selected from those listed are transferred to standard soil conditions and cultivated in a conventional manner.
  • the expression cassette After the expression cassette is stably incorporated into regenerated transgenic plants, it can be transferred to other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
  • FIG. 2 illustrates the cDNA and amino acid sequences of B . oleracea ACC oxidase [SEQ ID NOS:l and 2] compared to the cDNA and amino acid sequences of B . juncea ACC oxidase [SEQ ID NOS:9 and 10] .
  • the 1 kb ACC oxidase PCR fragment was cloned into the pCRIITM vector, included in the TA Cloning Kit available from Invitrogen Corporation (San Diego, California) to obtain a clone known as EFEG3 (Fig. 4) .
  • the sequence of the inserted gene in EFEG3 was verified by nucleotide DNA sequencing using a U.S. Biochemical (Cleveland, Ohio) dideoxy sequencing kit (Fig. 1 ) (SEQ ID N0:2) .
  • ACC oxidase cDNA sequence was PCR amplified from total Brassica oleracea first strand cDNA with the use of the cDNA template obtained as above.
  • the polymerase chain reaction (PCR) was carried out using reagents supplied with the Perkin Elmer Cetus Gene Amp PCR Kit under the following conditions: -0.1 ug/mL total cDNA of Brassica oleracea, 1.5mM MgCl 2/ 24ug/mL of each oligomer primer, 200uM each dNPT, kit reaction buffer, and AmpliTaq DNA ploymerase supplied with the kit.
  • Oligonucleotides used to prime the PCR were modeled after sequences of a cDNA clone of the ACC oxidase gene found in brassica juncea (Pua et al. (1992) Plant Mol. Biology 19:541-544).
  • Oligomer primers RMM389 (5' GAGAGAGCCATGGAGAAGAACATTAAGTTTCCAG 3' , complementary to the 5' end of the cDNA clone of brassica juncea ACC oxidase gene) (SEQ ID NO:3) and
  • RMM391 (5' CGGCATCTCTGAAAGATTTTTGTGGATCCTCAAACTCGC 3', complementary to the 3' end of the cDNA clone of EXAMPLE 7
  • the antisense cassette EFEG3FL AS (Fig. 4) was inserted into the unique Hindlll site of binary vector pGA482G to produce plasmid pEPG604 (Fig. 4) .
  • pGA482G is available from Gynehung An, Institute of Biological Chemistry, Washington State University in the form of pGA482 followed by the insertion of a gentamicin resistance gene.
  • the sense cassette EFEG3FL (Fig. 4) was inserted into the unique Hindlll site of binary vector pGA482G to produce plasmid pEPG606 (Fig. 4) .
  • the structures shown in Fig. 4 were verified by restriction analysis.
  • the binary plasmids pEPG604 and pEPG606 are transformed into strains of AgrroJbacterium tumefaciens, e.g., strain C58Z707 and A ⁇ rrobacterium rhizogenes, e . g . , strain A 4 .Strain C58Z707 is available from Augus Hebpurn at Indiana University, Bloomington, Indiana (Hepburn et al., (1985) J. Gen. Micro. 131:2961-2969). Strain A 4 is available from Jerry Slightom, The Upjohn Company, Kalamazoo, Michigan. Evidence of the origin of the strain A 4 is presented by Slightom et al. J. Biol. Chem. (1986) Vol. 261, No. 1 pp. 108-121. The resulting Agrobacteri urn strain is used to perform B . oleracea plant transformation procedures.
  • a ⁇ robacteriurn-mediated transfer of the plant expressible Brassica oleracea ACC oxidase is done using procedures known to those skilled in the art.
  • the resulting PCR fragment was cloned into the pCRII cloning vector included in the TA cloning kit available from Invitrogen Corporation to obtain a clone known as EFEG3' .
  • EFEG3' was digested with Ncol to produce an Ncol cDNA fragment encoding B. oleracea ACC oxidase.
  • this fragment was inserted into the expression cassette pUCl ⁇ cp express in an antisense orientation to obtain EFEG3cel and in the sense orientation to obtain EFEG3ce7 (Fig. 4) .
  • pUCl ⁇ cp express includes about 330 base pairs of the CaMV 35S transcript promoter and 70 bp of the cucumber mosaic virus 5' -untranslated region.
  • the region flanking the 3' end of the inserted gene includes 200 bp of the CaMV35S transcript poly(A) addition signal.
  • the Nco I site maintains the ATG translation initiation site found in the ACC oxidase gene.
  • Sense orientation constructs are designed to give sense mRNA that can be translated into ACC oxidase in the plant.
  • the antisense orientation of the Ncol fragment in EFEG3cel is designed to transcribe mRNA in the plant that is complementary to the sense mRNA; no B.
  • oleracea ACC oxidase protein can be translated in the plant from this construct.
  • protein in leaf tissue samples taken from RI transgenic lettuce seedlings is extracted and analyzed for NPTII protein by enzyme-linked immunosorbant assay (ELISA) .
  • ELISA enzyme-linked immunosorbant assay
  • transgenic plants for inhibition of ethylene biosynthesis can be accomplished by assaying transgenic B. oleacea materials for expression of ACC oxidase antisense RNA using a Northern analysis or a RNase protection assay.
  • RNA extracted from transgenic B . oleracea is subjected to agarose electrophoresis and blotted onto a Nylon membrane.
  • a radioactive ( 32 P- labelled) RNA probe (sense RNA) synthesized in vi tro is used to hybridize the blot.
  • antisense RNA of the ACC oxidase trangene in the plant will bind to the 32 P- labelled RNA probe; thus antisense ACC oxidase RNA will be detected by autoradiography.
  • Parallel hybridization of replicate blots with antisense ACC oxidase RNA probe serves as a check on the hybridization with the sense RNA probe.
  • the RNase protection assay involves hybridizing a labelled RNA molecule (pure sequence synthesized in vi tro) with total tissue RNA in solution in a tube. Only complementary RNA will hybridize with the pure RNA labelled and sythesized in vitro . The total pool of RNA is subjected to RNase A and RNase T, digestion; protected mRNAs are resistant to RNase digestion. 30
  • hypocotyls are transferred to MS medium containing 50 mg/1 kanamycin sulfate, 500 mg/1 carbenicillin and 200 mg/1 cefotaxime (MS-0) .
  • Hypocotyls are continuously subcultured every 21 days on MS-0 medium until shoots form. Shoots are then removed from agar and potted in soil.
  • Transgenic plants Ro
  • Transfer of this gene into plant cells can also be accomplished using other methods, such as direct DNA uptake (Paszkowski, et al, EMBO J. , 1084, 3:2717), microinjec ion (Crossway, et al., Mol Gen. Genet.
  • Transgenic status of RQ plants and their segregating progeny is verified by routine methods. These include ELISA assays for NPTII protein detection; DNA assays such as PCR amplification (detection) of transgenes and Southern blot hybridization for detection of transgenes. T, (5,000 U/ml) Sigma R-8251, and 25 ⁇ h of Ribonuclease A(10 mg/ml) Sigma R-4875.
  • the Ziplock bag was placed flat on a hard surface.
  • a one-liter Corning media-bottle was firmly rolled across the surface of the bag repeatedly until the leaf tissue was disrupted and had the consistency of applesauce.
  • the macerated sample was moved to a bottom corner of the Ziplock bag and the corner was cut with a scissors. The entire sample was squeezed into a sterile 15-mL
  • the sample was centrifuged in a Eppendorf microfuge for 60 seconds to pellet the precipitate. The supernatant was discarded, and the tube was inverted on a paper towel to drain. 500 ⁇ l of high salt solution (10 mM Tris pH 8.0, 1 M NaCl, 1 mM EDTA pH 8.0) was added, and the sample was incubated at 65°C for 15 minutes to dissolve the DNA. One ml of 100% ethanol was added and the sample was placed at -20°C for one hour or overnight to precipitate DNA. DNA was hooked or spooled with a 1.5 ml capillary pipet and placed into a sterile 1.5 ml Eppendorf tube. The DNA pellet was washed by adding 1 ml of wash solution (80% ethanol, 15 mM ammonium acetate) and incubated at room temperature 32 -
  • Protected mRNAa are evaluated quantitatively and qualitatively on an acrylamide gel.
  • the transgenic materials or tissues are assayed for ACC oxidase activity. This can be accomplished by the assay methods outlined above for measuring ACC oxidase activity.
  • immunological methods for example, ELISA or Western blots
  • transgenic would exhibit reduced levels of ACC oxidase protein compared with non-transgenic materials.
  • CTAB extraction buffer 1% (w/v) CTAB Sigma H-5882; 1.4 M NaCl; 100 mM Tris HCl pH 8.0; 30 mM EDTA pH 8.0
  • EFE3-1 was digested with Ncol to produce a 1528 bp Ncol fragment encoding genomic B. oleracea ACC oxidase; two internal Ncol sites near the 5' end of the gene resulted in the elimination of about 220 bp of the gene by Ncol digestion (Figs. 3 and 5) .
  • this fragment was inserted into the expression cassette pUCl ⁇ cp express in an antisense orientation to obtain EFE2.7 and in the sense orientation to obtain EFE3.3 (Fig. 5).
  • the washed DNA was dissolved in 300 ⁇ L of sterile water.
  • PCRs Polymerase chain reactions
  • Reaction tubes were subject to 93°C for 1 min, 55 °C for 1 min., the 72°C for 3 min. for 30 cycles in a Perkin Lemer Thermocycler.
  • Oligonucleotides used to prime the PCR were modeled after sequences of a cDNA close of the ACC oxidase gene found in Brassica juncea (Pua et al. (1992) Plant Mol. Biology 19:541-544). Oligomer primers RMM389 (5'
  • GAGAGAGCCATGGAGAAGAACATTAAGTTTCCAG 3' complementary to the 5' end of the cDNA clone of Brassica juncea ACC oxidase gene) (SEQ ID NO:3) AND rmm390 (5' CCGCCAATTAACAACCAGGTACCACAAATTTCACACCC 3' , complementary to the 3' end of the cDNA clone of
  • Brassica juncea ACC oxidase gene (SEQ ID NO:7) were used to prime this reaction. (Fig. 3) .
  • the genomic ACC oxidase PCR fragment was cloned into the pCRII vector (Invitrogen Corporation, San Diego,
  • EFE3-1 a clone known as EFE3-1 (Fig. 5) .
  • the sequence of the insert gene in EFE3-1 was verified EXAMPLE 17
  • Brassica oleracea ACC oxidase antisense constructs were transferred to melon ( Cucumis melo) plants via Agrobacteria-mediated transformation using procedures published by Fang and Grumet (1990 and 1993) .
  • the pEPG600 and pEPG604 constructs were transformed into melon (see Figures 4 and 5 for restriction maps of thesa binary plasmids) .
  • Hindlll fragments harboring full-length cDNA clone antisense and sense cassettes were isolated.
  • the antisense cassette EFE3.7 AS (Fig. 5) was inserted into the unique Hindlll site of binary vector pGA482G to produce plasmid pEPG600 (Fig. 5) .
  • the sense cassette EFE3.3 SENSE (Fig. 5) was inserted into the unique Hindlll site of binary vector pGA482G to produce plasmid pEPG602 (Fig. 5) .
  • the structures shown in Fig. 5 were verified by restriction analysis.
  • the binary plasmids are transformed into Agrrobacterium strains A* and C58Z707 as in Example 8.
  • the resulting Agrobacterium strain is used to perform B. oleracea plant transformation procedures.
  • ACC oxidase antisense transgene expression was evaluated in a number of RQ and R- melon plants by Northern blot hybridization. This assay measures levels of accumulated B. oleracea ACC oxidase antisense RNA.
  • RNA was extracted from transgenic Cucumis melo leaves with the use of an RNA extraction kit (Trireagent) supplied by Molecular Research Center, Inc. (Cincinnati, OH) . Total melon leaf RNA was subjected to glyoxalation before separation by agarose gel electrophoresis. After electrophoresis, RNA was pressure blotted onto a Nylon membrane (Hybond N, Amersham) with the use a Stratagene pressure blotter (La Jolla, CA) .
  • Radioactive ( 3 P-labelled) RNA probe (sense RNA) was synthesized in vi tro with the use of RNA transcription vectors, for example pGEM-3 (Promega, Madison, WI) .
  • RNA transcription vectors for example pGEM-3 (Promega, Madison, WI) .
  • the pGMM plasmid harboring the ACC oxidase coding sequence was linearized with BamHI and used as template for sense RNA synthesis in vi tro.
  • Radioactive 32 P-labelled probe was synthesized under the following reaction conditions: 2 ⁇ g linearized template DNA, T3/T7 buffer RNA blot analysis of melon plants transgenic for the B.
  • oleracea ACC oxidase antisense construct in pEPG604 shows accumulation of ACC oxidase antisense RNA ( Figures 6, 7, and 8) .
  • transgenic R Q melon plants 4168-18, 4168-10, 4168-20, and 4168-21 accumulate substantial levels of ACC oxidase antisense transcript ( Figure 6 and Table II) .
  • Figure 7 shows an autoradiogram of RNA blot of total RNA extracted from R 0 transgenic melon plants (leaves) hybridized with B. oleracea ACC oxidase sense RNA probe (approximately 50 x 10 6 cpm 32 P-labelled RNA probe) .
  • RNA extracted from melon plants transformed with virus coat protein cassettes and RNA extracted from red cabbage plants transformed with pEPG604 are also included
  • RNA MW Markers Approximately 10 ug total plant RNA was loaded in each well.
  • Lane 1 RNA MW Markers; lane 2, melon line CAIO transformed with pEPG328 (virus coated protein cassettes); lane 3, melon line CA40 transformed with pEPG328; lane 4, line 4168-11B; lane 5, line 4168-18; lane 6, 4168-19; lane 7, melon line 626 transformed with pEPG212 (virus coat protein cassettes); lane 8, CA10 melon nontransgenic control; lane 9, 4168-10; lane 10, 4168-20; lane 11, 4168-21; lane 12, 4168-15B; lane 13, red cabbage transgenic line 604-30 transformed with PEPG604; lane 14,, nontransgenic red cabbage; lane 15, B.
  • Number 4168 refers to melon line CA10 transformed with PEPG604 (see Table II for details) .
  • each RNA blot included an antisense and sense in vi tro transcript of ACC oxidase (for example, lanes 15 and 16, respectively, in Figures 6 and 7) .
  • ACC oxidase sense RNA in vitro transcript probe hybridized specifically with antisense in vi tro transcript (for example, see Figures 6 and 7, lanes 15 and 16) .
  • the sense RNA transcript probe did not hybridize with blotted antisense transcript ( Figures 6, and 7, lane 16) .
  • Hybridizations signals produced in RNA extracted from nontransgenic red cabbage, melons, and broccoli were compared with RNA extracted from pEPG604-transformed red cabbage melons, and broccoli. Only RNA samples extracted from transgenic plants produced an ACC oxidase antisense signal (for example, Figure 6, lanes 13 and 14) .
  • RNA blot analysis of R. progeny of 4168-10, 4168-19, and 4168-20 shows that some progeny accumulate ACC oxidase antisense RNA to high levels, and others accumulate lower levels of antisense RNA ( Figures 7 and 8 and Table III) .
  • Figure 7 shows an RNA blot of total RNA extracted from R* transgenic melon progeny of line 4168-10 hybridized with B. oleracea ACC oxidase sense RNA probe (about 50 x 10 6 cpm 32 P-labelled RNA probe) . Approximately 10 ug total RNA was electrophoresed in each lane. Seed taken from a fruit produced on RQ plant 4168-10 was germinated and RNA samples were extracted from seedlings for analysis.
  • Lane 1 RNA MW markers; land 2, melon line CA10 transformed with pEPG328; lane 3, 4168-10-1; lane 4, 4168-10-2; lane 5, 4168-10-3; lane 6, 4168-10-4; lane 64168-10-4; lane 7, 4168-10-5; lane 8, CA10 transformed with pEPG196; lane 9, 4168-10-6; lane 10, 4168-10-7; lane 11, 4168-10-8; lane 12, 4168- 10-9; lane 13, 4168-10-11; lane 14, 4168-18 RQ,- lane 15, B. oleracea ACC oxidase antisense RNA synthesized in vi tro; and lane 16, B. oleracea ACC oxidase sense RNA synthesized in vi tro .
  • Number 4168 refers to melon line CA10 transformed with PEPG604 (see Table II for details) .
  • Figure 8 shows an RNA blot of total RNA extracted from R- transgenic melon progeny of lines 4168-19 and 4168-20 hybridized with B. oleracea ACC oxidase sense RNA probe. Electrophoresis and hybridization conditions were similar to conditions used in Figures 3 and 4. Seed taken from produced on RQ plants 4168-19 and 4168-- 20 was germinated and RNA samples were extracted from seedlings for analysis.
  • Lane 1 RNA MW markers; Lane 2, CA10 transformed with PEPG328; lane 3, 4168--19-12; lane 4 , 4168 - 20 - 1 ; lane 5 , 4168 - 20 -21ane 6 , 4168 - 19 - 13 ; lane 7 , 4168 - 19 - 14 ; lane 8 , 4168 -20 - 3 ; lane 9 , 4168 - 20 - the art that various modifications thereof can be made without departing from the true spirit and scope of the invention. Accordingly, it is intended that the following claims cover all such modifications with the full inventive concept.
  • ACC oxidase truncated antisense were also compared with transcripts produced from the cassette in pEPG608 (ACC oxidase truncated antisense) following transformation into red cabbage. ACC oxidase transcripts detected in red cabbage plants transformed with the full length construct are longer than the transcripts detected in red cabbage plants transformed with the truncated ACC oxidase construct. This result demonstrates conclusively that the sense RNA problem is detecting only ACC oxidase antisense RNA transcripts.
  • RNA in these plants are analyzed in the same way. These binary plasmids include ACC synthase antisense RNA constructs.
  • the analysis includes Northern analysis to evaluate B . oleracea ACC synthase antisense RNA accumulation and reduction in levels of endogenous ACC synthase antisense RNA accumulation and reduction in levels of endogenous ACC synthase sense RNA levels. The analysis shows expression of RNA in these plants.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

On décrit l'utilisation de l'ADN complémentaire et de l'ADN génomique codant l'oxydase de l'acide 1-aminocyclopropane-1-carboxylique (ACC) de broccoli, ainsi que des produits de recombinaison anti-sens renfermant ces séquences d'ADN, pour réguler le niveau de l'oxydase ACC et donc la maturation et le vieillissement de plantes du type Brassica oleracea, ce qui permet de modifier la durée de conservation de ces plantes, par exemple de l'augmenter.
EP95922249A 1994-09-02 1995-06-07 Plantes transgeniques exprimant les genes de l'oxydase de l'acide 1-aminocyclopropane-1-carboxylique Withdrawn EP0779926A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US30033594A 1994-09-02 1994-09-02
US300335 1994-09-02
PCT/US1995/007233 WO1996007742A1 (fr) 1994-09-02 1995-06-07 Plantes transgeniques exprimant les genes de l'oxydase de l'acide 1-aminocyclopropane-1-carboxylique

Publications (1)

Publication Number Publication Date
EP0779926A1 true EP0779926A1 (fr) 1997-06-25

Family

ID=23158677

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95922249A Withdrawn EP0779926A1 (fr) 1994-09-02 1995-06-07 Plantes transgeniques exprimant les genes de l'oxydase de l'acide 1-aminocyclopropane-1-carboxylique

Country Status (5)

Country Link
EP (1) EP0779926A1 (fr)
AU (1) AU715924B2 (fr)
CA (1) CA2198708A1 (fr)
IL (1) IL115116A0 (fr)
WO (1) WO1996007742A1 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPN286295A0 (en) * 1995-05-09 1995-07-06 Allrad No.1 Pty Ltd Transgenic carnations exhibit prolonged post-harvest life
US6448474B1 (en) 1995-06-07 2002-09-10 University Of Hawaii Purified proteins, recombinant DNA sequences and processes for controlling the ripening of coffee plants
US5874269A (en) * 1995-06-07 1999-02-23 University Of Hawaii Purified proteins, recombinant DNA sequences and processes for controlling the ripening of coffee plant
US6075184A (en) * 1996-03-26 2000-06-13 University Of Hawaii Purified proteins, recombinant DNA sequences and processes for producing caffeine free beverages
CA2492544A1 (fr) 2002-08-02 2004-02-12 Basf Plant Science Gmbh Modification d'huile de graines par expression d'une cytidyltransferase putative dans des plantes transgeniques
CN110643631A (zh) * 2019-10-23 2020-01-03 宜春学院 含双报告基因的菊花aco基因过表达载体及其构建方法

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8916213D0 (en) * 1989-07-14 1989-08-31 Ici Plc Dna constructs,cells and plants derived therefrom
MX9100993A (es) * 1990-09-10 1992-05-04 Us Agriculture Secuencia de adn aislado y enzima acido 1-aminociclopropan-1-carboxilico sintasa,recombinante
GB9027616D0 (en) * 1990-12-20 1991-02-13 Ici Plc Dna,dna constructs,cells and plants derived therefrom
BR9107191A (pt) * 1990-12-26 1994-06-14 Monsanto Co Controle de amadurecimento de frutos e senescência em plantas
IL107239A0 (en) * 1992-10-15 1994-01-25 Gen Hospital Corp Crucifer acc synthase polypeptide, methods for the production thereof and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9607742A1 *

Also Published As

Publication number Publication date
AU2700095A (en) 1996-03-27
IL115116A0 (en) 1995-12-08
CA2198708A1 (fr) 1996-03-14
WO1996007742A1 (fr) 1996-03-14
AU715924B2 (en) 2000-02-10

Similar Documents

Publication Publication Date Title
Bovy et al. Heterologous expression of the Arabidopsis etr1-1 allele inhibits the senescence of carnation flowers
US5908973A (en) DNA encoding fruit-ripening-related proteins, DNA constructs, cells and plants derived therefrom
US6207881B1 (en) Control of fruit ripening through genetic control of ACC synthase synthesis
AU742461B2 (en) Inducible plant promoters
US5689042A (en) Transgenic plants with altered senescence characteristics
AU724942B2 (en) Transgenic potatoes having reduced levels of alpha glucan L- or H-type tuber phosphorylase activity with reduced cold-sweetening
US5633440A (en) P119 promoters and their uses
AU657276B2 (en) Recombinant ACC synthase
Robert et al. Antisense RNA inhibition of β-glucuronidase gene expression in transgenic tobacco plants
US5545815A (en) Control of fruit ripening in plants
CA2219962C (fr) Plantes en c3 exprimant un enzyme de photosynthese de plantes en c4
US6350935B1 (en) Fruit-specific and ripening-regulation expansin gene to control fruit texture and softening
AU709862B2 (en) Transgenic plants expressing ACC synthase gene
AU715924B2 (en) Transgenic plants expressing ACC oxidase genes
Wu et al. Functional characterization of seed coat-specific members of the barley germin gene family
US5723746A (en) Reduced ethylene synthesis and delayed fruit ripening in transgenic tomatoes expressing S-adenosylmethionine hydrolase
US6043409A (en) Transgenic plants expressing ACC oxidase genes
WO1998045412A1 (fr) Genes de la fructokinase et leur utilisation dans la mise au point metabolique de la teneur en sucre de fruits
WO1995032288A1 (fr) Genes induits par des nematodes dans la tomate
Yang et al. Activity of the Arabidopsis blue copper-binding protein gene promoter in transgenic tobacco plants upon wounding
WO2001071013A2 (fr) Agents promoteurs de melon destines a l'expression de transgenes dans des plantes
AU721557B2 (en) Polyphenol oxidase genes from lettuce and banana
WO2001007586A2 (fr) Enzyme biosynthetique d'acides gras a chaines longues de plantes
MXPA97001475A (en) Transgenic plants expressing deoxidase genes
WO1995014092A1 (fr) Adn, produits de recombinaison d'adn, cellules et plantes derivees desdits produits

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970228

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): ES FR GB IT NL

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SEMINIS VEGETABLE SEEDS, INC.

17Q First examination report despatched

Effective date: 20000526

111Z Information provided on other rights and legal means of execution

Free format text: 20010920 ES FR GB IT NL

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20010903