AU715924B2 - Transgenic plants expressing ACC oxidase genes - Google Patents

Description

WO 96/07742 PCT/US95/07233 1

TITLE

TRANSGENIC PLANTS EXPRESSING ACC OXIDASE GENES Field of the Invention This invention relates to the plant enzyme ACC oxidase which is essential for the production of ethylene in higher plants. More particularly, the invention relates to the DNA sequence of a Brassica oleracea ACC oxidase, DNA constructs containing this sequence, plant cells containing the constructs and plants derived therefrom.

Background of the Invention The enzyme ACC oxidase (also known as ethylene forming enzyme) is essential to the production of ethylene in higher plants. It is well known that ethylene is related to various events in plant growth and development including fruit ripening, seed germination, abscission, and leaf and flower senescence. Ethylene production is strictly regulated by the plant and is induced by a variety of external factors, including the application of auxins, wounding, anaerobic conditions, viral infection, elicitor treatment, chilling, drought SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 2 and ions such as cadmium and lithium ions, known as ethylene-inducible events. In addition, it recently has been shown that ethylene production begins after harvest (Tian et al. (1994) "A Role for Ethylene in the Yellowing of Broccoli After Harvest", J. Amer. Soc.

Hort. Sci. Vol. 119: 276-281).

The pathway for ethylene synthesis in plants was first described by Adams and Yang, PNAS, USA 76:170-174 (1979) who identified l-aminocyclopropane-l-carboxylic acid as an intermediate in the conversion of methionine to ethylene. The physiology and biochemistry of ethylene synthesis was extensively reviewed by Yang and Hoffman in Ann. Rev. Plant Physiol. 35:155-189 (1984).

In the ethylene biosynthetic pathway, methionine is catalyzed by the enzyme S-adenosylmethionine synthetase to form S-adenosylmethionine (SAM). SAM is then catalyzed to form the three-membered-ring amino acid 1aminocyclopropane-1-carboxylic acid (ACC) by the enzyme ACC synthase. This three-membered-ring amino acid is then catalyzed by the enzyme ACC oxidase to form ethylene.

The ethylene forming enzyme genes in tomato plants were the first to be isolated. Smith et al. (1986) Planta 168:94-100 reported the rapid appearance of an mRNA correlated with ethylene synthesis encoding a protein of molecular weight 35000.

A number of molecular strategies have been used to inhibit ethylene formation in transgenic plants.

Theologis et al., Cell, 70:181-184 (1992), report using updated antisense RNA and ACC deaminase approaches.

Gray et al, Plant Mol. Biol. 19:69-87 (1992), report the manipulation of fruit ripening with antisense genes. Both ACC oxidase (Hamilton et al., Nature SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 3 (1990) 346:284-296) and ACC synthase (Oeller et al, Science (1991) 254:437-439) antisense constructs have been used successfully to inhibit ethylene production in transgenic tomato plants. Klee et al. ((1991) The Plant Cell 3:1187-1193) overexpressed a Pseudomonas

ACC

deaminase gene in transgenic tomato plants.

ACC

deaminase converts ACC to a-ketobutyrate. This approach led to 90%-97% inhibition of ethylene production during fruit ripening in transgenic plants.

As is well known, a cell manufactures protein by transcribing the DNA of the gene for that protein to produce messenger RNA (mRNA), which is then processed by the removal of introns) and finally translated by ribosomes into protein. This process may be inhibited by the presence in the cell of "antisense RNA". By this term is meant an RNA sequence which is complementary to a sequence of bases in the mRNA in question: complementary in the sense that each base (or the majority of bases) in the antisense sequence (read in the 3' to 5' sense) is capable of pairing with the corresponding base (G with C, A with U) in the mRNA sequence read in the 5' to 3' sense. It is believed that this inhibition takes place by formation of a complex between the two complementary strands of RNA, preventing the formation of protein. How this works is uncertain: the complex may interfere with further transcription, processing, transport or translation, or degrade the mRNA, or have more than one of these effects. Such antisense RNA may be produced in the cell by transformation with an appropriate DNA construct arranged to transcribe backwards part of the coding strand (as opposed to the template strand) of the relevant gene (or of a DNA sequence showing substantial homology therewith).

SUBSTITUTE SHEET (RULE 26) WO96/07742 PCT/US95/07233 4 The use of this technology to downregulate the expression of specific plant genes is well known.

Reduction of gene expression has led to a change in the phenotype of the plant: either at the level of gross visible phenotypic difference, lack of anthocyanin production in flower petals of petunia leading to colorless instead of colored petals (van der Krol et al., Nature, 333, 866-869, 1988); or at a more subtle biochemical level, change in the amount of polygalacturonase and reduction in depolymerization of pectin during tomato fruit ripening (Smith et al., Nature, 334, 724-726). Thus, antisense RNA has been proven to be useful in achieving downregulation of gene expression in plants.

Information Disclosure WO 92/04456 reports the isolation of a gene encoding the ACC synthase gene derived from zucchini and transgenic plants in which ethylene production is modified to control changes associated with fruit ripening.

WO 92/11371 reports a gene encoding an ethylene forming enzyme gene derived from melon and transgenic plants in which ethylene production is modified to control changes associated with fruit ripening, improved fruit quality, improved flavor and texture, and the possibility of production over a longer harvest period.

WO 92/11372 reports a peach gene encoding ethylene forming enzyme and plants transformed with the peach ethylene forming enzyme gene construct. These constructs modify ethylene-associated ripening changes, reduced rate of deterioration after harvest, and allowed storage for longer periods.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 5 WO 94/08449 reports the isolation of a gene encoding the ACC synthase polypeptide derived from Crucifier and transgenic plants in which ethylene production is modified to control changes associated with fruit ripening.

Balague et al., (1993) Eur. J. Biochem. 212:27-34 reported the isolation and sequencing of an ethylene forming gene from melon (Cucumis melo where the predicted amino acid sequence of the melon ACC oxidase gene appears to be closely related to the sequences reported for 3 tomato ACC oxidase genes 81% and 77% identity), an avocado ACC oxidase gene (73% identity), and a carnation ACC oxidase gene identity). The authors speculate that transforming melon with pMEL1 antisense transgene should allow them to determine whether ethylene biosynthesis can be inhibited in ripening melon and whether this inhibition will delay ripening processes. However, the engineering of constructs for plant transformation or expression was not reported.

Gray et al., Plant Mol. Biol. 19:69-87 (1992) report the molecular biology of fruit ripening and its manipulation with antisense genes.

Hamilton et al. (1990) Nature 346:284-286 report the transformation of chimeric pTOM13 antisense gene construct into the tomato variety Ailsa Craig. All transformants showed reduced ethylene biosynthesis.

Ethylene production in wounded leaves of primary transformants was inhibited by 68% and by 87% in ripening fruit.

Holdsworth et al. (1987) Nucl. Acids Res. 15:731-739 report the structure and expression of an ethylenerelated mRNA from tomato.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 6 Holdsworth et al. (1987) Nuc. Acids Res. 15:10600 report the isolation and sequencing of a genomic clone (GTOMA) of tomato ethylene forming enzyme. Transgenic tomato plants expressing antisense RNA to tomato ethylene forming enzyme sequences displayed reduced ethylene synthesis.

Kende (1993) Ann. Rev. Plant Physiol. Plant Mol. Biol.

44:283-307 reports a history of the study of the ethylene biosynthetic pathway.

Kim, W.T. and Yang, S.F. (1993) Plant Physiol. Suppl.

102:26 reported the isolation and characterization of cDNAs encoding 1-aminocyclopropane-l-carboxylate oxidase homologs from mung bean hypocotyls.

Klee et al. ((1991) The Plant Cell 3:1187-1193) reports the overexpression of a Pseudomonas ACC deaminase gene in transgenic tomato plants to inhibit ethylene production during fruit ripening.

McGarvey et al. (1990) Plant Mol. Biol. 15:165-167 report the nucleotide sequence of a ripening-related cDNA from avocado fruit.

Oeller et al. (1991) Science 254:437-439 report the reversible inhibition of tomato fruit senescence by antisense ACC synthase RNA.

Pua et al. (1992) Plant Mol. Biology 19:541-544, report the isolation and sequence analysis of a cDNA clone encoding ethylene-forming enzyme in Brassica juncea but did not report any genomic clone or genetic sequence and reported no engineering for plant expression or plant transformation.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT1US95/07233 7 Smith et al. (1986) Planta 168:94-100 reported the rapid appearance of an mRNA correlated with ethylene synthesis encoding a protein of molecular weight 35000.

Theologis, Cell 70:181-184 (1992) report using updated antisense RNA and ACC deaminase approaches to control fruit ripening.

Theologis et al. (1993) Dev. Genet. 14:282-295 report the reversible inhibition of tomato fruit senescence by antisense ACC synthase

RNA.

Theologis et al. (1992) Plant Physiol. 100:549-551 report the modification of fruit ripening by suppressing gene expression.

Tian et al. (1994) J. Amer. Soc. Hort. Sci. Vol.

119:276-281 reports ethylene production and the yellowing of broccoli begins after harvest.

Wang et al. (1991) Plant Physiol. 96:1000-1001 isolated the ACC oxidase cDNA sequenced of a carnation (Dianthus caryophyllus) by screening a cDNA library with the tomato efe gene pTOM13 and an avocado efe gene pAVOe3.

Wang et al. (1992) Plant Physiol. 100:535-536 isolated the ACC oxidase cDNA sequence of Petunia corollas.

Yang (1984) Ann. Rev. Plant Physiol. 35:155-189 report generally on ethylene biosynthesis and its regulation in higher plants.

SUMMARY OF THE INVENTION The present invention provides recombinant materials which permit control of the level of ACC oxidase in plants, specifically, Brassica oleracea and Cucumis SUBSTITUTE SHEET (RULE 26) 8 melo. The invention is also directed to DNA in purified and isolated form comprising a DNA sequence encoding the enzyme ACC oxidase of Brassica oleracea and Cucumis melo. The invention is also directed to expression systems effective in expressing the DNA encoding said ACC oxidase and to recombinant hosts transformed with this expression system. The invention is further directed to S methods to control ACC oxidase production and, thus, the growth and development of Brassica oleracea and Cucumis melo plants, using the coding sequences for ACC oxidase in an antisense construct or by replacing the ACC oxidase gene by a mutated form thereof. The invention thus provides a method for controlling the maturation and aging of Brassica oleracea and Cucumis melo plants which allows one to influence, lengthen, the shelflife of these plants.

"o Thus, in a first embodiment of the invention, there is provided a DNA isolate comprising an isolated and purified nucleic acid sequence encoding an ACC oxidase polypeptide from Brassica oleracea, or an artificial variant or naturally occurring allelic variant thereof.

n another embodiment of the invention, there is provided a DNA isolate comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding an ACC I 5 oxidase polypeptide from Brassica oleracea, or an artificial variant or naturally occurring allelic variant thereof.

In a further embodiment of the invention, there is provided a method of inhibiting an ethylene-inducible event in a plant comprising: providing a transgenic plant with an antisense nucleotide sequence 2o complementary to a nucleotide sequence encoding a Brassica oleracea ACC oxidase polypeptide, I positioned for expression in a cell of said plant, wherein said antisense nucleotide sequence is complementary to a nucleotide sequence selected from the group consisting of: the nucleotide sequence as shown in SEQ ID NO:2; the nucleotide sequence as shown in SEQ ID NO:8; a nucleotide sequence which encodes the same sequence of amino acids as encoded by the nucleotide sequence shown in SEQ ID NO:2; and a nucleotide sequence which encodes the same sequence of amino acids as encoded by the nucleotide sequence shown in SEQ ID NO:8; and culturing said transgenic plant under conditions for expressing said DNA.

Brief Description of the Figures Fig. 1 illustrates the amino acid sequence of B. oleracea ACC oxidase [SEQ ID NO:1], the cDNA sequence of B. oleracea ACC oxidase [SEQ ID NO:2] and the restriction enzyme cloning sites for PCR oligomer reaction primers; [R:\LIBZZ]06072.doc: DKM 8a Fig. 2 illustrates the cDNA and amino acid sequences of B. oleracea ACC oxidase [SEQ ID NOS:1 and 2] compared to the cDNA and amino acid sequences of B. juncea ACC oxidase [SEQ ID NOS:9 and Fig. 3 illustrates the PCR oligomer reaction primers and the novel restriction enzyme cloning sites for each of the primers used for the amplification of the DNA nucleotide sequence of the B.

oleracea ACC oxidase gene [SEQ ID NO:8] from the portion of the B. oleracea genome containing the DNA sequence of the B. oleracea *0 a a [R:\LIBZZ]06072.doc: DKM WO 96/07742 PCT/US95/07233 9 ACC oxidase and compares to the genomic DNA sequence with the cDNA sequence of B. oleracea ACC oxidase; Fig. 4 illustrates a flow chart showing the engineering steps used to install the ACC oxidase cDNA coding sequence, both in the sense and the antisense orientation, into plant expression vectors and the subsequent insertion into binary plasmids; and Fig. 5 illustrates a flow chart showing the engineering steps used to install the B. oleracea ACC oxidase genomic DNA coding sequence, both in the sense and the antisense orientation, into plant expression vectors and the subsequent insertion into binary plasmids.

Fig. 6 illustrates an RNA blot of total RNA extracted from Ro transgenic melon plants (leaves) hybridized with B. oleracea ACC oxidase sense RNA probe.

Fig. 7 illustrates an RNA blot of total RNA extracted from R, transgenic melon progeny of line 4168-10 hybridized with B. oleracea ACC oxidase sense RNA probe.

Fig. 8 illustrates an RNA blot of total RNA extracted form R, transgenic melon progeny of lines 4168-19 and 4168-20 hybridized with B. oleracea ACC oxidase sense RNA probe.

Fig. 9 illustrates a comparison of melon ACC oxidase nucleotide sequence with B. oleracea nucleotide sequence. Sequences were aligned with the use of the Pileup Program in the UWGCG program package.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTIUS95/07233 10 DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT Most of the recombinant DNA methods employed in practicing the present invention are standard procedures, well known to those skilled in the art.

Enzymes are obtained from commercial sources and are used according to the vendor's recommendations or other variations known to the art. Reagents, buffers, and culture conditions are also known to those in the art.

General references containing such standard techniques include the following: R. Wu, ed. (1979) Methods in Enzymology, Vol. 68; J.H. Miller (1972) Experiments in Molecular Genetics; D.M. Glover, ed. (1985) DNA Cloning, Vol. II; S.B. Gelvin and R.A. Schilperoort, eds. Introduction. Expression, and Analysis of Gene Products in Plants; and Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor all of which are incorporated by reference.

As used herein, "recombinant" refers to a nucleic acid sequence which has been obtained by manipulation of genetic material using restriction enzymes, ligases, and similar recombinant.techniques as described by, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

"Recombinant", as used herein, does not refer to naturally-occurring genetic recombinations.

As defined herein, "ACC oxidase" includes enzymes which are capable of catalyzing the conversion of ACC to ethylene. The amino acid sequence of the oxidase may or may not be identical with the amino acid sequence which occurs natively in higher plants. An example of such a native sequence is shown in Fig. 1 [SEQ ID NO:1] which occurs in broccoli. Naturally occurring allelic SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 11 variants undoubtedly occur as well. In addition, artificially induced mutations are also included so long as they do not destroy activity. In general, conservative amino acid substitutions can be made for most of the amino acids in the primary structure as shown without effecting destruction of activity. Thus, the definition of ACC oxidase used herein includes those variants which are derived by direct or indirect manipulation of the disclosed sequence.

It is also understood that the primary structure may be altered by post-translational processing or by subsequent chemical manipulation to result in a derivatized protein which contains, for example, glycosylation substituents, oxidized forms of, for example, cysteine or proline, conjugation to additional moieties, such as carriers, solid supports, and the like. These alterations do not remove the protein from the definition of ACC oxidase so long as its capacity 'to convert ACC to ethylene is maintained.

Thus, the identity of an enzyme as "ACC oxidase" can be confirmed by its ability to effect the production of ethylene in an assay performed as follows: 5 ng to mg of enzyme protein in a 500-uL volume is added to mL of assay buffer [50mM Tris-HCl (pH 10% (v/v) glycerol, 0.1 mM FeSO 4 10 mM ascorbate, 1 mM ACC, and 1 mM 2-oxoglutarate] in 25-mL Erlenmeyer flasks. The vials are sealed with serum caps and incubated for 1 hr at 23 0 C shaking gently. Air in the headspace is analyzed by gas chromatography on a Varian 3400 gas chromatograph equipped with a flame ionization detector and an 80% Porapak N/20% Porapak Q column. Ethylene production is quantitated by comparison with a 97.7 ppm ethylene gas mixture in helium (Alltech Associates).

A

unit is defined as 1 nL/hr. Pirrung et al. (1993) Biochemistry 32:7445-7450, teach the purification and SUBSTITUTE SHEET (RULE 26) WO96/07742 PCT/US95/07233 12 properties of the apple fruit ethylene-forming enzyme.

While alternative forms of assessment of ACC oxidase can be devised, and variations on the above protocol are certainly permissible, the foregoing provides a definite criterion for the presence of ACC oxidase activity and classification of a test protein as ACC oxidase.

The amino acid sequence for ACC oxidase in broccoli is shown in Fig. 1 [SEQ ID NO:1]. Preferred forms of the ACC oxidase of the invention include that illustrated herein, and those derivable therefrom by systematic mutation of the genes. Such systematic mutation may be desirable to enhance the ACC oxidase properties of the enzyme, to enhance the characteristics of the enzyme which are ancillary to its activity, such as stability, or shelf life, or may be desirable to provide inactive forms useful in the control of ACC oxidase activity in vivo.

As described above, "ACC oxidase" refers to a protein having the activity assessed by the assay set forth above; a "mutated ACC oxidase" refers to a protein which does not necessarily have this activity, but which is derived by mutation of a DNA encoding in ACC oxidase. By "derived from mutation" is meant both direct physical derivation from a DNA encoding the starting material ACC oxidase using, for example, site specific mutagenesis or indirect derivation by synthesis of DNA having a sequence related to, but deliberately different from, that of the ACC oxidase.

As means for constructing oligonucleotides of the required length are available, such DNAs can be constructed wholly or partially from their individual constituent nucleotides.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 13 Initial Isolation of the ACC Oxidase cDNA In view of the recent studies which have shown that ethylene production begins after harvest (Tian et al.

(1994) J. Amer. Soc. Hort. Sci. Vol. 119:276-281), one does not have to wait until a plant illustrates visible signs of senescence to ensure one harvests the mRNA needed for ethylene production. After isolating total mRNA from plants such as Brassica oleracea var. Italica or Cucumis melo by methods well known in the art, such as single step liquid-phase separation, the mRNA is purified. The mRNA is then treated with reverse transcriptase to produce total first strand cDNA.

Polymerase chain reaction (PCR) primers can then be used to amplify the ACC oxidase gene from the cDNA template. In the case of Brassica oleracea and Cucumis melo, because it was suspected that its ACC oxidase DNA sequence would be similar to the ACC oxidase cDNA sequence of other species, oligonucleotides used to prime the PCR were modeled after sequences of a cDNA clone of the ACC oxidase gene found in Brassica juncea (Pua et al. (1992) Plant Mol. Biology 19:541-544).

With the ACC oxidase gene available because of PCR amplification, ACC oxidase can be produced in a variety of recombinant systems. Specifically, the ACC oxidase can be expressed in transgenic plants both in enhanced amounts and in an antisense mode to control the aspects of plant development which are ethylene sensitive, and in particular, to delay plant senescence.

Accordingly, a variety of expression systems and hosts can be used for the production of this enzyme. A variety of prokaryotic hosts and appropriate vectors is known in the art; most commonly used are E. coli or other bacterial hosts such as B. subtilis or SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 14 Pseudomonas and typical bacterial promoters include the trp, lac, tac, and beta-lactamase promoters. A readily controllable, inducible promoter, the lambda-phage promoter can also be used. A large number of control systems suitable for prokaryote expression is known in the art.

Similarly, a large number of recombinant systems have been developed for expression in eukaryotic hosts, including yeasts, insect cells, mammalian cells, and plant cells. These systems are well characterized and require the ligation of the coding sequence under the control of a suitable transcription initiating system (promoter) and, if desired, termination sequences and enhancers. Especially useful in connection with the ACC oxidase gene of the present invention are expression systems which are operable in plants. These include systems which are under control of a tissuespecific promoter, as well as those which involve promoters that are operable in all plant tissues.

Transcription initiation regions, for example, include the various opine initiation regions, such as ocotopine, mannopine, nopaline and the like. Plant viral promoters can also be used, such as the cauliflower mosaic virus 35S promoter. In addition, plant promoters such as ribulose-l,3-diphosphate carboxylase, flower organ-specific promoters, heat shock promoters, seed-specific promoters, promoters that are transcriptionally active in associated vegetable tissue, etc. can also be used.

The cauliflower mosaic virus (CaMV) 35S promoter has been shown to be highly active in many plant organs and during many stages of development when integrated into the genome of transgenic plants including tobacco and SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTIUS95/07233 15 petunia, and has been shown to confer expression in protoplasts of both dicots and monocots.

The CaMV 35S promoter has been demonstrated to be active and may be used in at least the following monocot and dicot plants with edible parts: blackberry, Rubus; blackberry/raspberry hybrid, Rubus, and red raspberry; carrot, Daucus carota; maize; potato, Solanum tuberosum; rice, Oryza sativa; strawberry, Fragaria x ananassa; and tomato, Lycopersicon esculentum.

The nopaline synthase (Nos) promoter has been shown to be active and may be used in at least the following monocot and dicot plants with edible parts: apple, Malus pumila; cauliflower, Brassica oleracea; celery, Apium graveolens; cucumber, Cucumis sativus; eggplant, Solanum melongena; lettuce, Lactuca sativa; potato, Solanum tuberosum; rye, Secale cereale; strawberry, Fragaria x ananassa; tomato, Lycopersicon esculentum; and walnut, Juglans regia.

Organ-specific promoters are also well known. For example, the E8 promoter is only transcriptionally activated during tomato fruit ripening, and can be used to target gene expression in ripening tomato fruit (Deikman and Fischer, EMBO J (1988) 7:3315). The activity of the E8 promoter is not limited to tomato fruit, but is thought to be compatible with any system wherein ethylene activates biological processes. Other organ-specific promoters appropriate for a desired target organ can be isolated using known procedures.

These control sequences are generally associated with genes uniquely expressed in the desired organ. In a typical higher plant, each organ has thousands of mRNAs that are absent from other organ systems (reviewed in Goldberg, Trans.. R. Soc. London (1986) B314:343).

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 16 To create an expression system, the gene coding for ACC oxidase in hand is ligated to a promoter using standard techniques now common in the art. The expression system may be further optimized by employing supplemental elements such as transcription terminators and/or enhancer elements.

Thus, for expression in plants, the recombinant expression cassette will contain in addition to the ACC oxidase-encoding sequence, a plant promoter region, a transcription initiation site (if the coding sequence to be transcribed lacks one), and a transcription termination sequence. Unique restriction enzyme sites at the 5' and 3' ends of the cassette are typically included to allow for easy insertion into a preexisting vector.

Sequences controlling eukaryotic gene expression have been extensively studied. Promoter sequence elements include the TATA box consensus sequence (TATAAT), which is usually 20-30 base pairs (bp) upstream of the transcription start site. In most instances, the TATA box is required for accurate transcription initiation.

By convention, the start site is called Sequences extending in the 5' (upstream) direction are given negative numbers and sequences extending in the 3' (downstream) direction are given positive numbers.

In plants, further upstream from the TATA box, at positions -80 to -100, there is typically a promoter element with a series of adenines surrounding the trinucleotide G (or T)NG (Messing, J. et al., in Genetic Engineering in Plants, Kosage, Meredith and Hollaender, eds. (1983) pp. 221-227). Other sequences conferring tissue specificity, response to environmental signals, or maximum efficiency of transcription may also be found in the promoter region.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 17 Such sequences are often found within 400 bp of transcription initiation site, but may extend as far as 2000 bp or more.

In the construction of heterologous promoter/structural gene combinations, the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in this natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

As stated above, any of a number of promoters which direct transcription in plant cells is suitable. The promoter can be either constitutive or inducible.

Promoters of bacterial origin include the octopine synthase promoter, the nopaline synthase promoter and other promoters derived from native Ti plasmids (Herrera-Estrella et al., Nature (1983) 303:209-213).

Viral promoters include the 35S and 19S RNA promoters of cauliflower mosaic virus (O'Dell et al., Nature (1985) 313:810-812. Plant promoters include the ribulose-1,3-diphosphate carboxylase small subunit promoter and the phaseolin promoter.

In addition to a promoter sequence, the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.

If the mRNA encoded by the structural gene is to be efficiently processed, DNA sequences which direct polyadenylation of the RNA are also commonly added to SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 18 the vector construct (Albert and Kawaski, Mol. and Appl. Genet. (1982) 1:419-434). Polyadenylation is of importance for expression of the ACC oxidase-encoding RNA in plant cells. Polyadenylation sequences include, but are not limited to the Agrobacterium octopine synthase signal (Gielen et al., EMBO J (1984) 3:835- 846) or the nopaline synthase signal (Depicker et al., Mol. and Appl. Genet. (1982) 1:561-573).

The resulting expression system or cassette is ligated into or otherwise constructed to be included in a recombinant vector which is appropriate for higher plant transformation. The vector will also typically contain a selectable marker gene by which transformed plant cells can be selected for and identified in culture. Usually, the marker gene will encode antibiotic resistance. These markers include resistance to G418, hygromycin, bleomycin, kanamycin, and gentamicin. After transforming the plant cells, those cells having the vector will be identified by their ability to grow on a medium containing the particular antibiotic. Replication sequences, of bacterial or viral origin, are generally also included to allow the vector to be cloned in a bacterial or phage host, preferably a broad host range prokaryotic origin of replication is included. A selectable marker for bacteria should also be included to allow selection of bacterial cells bearing the desired construct.

Suitable prokaryotic selectable markers also include resistance to antibiotics such as kanamycin or tetracycline.

Other DNA sequences encoding additional functions may also be present in the vector, as is known in the art.

For instance, in the case of Agrobacterium transformation, T-DNA sequences will also be included for subsequent transfer to plant chromosomes.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 19 In addition, vectors can also be constructed that contain in-frame ligations between the sequence encoding the ACC oxidase protein and sequences encoding other molecules of interest resulting in fusion proteins, by techniques well known in the art.

When an appropriate vector is obtained, transgenic plants are prepared which contain the desired expression system. A number of techniques are available for transformation; in general, only dicots can be transformed using Agrobacterium-mediated infection.

In one form of direct transformation, the vector is microinjected directly into plant cells by use of micropippettes to mechanically transfer the recombinant DNA (Crossway, Mol. Gen. Genetics (1985) 202:179-185).

In another form, the genetic material is transferred into the plant cell using polyethylene glycol (Krens, et al. Nature (1982) 296:72-74), or high velocity ballistic penetration by small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface, is used (Klein, et al., Nature (1987) 327:70-73). In still another method protoplasts are fused with other entities which contain the DNA whose introduction is desired. These entities are minicells, cells, lysosomes or other fusible lipidsurfaced bodies (Fraley, et al., Proc. Natl. Acad. Sci.

USA (1982) 79:1859-1863.

DNA may also be introduced into the plant cells by electroporation (Fromm et al., Proc. Natl. Acad. Sci.

USA (1985) 82:5824). In this technique, plant protoplasts are electroporated in the presence of plasmids containing the expression cassette.

Electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 20 the plasmids. Electroporated plant protoplasts reform the cell wall, divide and regenerate.

For transformation mediated by bacterial infection, a plant cell is infected with Agrobacterium tumefaciens or Agrobacterium rhizogenes previously transformed with the DNA to be introduced. Agrobacterium is a representative genus of the gram-negative family Rhizobiaceae. Its species are responsible for crown gall tumefaciens) and hair root disease

(A.

rhizogenes). The plant cells in crown gall tumors and hairy roots are induced to produce amino acid derivatives known as opines, which are catabolized only by the bacteria. The bacterial genes responsible for expression of opines are a convenient source of control elements for chimeric expression cassettes. In addition, assaying for the presence of opines can be used to identify transformed tissue.

Heterologous genetic sequences can be introduced into appropriate plant cells, by means of the Ti plasmid of A. tumefaciens or the Ri plasmid of A. rhizogenes. The Ti or Ri plasmid is transmitted to plant cells on infection by Agrobacterium and is stably integrated into the plant genome (Schell, Science (1987) 237:1176-1183). Ti and Ri plasmids contain two regions essential for the production of transformed cells. One of these, named transferred DNA (T-DNA), is transferred to plant nuclei and induces tumor or root formation.

The other, termed the virulence (vir) region, is essential for the transfer of the T-DNA but is not itself transferred. The T-DNA will be transferred into a plant cell even if the vir region is on a different plasmid (Hoekema, et al., Nature (1983) 303:179-189).

The transferred DNA region can be increased in size by the insertion of heterologous DNA without its ability to be transferred being affected. Thus a modified Ti SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 21 or Ri plasmid, in which the disease-causing genes have been deleted, can be used as a vector for the transfer of the gene constructs of this invention into an appropriate plant cell.

Construction of recombinant Ti and Ri plasmids in general follows a method typically used with the more common bacterial vectors, such as pBR322. Additional use can be made of accessory genetic elements sometimes found with the native plasmids and sometimes constructed from foreign sequences. These may include but are not limited to "shuttle vectors", (Ruvkum and Ausubel, Nature (1981) 298:85-88), promoters (Lawton et al., Plant Mol. Biol. (1987) 9:315-324) and structural genes for antibiotic resistance as a selection factor (Fraley et al., Proc. Natl. Acad. Sci. (1983) 80:4803- 4807).

There are two classes of recombinant Ti and Ri plasmid vector system now in use. In one class, called "cointegrate," the shuttle vector containing the gene of interest is inserted by genetic recombination into a non-oncogenic Ti plasmid that contains both the cisacting and trans-acting elements required for plant transformation as, for example, in the pMLJ1 shuttle vector of DeBlock et al., EMBO J (1984) 3:1681-1689 and the non-oncogenic Ti plasmid pGV2850 described by Zambryski et al., EMBOJ (1983) 2:2143-2150. In the second class or "binary" system, the gene of interest is inserted into a shuttle vector containing the cisacting elements required for plant transformation. The other necessary functions are provided in trans by the non-oncogenic Ti plasmid as exemplified by the pBIN19 shuttle vector described by Bevan, Nucleic Acids Research (1984) 12:8711-8721 and the non-oncogenic Ti plasmid PAL4404 described by Hoekma, et al., Nature SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTIUS95/07233 22 (1983) 303:179-180. Some of these vectors are commercially available.

There are two common ways to transform plant cells with Agrobacterium: co-cultivation of Agrobacterium with cultured isolated protoplasts, or transformation of intact cells or tissues with Agrobacterium. The first requires an established culture system that allows for culturing protoplasts and subsequent plant regeneration from cultured protoplasts. The second method requires that the intact plant tissues, such as cotyledons, can be transformed by Agrobacterium and that the transformed cells or tissues can be induced to regenerate into whole plants.

Most dicot species can be transformed by Agrobacterium as well as species which are a natural plant host for Agrobacterium are transformable in vitro.

Monocotyledonous plants, and in particular, cereals, are not natural hosts to Agrobacterium. Attempts to transform them using Agrobacterium have been unsuccessful until recently (Hooykas-Van Slogteren et al., Nature (1984) 311:763-764). However, there is growing evidence now that certain monocots can be transformed by Agrobacterium. Using novel experimental approaches cereal species such as rye (de la Pena et al., Nature (1987) 325:274-276), maize (Rhodes et al., Science (1988) 240:204-207), and rice (Shimamoto et al., Nature (1989) 338:274-276) may now be transformed.

Identification of transformed cells or plants is generally accomplished by including a selectable marker in the transforming vector, or by obtaining evidence of successful bacterial infection.

Plant cells which have been transformed can also be regenerated using known techniques.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 23 Plant regeneration from cultured protoplasts is described in Evans et al., Handbook of Plant Cell Cultures, Vol. 1: (MacMilan Publishing Co. New York, 1983); and Vasil I.R. Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. I, 1984, and Vol. II, 1986). It is known that practically all plants can be regenerated from cultured cells or tissues, including but not limited to, all major species of sugar-cane, sugar beet, cotton, fruit trees, and legumes.

Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts or a petri plate containing transformed explants is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently root. Alternatively, somatic embryo formation can be induced in the callus tissue. These somatic embryos germinate as natural embryos to form plants. The culture media will generally contain various amino acids and plant hormones, such as auxin and cytokinins.

It is also advantageous to add glutamic acid and proline to the medium, especially for such species as corn and alfalfa. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is usually reproducible and repeatable.

A large number of plants have been shown capable of regeneration from transformed individual cells to obtain transgenic whole plants. For example, regeneration has been shown for dicots as follows: apple, Malus pumila; blackberry, Rubus; Blackberry/raspberry hybrid, Rubus; red raspberry, Rubus; carrot, Daucus carota, cauliflower, Brassica oleracea; celery, Apium graveolens; cucumber, Cucumis SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 24 sativus; eggplant, solanum melongena; lettuce, Lactuca sativa; potato, Solanum tuberosum; rape, Brassica napus; soybean (wild), Glycine Canescens; strawberry, Fragaria x ananassa; tomato, Lycopersicon esculentum; walnut, Juglans regia; melon, Cucumis melo; grape, Vitis vinifera; mango, Mangifera indica; and for the following monocots; rice, Oryza sativa; rye, Secale cereale; and maize.

In addition, regeneration of whole plants from cells (not necessarily transformed) has been observed in: apricot, Prunus armeniaca; asparagus, Asparagus officinalis; banana, hydrib Musa; bean, Phaseolus vulgaris; cherry, hybrid Prunus; grape, Vitis vinifera; mango, Mangifera indica; melon, Cucumis melo; ochra, Abelmoschus esculentus; onion, hybrid Allium; orange, Citrus sinensis; papaya, Carrica papaya; peach, Prunus persica and plum, Prunus domestica; pear, Pyrus communis; pineapple, Ananas comosus; watermelon, Citrullus vulgaris; and wheat, Triticum aestivum.

The regenerated plants selected from those listed are transferred to standard soil conditions and cultivated in a conventional manner.

After the expression cassette is stably incorporated into regenerated transgenic plants, it can be transferred to other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.

The plants are grown and harvested using conventional procedures.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTIUS95/07233 25 ACC OXIDASE GENE OBTAINED FROM B. OLERACEA CDNA CLONES EXAMPLE 1 Isolation of total RNA from broccoli beads (florets) Total RNA was isolated from broccoli florets (beads) by use of TRI-REAGENT RNA/DNA/protein isolation reagent (a single step liquid-phase separation) (Molecular Research Center, Inc., Cincinnati, Ohio). The instructions provided with the reagent were followed to accomplish the isolation.

EXAMPLE 2 Enrichment for polyA RNA Oligo dT-cellulose chromatography was then used to enrich for polyA' RNA. The procedure involved mixing 'total broccoli floret RNA (this includes messenger RNA or polyA RNA) with oligo dT-cellulose in 20mM NaCl and Tris buffer. The oligo-dT cellulose was washed to eliminate non-polyadenylated RNAs from the cellulose.

Subsequently, polyA RNA was eluted from the cellulose by elution in Tris buffer that includes no NaCl.

Sambrook et al. (1989) "Selection of poly(A) RNA", Molecular Cloning: A Laboratory Manual, Second Edition, pp. 7.26-7.29.

EXAMPLE 3 Synthesis of single-stranded cDNA Single-stranded cDNA was synthesized using the polyA RNA template from Example 2. A 50uL reaction included 1 X First Strand cDNA Synthesis Buffer (GIBCO BRL, Gaithersburg, Maryland), 1 ug polyA RNA, 1 mM dNTP's SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 26 (USB, Cleveland Ohio), 1 ug oligo dT, 1 uL RNasin (Promega, Madison, Wisconsin), 3.3 uM dithiothreitol, uL 3 PdCTP (3000 Ci/mmol, NENDuPont NEG013H, Wilmington, Delaware), and luL RTase Superscript (GIBCO BRL, Gaithersburg, Maryland). Single-stranded B. oleracea cDNA was purified by the use of columns (Qiaquick-spin PCR column) obtained from Qiagen (Chatsworth, California). First strand cDNA was characterized by hydroxide agarose gel electrophoresis; based on electrophoretic mobility, the size distribution of first strand cDNA was estimated to center near 1 kilobase.

EXAMPLE 4 PCR amplification of target cDNA ACC oxidase sequences An ACC oxidase cDNA sequence was PCR amplified from total Brassica oleracea first strand cDNA with the use of the cDNA template obtained as above. The polymerase chain reaction (PCR) was carried out using reagents supplied with the Perkin Elmer Cetus Gene Amp PCR Kit under the following conditions: -0.1 ug/mL total cDNA of Brassica oleracea, 1.5mM MgC1 2 24ug/mL of each oligomer primer, 200uM each dNPT, kit reaction buffer, and AmpliTaq DNA ploymerase supplied with the kit.

Reaction tubes were subjected to 93 0 C for 1 min, 55 0

C

for 1 min, the 72 0 C for 3 min for 30 cycles in a Perkin Elmer Thermocycler. Oligonucleotides used to prime the PCR were modeled after sequences of a cDNA clone of the ACC oxidase gene found in brassica juncea (Pua et al.

(1992) Plant Mol. Biology 19:541-544). Oligomer primers RMM389 GAGAGAGCCATGGAGAAGAACATTAAGTTTCCAG complementary to the 5' end of the cDNA clone of brassica juncea ACC oxidase gene) (SEQ ID NO:3) and RMM391 CGGCATCTCTGAAAGATTTTTGTGGATCCTCAAACTCGC 3', complementary to the 3' end of the cDNA clone of SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTUS95/07233 27 Brassica juncea ACC oxidase gene) (SEQ ID NO:4) were used to prime this reaction. Fig. 2 illustrates the cDNA and amino acid sequences of B. oleracea ACC oxidase [SEQ ID NOS:1 and 2] compared to the cDNA and amino acid sequences of B. juncea ACC oxidase [SEQ ID NOS:9 and EXAMPLE Cloning an ACC oxidase PCR fragment into the DCRII vector The 1 kb ACC oxidase PCR fragment was cloned into the pCRIITM vector, included in the TA Cloning Kit available from Invitrogen Corporation (San Diego, California) to obtain a clone known as EFEG3 (Fig. The sequence of the inserted gene in EFEG3 was verified by nucleotide DNA sequencing using a U.S. Biochemical (Cleveland, Ohio) dideoxy sequencing kit (Fig. 1 (SEQ ID NO:2).

EXAMPLE 6 Insertion of the ACC oxidase coding sequence into an expression cassette (cp express) in antisense orientation EcoRI digestion of clone EFEG3 produced an EFEG3 fragment containing the Brassica aleracea ACC oxidase gene. An NcoI restriction site was fitted onto the 3' end of the EFEG3 fragment during a second PCR amplification by the use of the primer RMM480 CGGCATCTCTGAAAGATTTTTGTGGTACCTCAAA complementary to the 3' end of the ACC oxidase gene) (Figs 2 and 4) (SEQ ID NO:5). Its sequence is located at the 3' end of the gene and includes a novel NcoI site (Figs. 2 and 4).

During this second PCR amplification one of two SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 28 internal NcoI sites was also eliminated by the use of oligomer primer RMM470

GAGAGCCATGGAGAAGAACATTAAGTTTCCAGTTGTAGACT

TGTCCAAGCTCATTGGTGAAGAGAGAGACCAAACAAGTGGCTTTGATCAACGATGC

complementary to the 5' end of the ACC oxidase gene) (Figs. 2 and 4) (SEQ ID NO:6); RMM470 does not include the first internal NcoI site located in EFEG3 (Fig. The resulting PCR fragment was cloned into the pCRII cloning vector included in the TA cloning kit available from Invitrogen Corporation to obtain a clone known as EFEG3'.

To begin transfer of the Brassica oleracea cDNA ACC oxidase gene into a plant expression cassette, EFEG3' was digested with NcoI to produce an NcoI cDNA fragment encoding B. oleracea ACC oxidase. Using standard methods (see J.L.-Slightom, 1991, Gene, Vol. 100, pp.

251-255, "Custom PCR Engineering of a Plant Expression Vector"), this fragment was inserted into the expression cassette pUC18cp express in an antisense orientation to obtain EFEG3cel and in the sense orientation to obtain EFEG3ce7 (Fig. pUC18cp express includes about 330 base pairs of the CaMV transcript promoter and 70 bp of the cucumber mosaic virus 5'-untranslated region. The region flanking the 3' end of the inserted gene includes 200 bp of the transcript poly(A) addition signal. The Nco I site maintains the ATG translation initiation site found in the ACC oxidase gene. Sense orientation constructs are designed to give sense mRNA that can be translated into ACC oxidase in the plant. The antisense orientation of the NcoI fragment in EFEG3cel is designed to transcribe mRNA in the plant that is complementary to the sense mRNA; no B. oleracea ACC oxidase protein can be translated in the plant from this construct.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 29 EXAMPLE 7 Insertion of ACC oxidase DNA cassettes into a binary vector The antisense cassette EFEG3FL AS (Fig. 4) was inserted into the unique HindIII site of binary vector pGA482G to produce plasmid pEPG604 (Fig. pGA482G is available from Gynehung An, Institute of Biological Chemistry, Washington State University in the form of pGA482 followed by the insertion of a gentamicin resistance gene. The sense cassette EFEG3FL (Fig. 4) was inserted into the unique HindIII site of binary vector pGA482G to produce plasmid pEPG606 (Fig. 4).

The structures shown in Fig. 4 were verified by restriction analysis.

EXAMPLE 8 Transformation of the binary vectors into Brassica oleracea plants by Acrobacteria-mediated transformation The binary plasmids pEPG604 and pEPG606 are transformed into strains of Agrobacterium tumefaciens, strain C58Z707 and Agrobacterium rhizogenes, strain

A

4 .Strain C58Z707 is available from Augus Hebpurn at Indiana University, Bloomington, Indiana (Hepburn et al., (1985) J. Gen. Micro. 131:2961-2969). Strain A 4 is available from Jerry Slightom, The Upjohn Company, Kalamazoo, Michigan. Evidence of the origin of the strain A 4 is presented by Slightom et al. J. Biol. Chem.

(1986) Vol. 261, No. 1 pp. 108-121. The resulting Agrobacterium strain is used to perform B. oleracea plant transformation procedures.

Agrobacterium-mediated transfer of the plant expressible Brassica oleracea ACC oxidase is done using procedures known to those skilled in the art. For SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 30 example, David and Tempe (1988) Plant Cell Reports 7:88-91) and Damgaard and Rasmussen (1991) Plant Molecular Biology 17:1-8, transformed cauliflower and rapeseed hypocotyl cells and regenerated transformed plants. Specifically, aseptically grown hypocotyls with or without an intact root system are inoculated with engineered A. tumefaciens or A. rhizogene.

Hypocotyls are then transferred to Murashiges and Shogg (1962) Physiol Plantarum 15:473-497) medium (MS) containing 200 micromolar acetsyringone. Two to three days later, hypocotyls are transferred to MS medium containing 50 mg/l kanamycin sulfate, 500 mg/l carbenicillin and 200 mg/1 cefotaxime (MS-0).

Hypocotyls are continuously subcultured every 21 days on MS-0 medium until shoots form. Shoots are then removed from agar and potted in soil. Transgenic plants (R 0 are grown to sexual maturity in a green house and R, transgeneic seed is produced. Transfer of this gene into plant cells can also be accomplished using other methods, such as direct DNA uptake (Paszkowski, et al, EMBO 1084, 3:2717), microinjection (Crossway, et al., Mol Gen. Genet.

202:179), electroporation (Fromm et al., Proc. Natl.

Acad. Sci. U.S.A. 82:5824), or high velocity microprojectiles (Klein, et al., Nature 327:70).

EXAMPLE 9 Evaluation of transgenic plants for inhibition of ethylene biosynthesis Transgenic status of Ro plants and their segregating progeny is verified by routine methods. These include ELISA assays for NPTII protein detection; DNA assays such as PCR amplification (detection) of transgenes and Southern blot hybridization for detection of transgenes.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 31 For example, protein in leaf tissue samples taken from R1 transgenic lettuce seedlings is extracted and analyzed for NPTII protein by enzyme-linked immunosorbant assay (ELISA). The procedure and kit supplied by 5 Prime 3 Prime, Inc., Boulder, Colorado, is used to assay NPTII expression in R1 transgenic lettuce seedlings. In an initial screen of R1 transgenic seedlings for NPTII protein by ELISA, it is expected that 11 independent transgenic proprietary B. olerace lines express NPTII. The date indicate that these initial lines are segregating for the NPTII marker gene.

Evaluation of transgenic plants for inhibition of ethylene biosynthesis can be accomplished by assaying transgenic B. oleacea materials for expression of ACC oxidase antisense RNA using a Northern analysis or a RNase protection assay. In a Northern analysis of transgenic materials, RNA extracted from transgenic

B.

oleracea is subjected to agarose electrophoresis and blotted onto a Nylon membrane. A radioactive labelled) RNA probe (sense RNA) synthesized in vitro is used to hybridize the blot. Only antisense RNA of the ACC oxidase trangene in the plant will bind to the 32Plabelled RNA probe; thus antisense ACC oxidase RNA will be detected by autoradiography. Parallel hybridization of replicate blots with antisense ACC oxidase RNA probe serves as a check on the hybridization with the sense RNA probe.

The RNase protection assay involves hybridizing a labelled RNA molecule (pure sequence synthesized in vitro) with total tissue RNA in solution in a tube.

Only complementary RNA will hybridize with the pure RNA labelled and sythesized in vitro. The total pool of RNA is subjected to RNase A and RNase T, digestion; protected mRNAs are resistant to RNase digestion.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 32 Protected mRNAa are evaluated quantitatively and qualitatively on an acrylamide gel.

Following the determination of whether B. oleracea

ACC

oxidase antisense RNA is expressed, the transgenic materials or tissues are assayed for ACC oxidase activity. This can be accomplished by the assay methods outlined above for measuring ACC oxidase activity. In addition, it is possible to employ immunological methods (for example, ELISA or Western blots) to assay transgenic materials for levels of ACC oxidase protein. It is expected that transgenic would exhibit reduced levels of ACC oxidase protein compared with non-transgenic materials. Tian et al. (1994) J.

Amer. Soc. Hort. Sci. Vol. 119:276-281 outline in some detail their procedures for evaluating "degreening" in response to ethylene in harvested broccoli. They measured chlorophyll content in the florets after harvest.

ACC OXIDASE GENE OBTAINED FROM B. OLERACEA GENOMIC

CLONES

EXAMPLE Extraction of total cellular DNA from broccoli by a CTAB extraction method Three or 4 newly expanding leaves (0.5 1 gm fresh weight) were placed into the bottom corner of a Ziplock bag. One mL of preheated CTAB extraction buffer was added to the leaf sample. CTAB extraction buffer (1% CTAB Sigma H-5882; 1.4 M NaCl; 100 mM Tris HC1 pH 30 mM EDTA pH 8.0) was prepared and preheated to 65°C 5-10 minutes prior to use. The following was added to each mL of CTAB extraction buffer just before using: 10uL of 2-mercaptoethanol, 6 AL of Ribonuclease SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 33 T, (5,000 U/ml) Sigma R-8251, and 25 AL of Ribonuclease mg/ml) Sigma R-4875.

The Ziplock bag was placed flat on a hard surface. A one-liter Corning media-bottle was firmly rolled across the surface of the bag repeatedly until the leaf tissue was disrupted and had the consistency of applesauce.

The macerated sample was moved to a bottom corner of the Ziplock bag and the corner was cut with a scissors.

The entire sample was squeezed into a sterile Falcon tube and incubated at 700C for 30 minutes. The sample was cooled for 5 minutes at room temperature.

One mL of cholororm-octanol (24:1, V:V) was added, and the sample was vortexed 1 second to mix thoroughly.

The samples were then centrifuged in a Beckman GH 3.7 rotor (Beckman GPR centrifuge) at 2500 rpm, 250C for minutes to separate phases. The aqueous phase (-1000 il) was then transferred to a sterile 1.5-mL Eppendorf tube. 1.5 pL of RNAse Ti (10mg/mL) was added. An equal volume of 1% CTAB precipitation buffer was added to each sample. The tube was inverted a few times and incubated at room temperature for 30 minutes.

The sample was centrifuged in a Eppendorf microfuge for 60 seconds to pellet the precipitate. The supernatant was discarded, and the tube was inverted on a paper towel to drain. 500 pl of high salt solution (10 mM Tris pH 8.0, 1 M NaCl, 1 mM EDTA pH 8.0) was added, and the sample was incubated at 65 0 C for 15 minutes to dissolve the DNA. One ml of 100% ethanol was added and the sample was placed at -20°C for one hour or overnight to precipitate DNA. DNA was hooked or spooled with a 1.5 ml capillary pipet and placed into a sterile 1.5 ml Eppendorf tube. The DNA pellet was washed by adding 1 ml of wash solution (80% ethanol, mM ammonium acetate) and incubated at room temperature SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 34 minutes. The washed DNA was dissolved in 300 AL of sterile water.

EXAMPLE 11 PCR amplification of target genomic ACC oxidase Polymerase chain reactions (PCRs) were carried out using reagents supplied with the Perkin Elmer Cetus Gene Amp PCR Kit under the following conditions: -0.1 ug/mL total cellular DNA of Brassica oleracea 1.5 mM MgC 2 24 ug/mL of each oligomer primer, 200 uM each dNPT, kit reaction buffer, and AmpliTaq DNA polymerase supplied with the kit. Reaction tubes were subject to 930C for 1 min, 55 OC for 1 min., the 72°C for 3 min.

for 30 cycles in a Perkin Lemer Thermocycler.

Oligonucleotides used to prime the PCR were modeled after sequences of a cDNA close of the ACC oxidase gene found in Brassica juncea (Pua et al. (1992) Plant Mol.

Biology 19:541-544). Oligomer primers RMM389 GAGAGAGCCATGGAGAAGAACATTAAGTTTCCAG complementary to the 5' end of the cDNA clone of Brassica juncea ACC oxidase gene) (SEQ ID NO:3) AND rmm390 CCGCCAATTAACAACCAGGTACCACAAATTTCACACCC 3', complementary to the 3' end of the cDNA clone of Brassica juncea ACC oxidase gene) (SEQ ID NO:7) were used to prime this reaction. (Fig. 3).

EXAMPLE 12 Cloning genomic ACC oxidase PCR fragment into the pCRII vector The genomic ACC oxidase PCR fragment was cloned into the pCRII vector (Invitrogen Corporation, San Diego, California) to obtain a clone known as EFE3-1 (Fig. The sequence of the insert gene in EFE3-1 was verified SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 by nucleotide DNA sequencing using a U.F. Biochemical (Cleveland, Ohio) dideoxy sequencing kit (Fig. 3) (SEQ ID NO:8). Comparison of B. oleracea genomic clone EFE3-1 with cDNA clone EFEG-3 revealed 4 exons and 3 introns in B. oleracea ACC oxidase genomic clone 3-1 (Fig. The coding regions of genomic clone 3-1 are identical to the sequence for the cDNA clone EFEG-3 (Fig. The structure of Brassica oleracea ACC oxidase is highly related to the intron/exon arrangement in the tomato genomic ACC oxidase clone GTOMA (Holdsworth et al. (1987) Nuc. Acids Res.

15:10600).

EXAMPLE 13 Insertion of the ACC oxidase coding sequence into an expression cassette (cp express) To begin transfer of the genomic Brassica oleracea ACC oxidase gene into a plant expression cassette, EFE3-1 was digested with Ncol to produce a 1528 bp NcoI fragment encoding genomic B. oleracea ACC oxidase; two internal NcoI sites near the 5' end of the gene resulted in the elimination of about 220 bp of the gene by NcoI digestion (Figs. 3 and Using standard methods (see J.L. Slightom, 1991, Gene. Vol. 100, pp.

251-255), this fragment was inserted into the expression cassette pUC18cp express in an antisense orientation to obtain EFE2.7 and in the sense orientation to obtain EFE3.3 (Fig. SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTUS95/07233 36 EXAMPLE 14 Insertion of enomic ACC oxidase DNA cassettes into a binary vector HindIII fragments harboring full-length cDNA clone antisense and sense cassettes were isolated. The antisense cassette EFE3.7 AS (Fig. 5) was inserted into the unique HindIII site of binary vector pGA482G to produce plasmid pEPG600 (Fig. The sense cassette EFE3.3 SENSE (Fig. 5) was inserted into the unique HindIII site of binary vector pGA482G to produce plasmid pEPG602 (Fig. The structures shown in Fig.

were verified by restriction analysis.

EXAMPLE Transformation of the binary vectors into Brassica oleracea plants by Agrobacteria-mediated transformation procedures.

The binary plasmids are transformed into Agrobacterium strains

A

4 and C58Z707 as in Example 8. The resulting Agrobacterium strain is used to perform B. oleracea plant transformation procedures.

EXAMPLE 16 Evaluation of transgenic plants for inhibition of ethylene biosynthesis Evaluation of transgenic plants for inhibition of ethylene biosynthesis is accomplished as described in Example 9.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 37 EXAMPLE 17 Brassica oleracea ACC oxidase antisense constructs were transferred to melon (Cucumis melo) plants via Agrobacteria-mediated transformation using procedures published by Fang and Grumet (1990 and 1993). The pEPG600 and pEPG604 constructs were transformed into melon (see Figures 4 and 5 for restriction maps of thesa binary plasmids).

After shoots were regenerated on kanamycin-containing solid tissue culture media, they were rooted and tested for transformation status. We verified transformation status either by testing regenerated organized shoots for ability to form callus on kanamycin-containing solid media (only transformed materials expressing NPTII can grow on these media) or by NPTIII expression detected by ELISA. The results are summarized in Table I.

TABLE I SUMMARY OF CANTALOUPE LINES TRANSFORMED

WITH

B. OLERACEA ACC OXIDASE CONSTRUCT Inbred 10 10 10 Exp.line Construct Ploidy 4140.3 604 AB 4168.10 604 4168.11B 604 4168.14 604 4168.15 604 4168.15B 604 4168.17D 604 4168.18 604 4168.19 604 4168.20 604 4168.21B 604 AB 4168.22B 604 4168.25B 604 4168.29 604 SUBSTITU TE brET (RULE 26) Plant Status discarded harvested potted died died harvested potted harvested harvested harvested discarded harvested harvested died R1 Seed 0162 0010 0016 0084 0146 0173 0047 WO 96/07742 PCT/US95/07233 38 Plant Inbred Exp.line Construct Ploidy Status R1 Seed 4168.33 604 potted 4168.33B 604 potted 4132.6 600 potted 4132.9 600 harvested 0190 Accordingly, stable transgenic lines have been produced containing the ACC antisense constructs.

Further, seed has been harvested from these plants.

EXAMPLE 18 ACC oxidase antisense transgene expression was evaluated in a number of Ro and R, melon plants by Northern blot hybridization. This assay measures levels of accumulated B. oleracea ACC oxidase antisense RNA. RNA was extracted from transgenic Cucumis melo leaves with the use of an RNA extraction kit (Trireagent) supplied by Molecular Research Center, Inc. (Cincinnati, OH). Total melon leaf RNA was subjected to glyoxalation before separation by agarose gel electrophoresis. After electrophoresis, RNA was pressure blotted onto a Nylon membrane (Hybond N, Amersham) with the use a Stratagene pressure blotter (La Jolla, CA).

Radioactive 32 P-labelled) RNA probe (sense RNA) was synthesized in vitro with the use of RNA transcription vectors, for example pGEM-3 (Promega, Madison, WI).

First the coding sequence for B. oleracea oxidase was inserted into the RNA transcription vector pGMM, a modification of pBluescript II SK The pGMM plasmid harboring the ACC oxidase coding sequence was linearized with BamHI and used as template for sense RNA synthesis in vitro. Radioactive 3 P-labelled probe was synthesized under the following reaction conditions: 2 Ag linearized template DNA, T3/T7 buffer SUSTUTE SHEET (RUL a2 WO 96/07742 PCTIUS95/07233 39 (1X) (BRL), 10 pL c 2 P-UTP, 10 mM dithiothreitol, 2 ul RNAsin (Promega, Madison, WI), 2 mM ATP, CTP, and GPT and 1 mM UTP, and 1 il T7 RNA polymerase (BRL) in a p1 total reaction volume. Blots were hybridized at 65 0 C with the use of Megablock (Cel Associates, Houston, TX) and instructions provided with the Megablock reagent. Following hybridization blots were washed according to instructions provided with Megablock reagent. Hybridization signals were detected by autoradiography. The results are summarized in Table II and Table III.

Table II SUMMARY OF Ro PLANT RNA BLOT RESULTS Species Binary Gene Construct RoPlant Transcript? Melon CA10 pEPG 604 EFE cCNA fl AS 4168-33 (as-) 4168-11B (as+) 4168-18 (as+) 4168-19 (as-) 4168-25B (as-) 4168-35 (as-) 4168-19 (as-) 4168-10 (as+) 4168-20 (as+) 4168-15B (as+) SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTIUS95/07233 40 TABLE III SUMMARY OF R1 PLANT RNA BLOT ANALYSIS Species Melon CA10 Binary Gene Construct pEPG 604 EFE cCNA fl

AS

R

0 Plant 4168-10-1 4168-10-2 4168-10-3 4168-10-4 4168-10-5 4168-10-6 4168-10-7 4168-10-8 4168-10-9 4168-10- 11 4 168-19- 12 4168-20-1 4168-20-2 4168-19- 13 4 168-19- 14 4168-20-3 4168-20-4 4 168-20-5 4168-20-6 4168-20-7 4168-20-8 4168-20-9 4168-20- 4168-20- 11 4168-20- 12 4168-20- 13 4168-20- 14 4 168-20- Transcript? (as-)

NPTII

(as- (as- (as- (as+) (as+) (as+) (as+) (as+) (as+) (as+) (as+) (as+) (as+) ias+) (as+) (as+) (as+) (as+) (as+) SUBSTITUTE SHEET (RULE 26) WO 96 07742 PCTIUS95/07233 41 RNA blot analysis of melon plants transgenic for the B.

oleracea ACC oxidase antisense construct in pEPG604 shows accumulation of ACC oxidase antisense

RNA

(Figures 6, 7, and For example, transgenic

R

0 melon plants 4168-18, 4168-10, 4168-20, and 4168-21 accumulate substantial levels of ACC oxidase antisense transcript (Figure 6 and Table II).

Figure 7 shows an autoradiogram of RNA blot of total RNA extracted from Ro transgenic melon plants (leaves) hybridized with B. oleracea ACC oxidase sense RNA probe (approximately 50 x 106 cpm 3 P-labelled RNA probe).

RNA

extracted from melon plants transformed with virus coat protein cassettes and RNA extracted from red cabbage plants transformed with pEPG604 are also included Approximately 10 ug total plant RNA was loaded in each well. Lane 1, RNA MW Markers; lane 2, melon line transformed with pEPG328 (virus coated protein cassettes); lane 3, melon line CA40 transformed with pEPG328; lane 4, line 4168-11B; lane 5, line 4168-18; lane 6, 4168-19; lane 7, melon line 626 transformed with pEPG212 (virus coat protein cassettes); lane 8, melon nontransgenic control; lane 9, 4168-10; lane 4168-20; lane 11, 4168-21; lane 12, 4168-15B; lane 13, red cabbage transgenic line 604-30 transformed with PEPG604; lane 14,, nontransgenic red cabbage; lane B. oleracea ACC oxidase antisense RNA synthesized in vitro; and lane 16, B.oleacea ACC oxidase sense RNA synthesized in vitro. Number 4168 refers to melon line CA10 transformed with PEPG604 (see Table II for details).

This result strongly indicates that B. oleracea ACC oxidase antisense constructs are actively transcribed after being transferred into melon.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 42 RNA blot analysis of R, progeny of 4168-10, 4168-19, and 4168-20 shows that some progeny accumulate ACC oxidase antisense RNA to high levels, and others accumulate lower levels of antisense RNA (Figures 7 and 8 and Table III).

Figure 7 shows an RNA blot of total RNA extracted from RI transgenic melon progeny of line 4168-10 hybridized with B. oleracea ACC oxidase sense RNA probe (about 50 x 106 cpm "P-labelled RNA probe). Approximately ug total RNA was electrophoresed in each lane. Seed taken from a fruit produced on Ro plant 4168-10 was germinated and RNA samples were extracted from seedlings for analysis. Lane 1, RNA MW markers; land 2, melon line CA10 transformed with pEPG328; lane 3, 4168-10-1; lane 4, 4168-10-2; lane 5, 4168-10-3; lane 6, 4168-10-4; lane 64168-10-4; lane 7, 4168-10-5; lane 8, CA10 transformed with pEPG196; lane 9, 4168-10-6; lane 10, 4168-10-7; lane 11, 4168-10-8; lane 12, 4168- 10-9; lane 13, 4168-10-11; lane 14, 4168-18

R

0 lane B. oleracea ACC oxidase antisense RNA synthesized in vitro; and lane 16, B. oleracea ACC oxidase sense RNA synthesized in vitro. Number 4168 refers to melon line transformed with PEPG604 (see Table II for details).

Figure 8 shows an RNA blot of total RNA extracted from R, transgenic melon progeny of lines 4168-19 and 4168-20 hybridized with B. oleracea ACC oxidase sense RNA probe. Electrophoresis and hybridization conditions were similar to conditions used in Figures 3 and 4.

Seed taken from produced on Ro plants 4168-19 and 4168was germinated and RNA samples were extracted from seedlings for analysis. Lane 1, RNA MW markers; Lane 2, CA10 transformed with PEPG328; lane 3, 4168--19-12; lane 4, 4168-20-1; lane 5, 4 168-20-21ane 6, 4168-19-13; lane 7, 4168-19-14; lane 8, 4168-20-3; lane 9, 4168-20- SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTfUS95/07233 43 4; lane 10, 4168-20-5; lane 11, CA10 transformed with pEPG208; lane 12, 4168-20-6; lane 13, 4168-20-7; lane 14, 4168-20-8; lane 15, 4168-20-9; lane 16, 4168-20-10; lane 17, 4168-20-11; lane 18, 4168-20-12; lane 19, 4168-20-13; lane 20, 4168-20-14; lane 21, 4168-20-15; lane 22, 4168-18 Ro; lane 23, B. oleracea ACC oxidase antisense RNA synthesized in vitro; and lane 24, B.

oleracea ACC oxidase sense RNA synthesized in vitro.

Numbers 4168-19 and 4168-20 refer to melon line transformed with PEPG604 (see Table II for details).

These results demonstrate clearly that the transgene is heritable and that it produces antisense RNA in R, progeny.

It is highly unlikely that the hybridization signals shown in Figures 6, 7, and 8 result from non-specific hybridization. Each RNA blot included an antisense and sense in vitro transcript-of ACC oxidase (for example, lanes 15 and 16, respectively, in Figures 6 and 7).

ACC oxidase sense RNA in vitro transcript probe hybridized specifically with antisense in vitro transcript (for example, see Figures 6 and 7, lanes and 16). The sense RNA transcript probe did not hybridize with blotted antisense transcript (Figures 6, and 7, lane 16).

Hybridizations signals produced in RNA extracted from nontransgenic red cabbage, melons, and broccoli were compared with RNA extracted from pEPG604-transformed red cabbage melons, and broccoli. Only RNA samples extracted from transgenic plants produced an ACC oxidase antisense signal (for example, Figure 6, lanes 13 and 14).

The mobility of ACC oxidase antisense transcripts produced from the cassette in pEPG604 (ACC oxidase full SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 44 length antisense) were also compared with transcripts produced from the cassette in pEPG608 (ACC oxidase truncated antisense) following transformation into red cabbage. ACC oxidase transcripts detected in red cabbage plants transformed with the full length construct are longer than the transcripts detected in red cabbage plants transformed with the truncated ACC oxidase construct. This result demonstrates conclusively that the sense RNA problem is detecting only ACC oxidase antisense RNA transcripts.

These results demonstrate that only antisense RNA transcribed by the B. oleracea ACC oxidase transgene in the plant is being detected by the 3 P-labelled RNA probe.

Lack of detectable ACC oxidase antisense accumulation does not indicate that the transgene will be ineffective in inhibiting ethylene biosynthetic pathway gene expression. Published results indicate that the degree of endogenous sense RNA reduction is not related to levels of antisense RNA accumulation (for example, see Stockhaus et al., 1990). Endogenous melon ACC oxidase mRNA is produced in transgenic lines.

Melon, red cabbage, and broccoli plants transformed with pEPG610 and pEPG612 are analyzed in the same way.

These binary plasmids include ACC synthase antisense RNA constructs. The analysis includes Northern analysis to evaluate B. oleracea ACC synthase antisense RNA accumulation and reduction in levels of endogenous ACC synthase antisense RNA accumulation and reduction in levels of endogenous ACC synthase sense RNA levels.

The analysis shows expression of RNA in these plants.

While specific embodiments of the invention have been described, it should be apparent to those skilled in SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTIUS95/07233 45 the art that various modifications thereof can be made without departing from the true spirit and scope of the invention. Accordingly, it is intended that the following claims cover all such modifications with the full inventive concept.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 46 A. One of our first goals was to determine whether our ACC oxidase constructs produce antisense RNA in a transgenic situation. To answer this question, we transformed ACC oxidase constructs into red cabbage.

Transgenic red cabbage lines were generated with the use of the following binary plasmids; pEPG600, 604, 606, and 608. We verified the transgenic status of many of the plants by NPTII ELISA and PCR analysis of the ACC oxidase transgene. These are summarized in the Tables.

B. Next we isolated, electrophoresed, and blotted total RNA by methods described in the melon ACC oxidase disclosure. Antisense ACC oxidase RNA transcripts were detected in RNA extracted from plants transformed with pEPG604 and 608 (see Tables).

C. We next verified unambiguously that hybridization signals detected in total RNA of red cabbage R, transgenics correspond to Brassica oleracea ACC oxidase antisense messenger RNA. We analyzed cabbage R, plants transformed with pEPG604 (ACC oxidase full-length CDNA AS cassette) and plants transformed with pEPG608 (ACC oxidase truncated cDNA AS cassette). We electrophoresed both "604" and "608" transgenic RNAs on the same gel to compare mobilities of transgene messages produced by the full length and the truncated genes. The resulting blot clearly shows smaller messages in the "608" transgenic RNA's and longer messages in the "604" RNA's. This hybridization result can only be explained by expression of ACC oxidase antisense genes.

SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCT/US95/07233 47 D. Brocoli plants transgenic for ACC oxidase constructs have also been obtained. These include the following lines: Transgenic Line Number 173-10 133-1 173-50 173-40 173-20 133-19 224-55 238-33 294-77 287-68 294-99 238-6 266-7 133-22 294-45 224-81 290-9 224-62 133-14 294-27 287-67 294-53 294-84 294-88 238-77 287-72 238-77 294-144 294-35 294-3 287-36 287-123 294-122 294-109 294-4 294-47 pEPG Construct 604 604 604 604 604 604 604 604 600 600 600 604 604 604 600 604 600 604 604 600 600 600 600 600 604 600 604 600 600 600 600 600 600 600 600 600 Status potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted potted shoots shoots shoots shoots shoots shoots shoots shoots shoots shoots shoots SUBSTITUTE SHEET (RULE 26) WO 96/07742 PCTUS95O7233 48 TRANSGENIC RED-CABBAGE

EVALUATION

Germ-Iine:(1 6)NC931 7424 Gene construct: pEPG6O6 I

I

Transformant#

NPTII

ELISA PCR 1PCR-Gene presence 1 1

I

606-1 0.329 0.329 t 4.

L

606-2 1.298 RNA Transcript blot 11:?? blot 12: degraded RNA blot 12:?? 1.29 606-3 1.028 SUBSTITUTE SHEET (RULE 26) WO 96/07742 WO 9607742PCT/US95/07233 49 TRANSGENIC RED-CABBAGE EVALUATION Germ-line: (1 5)NC931 7405 Gene construct: pEPG6O8 NPTI I Transformant# PCR-Gene PCR presence RNA Transcript 608-1 1.398 blots 7 12: AS+ 608-2 0.334 no RNA 608-3 1.776 __blot 7: AS+ 608-4 1.649 blot 7: AS+ 608-5 1.651 blot 6 608-6 1.68 1 not tested 608-7 1.924 blot 13: AS+ 608-8 1.743 no RNA 608-9 1.909

RNA

608-10 1.210 no RNA 608-11 1.555 __blot 12: AS+ 608-12 0.007 blot 13: AS+ 608-13 0.828 blot 13: AS+ 608-14 1.892 no RNA 608-1 5 1.725 not tested 608-16 12:AS 608-17 blot 13:AS SUBSTITUTE SHEET (RULE 26) WO 96/07742 WO 9607742PCT1US95/07233 50 TRANSGENIC RED-CABBAGE EVALUATION Germ-line: (4)PC929090 Gene construct: pEPG600

NPTII

Transformant# -PCR-Gene PCR presence RNA Transcript 600-1 1.545 blot 12: AS- 600-2 1.472 blot 12: AS- 600-3 1.792 no RNA 600-4 1.801 no RNA 600-5 not not tested tested 600-6 not not tested tested SUBSTITUTE SHEET (RUL8 26) WO 96/07742 PC/US95/07233 51 TRANSG EN IC RED-CABBAGE

EVALUATION

Germ-line: (1 6)NC931 724 Gene coflstruto Pn3f~A w Transformant# N PTI I ELISA I PCR PCR-Gene presence I 4- 604-1 1.300 i 4 I 604-2 0.557

R

4 4. 604-3 0.573 604-4 0.757 604-5 0.973 604-6 0.670 604-7 1.041 blo 604-8 1.632 N A Transcript blot 8: AS+ blot 9: AS? blot 9: AS+ blot 8: AS+ blot 8: AS? ts 8 13: AS? blot 9: AS? 604-9 604-10 604-11 1.406 1.007 1.131 4. 4 1 604-12 10.5521 604-13 A,B 1.125 1 I-4 I 604-14 1.004 4. i 604-15 1.153 604-16 f1.291 1 604-17 0.043 I blot 9: AS+ blot 8: AS+ blot 9: AS+ blot 9: degraded RNA blot 9: AS blot 11: degraded blots 6 7: AS+ blot 11: degraded RNA blot 10: AS+ blot 1: AS+ blot 1: gAdedRN blot 10: AS+ 604-18 0.277 604-19 1.329 604-20 0.911 604.21 1.479 604-22 1.535 64-23 1.486 604-24 1.037 SUBSTITUTE SHEET (RULE 26? WO 96/07742 PCTIUS95/07233 52 TRANSGENIC RED-CABBAGE

EVALUATION

Germ-line: (16)NC931724 Gene construct: pEPG6O4 I r Transformant#

NPTII

ELISA IPCR PCR-Gene presence 604-1 1.300 604-25 41.556 j 604-26 1.704 4 J. I 604-27 1.537 604-28 1.293 604-29 1.702 604-30 1.178 604-3 1 1.810 604-32 1.575 604-33 1.597 604-34 604-35 604-36 604-37 604-38 604-39 RNA Transcript blot 8: AS+ blot 13: AS? blots 10 11: AS+ blot 12: AS+ blots 6 7: AS+ blots 6& 11: AS blots 6 7: AS blot 10: AS not tested blot 10: ASblot 11: degraded RNA blots 6, 7, 11, 15: AS+ blot 10: AS+ blot 10: ASnot test no RNA not tested 604-40 not tested 1 .1.

604-41 not tested not tested 604-421 604-443J 604-434 SUBSTITUTE SHEET (RULE 26) 52a Sequence listing Information for seq id no: 1: sequence characteristics: length: 321 amino acids Type: amino acid (d) topology: linear (ii) molecule type: protein (xi) sequence description: seq id no:1: Met Glu Lys Asn lie Lys Phe Pro Val Val Asp Leu Ser Lys Leu lie 1 5 10 Gly Glu Glu Arg Asp Gin Thr Met Ala Leu lie Asn Asp Ala Cys Glu 25 Asn Trp Gly Phe Phe Glu lie Val Asn His Gly Leu Pro His Asp Leu 40 Met Asp Asn Val Glu Lys Met Thr Lys Glu His Tyr Lys lie Ser Met 55 Glu Gin Lys Phe Asn Asp Met Leu Lys Ser Lys Gly Leu Glu Asn Leu 70 75 Glu Arg Glu Val Glu Asp Val Asp Trp Glu Ser Thr Phe Tyr Leu Arg 90 His Leu Pro Gin Ser Asn Leu Tyr Asp lie Pro Asp Met Ser Asp Glu 100 105 110 Tyr Arg Thr Ala Met Lys Asp Phe Gly Lys Arg Leu Glu Asn Leu Ala 115 120 125 Glu Asp Leu Leu Asp Leu Leu Cys Glu Asn Leu Gly Leu Glu Lys Gly 130 135 140 Tyr Leu Lys Lys Val Phe His Gly Thr Lys Gly Pro Thr Phe Gly Thr 145 150 155 160 S. Lys Val Ser Asn Tyr Pro Ala Cys Pro Lys Pro Glu Met lie Lys Gly 0 165 170 175 Leu Arg Ala His Thr Asp Ala Gly Gly lie lie Leu Leu Phe Gin Asp 180 185 190 Asp Lys Val Ser Gly Leu Gin Leu Leu Lys Asp Gly Asp Trp lie Asp 195 200 205 Val Pro Pro Leu Asn His Ser lie Val lie Asn Leu Gly Asp Gin Leu 210 215 220 Glu Val lie Thr Asn Gly Arg Tyr Lys Ser Val Met His Arg Val Val 225 230 235 240 Thr Gin Lys Glu Gly Asn Arg Met Ser lie Ala Se. Phe Tyr Asn Pro 245 250 255 Gly Ser Asp Ala Glu lie Ser Pro Ala Ser Ser Leu Ala Cys Lys Glu 260 265 270 Thr Glu Tyr Pro Ser Phe Val Phe Asp Asp Tyr Met Lys Leu Tyr Ala 275 280 285 Gly Val Lys Phe Gin Pro Lys Glu Pro Arg Phe Glu Ala Met Lys Asn 290 295 300 Ala Asn Ala Val Thr Glu Leu Asn Pro Thr Ala Ala Val Glu Thr Phe 305 310 315 320 Information for seq id no:2: sequence characteristics: length: 976 base pairs type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: cdna (iii) hypothetical: no (iv) anti-sense: no (vi) original source: organism: brassica oleracea (ix) feature: name/key: cds location: 3..965 Libc\O1915 (xi) sequence description: seq id no:2: CC ATG GAG AAG AAC ATT AAG TTT CCA GTT GTA GAC TTG TCC AAG CTC 47 Met Glu Lys Asn lie Lys Phe Pro Val Val Asp Leu Ser Lys Leu 1 5 10 ATT GGT GAA GAG AGA GAC CAA ACC ATG GCT TTG ATC AAC GAT GCT TGT lie Gly Glu Glu Arg Asp Gin Thr Met Ala Leu lie Asn Asp Ala Cys 25 GAG AAT TGG GGC TTC TTT GAG ATA GTG AAC CAT GGT TTA CCA CAT GAT 143 Glu Asn Trp Gly Phe Phe Glu lie Val Asn His Gly Leu Pro His Asp 40 TTG ATG GAC AAC GTC GAG AAG ATG ACA AAG GAA CAT TAC AAG ATA TCA 191 Leu Met Asp Asn Val Glu Lys Met Thr Lys Glu His Tyr Lys lie Ser 55 ATG GAA CAA AAG TTC AAC GAC ATG CTC AAA TCA AAA GGT TTG GAA AAT 239 Met Glu Gin Lys Phe Asn Asp Met Leu Lys Ser Lys Gly Leu Glu Asn 70 CTT GAG AGA GAA GTT GAG GAT GTT GAT TGG GAA AGC ACT TTC TAC CTT 287 Leu Glu Arg Glu Val Glu Asp Val Asp Trp Glu Ser Thr Phe Tyr Leu 85 90 CGT CAT CTC CCT CAG TCC AAT CTC TAC GAC ATT CCT GAT ATG TCT GAT 335 Arg His Leu Pro Gin Ser Asn Leu Tyr Asp Ile Pro Asp Met Ser Asp 100 105 110 GAA TAC CGG ACG GCC ATG AAA GAT TTT GGG AAG AGA TTG GAG AAT CTT 383 Glu Tyr Arg Thr Ala Met Lys Asp Phe Gly Lys Arg Leu Glu Asn Leu 115 120 125 GCT GAG GAT TTG TTG GAT CTA TTG TGT GAG AAT TTA GGG TTA GAG AAA 431 Ala Glu Asp Leu Leu Asp Leu Leu Cys Glu Asn Leu Gly Leu Glu Lys 130 135 140 GGG TAC TTG AAG AAA GTT TTT CAT GGA ACA AAA GGT CCA ACC TTT GGG 479 Gly Tyr Leu Lys Lys Val Phe His Gly Thr Lys Gly Pro Thr Phe Gly 145 150 155 ACT AAG GTG AGC AAC TAT CCA GCT TGT CCT AAG CCA GAG ATG ATC AAA 527 Thr Lys Val Ser Asn Tyr Pro Ala Cys Pro Lys Pro Glu Met lie Lys 160 165 170 175 GGT CTT AGG GCC CAC ACT GAT GCA GGA GGC ATC ATC TTG TTG TTT CAA 575 Gly Leu Arg Ala His Thr Asp Ala Gly Gly lie lie Leu Leu Phe Gin 180 185 190 GAT GAC AAG GTC AGT GGT CTC CAG CTT CTT AAA GAT GGT GAC TGG ATT 623 Asp Asp Lys Val Ser Gly Leu Gin Leu Leu Lys Asp Gly Asp Trp lie 195 200 205 GAT GTT CCT CCA CTC AAC CAC TCT ATT GTC ATC AAT CTT GGT GAC CAA 671 Asp Val Pro Pro Leu Asn His Ser lie Val lie Asn Leu Gly Asp Gin 210 215 220 CTT GAG GTG ATA ACC AAC GGC AGG TAC AAG AGT GTG ATG CAT CGT GTG 719 Leu Glu Val lie Thr Asn Gly Arg Tyr Lys Ser Val Met His Arg Val 225 230 235 GTG ACT CAG AAA GAA GGA AAC AGA ATG TCA ATT GCA TCT TTC TAC AAC 767 Val Thr Gin Lys Glu Gly Asn Arg Met Ser lie Ala Ser Phe Tyr Asn 240 245 250 255 CCG GGA AGC GAT GCT GAG ATC TCT CCA GCT TCA TCG CTT GCC TGT AAA 815 Pro Gly Ser Asp Ala Glu lie Ser Pro Ala Ser Ser Leu Ala Cys Lys 260 265 270 Libc\01915 52c GAA ACC GAG TAC CCA AGT TTT GTT TTT GAT GAC TAC ATG AAG CTC TAT 863 Glu Thr Glu Tyr Pro Ser Phe Val Phe Asp Asp Tyr Met Lys Leu Tyr 275 280 285 GCT GGG GTC AAG TTT CAG CCT AAG GAG CCA CGG TTC GAG GCA ATG AAG 911 Ala Gly Val Lys Phe Gin Pro Lys Glu Pro Arg Phe Glu Ala Met Lys 290 295 300 AAT GCT AAT GCA GTT ACA GAA TTG AAC CCA ACA GCA GCC GTA GAG ACT 959 Asn Ala Asn Ala Val Thr Glu Leu Asn Pro Thr Ala Ala Val Glu Thr 305 310 315 TTC TAA AAACACCATG G 976 Phe 320 information for seq id no:3: sequence characteristics: length: 34 base pairs type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: other nucleic acid (a) description: /desc "oligonucleotide primer rmm 389" (iii) hypothetical: no (iv) anti-sense: no (xi) sequence description: seq id no:3: GAGAGAGCCA TGGAGAAGAA CATTAAGTTT CCAG 34 Information for seq id no:4: sequence characteristics: length: 39 base pairs type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: other nucleic acid (a) description: /desc "oligonucleotide primer rmm 391" (iii) hypothetical: no (iv) anti-sense: no (xi) sequence description: seq id no:4: CGGCATCTCT GAAAGATTTT TGTGGATCCT CAAACTCGC 39 Information for seq id sequence characteristics: length: 34 base pairs type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: other nucleic acid (a) description: /desc "oligonucleotide primer rmm 480" (iii) hypothetical: no (iv) anti-sense: no 20 (xi) sequence description: seq id CGGCATCTCT GAAAGATTTT TGTGGTACCT CAAA 34 Information for seq id no:6: sequence characteristics: length: 96 base pairs type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: other nucleic acid (a) description: /desc "oligonucleotide primer rmm470" (iii) hypothetical: no (iv) antisense: no (xi) sequence description: seq id no:6: GAGAGCCATG GAGAAGAACA TTAAGTTTCC AGTTGTAGACTTGTCCAAGC TCATTGGTGA AGAGAGAGAC CAAACAATGG CTTTGATCAA CGATGC 96 Libc\01915 Information for seq id no:7: sequence characteristics: length: 38 base pairs type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: other nucleic acid (a) description: /desc "Oligonucleotide Primer RMM39O" (iii) hypothetical: no (iv) antisense: no (xi) sequence description: seq id no:7: CCGCCAATTA ACAACCAGGT ACCACAAATT TOACACOC 38 Information for seq id no:8: sequence characteristics: length: 1772 base pairs Type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: dna (genomic) (iii) hypothetical: no (iv) anti-sense: no (xi) sequence description: seq id no:8: GAGAGAGAGC CATGGAGAAG AACATTAAGT GTGAAGAGAG AGACCAAACC

ATGGCTTTGA

TTGAGGTACA AGCATATATG TGATTATATC TAATGTGGAT CTTTTTGTTT GGTGGTTAAC CCACATGATT TGATGGACAA CGTCGAGAAG GAACAAAAGT TCAACGACAT

GCTCAAATCA

GAG GATGTTG ATTGGGAAAG CACTTTCTAC GACATTCCTG ATATGTCTGA TGMATACCGG CTTTAAATCA TATGTTATGG TAACCAAAAA CCACTCTGCC ACTTTTACCT ATATTAAAAA ATAACTATAC TTTGTTAGTT AGTAAAAACA TCTAATCCTT TTTGTGTAAT

GAAAATAAAG

G GGAAGAGAT TGGAGAATCT TGCTGAGGAT TTAGAGAAAG GGTACTTGAA GAAAGTTTTT AAGGTGAGCA ACTATCCAGC TTGTCCTAAG ACTGATGCAG GAGGCATCAT

CTTGTTGTTT

CTTAAAGATG GTGACTGGAT

TGATGTTCCT

*GGTGACCAAC TTGAGGTATG ATATGTTCAC n* AAATCCAATG TTCGGTATTG AGTATTGGTT GATTAGTAAA TGTTATAACA GAG CTTATTA TGGCTTTGGG ACATTCATTT

GTATTGTTCT

TAACTGGAAA ATATTTTCCT TATTGMATGT TGATGCATCG TGTGGTGACT

CAGAAAGAAG

ACCCGGGAAG CGATGCTGAG ATCTCTCCAG ACCCAAGTTT TGTTTTTGAT GACTACATGA AGGAGCCACG GTTCGAGGCA ATGAAGAATG GTGTTTGTGT TGTGTGTTTA

CGTCMTAAG

AAGATGTCTG GCGGTTAATT

GTTGGTCCAT

TTCCAGTTGT

TCAACGATGC

TAGCTTTTTT

TTGATTTTCC

ATGACAAAGG

AAAGGTTTGG

CTTCGTCATC

TACATATATA

ATATCATATG

GATTTTTGTG

GTTTTAAGGA

TTGAGAAGAA

TTATTTTGCA

TTGTTGGATC

CATGGAACAA

CCAGAGATGA

CAAGATGACA

CCACTCAACC

ACCACATTTT

TGGTTCGGGT

AACTAGAAGA

CAAATGGTTT

AGGTGATAAC

GAAACAGAAT

CTTCATCGCT

AGCTCTATGC

CTAATGCAGT

GAGTTTGAGC

TTAAAGACTG

GG

AGACTTGTCC

TTGTGAGAAT

GAGTTTGTGT

AGATAGTGAA

AACATTACAA

AAAATCTTGA

TCCCTCAGTC

TTTTTTCTTC

TTATATCCCC

ATATTTTATT

ATTTGTTTCA

ACGTCTAAAA

GGACGGCCAT

TATTGTGTGA

AAGGTCCAAC

TCAAAGGTCT

AGGTCAGTGG

ACTCTATTGT

CAAAAAAATC

TTGATGTAAC

GCMACGTTTC

CTTTGGAAAA

CAACGGCAGG

GTCAATTGCA

TGCCTGTAAA

AAGCTCATTG

TGGGGCTTCT

ACTTMATTGG

CCATGGTTTA

GATATCMATG

GAGAGAAGTT

CAATCTCTAC

ATAAAATCAA

TTTAAAAGGG

TCTAAACAAA

CTTTAGAACC

ATTTMACACA

GAAAGATTTT

GAATTTAGGG

CTTTGGGACT

TAGGGCCCAC

TCTCCAGCTT

CATCAATCTT

TCTTGTTAAA

TGGGAAAAAT

CAACCTCAMA

GGCTAAGGTT

TACAAGAGTG

TCTTTCTACA

120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 TGGGGTCAAG TTTCAGCCTA TACAGAATTG AACCCAACAG GAAACGAAAG AAACAAAAAT ATATTATTGT TGATATAATT Information for seq id no:9: sequence characteristics: length: 1275 base pairs type: nucleic acid (c) strandedness: single topology: linear (ii) molecule type: cdna (iii) hypothetical: no (iv) anti-sense: no (vi) original source: organism: brassica juncea (c) individual isolate: india mustard (ix) feature: name/key: cds location: 64.

i .1026 publication information: authors: Pua, Eng-Chong Sim, Guek-Eng Libc\01915 Chye, Mee-Len title: Isolation and sequence analysis of a cDNA clone encoding ethylene-forming enyzme in Brassica juncea Czern Coss journal: Plant Molecular Biology volume: 19 pages: 541-544 date: 1992 relevant residues in seq id no:9: from 1 to 1275 (xi) sequence description: seq id no:9: CCCGGGAAAA CAATCAAACA ACTAGCTACT TCAACCAAAT ACTTTCAAAG AAGAGAGAGA GAG ATG GAG AAG AAC ATT AAG TTT CCA GTT GTA GAC TTG TCC AAG CTC 108 Met Glu Lys Asn lie Lys Phe Pro Val Val Asp Leu Ser Lys Leu 325 330 335 ATT GGT GAA GAG AGA GAC CAA ACC ATG GCT TTG ATC AAC GAT GCT TGT 156 lie Gly Glu Glu Arg Asp Gin Thr Met Ala Leu lie Asn Asp Ala Cys 340 345 350 GAG AAT TGG GGC TTC TTT GAG ATA GTG AAC CAT GGT TTA CCA CAT GAT 204 Glu Asn Trp Gly Phe Phe Glu lie Val Asn His Gly Leu Pro His Asp 355 360 365 TTG ATG GAC AAC GCC GAG AAG ATG ACA AAG GAA CAT TAC AAG ATA TCA 252 Leu Met Asp Asn Ala Glu Lys Met Thr Lys Glu His Tyr Lys Ile Ser 370 375 380 ATG GAA CAA AAG TTC AAC GAC ATG CTC AAA TCC AAA GGT TTG GAA AAT 300 Met Glu Gin Lys Phe Asn Asp Met Leu Lys Ser Lys Gly Leu Glu Asn o 385 390 395 400 CTT GAG CGA GAA GTT GAG GAT GTT GAT TGG GAA AGC ACT TTC TAC CTT 348 o* Leu Glu Arg Glu Val Glu Asp Val Asp Trp Glu Ser Thr Phe Tyr Leu ~405 410 415 CGT CAT CTC CCT CAG TCC AAT CTC TAC GAC ATT CCT GAT ATG TCT GAT 396 Arg His Leu Pro Gin Ser Asn Leu Tyr Asp lie Pro Asp Met Ser Asp 420 425 430 GAA TAC CGG ACG GCC ATG AAA GAT TTT GGT AAG AGA TTG GAG AAT CTT 444 Glu Tyr Arg Thr Ala Met Lys Asp Phe Gly Lys Arg Leu Glu Asn Leu 435 440 445 GCT GAG GAT TTG TTG GAT CTA TTG TGT GAG AAT TTA GGG TTA GAG AAA 492 Ala GIL Asp Leu Leu Asp Leu Leu Cys Glu Asn Leu Gly Leu Glu Lys 450 455 460 GGG TAC TTG AAG AAA GTG TTT CAT GGA ACA AAA GGT CCA ACC TTT GGG 540 Gly Tyr Leu Lys Lys Val Phe His Gly Thr Lys Gly Pro Thr Phe Gly 465 470 475 480 ACT AAG GTG AGC AAC TAT CCA GCT TGT CCT AAG CCA GAG ATG ATA AAA 588 S Thr Lys Val Ser Asn Tyr Pro Ala Cys Pro Lys Pro Glu Met lie Lys 485 490 495 GGT CTT AGG GCC CAC ACT GAT GCA GGA GGC ATC ATC TTG TTG TTT CAA 636 Gly Leu Arg Ala His Thr Asp Ala Gly Gly lie lie Leu Leu Phe Gin 500 505 510 S0 GAT GAC AAG GTC ACT GGT CTC CAG CTT CTT AAA GAT GGT GAC TGG ATT 684 Asp Asp Lys Val Thr Gly Leu Gin Leu Leu Lys Asp Gly Asp Trp Ile 515 520 525 GAT GTT CCT CCA CTC AAC CAC TCT ATT GTC ATC AAT CTT GGT GAC CAA 732 Asp Val Pro Pro Leu Asn His Ser Ile Val lie Asn Leu Gly Asp Gin 530 535 540 CTT GAG GTG ATA ACT AAC GGC AGG TAC AAG AGT ATG ATG CAC CGT GTG 780 Leu Glu Val lie Thr Asn Gly Arg Tyr Lys Ser Met Met His Arg Val 545 550 555 560 Libc\01915 52f GTG ACT CAG AMA GMA GGA MAC AGA ATG TCA ATT GCA TCT TTC TAO MAC 828 Vai Thr Gin Lys Glu Gly Asn Arg Met Ser Ilie Ala Ser Phe Tyr Asn 565 570 575 COG GGA AGO GAT GOT GAG ATO TOT OCA GOT TOA TOG OTT GOC TGT AAA 876 Pro Gly Ser Asp Ala Glu Ilie Ser Pro Ala Ser Ser Leu Ala Cys Lys 580 585 590 GMA ACC GAG TAO COG AGT TTT GTT TTT GAT GAO TAO ATG MAG OTO TAT 924 Glu Thr Glu Tyr Pro Ser Phe Val Phe Asp Asp Tyr Met Lys Leu Tyr 595 600 605 GOT GGG GTO MAG TTT CAG OCT MAG GAG OCA OGO TTO GAG GOA ATG MAG 972 Ala Gly Val Lys Phe Gin Pro Lys Glu Pro Arg Phe Glu Ala Met Lys 610 615 620 AAT GOT MAT GOA GTT ACG GMA TTG MOC OCA ACA GOA GOC GTA GAG ACT 1020 Asn Ala Asn Ala Val Thr Glu Leu Asn Pro Thr Ala Ala Val Glu Thr 625 630 635 640 TTO TMA MACMAAGTG GAGTTTGAGO GAMAGOMCA MOCAAAAATG TGTTTTGTGT 1076 Phe TGTGTGTTTA OGTOMATMG TTMAAGACTG ATATTATTGT TGATATMATT MAGATGTOTG 1136 GOGGTTMATT GTTGGTOMAT GGTGTTTAMA GTGTGGGGTG TTTATTTATG TTTATGGMAG 1196 ATGATMATM TAAMAATAMA TMTATGATA AOTGTTOTMA GAAAAAAAMA AAAAAAAMA 1256 AOOOGGGOOO GGGOOOGGG 1275 Information for seq id no: sequence characteristics: length: 321 amino acids Type: amino acid (d) topology: linear (ii) molecule type: protein (xi) seauence desc-riptin: er id nns iner S .~eO

S

Oeee 0O.~ 0 *000

C

COOS

0C

C

000 SO S

CO

OC

C.

See

CS..

0e *5 0

CS..

0

S.C.

0e CC AC

C

4J 'KT O~ Met Gu Lys Asn Ilie Lvs Phe Pro -Val Val Asp Leu Se y eu le 1 10 Gly Glu Glu Arg Asp Gin Thr Met Ala Leu le Asn Asp Ala Cys Glu 20 25 Asn Trp 1ly Phe Phe Glu le Val Asn His G9ly Leu Pro His Asp Leu 40 45 Met Asp Asn Ala Gu LysMet Thr Lys Glu His Tyr Lys Ilie SerMe 55 60 Glu Gin Lys Phe Asn Asp Met Leu Lys Ser Lys !Ly Leu Glu Asn Leu 65 170 75 Glu Ag Glu Val Glu Asp Val Asp Trp Glu Ser Thr Phe _Tyr_ Leu Arg 85 90 _95 His Leu Pro Gin Ser 1Asn Leu Tyr Asp Ilie Pro Asp Met Ser Asp Gu ___100 105 110 T~yrArg Thr Ala Met Lys Asp Phe GlyLys Arg Leu Giu Asn Leu Ala 115 ___120 125 Giu Asp Leu Leu Asp Leu Leu Cys Giu Asn Leu *ply Leu Glu Lys G§jy 130 ___135 140 T~y Leu Lys Lys Val Phe His G!L Thr Lys *9ly Pro Thr Phe Gly Thr 145 150 1155 160 -Lys Val Ser Asn Tyr Pro Ala Cys Pro Lys Pro Glu Met le Lys Giy 165 170 -175 Leu Arg Ala His Thr Asp Aa Gy Gy Ilie le Leu Leu Phe GIn As 180 185 190 As LsVa Thr Ley Gin Ley Leu Lys Asp GI y Ap Tr Ilie Asp 15 200 Libc\01915 Val Pro Pro eu Asn His Ser Ile Val le Asn Leu Gly iu _0 215 1 220 Val Ile Thr Asn IL G Arg Tyr Lys -Serj Met Met His- 225 42304 1235 Cys n-r~ Gin Val Asn 255 Lvs 7Ceu Val 240 Pro Glu I nr Gin JLys lGu jGly IAsn ,Arg I Met I Ser 1 Ile I Ala I Ser I F 'he la Gly ESerAsP j Ij a Glu lle Ser Pro AJa Ser Ser Leu1 TLy. Tlu Thr r'V7A Y1 4 rIU I C) Ii e Ival lne lAsp AsDI Tvr I 275 280 Gly Il Lys Phe GIn Pro Lys Glu Pro Arg Phe 290 295 Ala Asn Ala Val Thr Glu Leu Asn Pro Thr Ala 305 310 1 315 Met Glu 300 Ala

LYS

285 Ala Val Leu Met Glu Lys Thr Ala Asn Phe 320 a 0 ma

OSB

0O 0* a a-a' p* Libc\O0 915

Claims (38)

1. A DNA isolate comprising an isolated and purified nucleic acid sequence encoding an ACC oxidase polypeptide from Brassica oleracea, or an artificial variant or naturally occurring allelic variant thereof,

2. A DNA isolate according to claim 1 wherein the nucleic acid comprises an isolated and purified Brassica oleracea nucleic acid which encodes a Brassica oleracea polypeptide, wherein said nucleic acid comprises a nucleotide sequence selected from the group consisting of: the nucleotide sequence as shown in SEQ ID NO:2; the nucleotide sequence as shown in SEQ ID NO;8; io a nucleotide sequence which encodes the same sequence of amino acids as encoded by the nucleotide sequence shown in SEQ ID NO:2; and a nucleotide sequence which encodes the same sequence of amino acids as encoded by the nucleotide sequence shown in SEQ ID NO:8.

3. A DNA isolate comprising an isolated and purified nucleic acid sequence encoding 1 5 a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples.

4. A plant transformation vector comprising a nucleic acid sequence according to any one of claims 1 to 3, a promoter, and a polyadenylation signal, wherein said promoter is upstream and S operably linked to said nucleic acid sequence, and said nucleic acid sequence is upstream and 20 operably linked to said polyadenylation signal. A plant transformation vector according to claim 4 wherein said promoter is Cauliflower mosaic virus 35S promoter. S S6. A plant transformation vector according to claim 4 or claim 5 wherein said polyadenylation signal is the polyadenylation signal of the cauliflower mosaic CaMV 35S gene. 25

7. A plant transformation vector comprising a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples.

8. A bacterial cell comprising a plant transformation vector according to any one of claims 4 to 7.

9. A bacterial cell according to claim 8 in which said bacterial cell is selected from the group consisting of: an Agrobacterium tumefaciens cell and an Agrobacterium rhizogenes cell. A bacterial cell containing a plant transformation vector comprising a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples. [R:\LIBZZ]06072.doc:DKM

11. A transformed plant cell comprising a plant transformation vector according to any one of claims 4 to 7.

12. A transformed plant cell transformed with a plant transformation vector comprising a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples.

13. A transgenic plant selected from the species Brassica oleracea L. comprising transformed cells according to claim 11 or claim 12.

14. A transgenic plant from the species Brassica oleracea L. transformed with a plant transformation vector comprising a nucleic acid sequence encoding a Brassica ACC oxidase ir polypeptide, substantially as hereinbefore described with reference to any one of the examples. A transgenic seed from a transgenic plant according to claim 13 or claim 14, comprising a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide.

16. A transgenic plant seed comprising a plant transformation vector according to any one of claims 4 to 7. 1

17. A transgenic plant seed containing a plant transformation vector comprising a l°. nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore a* described with reference to any one of the examples.

18. A method of producing a recombinant Brassica ACC oxidase polypeptide, wherein the method is characterised by: 20 providing a cell transformed with a DNA isolate according to any one of claims 1 to 3 positioned for expression in a cell; culturing said transformed cell under conditions for expressing said DNA; and isolating said recombinant Brassica ACC oxidase polypeptide.

19. A method of inhibiting an ethylene-inducible event in a plant, wherein said method is characterized by: providing a transgenic plant containing a DNA isolate according to any one of claims 1 to 3 positioned for expression in a cell of a plant; and culturing said transgenic plant under conditions for expressing said DNA. _o

20. A method according to claim 19, wherein said ethylene-inducible event comprises maturation or senescence.

21. A method of inhibiting an ethylene-inducible event in a plant through expression in said plant of a nucleic acid sequence in the antisense direction, wherein said nucleic acid sequence encodes a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples. [R:ALI 3ZZ]06072.doc:DK M

22. A DNA isolate comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding an ACC oxidase polypeptide from Brassica oleracea, or an artificial variant or naturally occurring allelic variant thereof.

23. A DNA isolate according to claim 22, wherein said antisense nucleotide sequence is complementary to a nucleotide sequence selected from the group consisting of: the nucleotide sequence as shown in SEQ ID NO:2; the nucleotide sequence as shown in SEQ ID NO:8; a nucleotide sequence which encodes the same sequence of amino acids as encoded by the nucleotide sequence shown in SEQ ID NO:2; and 1 i a nucleotide sequence which encodes the same sequence of amino acids as encoded by the nucleotide sequence shown in SEQ ID NO:8.

24. A DNA isolate comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples. 5

25. A plant transformation vector comprising a nucleic acid sequence according to any .one of claims 22 to 24, a promoter, and a polyadenylation signal, wherein said promoter is upstream .and operably linked to said nucleic acid sequence, and said nucleic acid sequence is upstream and operably linked to said polyadenylation signal.

26. A plant transformation vector according to claim 25, wherein said promoter is Cauliflower mosaic virus 35S promoter.

27. A plant transformation vector according to claim 25 or claim 26, wherein said polyadenylation signal is the polyadenylation signal of the cauliflower mosaic CaMV 35S gene.

28. A plant transformation vector comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, 25 substantially as hereinbefore described with reference to any one of the examples.

29. A bacterial cell comprising a plant transformation vector according to any one of claims 25 to 28. A bacterial cell according to claim 29 in which said bacterial cell is selected from the group consisting of: an Agrobacterium tumefaciens cell and an Agrobacterium rhizogenes cell.

31. A bacterial cell containing a plant transformation vector comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples.

32. A transformed plant cell comprising a plant transformation vector according to any one of claims 25 to 28. [R:\LII3ZZ]06072.doc:DKM

33. A transformed plant cell transformed with a plant transformation vector comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples.

34. 32 or claim 33. A transgenic Brassica plant comprising transformed plant cells according to claim A transgenic plant according to claim 34 selected from the species Brassica .9 a oleracea L.

36. A transgenic Cucumis plant comprising transformed plant cells according to claim io 32 or claim 33.

37. A transgenic plant according to claim 36 selected from the species Cucumis melo.

38. A transgenic plant containing a plant transformation vector comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples.

39. A transgenic seed from a transgenic plant according to any one of claims 34 to 38, S comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding S a Brassica ACC oxidase polypeptide.

40. A transgenic plant seed comprising a plant transformation vector according to any 20 one of claims 25 to 28.

41. A transgenic plant seed containing a plant transformation vector comprising an antisense nucleic acid sequence complementary to a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples. '2

42. A method of inhibiting an ethylene-inducible event in a plant comprising: providing a transgenic plant with an antisense nucleotide sequence complementary to a nucleotide sequence encoding a Brassica oleracea ACC oxidase polypeptide, positioned for expression in a cell of said plant, wherein said antisense nucleotide sequence is complementary to a nucleotide sequence selected from the group consisting of: 30 the nucleotide sequence as shown in SEQ ID NO:2; the nucleotide sequence as shown in SEQ ID NO:8; a nucleotide sequence which encodes the same sequence of amino acids as encoded by the nucleotide sequence shown in SEQ ID NO:2; and a nucleotide sequence which encodes the same sequence of amino 3. acids as encoded by the nucleotide sequence shown in SEQ ID NO:8; and [R:\LIBZZ]06072.doc:DKM 57 culturing said transgenic plant under conditions for expressing said DNA.

43. A method according to claim 42, wherein said ethylene-inducible event comprises maturation or senescence.

44. A method of inhibiting an ethylene-inducible event in a plant through expression in said plant of an antisense nucleic acid sequence complementary for a nucleic acid sequence encoding a Brassica ACC oxidase polypeptide, substantially as hereinbefore described with reference to any one of the examples. Dated 8 December, 1999 Seminis Vegetable Seeds, Inc. i °Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON [R:\LIBZZ]06072.doc:DKM