EP0733122A1 - Proteines de fusion contenant une proteine rep de virus associe a l'adenovirus et proteine bacterienne - Google Patents

Proteines de fusion contenant une proteine rep de virus associe a l'adenovirus et proteine bacterienne

Info

Publication number
EP0733122A1
EP0733122A1 EP94919252A EP94919252A EP0733122A1 EP 0733122 A1 EP0733122 A1 EP 0733122A1 EP 94919252 A EP94919252 A EP 94919252A EP 94919252 A EP94919252 A EP 94919252A EP 0733122 A1 EP0733122 A1 EP 0733122A1
Authority
EP
European Patent Office
Prior art keywords
protein
rep
adeno
peptide
fragment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP94919252A
Other languages
German (de)
English (en)
Other versions
EP0733122A4 (fr
Inventor
Robert Kotin
Brian Safer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Genetic Therapy Inc
Original Assignee
US Department of Health and Human Services
Genetic Therapy Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services, Genetic Therapy Inc filed Critical US Department of Health and Human Services
Publication of EP0733122A1 publication Critical patent/EP0733122A1/fr
Publication of EP0733122A4 publication Critical patent/EP0733122A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/24—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a MBP (maltose binding protein)-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • This invention relates to adeno-associated virus rep protein and the production thereof. More particularly, this invention relates to fusion proteins including an adeno- associated virus rep protein and a bacterial protein.
  • the left open reading frame of adeno-associated virus, or AAV encodes the so-called rep proteins.
  • Two promoters located at map positions 5 and 19 control expression of the four proteins derived from this ORF. Processing of a common intron results in two gene products which are derived from transcripts that initiated from each promoter (and designated by the proteins' apparent mass in kilodalton ⁇ ) : rep 78 and rep 68 are produced from p5 promoted transcripts, and rep 52 and rep 40 are produced from pl9 promoted transcripts.
  • Plasmid ⁇ containing cloned AAV yield wild-type infectious AAV when transfected into adenovirus infected cells; however, mutations within sections of the rep genes blocked production of infectious virus.
  • the block in viral production was determined to be at the level of DNA replication, thus the gene (and gene products) were referred to as rep.
  • the rep proteins appear to have pleiotropic effects on infected or transfected cells.
  • Properties of the p5 promoted rep proteins determined in vivo by mutational analysis, include the ability to: (i) transactivate p5 transcription; (ii) activate replication of AAV; (iii) inhibit transcription of heterologou ⁇ viral promoters; and (iv) inhibit cellular transformation by bovine papilloma virus, or BPV.
  • p5 derived rep proteins Demonstrable in vitro activities of p5 derived rep proteins are: (i) binding to the AAV ITR; (ii) ⁇ eguence-specific single- ⁇ trand endonuclease (essential for replication of viral DNA; (iii) helicase activity; and (iv) binding to a defined region of human chromosome 19 at the integration locus for AAV proviru ⁇ .
  • the rep proteins are inhibitors of replication and transcription; however, in the presence of helper virus co-infection, the rep protein( ⁇ ) functions as tran ⁇ activator ⁇ of expre ⁇ sion and replication.
  • the roles in replication appear to be the result of direct interactions between rep protein(s) and the viral ITR whereas the transcriptional effect ⁇ may be mediated indirectly by undetermined cellular factor ⁇ .
  • the rep protein ⁇ al ⁇ o may be anti-tumorigenic, and may repre ⁇ expression from certain viral promoters such as human papilloma virus promoters.
  • rep protein ⁇ from cellular extract ⁇ ha ⁇ been problematic.
  • the partially purified rep protein was e ⁇ timated to have been purified 200-1000 fold over the cellular extract although the protein ⁇ were only detected by immunoblotting (Im, et al. , 1992) .
  • a fusion protein which includes an adeno- a ⁇ sociated virus rep protein or a fragment or derivative thereof, and a protein or peptide which i ⁇ not an adeno-a ⁇ sociated virus protein or peptide.
  • the adeno-associated virus rep protein is selected from the group consisting of rep 78, which has a molecular weight of 78 kda; rep 68, which has a molecular weight of 68 kda; rep 52, which ha ⁇ a molecular weight of 52 kda; and rep 40, which ha ⁇ a molecular weight of 40 kda; and fragment ⁇ or derivatives thereof.
  • fragments or derivatives thereof as used herein means that the rep protein or the protein or peptide which i ⁇ not an adeno-a ⁇ sociated viru ⁇ protein or peptide may be a protein or peptide which has deletion( ⁇ ) of amino acid re ⁇ idue ⁇ within the protein or peptide structure, and/or may be truncated at the C-terminal and/or the N-terminal, and/or may be mutated such that one or more amino acid residues normally pre ⁇ ent in the protein or peptide structure are replaced with other amino acid residues.
  • Such fragment ⁇ and derivative ⁇ of rep protein ⁇ retain the ⁇ ame biological activity a ⁇ the unmodified rep protein ⁇ .
  • the adeno-a ⁇ sociated viru ⁇ rep protein is the rep 68 protein or a fragment or derivative thereof.
  • the adeno-a ⁇ ociated virus rep protein is the rep 78 protein or a fragment or derivative thereof.
  • Proteins or peptides which are not adeno-associated virus proteins and peptides include, but are not limited to. bacterial proteins or peptides, or fragments or derivatives thereof; and histidine "tags" of 6 to 10 histidine residues.
  • the protein or peptide which is not an adeno-as ⁇ ociated virus protein or peptide is a bacterial protein or fragment or derivative thereof.
  • the bacterial protein is the E.coli maltose-binding protein or a fragment or derivative thereof.
  • maltose-binding protein or MBP
  • MBP maltose-binding protein
  • Fusion proteins which include MBP can be isolated from supernatants prepared from E.coli by adsorption and elution from a column including an amylose re ⁇ in.
  • AAV rep protein can be isolated and purified, while such AAV rep protein retains its biological activity.
  • fusion proteins also may be produced by standard protein synthesis techniques given the teachings contained herein.
  • the proteins may be synthesized on an automatic peptide or protein ⁇ ynthe ⁇ izer.
  • oligopeptide ⁇ may be synthesized by standard techniques, and such oligopeptide ⁇ may be linked ⁇ ub ⁇ equently by standard technique ⁇ to form the fu ⁇ ion protein.
  • the fusion protein may be produced by genetic engineering technique ⁇ .
  • an expre ⁇ sion vehicle which includes a first DNA sequence encoding an adeno-as ⁇ ociated viru ⁇ rep protein or a fragment or derivative thereof, and a ⁇ econd DNA sequence encoding a protein or a peptide which i ⁇ not an adeno- a ⁇ ociated viru ⁇ protein or peptide, whereby expre ⁇ ion of ⁇ aid first DNA sequence and ⁇ aid second DNA sequence results in expre ⁇ ion of a fusion protein including the adeno-associated virus rep protein or a fragment or derivative thereof, and the protein or peptide which is not an adeno-as ⁇ ociated virus protein or peptide.
  • the adeno-a ⁇ sociated viru ⁇ rep protein and the protein or peptide which is not an adeno-as ⁇ ociated virus protein or peptide may be ⁇ elected from those hereinabove de ⁇ cribed.
  • Expre ⁇ ion vehicles which may be employed include, but are not limited to, eukaryotic vectors, such as yeast vectors and fungal vectors; prokaryotic vector ⁇ , such as bacterial vectors; and viral vectors such as retroviral vectors, adenoviral vectors, and adeno-associated virus vectors.
  • eukaryotic vectors such as yeast vectors and fungal vectors
  • prokaryotic vector ⁇ such as bacterial vectors
  • viral vectors such as retroviral vectors, adenoviral vectors, and adeno-associated virus vectors.
  • the expression vector is a bacterial expres ⁇ ion vector.
  • bacterial expression vectors include, but are not limited to, E.coli expre ⁇ ion vector ⁇ .
  • the DNA which encode ⁇ the fusion protein is under the control of a suitable promoter.
  • suitable promoters which may be employed include, but are not limited to, the CMV promoter; the SV40 promoter; globin promoters, such as the ⁇ -globin promoter; and inducible promoters such as, but not limited to, the MMT promoter, the metallothionein promoter, heat ⁇ hock promoter ⁇ , glucocorticoid promoter ⁇ , and the E.coli tac promoter.
  • the promoter i ⁇ an inducible or regulatable promoter which include ⁇ an operator site for a repressor gene.
  • the promoter is the E.coli tac promoter which includes an operator site for the E.coli lad repressor. Repression i ⁇ ⁇ topped upon the addition of an inducer which bind ⁇ to a repre ⁇ or.
  • the inducer may be, for example, a chemical inducer, ⁇ uch a ⁇ , for example, i ⁇ opropyl- ⁇ -D- thiogalactopyrano ⁇ ide, or IPTG, or ⁇ teroid ⁇ .
  • the expression vehicle is a bacterial expression vector which includes DNA encoding a fusion protein, which includes the E.coli aIE gene, which encodes maltose-binding protein, and DNA encoding an adeno-as ⁇ ociated virus rep protein.
  • the DNA encoding the fu ⁇ ion protein i ⁇ under the control of the E.coli tac promoter, which includes an operator site for the E.coli lad repres ⁇ or, which i ⁇ al ⁇ o contained in the expression vector. In the absence of an inducer, the fusion protein is not expressed.
  • IPTG When IPTG is added to a culture medium containing bacteria tran ⁇ fected with the expre ⁇ ion vector, the IPTG prevents binding of the lac repres ⁇ or to the operator site of the E.coli tac promoter, thereby enabling expre ⁇ sion of the fu ⁇ ion protein.
  • the expre ⁇ sion vehicle may be transfected into an appropriate host cell, whereby the fusion protein i ⁇ expres ⁇ ed by the host cell.
  • Host cells which may be tran ⁇ fected include, but are not limited to, prokaryotic cell ⁇ , ⁇ uch as, for example, bacterial cell ⁇ , ⁇ uch a ⁇ , for example, E.coli cell ⁇ , and eukaryotic cell ⁇ , ⁇ uch as, for example, yeast cell ⁇ and fungal cell ⁇ .
  • Such fu ⁇ ion protein ⁇ are more stable in the above- mentioned cell ⁇ and are le ⁇ toxic to such cell ⁇ than rep protein which i ⁇ not fu ⁇ ed to a protein or peptide, ⁇ uch a ⁇ a bacterial protein, which is not an adeno-as ⁇ ociated viru ⁇ protein or peptide.
  • the fu ⁇ ion protein expressed by the host cell ⁇ in vitro may be employed a ⁇ a therapeutic agent, such a ⁇ , for example, a ⁇ an anti-tumor agent, or a ⁇ an anti-viral agent, whereby the rep protein portion of the fu ⁇ ion protein exhibit ⁇ an anti- tu origenic or anti-viral effect.
  • the fusion protein may be cleaved by an appropriate agent, such as Factor Xa, whereby the rep protein i ⁇ cleaved from the protein or peptide which i ⁇ not an adeno-a ⁇ sociated viru ⁇ peptide or protein. Purified rep protein is produced from the fusion protein by the application of standard technique ⁇ .
  • a protease such as Factor Xa is used to cleave the fusion protein at the cleavage site in MBP.
  • An appropriate affinity column is used to separate the cleaved rep protein from the protein or peptide which is not an adeno-associated virus protein or peptide and from the Factor Xa.
  • Purified rep protein then i ⁇ recovered.
  • the rep protein then may be admini ⁇ tered a ⁇ a therapeutic agent for purpose ⁇ which include tho ⁇ e hereinabove mentioned.
  • Variou ⁇ activitie ⁇ have been associated with expres ⁇ ion of the encoding rep protein in tran ⁇ fected or infected mammalian cell ⁇ .
  • the ⁇ e include repression of reporter gene expres ⁇ ion by heterologou ⁇ promoter ⁇ (Hermonat, Cancer Re ⁇ .. Vol. 51:3373-3377 (1991) and Laughlin, et al., Virology., Vol. 94:162-174 (1979)), inhibition of cellular transformation (Khleif, et al., Virology, Vol. 181:738-741 (1991) and Hermonat, Virology, Vol.
  • rep protein or fusion proteins of MBP and rep protein may be u ⁇ eful a ⁇ a drug in the treatment of human cancer ⁇ by halting or ⁇ lowing down the rapid tumor proliferation that i ⁇ the hallmark of malignancy.
  • An example of how the ⁇ e protein ⁇ could be used to control malignancy would be their incorporation into a tumor-specific protein delivery system.
  • protein could be delivered to cell ⁇ in vitro or ex vivo by electroporation according to the method di ⁇ clo ⁇ ed in Chakrabariti, et al. ( J . Biol. Chem. Vol. 264:15494- 15500 (1989)), who found that electroporation resulted in high efficiency (greater than 90%) uptake of protein ⁇ , and that the protein retained its structure and function.
  • electroporation resulted in high efficiency (greater than 90%) uptake of protein ⁇ , and that the protein retained its structure and function.
  • protoplasts to deliver protein to cell ⁇ in vitro, ex vivo, or in vivo.
  • Such techniques are di ⁇ clo ⁇ ed in Kaneda, et al. (Science. Vol.
  • Liposomes have successfully delivered functional protein ⁇ to cell ⁇ in vitro and in vivo (Debs, et al., J. Biol. Chem.. Vol. 265-10189-92 (1990) and Lin, et al., Biochem. Biophys. Res. Comm.. Vol. 192-413-419 (1993)).
  • the techniques disclo ⁇ ed in the ⁇ e paper ⁇ can readily be applied by per ⁇ on ⁇ ⁇ killed in the art of preparing and u ⁇ ing liposomes to deliver rep protein, given the teaching ⁇ contained herein.
  • Liposome formulations may be prepared by standard methods, for example by suspending lipids in chloroform, drying the lipids onto the walls of a vessel, and hydrating the lipids with a ⁇ olution containing the protein.
  • Suitable lipid ⁇ are known in the art, including pho ⁇ phatidyl ⁇ erine, pho ⁇ phatidyl glycerol, lethicin, and the like.
  • the expre ⁇ sion vehicles of the present invention may also be employed a ⁇ part of a vector ⁇ y ⁇ tem for u ⁇ e in gene therapy.
  • the vector sy ⁇ tem includes a first vector which is the expre ⁇ ion vehicle hereinabove de ⁇ cribed.
  • the vector ⁇ y ⁇ tem also includes a second vector which is an adeno-a ⁇ ociated viral vector which doe ⁇ not include DNA encoding an adeno-a ⁇ ociated viru ⁇ rep protein, and which contain ⁇ DNA encoding at lea ⁇ t one heterologou ⁇ protein to be expre ⁇ sed.
  • the second vector includes an adeno-associated viral 5' ITR, an enhancer sequence, a promoter sequence, a poly A signal, DNA encoding a heterologou ⁇ protein, and an adeno-a ⁇ sociated viral 3' ITR.
  • the second vector may also include an intron, ⁇ uch as the ⁇ -globin intron. Because such vector does not include DNA encoding adeno- a ⁇ sociated viru ⁇ rep protein ⁇ , ⁇ uch vector may include an increased amount of DNA encoding a heterologou ⁇ protein( ⁇ ).
  • Tumor necro ⁇ i ⁇ factor (TNF) genes such as TNF- ⁇
  • genes encoding interferon ⁇ ⁇ uch a ⁇ Interferon- ⁇ ; Interferon- ⁇ , and Interferon- 7 gene ⁇ encoding interleukin ⁇ ⁇ uch as IL-1, IL-l ⁇ , Interleukins 2 through 12
  • genes encoding GM-CSF genes encoding adenosine deamina ⁇ e, or ADA
  • the first and second vectors of the vector ⁇ y ⁇ tem may be used to transduce eukaryotic cells, such as mammalian cell ⁇ , for example, to produce proteins in vitro, or the cell ⁇ may be admini ⁇ tered in vivo to a host as part of a gene therapy procedure.
  • eukaryotic cells such as mammalian cell ⁇
  • the cell ⁇ may be admini ⁇ tered in vivo to a host as part of a gene therapy procedure.
  • expre ⁇ ion of the rep protein by the fir ⁇ t vector enable ⁇ the second vector to integrate into the genome of the eukaryotic cell, whereby expre ⁇ ion of the foreign gene(s) is controlled by the adeno- as ⁇ ociated viral ITR' ⁇ .
  • Eukaryotic cell ⁇ which may be tran ⁇ duced with the fir ⁇ t and ⁇ econd vector ⁇ include, but are not limited to, primary cell ⁇ , ⁇ uch a ⁇ primary nucleated blood cell ⁇ , ⁇ uch a ⁇ leukocyte ⁇ , granulocyte ⁇ , monocyte ⁇ , macrophage ⁇ , lymphocyte ⁇ (including T- lymphocyte ⁇ and ⁇ -lymphocyte ⁇ ), totipotent ⁇ tem cell ⁇ , and tumor infiltrating lymphocyte ⁇ (TIL cell ⁇ ); bone marrow cell ⁇ ; endothelial cell ⁇ ; epithelial cell ⁇ ; keratinocyte ⁇ ; ⁇ tem cell ⁇ ; hepatocyte ⁇ , including hepatocyte precursor cell ⁇ , fibrobla ⁇ t ⁇ ; me ⁇ enchymal cells; me ⁇ othelial cell ⁇ ; and parenchymal cell ⁇ .
  • the cell ⁇ may be targeted to a ⁇ pecific ⁇ ite, whereby the cell ⁇ function as a therapeutic at ⁇ uch ⁇ ite.
  • the cell ⁇ may be cell ⁇ which are not targeted to a ⁇ pecific site, and ⁇ uch cell ⁇ function a ⁇ a ⁇ y ⁇ temic therapeutic.
  • the cell ⁇ may be admini ⁇ tered in combination with a pharmaceutically acceptable carrier ⁇ uitable for admini ⁇ tration to a patient.
  • the carrier may be a liquid carrier (for example, a saline ⁇ olution), or a solid carrier such as, for example, an implant or microcarrier beads.
  • the cells may be introduced intravenously, subcutaneou ⁇ ly, intramu ⁇ cularly, intraperitoneally, intrale ⁇ ionally, etc.
  • the cell ⁇ may be administered by transplanting or grafting the cells.
  • Transduced cells may be used, for example, in the treatment of cancer in a human by transducing into human primary cell ⁇ , ⁇ uch a ⁇ , for example, blood cell ⁇ , which specifically "target" to a tumor and which have been removed from a cancer patient and expanded in culture, the fir ⁇ t and ⁇ econd vectors of the present invention in which the second vector contains gene ⁇ that enhance the anti-tumor effects of the blood cell ⁇ .
  • the blood cell ⁇ can be expanded in number before or after tran ⁇ duction with the fir ⁇ t vector and the ⁇ econd vector containing the de ⁇ ired gene ⁇ . Thu ⁇ , the procedure is performed in such a manner that upon injection into the patient, the transformed blood cells will produce the agent in the patient's body, preferably at the ⁇ ite of the tumor it ⁇ elf.
  • the gene carried by the blood cell ⁇ can be any gene which directly or indirectly enhance ⁇ the therapeutic effect ⁇ of the blood cell ⁇ .
  • the gene carried by the blood cell ⁇ can be any gene which allow ⁇ the blood cell ⁇ to exert a therapeutic effect that it would not ordinarily have, such as a gene encoding a clotting factor u ⁇ eful in the treatment of hemophilia.
  • the gene can encode one or more product ⁇ having therapeutic effect ⁇ . Examples of ⁇ uitable genes include those that encode cytokines ⁇ uch a ⁇ TNF, interleukin ⁇ (interleukin ⁇ 1-14), interferon ⁇ ( a, ⁇ , 7-interferon ⁇ ), T-cell receptor protein ⁇ and Fc receptors for antigen-binding domains of antibodies, such as immunoglobulin ⁇ .
  • ⁇ uitable gene ⁇ include gene ⁇ that modify primary cell ⁇ ⁇ uch a ⁇ blood cells to "target” to a ⁇ ite in the body to which the blood cell ⁇ would not ordinarily "target,” thereby making possible the use of the blood cell's therapeutic properties at that site.
  • blood cells such as TIL cells can be modified, for example, by introducing a Fab portion of a monoclonal antibody into the cells, thereby enabling the cells to recognize a chosen antigen.
  • blood cells having therapeutic propertie ⁇ can be used to target, for example, a tumor, that the blood cells would not normally target to.
  • genes useful in cancer therapy can be used to encode chemotactic factor ⁇ which cau ⁇ e an inflammatory re ⁇ pon ⁇ e at a ⁇ pecific ⁇ ite, thereby having a therapeutic effect.
  • ⁇ uitable gene ⁇ include gene ⁇ encoding ⁇ oluble CD4 which i ⁇ u ⁇ ed in the treatment of AIDS and gene ⁇ encoding ⁇ - antitryp ⁇ in, which i ⁇ useful in the treatment of emphysema caused by ⁇ -antitrypsin deficiency.
  • the tran ⁇ duced cell ⁇ of the pre ⁇ ent invention are u ⁇ eful in the treatment of a variety of di ⁇ ea ⁇ e ⁇ including but not limited to adeno ⁇ ine deamina ⁇ e deficiency, ⁇ ickle cell anemia, thala ⁇ emia, hemophilia, diabetes, ⁇ -antitrypsin deficiency, brain disorder ⁇ ⁇ uch a ⁇ Alzheimer' ⁇ disease, phenylketonuria and other illne ⁇ e ⁇ ⁇ uch a ⁇ growth disorders and heart disease ⁇ , for example, those caused by alterations in the way cholesterol is metabolized, and defects of the immune sy ⁇ tem.
  • the tran ⁇ duced cell ⁇ may be used for the delivery of polypeptides or proteins which are u ⁇ eful in prevention and therapy of an acquired or an inherited defect in hepatocyte (liver) function.
  • they can be used to correct an inherited deficiency of the low den ⁇ ity lipoprotein (LDL) receptor, and/or to correct an inherited deficiency of ornithine tran ⁇ carbamyla ⁇ e (OTC), which re ⁇ ult ⁇ in congenital hyperammonemia.
  • LDL low den ⁇ ity lipoprotein
  • OTC ornithine tran ⁇ carbamyla ⁇ e
  • hepatocyte precur ⁇ or ⁇ tran ⁇ duced with the fir ⁇ t and ⁇ econd vector ⁇ of the pre ⁇ ent invention may be grown in ti ⁇ ue culture ve ⁇ el ⁇ ; removed from the culture ve ⁇ el; and introduced into the body.
  • Thi ⁇ can be done ⁇ urgically, for example.
  • the tis ⁇ ue which i ⁇ made up of tran ⁇ duced hepatocyte precur ⁇ or ⁇ capable of expre ⁇ ing the nucleotide sequence of interest is grafted or transplanted into the body. For example, it can be placed in the abdominal cavity in contact with/grafted onto the liver or in close proximity to the liver.
  • the genetically engineered hepatocyte precursors can be attached to a support, such a ⁇ , for example, microcarrier bead ⁇ , which are introduced (e.g., by injection) into the peritoneal space of the recipient.
  • a support such as a ⁇ , for example, microcarrier bead ⁇
  • the tran ⁇ duced hepatocyte precursors may be injected into the portal venous system or may be injected intrasplenically.
  • the cell ⁇ may be tran ⁇ ported by the circulatory ⁇ y ⁇ tem to the liver. Once in the liver, ⁇ uch cell ⁇ may expre ⁇ the gene( ⁇ ) of intere ⁇ t and/or differentiate into mature hepatocyte ⁇ which express the gene(s) of intere ⁇ t.
  • tran ⁇ duced cell ⁇ of the pre ⁇ ent invention may be employed to treat acquired infectiou ⁇ disease ⁇ , ⁇ uch a ⁇ di ⁇ eases re ⁇ ulting from viral infection.
  • tran ⁇ duced hepatocyte precur ⁇ or ⁇ may be employed to treat viral hepatiti ⁇ , particularly hepatiti ⁇ B or non-A non-B hepatiti ⁇ .
  • the fir ⁇ t and ⁇ econd vector ⁇ , wherein the ⁇ econd vector contain ⁇ a gene encoding an anti- ⁇ en ⁇ e gene could be tran ⁇ duced into hepatocyte precursors to inhibit viral replication.
  • the first and ⁇ econd vector ⁇ wherein the ⁇ econd vector include ⁇ a ⁇ tructural hepatitis gene in the reverse or opposite orientation, would be introduced into hepatocyte precursor ⁇ , re ⁇ ulting in production in the tran ⁇ duced hepatocyte precur ⁇ or ⁇ and any mature hepatocytes differentiated therefrom of an anti- ⁇ en ⁇ e gene capable of inactivating the hepatiti ⁇ viru ⁇ or its RNA transcripts.
  • the hepatocyte precursor ⁇ may be tran ⁇ duced with the first and second vectors wherein the second vector includes a gene which encodes a protein, such as, for example, ⁇ -interferon, which may confer resi ⁇ tance to the hepatiti ⁇ virus.
  • a protein such as, for example, ⁇ -interferon
  • an expre ⁇ ion vector which include ⁇ an adeno-a ⁇ ociated viru ⁇ 5'ITR, at lea ⁇ t one DNA sequence encoding a heterologous protein located 3' to the 5' ITR, and located 3' to the at least one DNA sequence encoding a heterologou ⁇ protein, i ⁇ an adeno-a ⁇ sociated virus 3' ITR, and, located outside the region of the expres ⁇ ion vehicle which i ⁇ 3' to the 5' ITR and 5' to the 3' ITR are the first DNA sequence encoding an adeno-a ⁇ ociated viru ⁇ rep protein or fragment or derivative thereof and the ⁇ econd DNA ⁇ equence encoding a protein or peptide which i ⁇ not an adeno-a ⁇ ociated viru ⁇ protein or peptide.
  • expre ⁇ ion vehicle may be used to tran ⁇ duce eukaryotic cell ⁇ as hereinabove de ⁇ cribed with respect to the fir ⁇ t and ⁇ econd vector ⁇ of the vector ⁇ y ⁇ tem hereinabove mentioned.
  • expre ⁇ ion of the rep protein enable ⁇ the adeno-a ⁇ ociated viru ⁇ 5'ITR, the at lea ⁇ t one DNA ⁇ equence encoding a heterologou ⁇ protein, and the adeno-a ⁇ ociated viru ⁇ 3'ITR to integrate into the genome of the eukaryotic cell, whereby expre ⁇ ion of the foreign gene( ⁇ ) i ⁇ controlled by the adeno- a ⁇ ociated viral ITR' ⁇ .
  • the fu ⁇ ion protein ⁇ expressed by the host cells in vitro have the same biological activitie ⁇ and propertie ⁇ as those hereinabove mentioned for native or wild- type rep protein.
  • Such fu ⁇ ion ⁇ protein ⁇ may al ⁇ o be expre ⁇ ed by the ho ⁇ t cell ⁇ in large quantitie ⁇ .
  • modified rep proteins having deletions and/or mutations of amino acid residues which retain the biological activities and properties of native or wild-type rep protein, and which are not toxic to cells could be employed in a packaging cell line.
  • an expres ⁇ ion vehicle which includes DNA encoding such a modified rep protein.
  • Such expression vehicle may be transfected into an appropriate cell in order to generate a packaging cell line.
  • the packaging cell line may also be transfected with an adeno- as ⁇ ociated viral vector which does not include DNA encoding an adeno-a ⁇ ociated viru ⁇ rep protein, and which contain ⁇ DNA encoding at lea ⁇ t one heterologou ⁇ protein to be expre ⁇ sed.
  • Such packaging cell line then may generate infectiou ⁇ viral particle ⁇ , which may be employed in tran ⁇ ducing eukaryotic cells such as tho ⁇ e hereinabove de ⁇ cribed.
  • eukaryotic cell ⁇ then may be admini ⁇ tered to a host a ⁇ part of a gene therapy procedure, al ⁇ o a ⁇ hereinabove de ⁇ cribed.
  • ⁇ uch modified rep protein ⁇ which are found to retain the biological activitie ⁇ and propertie ⁇ hereinabove de ⁇ cribed with re ⁇ pect to native or wild-type rep protein; and yet are le ⁇ toxic to ho ⁇ t cell ⁇ or organi ⁇ m ⁇ than native rep protein may al ⁇ o be employed a ⁇ a therapeutic, ⁇ uch a ⁇ , for example, a ⁇ an anti-tumor agent or a ⁇ an anti-viral agent a ⁇ hereinabove de ⁇ cribed.
  • the invention may be de ⁇ cribed with re ⁇ pect to the following example ⁇ ; however, the ⁇ cope of the pre ⁇ ent invention i ⁇ not intended to be limited thereby.
  • rep protein ⁇ rep 68 and rep 78 were generated by PCR amplification.
  • a common 5' primer corre ⁇ ponding to nucleotide ⁇ 327-346 of adeno-a ⁇ ociated viru ⁇ (codons 3-9 of rep 68 and the rep 78 open reading frame) was synthesized and used for both rep 68 and rep 78.
  • rep 68 was amplified using a 3' primer corresponding to a reverse complement of AAV nucleotides 2029-2048 (codons 570-576).
  • PCR amplification wa ⁇ performed u ⁇ ing cloned Pfu polymera ⁇ e (Stratagene) with buffer.
  • rep 68 ⁇ a modified rep 68 protein, sometime ⁇ hereinafter referred to as rep 68 ⁇ , in which the last 16 amino acids at the C-terminal have been deleted.
  • pPR997 includes an E.coli malE gene, in which nucleotides 2-26 of the alE gene were deleted, controlled by the E.coli tac promoter which includes an operator site for the lacl repressor.
  • pPR997 al ⁇ o includes a polylinker or multiple cloning site. This cloning strategy resulted in the open reading frame of the rep 68 gene ligating in frame with the malE open reading frame of pPR997 at the 5' end of the rep 68 gene.
  • the 3' terminu ⁇ of the rep 68 gene is a frame- ⁇ hifted fu ⁇ ion between the AAV rep 68 open reading frame and the lacZ ⁇ gene, re ⁇ ulting in an additional 50 re ⁇ idue ⁇ at the carboxy-terminu ⁇ .
  • the re ⁇ ulting pla ⁇ mid is pMBP- rep 68 A .
  • Thi ⁇ ⁇ equence include ⁇ an overlapping region of rep ji8 and rep 78 and the 3' terminu ⁇ of rep 78.
  • the 5' primer corre ⁇ ponds to AAV nucleotides 1872-1894 and the 3' primer correspond ⁇ to the rever ⁇ e complement of AAV nucleotide ⁇ 2215- 2239, and al ⁇ o incorporate ⁇ Hindlll and Xbal ⁇ ite ⁇ .
  • the PCR product wa ⁇ dige ⁇ ted with Hindlll and ligated into Hindlll digested pMBP-rep 68 ⁇ .
  • the MBP-rep 78 protein i ⁇ an in-frame fu ⁇ ion protein between the malE open reading frame and the adeno-a ⁇ sociated viru ⁇ open reading frame beginning at codon 3 of the rep 78 gene.
  • the 3'-terminu ⁇ utilize ⁇ the naturally occurring ⁇ top codon of the rep gene, and therefore there are no carboxy terminu ⁇ re ⁇ idues.
  • E.coli organi ⁇ ms were transfected with pMBP-rep 68 ⁇ or pMBP-rep 78 according to standard technique ⁇ .
  • the DNA encoding MBP-rep 68__ior MBP-rep 78 i ⁇ under the control of the E.coli tac promoter which i ⁇ repre ⁇ sed by the lacl repre ⁇ or gene product. Addition of IPTG prevents binding of the lac repressor to the tac promoter, thereby enabling high levels of expression of MBP-rep 68 ⁇ or MBP rep 78.
  • Recombinants that were po ⁇ itive for the correct insert and orientation were screened for expre ⁇ sion of fu ⁇ ion protein.
  • the bacterial clone ⁇ that produced a protein of the predicted molecular weight were grown on a larger ⁇ cale.
  • One liter culture ⁇ of bacteria tran ⁇ formed with pMBP- rep 68__or pMBP-rep 78 were obtained.
  • a bacterial pellet wa ⁇ obtained from each culture by centrifugation, and each bacterial pellet wa ⁇ re ⁇ u ⁇ pended in 0.05 vol. of column buffer (200mM NaCl, 20mM Tri ⁇ -Cl (pH 7.4), ImM EDTA, and ImM dithiothreitol) .
  • the bacteria were lysed by sonication by four 30 ⁇ econd pul ⁇ e ⁇ .
  • the ⁇ u ⁇ pen ⁇ ion wa ⁇ cleared by centrifugation at 9,000xg for 20 in. at 4°C.
  • MBP-rep 68_4 and MBP-rep 78 comprised approximately 10% of the protein in the E.coli lysate.
  • the ⁇ upernatant wa ⁇ loaded onto a column packed with amylo ⁇ e-Sepharo ⁇ e re ⁇ in equilibrated in column buffer.
  • the column then wa ⁇ washed with 10 column volumes of column buffer.
  • the proteins then were eluted with lx column buffer containing lOmM maltose. Approximately 1 ml fraction ⁇ were collected and 2 ⁇ l were fractionated by SDS-polyacryla ide gel electrophore ⁇ i ⁇ on an 8% SDS-polyacrylamide gel, which wa ⁇ ⁇ ub ⁇ equently ⁇ tained with Cooma ⁇ ie blue. A ⁇ ⁇ hown in Figure 4, lane L i ⁇ the total E.
  • coli ⁇ upernatant applied to the column lane FT is the unad ⁇ orbed fraction; lane ⁇ 1-12 are aliquots of fractions eluted with lOmM malto ⁇ e; and lane M gives molecular weight standards in kilodalton ⁇ of the ⁇ izes indicated.
  • Approximately 90% of the eluted protein wa ⁇ full-length MBP-rep 68 ⁇ or MBP-rep 78.
  • An ITR probe was produced by digesting p ⁇ ub201 (Samulski, et al. , J. Virol.. Vol. 61, pg ⁇ . 3096-3101 1987)) with the re ⁇ triction enzymes Xbal and PvuII.
  • the product is a modified ITR plus 45 nucleotides on the viral ⁇ ide, i.e., AAV nucleotide ⁇ 4490-4667 (Wild type ITR consists of nucleotides 4536-4680).
  • a schematic of the AAV ITR which shows the sequences and organization of the A, A', B, B', C, C, D and D' sequences (Srivastava, et al., J. Virol. , Vol.
  • Such product either may be 3'-end labeled with 32 P-CTP by the filling-in reaction of Klenow or 5'- end labeled with 32 P-ATP and T4 polynucleotide kinase.
  • a ⁇ ynthetic ITR ⁇ equence hereinafter referred to a ⁇ ⁇ ITR, and which includes the A and D' sequence ⁇ of the AAV ITR, was produced by synthetic techniques.
  • ⁇ ITR ha ⁇ the following ⁇ equence: GATCAGTGATGGAGTTGGCCACTCCCTCTCTGCGCTCGCTCGCTCACTGAGGCCG
  • ⁇ ITR also was labeled with 32 P as hereinabove described.
  • the reaction contain ⁇ from 2 to .4 moles of labeled probe (10,000 cpm) and may, in some in ⁇ tance ⁇ , also include unlabeled ITR probe or unlabeled ⁇ ITR probe.
  • the labeled probe ⁇ were incubated with the MBP-rep 68 ⁇ protein fraction ⁇ at 30°C for 15 minute ⁇ in 25 ⁇ l of buffer.
  • the reaction buffer contained lOmM Tris-Cl (pH 7.5), ImM EDTA, lOmM mercaptoethanol, 0.1% Triton X-100, 4% glycerol, and 0.5 ⁇ g poly- (dl-dC) .
  • Binding of MBP-rep 68 ⁇ to 32 P-ITR or 32 P- ⁇ ITR is shown in Figure 6.
  • lanes 1-7 demonstrate binding of MBP-rep 68 ⁇ to 32 P-ITR
  • lanes 8-14 demonstrate binding of MBP-rep 68 ⁇ to 32 P- ⁇ ITR.
  • Lanes 3 and 10 are the control lanes (no MBP-rep 68 ⁇ added). In lane ⁇ 1, 2, 8, and 9, no unlabeled ITR or ⁇ ITR wa ⁇ added. In lane ⁇ 4, 5, 11, and 12, an unlabeled ⁇ ITR competitor was added. In lane ⁇ 6, 7, 13, and 14, an unlabeled ITR competitor was added.
  • MBP- rep 68 ⁇ binds to both 32 P-ITR and 32 P- ⁇ ITR.
  • Al ⁇ o the addition of unlabeled ITR or unlabeled ⁇ ITR reduces the amount of binding of MBP-rep 68 ⁇ to 32 P-ITR or to 32 P- ⁇ ITR.
  • the above results indicate that MBP-rep 68 ⁇ will bind specifically to the AAV ITR.
  • Wild-type or native rep 68 and rep 78 have a site - specific single- ⁇ tranded endonuclea ⁇ e activity that i ⁇ critical for AAV DNA replication. Cleavage at thi ⁇ ⁇ ite, the terminal resolution ⁇ ite, or trs, within the D region of the AAV ITR (Srivastava, et al. , 1983), result ⁇ in tran ⁇ ference of the template ITR to the daughter ⁇ trand. The template strand ⁇ ub ⁇ equently can be repaired ⁇ o that the template and daughter ⁇ trand ⁇ are chimera ⁇ of na ⁇ cent and input DNA. The nicking or trs activity can be measured in vitro u ⁇ ing end-labeled AAV ITR a ⁇ the ⁇ ub ⁇ trate. (Im, et al., 1992)
  • the ITR oligonucleotide of Example 3 which corresponds to the A and D' sequence ⁇ of the AAV ITR, wa ⁇ 5' end labeled and annealed to the complementary oligonucleotide.
  • Approximately 20 ng of duplex oligonucleotide ⁇ were u ⁇ ed a ⁇ ⁇ ub ⁇ trate in each 20 ⁇ l reaction that contained 25mM HEPES-KOH (pH 7.5), 5mM MgCl 2 , ImM dithiothreitol (DTT), 0.4mM ATP, and lO ⁇ g/ml bovine ⁇ erum albumin (BSA) .
  • Each reaction mixture al ⁇ o included 1.0, 0.1, or O.Ol ⁇ l of MBP-rep 78 or MBP-rep 68 ⁇ . Each reaction mixture was incubated at 37°C for 30 minutes. Each reaction wa ⁇ terminated by the addition of lOO ⁇ l of ⁇ top buffer containing lOmM Tri ⁇ -Cl (pH 7.9), lOmM NaCl, 0.5% SDS, 0.2mg/ml yeast tRNA, 20mM EDTA, and 2mg/ml proteina ⁇ e K. The reaction mixture ⁇ then were incubated for 30 min. at 37°C. The nucleic acid ⁇ were extracted by phenol-chloroform and ethanol precipitated. The products then were fractionated on an 8% sequencing gel.
  • lane 1 is a G+A sequencing reaction of the end labeled oligonucleotide for u ⁇ e a ⁇ a ⁇ izing ladder (Maxam, et al. , Meth. in Enzymology. Vol. 65, pg.
  • lane ⁇ 2, 3, and 4 indicate the addition of l.O ⁇ l, O.l ⁇ l, and O.Ol ⁇ l, re ⁇ pectively, of MBP-rep 78 to the reaction;
  • lane ⁇ 5, 6, and 7 indicate the addition of l.O ⁇ l, O.l ⁇ l, and O.Ol ⁇ l, re ⁇ pectively, of MBP-rep 68 to the reaction;
  • Wild-type rep 68 and rep 78 have a helica ⁇ e activity that can be mea ⁇ ured by the di ⁇ placement of a labeled oligonucleotide annealed to single-stranded ⁇ X174 DNA (Im, et al., 1992) .
  • reaction mixture wa ⁇ incubated at 37°C for 30 minute ⁇ .
  • Each reaction wa ⁇ terminated by the addition of lO ⁇ l of 0.5% SDS, 50mM EDTA, 40% glycerol, 0.1% bromophenol blue, and 0.1% xylene cyanole.
  • the reaction product ⁇ were fractionated on a non-denaturing 8% polyacrylamide gel. The gel then wa ⁇ dried and exposed to X-ray autography.
  • MBP-rep 78 and MBP-rep 68 di ⁇ place the labeled oligonucleotide from the template, thu ⁇ indicating that MBP-rep 78 and MBP-rep 68 ⁇ have helica ⁇ e activity.
  • the condition ⁇ for ⁇ cale-up were determined by the pilot experiment.
  • the amount of Factor Xa, time, and temperature condition ⁇ were e ⁇ tabli ⁇ hed by the experiment de ⁇ cribed in the fir ⁇ t paragraph of thi ⁇ example.
  • Ba ⁇ ed upon the condition ⁇ for cleavage a ⁇ determined by the pilot experiment Factor Xa i ⁇ added to the fu ⁇ ion protein in an amount up to about 10 wt. %, a ⁇ determined by the pilot experiment.
  • Incubation of the reaction mixture was carried out at a temperature of from about 4°C to about room temperature for a period of time of from about 3 hours to several days.
  • Partial denaturation of the protein may, in ⁇ ome ca ⁇ e ⁇ , be nece ⁇ ary for efficient cleavage. Such denaturation may be carried out with a mild detergent or surfactant (such as Triton X-100, or Nonidet 40), at concentrations of les ⁇ than about 1.0%. A harsher detergent, sodium dodecyl ⁇ ulfate, al ⁇ o may be employed at low concentration ⁇ .
  • a mild detergent or surfactant such as Triton X-100, or Nonidet 40
  • a harsher detergent, sodium dodecyl ⁇ ulfate, al ⁇ o may be employed at low concentration ⁇ .
  • ⁇ ome ca ⁇ e ⁇ for example, to remove denaturant ⁇ ⁇ uch a ⁇ guanidine hydrochloride, it may be nece ⁇ ary to dialyze the fusion protein against a Factor Xa cleavage buffer of 20 mM Tris-Cl, 100 mM NaCl, 2 M CaCl 2 , and optionally, 1 mM sodium azide.
  • the fusion protein cleavage mixture which contains rep protein, MBP, and Factor Xa, then wa ⁇ dialyzed again ⁇ t a buffer (hereinafter referred to a ⁇ Buffer A) of 10 mM Tris-Cl, 25 mM NaCl, 10 mM b-mercaptoethanol, pH8.0.
  • a ⁇ Buffer A 10 mM Tris-Cl, 25 mM NaCl, 10 mM b-mercaptoethanol, pH8.0.
  • the dialy ⁇ i ⁇ con ⁇ i ⁇ t ⁇ of 2 or 3 change ⁇ of 100 volume ⁇ for a period of time of at lea ⁇ t two hour ⁇ for each change.
  • the fusion protein and cleavage mixture then was loaded onto the column. 2.5 ml fractions of the eluate then were collected. The column then was washed with 3 to 5 column volumes of Buffer 1, and 2.5 ml fractions of the eluate continued to be collected.
  • Cells then are wa ⁇ hed two time ⁇ with PBS (1 x ⁇ olution) .
  • the cell ⁇ then are washed with DMEM, and then covered with DMEM.
  • the lipo ⁇ ome ⁇ then are applied to the cell ⁇ in order to deliver the MBP-rep fu ⁇ ion protein to the cell ⁇ .
  • Advantage ⁇ of the present invention include the ability to produce adeno-a ⁇ ociated viru ⁇ rep protein in a form that enable ⁇ the protein to be purified ea ⁇ ily and enables the protein to be obtainable in large quantitie ⁇ .
  • ⁇ uch protein ha ⁇ the ⁇ a e biological activity a ⁇ native rep protein, and therefore, ⁇ uch protein may be employed for the same uses a ⁇ native rep protein.
  • the ⁇ cope of the present invention is not to be limited to the specific embodiments de ⁇ cribed above.
  • the invention may be practiced other than a ⁇ particularly de ⁇ cribed and ⁇ till be within the ⁇ cope of the accompanying claim ⁇ .
  • MOLECULAR TYPE Fragment of modified adeno- associated virus ITR sequence
  • NAME/KEY Adeno-associated virus ITR (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: TCCTTGGGGA TCACTACCTC AACCGGTGAG GGAGAGACGC GCGAGCGAGC GAGTGACTCC 60 GGCCCGCTGG TTTCCAGCGG GCTGCGGGCC CAAAGGGCCC GCCGGAGTCA CTCGCTCGCT 120 CGCGCCTCTC TCCCTCACCG GTTGAGGTAG TGATCCCCAA GGA 163

Abstract

L'invention concerne une protéine de fusion contenant une protéine rep de virus associé à l'adénovirus, un fragment ou un dérivé de cette dernière, ainsi qu'une protéine ou un peptide autre qu'une protéine ou un peptide de virus associé à l'adénovirus. On produit ladite protéine de fusion à l'aide de techniques de génie génétique dans lesquelles on produit un véhicule d'expression comprenant une première séquence d'ADN codant une protéine rep de virus associé à l'adénovirus, un fragment ou un dérivé de cette dernière, ainsi qu'une deuxième séquence d'ADN codant une protéine ou un peptide autre qu'une protéine de virus associé à l'adénovirus, l'expression desdites première et deuxième séquences d'ADN induisant l'expression d'une protéine de fusion comprenant la protéine rep de virus associé à l'adénovirus, un fragment ou un dérivé de cette dernière, et la protéine ou le peptide tels que la protéine fixant le maltose d'E. coli ne constituant pas une protéine ou un peptide de virus associé à l'adénovirus. Lesdites protéines de fusion peuvent être produites et purifiées en grandes quantités, la partie de la protéine rep de virus associé à l'adénovirus de la protéine de fusion conservant son activité biologique.
EP94919252A 1993-05-26 1994-05-26 Proteines de fusion contenant une proteine rep de virus associe a l'adenovirus et proteine bacterienne Withdrawn EP0733122A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US6723693A 1993-05-26 1993-05-26
US67236 1993-05-26
PCT/US1994/005940 WO1994028157A1 (fr) 1993-05-26 1994-05-26 Proteines de fusion contenant une proteine rep de virus associe a l'adenovirus et proteine bacterienne

Publications (2)

Publication Number Publication Date
EP0733122A1 true EP0733122A1 (fr) 1996-09-25
EP0733122A4 EP0733122A4 (fr) 1998-06-10

Family

ID=22074622

Family Applications (1)

Application Number Title Priority Date Filing Date
EP94919252A Withdrawn EP0733122A4 (fr) 1993-05-26 1994-05-26 Proteines de fusion contenant une proteine rep de virus associe a l'adenovirus et proteine bacterienne

Country Status (4)

Country Link
EP (1) EP0733122A4 (fr)
JP (1) JPH09501309A (fr)
CA (1) CA2162271A1 (fr)
WO (1) WO1994028157A1 (fr)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6342390B1 (en) * 1994-11-23 2002-01-29 The United States Of America As Represented By The Secretary Of Health And Human Services Lipid vesicles containing adeno-associated virus rep protein for transgene integration and gene therapy
US5843742A (en) * 1994-12-16 1998-12-01 Avigen Incorporated Adeno-associated derived vector systems for gene delivery and integration into target cells
US6281010B1 (en) 1995-06-05 2001-08-28 The Trustees Of The University Of Pennsylvania Adenovirus gene therapy vehicle and cell line
US5756283A (en) * 1995-06-05 1998-05-26 The Trustees Of The University Of Pennsylvania Method for improved production of recombinant adeno-associated viruses for gene therapy
DE19545126A1 (de) 1995-12-04 1997-06-05 Hoechst Ag ATP- und Nukleinsäure-bindendes Protein mit Helikase-Eigenschaften
WO1998009524A1 (fr) * 1996-09-06 1998-03-12 Chiron Corporation Procedes et compositions destines a une administration specifique dans le foie de molecules therapeutiques en utilisant des vecteurs recombinants aav
US6544523B1 (en) 1996-11-13 2003-04-08 Chiron Corporation Mutant forms of Fas ligand and uses thereof
ATE476508T1 (de) 1997-11-06 2010-08-15 Novartis Vaccines & Diagnostic Neisseriale antigene
EP2210945B1 (fr) 1998-01-14 2013-06-26 Novartis Vaccines and Diagnostics S.r.l. Antigènes de Neisseria meningitidis
NZ508366A (en) 1998-05-01 2004-03-26 Chiron Corp Neisseria meningitidis antigens and compositions
US7368261B1 (en) 1999-04-30 2008-05-06 Novartis Vaccines And Diagnostics Srl Conserved Neisserial antigens
GB9911683D0 (en) 1999-05-19 1999-07-21 Chiron Spa Antigenic peptides
GB9916529D0 (en) 1999-07-14 1999-09-15 Chiron Spa Antigenic peptides
MXPA02004283A (es) 1999-10-29 2002-10-17 Chiron Spa Peptidos antigenicos neisseriales.
DK1248647T3 (da) 2000-01-17 2010-09-27 Novartis Vaccines & Diagnostic Ydre membranvesikel (OMV) vaccine omfattende N. meningitidis serogruppe B ydre membranproteiner
MXPA03003690A (es) 2000-10-27 2004-05-05 Chiron Spa Acidos nucleicos y proteinas de los grupos a y b de estreptococos.
GB0107658D0 (en) 2001-03-27 2001-05-16 Chiron Spa Streptococcus pneumoniae
GB0107661D0 (en) 2001-03-27 2001-05-16 Chiron Spa Staphylococcus aureus
NZ562929A (en) 2001-12-12 2009-07-31 Novartis Vaccines & Diagnostic Immunisation against chlamydia trachomatis
GB0308198D0 (en) 2003-04-09 2003-05-14 Chiron Srl ADP-ribosylating bacterial toxin
US8268324B2 (en) 2004-03-29 2012-09-18 Galpharma Co., Ltd. Modified galectin 9 proteins and use thereof
EP2054431B1 (fr) 2006-06-09 2011-08-31 Novartis AG Conformères d'adhésines bactériennes

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0486917A2 (fr) * 1990-11-17 1992-05-27 BEHRINGWERKE Aktiengesellschaft Activité antivirale du gène rep codé par l'AAV-2

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5139941A (en) * 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0486917A2 (fr) * 1990-11-17 1992-05-27 BEHRINGWERKE Aktiengesellschaft Activité antivirale du gène rep codé par l'AAV-2

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHIORINI J A ET AL: "BIOLOGICALLY ACTIVE REP PROTEINS OF ADENO-ASSOCIATED VIRUS TYPE 2 PRODUCED AS FUSION PROTEINS IN ESCHERICHIA COLI" JOURNAL OF VIROLOGY, vol. 68, no. 2, February 1994, pages 797-804, XP000608411 *
IM D.S: & MUZYCZKA N.: "The AAV origin bvinding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity." CELL, vol. 61, 4 May 1990, pages 447-457, XP002060793 *
NEW ENGLAND BIOLABS CATALOG, 1992, pages 96-97, XP002061117 *
See also references of WO9428157A1 *

Also Published As

Publication number Publication date
JPH09501309A (ja) 1997-02-10
EP0733122A4 (fr) 1998-06-10
CA2162271A1 (fr) 1994-12-08
WO1994028157A1 (fr) 1994-12-08

Similar Documents

Publication Publication Date Title
WO1994028157A1 (fr) Proteines de fusion contenant une proteine rep de virus associe a l'adenovirus et proteine bacterienne
WO1994028157A9 (fr) Proteines de fusion contenant une proteine rep de virus associe a l'adenovirus et proteine bacterienne
CA2278616C (fr) Adenovirus comprenant des proteines d'hexon modifiees
Chiorini et al. Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli
CA2205874C (fr) Vesicules lipidiques contenant la proteine rep de virus adeno-associe pour integration transgenique et therapie genique
US6521225B1 (en) AAV vectors
KR100257457B1 (ko) 인간응집인자 viii 단백질 복합체의 제조방법
US8143027B2 (en) Method of making a plasminogen activator polypeptide with clot-specific streptokinase activity
HUT50870A (en) Process for producing new recombinant and chimeric antibodies against human adenocarcinoma antigene
WO1997017458A1 (fr) Fonctions accessoires servant a produire des virions de vaa recombines
JPH02131431A (ja) α−インターフェロンおよびα−インターフェロンを含有する処置組成物
WO1988000831A1 (fr) Sequences adn pour facteur viii:c modifie et polypeptides semblables au facteur viii:c modifie et procedes de production en grandes quantites de ces polypeptides
WO1996015777A9 (fr) Vesicules lipidiques contenant la proteine rep de virus adeno-associe pour integration transgenique et therapie genique
EP0091527A2 (fr) Séquences d'ADN, molécules d'ADN recombinant et procédé de préparation de polypeptides du genre de sérumalbumine humaine
AU633891B2 (en) Production and purification of recombinant human interleukin-3 and muteins thereof
US4808523A (en) Constitutive production of human IFN-β1 by mammalian cells transformed by the IFN-β1 gene fused to an SV40 early promoter
EP1012286B1 (fr) Gene allelomorphe du stat3 humain
CA2001343A1 (fr) Agents thrombolytique
EP0648268A1 (fr) Fragments therapeutiques du facteur willebrand
Nagae et al. Identification of an interleukin-6 responsive element and characterization of the proximal promoter region of the rat hemopexin gene
Yin et al. Assembly of the human signal recognition particle (SRP): overlap of regions required for binding of protein SRP54 and assembly control
IE60641B1 (en) Human protein s, a plasma protein regulator of hemostasis
Rice et al. CLONING USING BACTERIOPHAGE SPP1v AS THE VECTOR: VECTOR DEVELOPMENT, STABILITY AND EXPRESSION
JPH0453489A (ja) プロウロキナーゼの遺伝子工学的製造法
HU204086B (en) Process for producing non-human mammal animal interferons, dna sequemces coding form them and pharmaceutical compositions comprising sand interferons

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19951202

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

RHK1 Main classification (correction)

Ipc: C12N 15/62

A4 Supplementary search report drawn up and despatched

Effective date: 19980428

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19980723