Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6844—Nucleic acid amplification reactions
  • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction

Definitions

• the present invention relates to the in. vitro replication of nucleic acids. More specifically, the invention relates to a process for replicating a nucleic acid sequence of interest, with large quantities of the desired sequence ultimately resulting from the linkage of primer extension reactions wherein the sequence of interest accumulates in a mathematically linear fashion.
• nucleic acid "amplification” The extensive replication of nucleic acids, today known as (and referred to herein as) nucleic acid "amplification," finds wide utility, both practical and theoretical, in a variety of contexts.
• H.G. Khorana and his co-workers first proposed the use of an in vitro DNA amplification process to increase available amounts of double-stranded DNA (partial sequences of the gene for the major yeast alanine t-RNA) that had been created by the enzymatic ligation of synthetic DNA's. See K. Kleppe et al.; J. Mol. Biol. 56:341-361 (1971).
• PCR polymerase chain reaction
• the PCR process is referred to in the literature as an "exponential amplification" process.
• a primer binding site for the other primer is synthesized.
• each of the synthetic DNA molecules produced in any of the previous cycles is available to serve as a template for primer-dependent replication.
• This aspect of the process coupled with the presence of a sufficiently large number of primer molecules, results in synthetic DNA accumulating in a mathematically exponential manner as the reaction proceeds.
• PCR has proven to be a valuable technique for the molecular biologist, and has been used extensively in the fields of human genetic research, diagnostics and forensic science, and even in the detection of antibodies, disadvantages nevertheless have been recognized.
• the PCR process can be difficult to quantify accurately, mainly because the amplification products increase exponentially with each round.
• the products of PCR namely, double-stranded DNA molecules, are difficult to analyze or sequence per se.
• Strand separation typically must be carried out prior to sequencing or other downstream processes that requires single strandedness, such as hybridization to a probe capable of detecting the sequence of interest.
• the PCR process also has proven to be quite susceptible to contamination generated through the transfer of previously amplified DNA sequences into a new reaction. This problem appears to be caused by the facts that (1) very large amounts of DNA are generated in any given reaction cycle and (2) the process uses all product DNA strands as templates in subsequent cycles. Even minute quantities of contaminating DNA can be exponentially amplified and lead to erroneous results. See Kwok and Higuchi, Nature 339:237-238 (1989). Various methods to reduce such contamination have been reported in the literature (e.g. chemical decontamination, physical treatment, enzyme treatment and utilizing closed systems), as these contamination problems are widely recognized. See, John B. Findlay, "Development of PCR for in vitro Diagnostics," presented at "Genetic Recognition,” Nov. 20, 1992, San Diego, CA.
• nucleic acid (DNA) amplification methods that provide large amounts of DNA, and that selectively amplify only a specific sequence of interest, but which avoid the problems now associated with the "PCR" reaction.
• nucleic acid amplification methods that ultimately produce large amounts of a nucleic acid molecule of interest, or large amounts of a molecule containing a nucleic acid sequence of interest, but are relatively insensitive to the presence of contaminating nucleic acids.
• nucleic acid amplification methods that generate single-stranded products.
• the present invention provides a process for amplifying a specific nucleic acid sequence of interest within complementary nucleic acid strands contained in a sample, the process including the steps of:
• step (c) treating the first generation primer extension products with the primers of step (a) under conditions such that second generation primer extension products are synthesized using the first generation primer extension products as templates; wherein the second generation primer extension products contain at least a portion of the nucleic acid sequence of interest and cannot serve as templates for the synthesis of extension products of the primers which were extended to synthesize their templates.
• step (c) the products of step (c) are separated to produce single-stranded molecules, and the entire process is repeated at least once.
• Step (c) preferably is repeated many times, with the process being carried out in an automated fashion under the control of a programmable thermal cycling apparatus.
• a new set of primers that contain non-replicable elements can be employed.
• the new set of primers advantageously bind to the second generation synthetic products, bounding the sequence of interest to be amplified.
• the linear replication process is again carried out through a number of cycles. Such "linking together" of multi- cycle primer extension reactions ultimately results in thousand-fold or million-fold amplification of the original nucleic acid sequence of interest. Thus, the present process is deemed “linked linear amplification" or "LLA.”
• multiple (nested) sets of primers containing non-replicable elements can be provided in a single amplification reaction mixture. The sets are selected so as to be capable of binding to their respective templates under decreasingly stringent conditions. Thus, all the components necessary to carry out several linked linear amplifications can be provided in a single reaction mixture.
• allele-specific nucleic acid replication is carried out according to the present invention with the use of primers directed to specific polymorphic sites on the template that are known to be indicative of a genetic disease or disorder, such as sickle cell disease.
• the allele-specific primers, containing non-replicable elements, are designed so that they prime nucleic acid synthesis of only those templates containing the desired allele.
• the synthetic nucleic acid molecules resulting from the present process can be used in the diagnosis of genetic disorders or diseases, as reagents in further techniques such as gene cloning, for forensic identification, etc.
• the process described herein also can be carried out using a single nucleic acid strand as a starting material. Such a process comprises:
• Steps (a) - (c) can be repeated many times, resulting in extensive nucleic acid synthesis, following which the reaction is linked to a subsequent reaction using a new set of primers.
• the present invention also relates to a reagent kit for use in amplifying a particular nucleic acid sequence.
• kit includes, for example, a DNA polymerase, a pair of primers for each sequence to be amplified wherein each of said primers comprises a non- replicable element, and, optionally, a control nucleic acid sequence capable of being replicated by the primers and DNA polymerase.
• the kit also may contain a nucleic acid probe capable of indicating the presence or absence of an amplification product of the particular sequence.
• Figures 1 - 4 comprise a schematic representation of a nucleic acid amplification process of the present invention.
• Figures 5 - 6 comprise a schematic representation of a nucleic acid amplification process that has been linked to the process represented by Figures 1 - 4.
• Figure 7 is a more detailed schematic representation of a nucleic acid amplification process carried out with two primers according to the present invention.
• Figures 8 - 10 present a detailed schematic representation of a linked linear nucleic acid amplification process carried out with four primers according to the present invention.
• Figure 11 is a schematic representation of nucleic acid molecules prepared by the PCR process and by a process according to the present invention.
• Figure 12 is a schematic representation of the sequence of the human ⁇ -globin gene (GenBank locus HUMHBB) and of several primers described herein.
• the nucleic acid replication process of the present invention is capable of producing large quantities of a specific nucleic acid sequence of interest.
• the process in its preferred form comprises a linked series of multi-cycle primer extension reactions.
• primer-dependent nucleic acid replication is carried out through a number of cycles, with the primer extension products accumulating in a numerically linear fashion from cycle to cycle.
• a unique primer, or set of primers, is provided for each nucleic acid strand in the starting sample that contains the sequence to be amplified.
• primer extension products from cycle to cycle are assured through the use of primers that contain non-replicable elements — elements that halt the primer extension reaction, preventing the nucleic acid polymerase from replicating the entire sequence of the primer.
• primer extension products which accumulate in greatest abundance referred to herein as "second generation primer extension products”
• second generation primer extension products cannot serve as templates themselves in subsequent cycles of primer extension using the same primers.
• the process of the present invention utilizes and takes advantage of a number of important properties of oligonucleotide hybridization and the primer extension reaction.
• the invention takes advantage of the facts that:
• DNA polymerase is able to copy a template DNA many times by sequential cycles of denaturation and primer-dependent elongation.
• Primer-dependent elongation can occur, under appropriate conditions, even if the primer is not completely complementary to the template.
• Primer extension can utilize a template produced in a previous round of primer extension. • Primer extension is inhibited by abasic sites or by non-nucleotide residues when such are present in the template nucleic acid.
• Primer length and composition affect, in known ways, the conditions (e.g., temperature) at which a primer will "prime” polymerase-induced extension on a template.
• Primer extension reactions can be performed in rapid cycles with the aid of thermal cycling apparatus.
• the present process advantageously utilizes a series of linear amplification reactions, which can be carried out (linked) either in series or in parallel (i.e., simultaneously) to generate a very large number of copies of a nucleic acid sequence of interest.
• the nucleic acid sequence of interest may encompass essentially the entire length of the template strand(s), or it may comprise only a very minor portion of it.
• the template strand(s) containing the sequence of interest may be present in a substantially homogeneous sample or as part (even an extremely minor part) of a mixture of nucleic acids.
• a primer that contains a non-replicable element is provided for each strand containing a sequence to be amplified.
• the primer(s) are added either prior to or following denaturation of the template.
• the primers are permitted to anneal to their respective starting templates, and are extended in the presence of a polymerase enzyme, under conditi ns appropriate for the function of the enzyme, to form first generation primer extension products.
• the process is repeated by denaturing the resulting duplexed nucleic acid, permitting the primers to anneal to the strands and again carrying out the primer extension reaction.
• Figures 1 - 5 present a schematic representation of one series of primer extension reactions (i.e., one linear amplification reaction) carried out on a DNA template according to the process of the present invention. The process is illustrated starting in step (a) with a double-stranded DNA molecule having defined termini. The strands of the starting DNA are denoted by solid ( ) lines throughout Figures 1 - 4.
• the starting duplex is denatured, preferably by heating in a buffer solution containing the same, and the resulting single strands are contacted with a pair of primers (step (b)).
• Each primer preferably is provided in substantial molar excess of the starting template strand and contains within its sequence a non- replicable element, here denoted by (x) or (o) within the primer sequence.
• the primers anneal to their respective templates and are elongated (step (c)) according to the primer extension reaction in the presence of a DNA polymerase and the four deoxyribonucleotides.
• Synthesized DNA is denoted by dotted (••••••) lines in Figure 1 - 4, and the DNA synthesized using the starting duplex DNA as a template is denoted "first generation" DNA.
• the resulting templates again are denatured, and the primers are annealed (step (d)).
• step (e) of Figure 2 primer elongation using first generation DNA as a template results in the preparation of second generation DNA and does not progress past the non-replicable element incorporated into the first generation synthetic DNA.
• DNA molecules denoted by reference numerals 10 and 20 are synthesized. These second generation molecules do not participate further in the primer extension reaction because, as seen in the Figures, molecule 10 has not incorporated an effective binding site for the primer containing non-replicable element (x), and molecule 20 has not incorporated an effective binding site for the primer containing non-replicable element (o) .
• second generation molecules accumulate in a mathematically linear fashion in subsequent rounds of primer extension.
• the synthetic DNA is utilized as a starting material for (i.e., linked to) a second series of primer extension reactions using a second set of primers.
• primers containing non-replicable elements designated (a) and (b) are selected so as to be able to utilize molecules 10 and 20, the products of the reaction of Figures 1 - 4, as templates for further DNA synthesis.
• This series of primer extension reactions similarly results in the accumulation of synthetic DNA molecules, designated by reference numerals 30 and 40 in step (e) of Figure 6, which cannot serve as templates for the primers utilized in those reactions.
• these synthetic molecules can be linked to further replication using appropriate primers again containing non-replicable elements.
• the synthetic nucleic acid products of any one series of cycles can themselves serve as templates for further amplification only if a new primer or set of primers is provided.
• a first linear amplification is performed for one hundred cycles, the one hundred copies produced from this reaction can be used as a template in a linked linear amplification (LLA) reaction using a new set of primers capable of hybridizing to the synthetic templates.
• LLA linked linear amplification
• One hundred additional cycles of linear amplification provides a cumulative amplification of ten thousand (100*100).
• Repeating the process with a third set of primers yields a cumulative amplification of lxlO 6 . Additional amplification is achieved through the use of additional primers and additional cycles of primer extension.
• Figure 7 schematically illustrates, in greater detail, the use of two primers in an amplification process according to the present invention.
• two primers are utilized for sequential rounds of primer extension.
• Each primer is complementary to the target sequence but contains a single non-replicable element (X) in place of one of the complementary nucleotides.
• X non-replicable element
• reaction 1 primer PI produces copies (first generation nucleic acid; product I) of the upper strand of the template.
• One copy of product I is produced during each cycle, m cycles leading to m copies.
• primer P2 similarly produces copies (first generation nucleic acid; product II) of the lower strand of the template.
• One copy of product II is produced during each cycle, n cycles leading to n copies.
• primer PI produces copies (second generation nucleic acid; product III) of product II (designated template II) from reaction 2, except that template II is not replicated beyond the non-replicable element incorporated therein.
• product III is not a template for either primer PI or P2.
• primer P2 produces copies (second generation nucleic acid; product IV) of template I, except that template I is not replicated beyond the non-replicable element.
• product IV is not a template for either primer PI or P2.
• Table 1 shows the accumulation of each product as a function of cycle number. As can be seen, the equation (n 2 +n)/2 can be used to calculate the yield of the reaction.
• a third primer containing a non-replicable element and complementary to either product III or product IV is included in the reaction, a new product, shorter than either product III or product IV will accumulate. This product will be in greater abundance than any other DNA strand in the reaction and will remain mostly single stranded.
• the complementary site for primer P3 is 5' (with respect to the template) of the PI complementary site.
• the complementary site for primer P4 is 5' (with respect to the template) of the P2 complementary site.
• the nucleic acid sequence of interest advantageously will be located within the region bounded by both primer pairs.
• Reactions 1A, IB, 2A and 2B each result in the linear accumulation of first generation synthetic nucleic acid (products IA, IB, IIA and IIB, respectively) complementary to a respective strand of the starting nucleic acid template.
• Reactions 3A, 3B, 4A and 4B each result in the linear accumulation of second generation synthetic nucleic acid which, due to the presence of the non-replicable element in the nucleic acid synthesized in reactions IA, IB, 2A and 2B, does not serve as a template for primer PI or P2.
• primers P3 and P4 due to the location of their complementary site, can function to prime DNA synthesis on both original template DNA and templates IVA and IIIA, respectively.
• Products IIIB and IVB are not templates for any primers of this reaction, but contain the nucleic acid sequence of interest.
• primers P3 and P4 can be added to the reaction mixture following n cycles of primer extension, where n ranges, for example, from 2 to 100.
• primers PI and P2 are selected so that they are capable of annealing to the template DNA and priming DNA synthesis under conditions (e.g., temperature) that do not permit primers P3 and P4 to prime.
• Primers PI, P2, P3 and P4 will be provided in the initial reaction mixture.
• the first linear amplification is carried out under the more stringent conditions, where only primers PI and P2 participate in primer extension. Following a desired number of cycles, the reaction conditions are made less stringent, whereupon all four primers participate in nucleic acid synthesis. Primers PI and P2 continue to generate first generation primer extension products using the starting template and second generation primer extension products using the first generation products as template; primers P3 and P4 also utilize second generation primer extension products of primers PI and P2 as templates.
• the nucleic acid sequence of interest advantageously is located within the region of the template strand bounded by both primer pairs.
• primers that contain non-replicable elements ensures that, except for primer extension products synthesized on an original template nucleic acid strand present in the starting material (such primer extension products being referred to herein as "first generation primer extension products"), none of the synthetic nucleic acids produced during the process will serve as templates in subsequent rounds of primer extension.
• first generation primer extension products such primer extension products being referred to herein as "first generation primer extension products”
• primers that contain non-replicable elements can be synthesized according to the method described in Seela et al., Nucleic Acids Res. .15., 3113-3129 (1987) and are commercially available from Glen Research, 44901 Falcon Place, Sterling, VA, 20166 USA.
• Primers containing a residue of 1,4-anhydro-2-deoxy-D-ribitol can be synthesized with the assistance of Eritja et al., Nucleosides & Nucleotides 6., 803-814 (1987).
• Published European Patent Application 416,817 A2 (Imperial Chemical Industries PLC; March 13, 1991) describes the synthesis of primers containing one or more 2'deoxyribofuranosyl naphthalene moieties as non- replicable elements between a primer sequence and a polynucleotide tail.
• oligonucleotide primers that contain other elements that halt polymerase-dependent copying of the template, such as derivatives of ribonucleosides and deoxyribonucleosides, will be apparent to those who are experienced in this field.
• the non-replicable element preferably is not located at the terminal residue of any of the primers.
• a typical amplification reaction will be carried out starting with a double- stranded DNA molecule that contains a sequence to be replicated embedded within a much longer sequence.
• An oligonucleotide primer specific for each of the strands is annealed to its respective strand, with each primer containing a non-replicable element as described herein.
• the primers are selected so that they bind to the respective strands at positions bounding the sequence to be amplified.
• a first cycle of primer extension is carried out in the presence of a DNA polymerase and the four deoxyribonucleotide bases, under conditions appropriate for the selected enzyme.
• the resulting first generation synthetic DNA will have incorporated therein the oligonucleotide primer at its 3' end and the entire binding site for the other primer downstream (5') therefrom.
• a second cycle of primer extension is carried out, wherein the first generation synthetic DNA serves as a template for the other primer, that is, the primer which is not incorporated at its 3' end.
• DNA synthesis progresses along the template, but halts when the non- replicable element embedded in the template is encountered by the polymerase molecule.
• the resulting synthetic DNA herein termed "second generation synthetic DNA,” has discrete ends defined at its 5' end by the entire sequence of its primer, and defined at its 3' end by only a portion of the sequence of the other primer — the portion that was copied by the DNA polymerase prior to encountering the non-replicable element. Second generation synthetic DNA will not participate as a template for further DNA synthesis.
• second generation synthetic DNA contains only a portion of the necessary primer binding site. Under the selected primer annealing and extension conditions, that portion of the primer binding site is insufficient to permit the primer to bind and serve as a site for primer-dependent DNA synthesis. Thus, when the third and subsequent cycles of primer extension are carried out, only original template DNA and first generation synthetic DNA participate as templates. The continued copying of those templates results in the round-to-round "linear" accumulation of second generation synthetic DNA containing the sequence of interest.
• additional replication can be attained by providing a second primer for each strand, the second primer(s) being selected so as to bind to regions of the original template strands within the region bounded by the original set of primers.
• the second primers too, will contain non-replicable elements, thereby ensuring that their primer extension products cannot serve as templates for nucleic acid synthesis in subsequent rounds using those same primers.
• primer binding conditions can dictate whether a specific primer will bind to a specific template. See Rychlik et al., Nucleic Acids Res. 1., 6409-6412 (1990); Wu et al., DNA Cell Biol. HL, 233-238 (1991).
• the selection of a primer binding temperature can also function to select which primers will be capable of priming DNA synthesis.
• first, second and third sets of primers that will prime at 72°, 62° and 52° C, respectively, in a single amplification reaction mixture
• carrying out a first series of primer extension reactions at 72° C will ensure that only the first primer set will function to bring about primer- dependent nucleic acid synthesis.
• the primer extension temperature can be lowered to 62° C, whereupon the first and second primer sets will prime DNA synthesis.
• Lowering the primer extension reaction temperature to 52° C permits all three primer sets to participate in primer- dependent DNA synthesis.
• the use of mixtures of primers in the present process permits the process to be carried out in an efficient manner, without the need for the researcher separately to add each primer set as the process progresses.
• all three primer sets as described above can be provided in a single amplification reaction mixture.
• the primers will be selected so that those that prime DNA synthesis under the most stringent conditions bind to the template 3' of the other primers. Similarly, those primers which prime under the least stringent conditions bind to the template 5' of the other primers.
• a first series of primer extension reactions (cycles) are carried out under the most stringent (highest temperature) primer annealing conditions, whereupon only the first set of primers participate in the synthesis of DNA containing the sequence of interest. Following a pre-selected number of primer extension cycles, the primer annealing conditions are made less stringent.
• the second set of primers will initiate further DNA amplification by priming the linear copying of the second generation synthetic DNA produced during the first series of primer extension cycles under the selected conditions.
• the second generation synthetic DNA's produced in both the first and second series of primer extension reactions serve as templates for DNA replication.
• the design of primers that bind at preselected temperatures is within the skill of molecular biologists. The temperature at which a specific primer will function can be predicted by available algorithms (Wu et al., DNA Cell Biol. 0., 233-238 (1991)) and by computer programs (Rychlik et al., Nucleic Acids Res.
• a primer is designed such that its 3' nucleotide is complementary to a particular nucleotide in the template known to be variable (polymorphic).
• the variable nucleotide can be a nucleotide involved in a genetic disease such as sickle cell anemia, or at another site known to be polymorphic. If a mismatch is present between the 3' nucleotide of the primer and the corresponding nucleotide of the template DNA, the primer design insures that it will be extended poorly, or, preferably, not at all. See Petruska et al., PNAS USA 85., 6252-6256 (1988).
• such a primer is "allele specific" and capable of discerning the presence of absence of a single base within a nucleic acid sequence of interest.
• the presence of synthetic DNA following the use of an allele-specific primer in the process according to the present invention thus is indicative of the presence of the allele of interest in the original DNA template.
• the primary products of the amplification process of the present invention are single-stranded synthetic DNA's of a defined length.
• the length of the product strand is determined by the position of the last-used primer and is equal to the sum of the length of the primer itself and the number of nucleotides which can be incorporated from the 3' end of the primer to the non-replicable element of the template.
• the products can be detected by known nucleic acid detection techniques, including the use of primers or probes labelled with radioactivity, a fluorescent moiety or an enzyme, etc., electrophoresis, high pressure liquid chromatography, etc.
• the present invention will have important application in the diagnosis of human and other animal genetic diseases.
• Many human genetic diseases are known to be caused by specific changes in genes of known sequence.
• DNA- based diagnosis is possible using hybridization or other allele specific technologies (see above) to determine which of the various gene sequences are present in the DNA of a person at risk for the disease(s)-
• amplification of target DNA has been- vfe ' ry helpful in developing these technologies.
• the main advantages of template amplification are: smaller sample sizes can be used, the signal to noise ratio of the detection system is improved, there is a real potential for automation and the amplification system itself can be the detection system.
• the processes of the present invention offer all of the same advantages offered by other amplification reactions, plus additional benefits.
• the products are single stranded and thus do not have to be denatured prior to detection. If an odd number of primers is used, excess single stranded molecules will be produced. These molecules will be useful, for example, as hybridization probes, and thus provide an additional advantage over other amplification technologies. Still further advantages are presented as the products accumulate linearly and thus can be accurately quantified; the occurrence of "false positives" will be reduced in comparison with exponential processes that use newly-synthesized DNA as a template in subsequent rounds using the same primer.
• Tris-EDTA 10 mM Tris-HCl, 1 mM EDTA. pH 8.0 TBE (Tris-Borate-EDTA) : 89 mM Tris-HCl, 89 mM Boric Acid, 2 mM EDTA, pH 8.3 Klenow polymerase Buffer: 50 mM Tris-HCl, 10 mM MgCl 2 , pH 7.6
• kinase Buffer 50 mM Tris-HCl, 10 mM MgCl 2 , 5 mM DTT, 0.1 mM spermidine-HCl, 0.1 mM EDTA, pH 7.6
• DNA Polymerase I buffer 50 mM Tris-HCl, 10 mM MgS0 4 , 0.1 mM DTT, 50 ⁇ g/ml bovine serum albumin, pH 7.2
• Sequenase buffer 40 mM Tris-HCl, 20 mM MgCl 2 , 50 mM NaCl, pH 7.5
• Bst polymerase buffer 20 mM Tris-HCl, 20 mM MgCl 2 , pH 8.5
• Thermus a ⁇ uaticus polymerase buffer 50 mM KCl
• 10X Ficoll loading buffer 100 mM Tris-HCl pH 7.5, 10 mM EDTA, 0.5% bromophenol blue, 0.5% xylene cyanol, 30% Ficoll 5X SSPE: 50 mM sodium phosphate pH 7.0, 0.9 mM NaCl and 5 mM EDTA
• a template with or without a single nucleotide base containing a 1,3 propane diol moiety (designated as non-replicable element "X") and a primer complementary to the 3' end of the template were synthesized in order to demonstrate the ability of the non-replicable element "X"
• 1,3 propane diol moiety to serve as a non-replicable element and halt DNA synthesis.
• sequences synthesized are as follows:
• primers and templates were annealed to form the following primer template complexes:
• primer template complexes were then extended with various DNA polymerases (Klenow fragment of DNA Polymerase I, AmpliTaq polymerase (Perkin Elmer - Cetus Corp.), BST polymerase (Bio-Rad Laboratories, Hercules, CA) and Sequenase polymerase (United States
• the primer and templates were mixed at a primer/template ratio of 10, and buffers appropriate for the polymerase enzymes were employed. Twenty ⁇ l reactions containing 1 pmol of either 207 or 207-X, 10 pmol PI2, 25 ⁇ M dNTPs, 0.5 ⁇ Ci of ⁇ -[ 32 P]-dCTP and either AmpliTaq buffer, BST buffer, Klenow buffer or Sequenase buffer. The samples were heated at 90°C for two minutes and cooled to 0°C for five minutes before adding one unit of DNA polymerase and reacting at 37°C for 10 minutes. The results indicate that the propane diol residue blocks primer elongation for all four DNA polymerases as shown below:
• oligonucleotides were prepared, two of which contained the non-replicable 1,3-propane diol moiety.
• BGP-1 30 GGCAGGAGCCAGGGCTGGGCATAAAAGTCA
• the plasmid pH ⁇ A was mixed with propane diol- containing primers (BGP-1 30X and BGP-2 22X) or control primers (BGP-1 30 and BGP-2 22) not containing propane diol moieties.
• the primer/template mixtures were subjected to thermal cycling conditions of 94°C for 20 seconds to dissociate the double-stranded template, followed by 48°C for 20 seconds. After the final cycle, the reaction mixtures were incubated a further 5 minutes 40 seconds at 48°C to complete the primer extension reaction and anneal the single stranded DNA's.
• the reaction mixtures employing the propane diol-containing primers (according to the present invention) were cycled through 45 rounds of primer extension.
• the PCR reactions utilizing the primers not containing propane diol moieties were cycled through 10 rounds of primer extension.
• the products of the reactions were subjected to electrophoresis on 1.5% agarose (TBE buffer).
• the propane diol-containing primers produce a DNA fragment which was smaller than the PCR generated fragment. The smaller size is due to the fact that the primer extension does not extend to the end of the template strand, leaving 5' extensions on the product.
• Figure 11 presents a comparison of the products of a PCR reaction and of an LLA reaction according to the present invention.
• the major products of a PCR reaction which accumulate exponentially, are completely double-stranded with defined ends corresponding to the ends of the primers employed.
• the products of the present process are shorter than corresponding PCR products, as primer extension past the non-replicable element does not occur.
• An amplification reaction according to the present invention was performed using BGP-1 3OX and BGP-2 22X for various numbers of cycles.
• the products of the amplification were subjected to dot blot hybridization, and the hybridization signal was compared to that obtained from a known amount of plasmid DNA containing the sequence.
• the products of the reactions (3 ⁇ l) were mixed with 10 ⁇ l 4N NaOH, 250 mM EDTA and were blotted onto a Zeta-Probe membrane (Bio-Rad Laboratories, Hercules, CA) . Also included on the membrane was 56, 118 and 231 ng of the plasmid pH ⁇ ⁇ similarly denatured.
• the membrane was hybridized with 5'- 32 P- CTGCAGTAACGGCAGACTTCTCCT at 55°C for three hours in 5X SSPE, 1% SDS, 5 mg/ml Blotto, 10 ⁇ g/ml Homomix I RNA.
• the blot was washed at room temperature in 6X SSC and then scanned in a Bio-Rad Molecular Imager.
• the reaction produced approximately 250 fold amplification demonstrating the process of the present invention results in the amplification of the nucleic acid sequence of interest.
• Example 5 Amplification Of The Human ⁇ -globin Gene From Genomic DNA Linear amplification reactions were performed according to the present invention in a 15 ⁇ l volume containing Thermus aquaticus polymerase buffer, template DNA (800 ng of genomic DNA or 10* molecules of plasmid pH ⁇ ⁇ ), 200 ⁇ M each dNTP (dATP, dTTP, dCTP, and dGTP), 2 pmol of oligonucleotide primers BGP5-22X and BGP4-22X, and 2 units of Ampli-Taq Polymerase (Perkin- Elmer Cetus).
• template DNA 800 ng of genomic DNA or 10* molecules of plasmid pH ⁇ ⁇
• 200 ⁇ M each dNTP dATP, dTTP, dCTP, and dGTP
• 2 pmol of oligonucleotide primers BGP5-22X and BGP4-22X 2 units of Ampli-Taq Polymerase (Perkin- Elmer Cetus).
• Plasmid pH ⁇ ⁇ contains a 4.4 kb Pst I fragment of the human ⁇ -globin gene cloned at the Pst I site of pBR322.
• a negative control a reaction was carried out which included all the ingredients used in the previous reactions except the template DNA (a "no template" control).
• the amplification was performed for 99 cycles as follows: annealing at 55 °C for 30 sec, polymerization at 72 °C for 15 sec, and denaturation at 94 °C for 30 sec. At the end of the last cycle, the samples were annealed at 55 °C for 30 sec and finally polymerized at 72 °C for 4 min.
• 7.5 ⁇ l were removed from each sample (genomic DNA, plasmid DNA, and negative control), and mixed with 7.5 ⁇ l containing Thermus aquaticus polymerase buffer, 5 pmol of primers BGP1-35X and BGP2-35X, and 2 units of Ampli ⁇ Taq Polymerase.
• the cycling program was similar to the program used in the first step, except that the annealing temperature was 63 °C.
• One reaction contained Thermus aquaticus polymerase buffer, 5 pmol of primers BGP5-22X and BGP4-22X, 1 x 10 8 molecules of plasmid pH ⁇ A , and 3 units of Ampli-Taq Polymerase.
• the second control included the same ingredients as the previous reaction except that the primers BGP1-35X and BGP2-35X were used.
• the template DNA was denatured for 4 min at 94 °C and then cycled 48 times using the following conditions program: annealing and polymerization at 55 °C for 30 sec; denaturation at 94 °C for 30 sec. At the end of the last cycle the samples were annealed at 55 °C for 30 sec and polymerized at 72 °C for 4 min.
• the entire reaction (15 ⁇ l) was mixed with 1.6 ⁇ l 10X Ficoll loading buffer and subjected to electrophoresis in a 1.5% agarose gel (Bio-Rad ultrapure agarose). Electrophoresis was performed in TBE buffer for 90 min at 110 volts. The gel was subsequently stained with ethidium bromide (1 ⁇ g/ml) for 30 min, destained for 15 min, and photographed by ultraviolet (UV) illumination. The electrophoresed DNA was then transferred to a nylon membrane (Zeta probe, Bio-Rad) by alkaline transfer (Reed, K. C. and D. A. Mann, Rapid transfer of DNA from agarose gels to nylon membranes, Nucleic Acids Res.
• the membrane was washed twice with 6X SSC for 30 min at room temperature and autoradiographed at room temperature for 30 min.
• the genomic DNA produced the same fragment as the globin gene plasmid DNA control.
• the size of the fragment is that produced by the BGP1-35X and BGP2-35X primers.
• the "LLA" amplification reaction of the present invention was carried out in a 15 ⁇ l volume containing Thermus aquaticus polymerase buffer, template DNA (3.5 x 10 9 molecules of plasmid pH ⁇ ⁇ ) , 200 ⁇ M each dNTP (dATP, TTP, dCTP, and dGTP), 5 picomoles of oligonucleotide primers BGP1-22X and BGP2-22X, and 1.25 units of Ampli-Taq DNA Polymerase (Perkin-Elmer Cetus) . After denaturating the template DNA for 1 min, the amplification was performed for 49 cycles by annealing at 48 °C for 30 seconds and denaturing at 94 °C for 30 seconds. At the end of the last cycle, the samples were incubated at 48 °C for 4 min.
• the PCR reaction was performed for comparison purposes in a 15 ⁇ l volume containing Thermus aquaticus polymerase buffer, template DNA (3.5 x 10 9 molecules of plasmid pH ⁇ A ), 200 ⁇ M each dNTP (dATP, TTP, dCTP, and dGTP), 5 picomoles of oligonucleotide primers BGP1-22 and BGP2-22, and 1.25 units of Ampli-Taq DNA Polymerase. After denaturating the template DNA for 1 min, the amplification was performed for 9 cycles by annealing at 48 °C for 30 seconds and denaturing at 94 °C for 30 seconds. At the end of the last cycle, the samples were incubated at 48 °C for 4 min. Analysis of the LLA and PCR products
• the membrane was hybridized in 5x SSPE, 1% sodium dodecyl sulfate (SDS), 10 ⁇ g/ml homomix RNA, 0.5% powdered skim milk and 2.5 x 10 6 cpm of the 32 P labelled probe 5'CAGGAGTCAGGTGCACCATGGT. The hybridization took place at 55 °C for two hours. After hybridization, the membrane was washed twice with 6x SSC at room temperature for 15 min. and then scanned and quantified with the Bio-Rad GS-250 Molecular Imager. Amplicon contamination experiments
• Equal amounts of LLA (1/26 ⁇ l) and PCR (1/16 ⁇ l) products were diluted with distilled water by 10*, 10 5 , and 10 6 fold; these dilutions were subsequently used as DNA templates in PCR reactions.
• the amplification reactions were performed in a 15 ⁇ l volume containing Thermus aquaticus polymerase buffer, template DNA (LLA or PCR dilutions), 200 ⁇ M each dNTP (dATP, TTP, dCTP and dGTP), 5 picomoles of oligonucleotide primers BGP1-22 and BGP2-22, and 1 unit of Ampli-Taq Polymerase.
• Reactions were duplicated and after a first step of thermal denaturation for 3 min at 94 °C, the samples were run for 25 and 30 cycles of amplification (30 seconds at 55 °C, 30 seconds at 72 °C, and 30 seconds at 94 °C) and finally incubated at 50 °C for 30 seconds and 4 min at 72 °C. Furthermore, a negative control which contained all reagents except the template DNA was included.
• a second PCR reaction set was performed using a different primer set (MD040 and PC04) which prime internally to BGP1-22 and BGP2-22.
• the reaction ingredients (except the primers) and reaction conditions were as described in the previous paragraph.
• the 15 ⁇ l reaction volumes were mixed with 1.6 ⁇ l 10X Ficoll loading buffer and subjected to electrophoresis in a 1.5% agarose gel (Bio-Rad ultrapure agarose). Electrophoresis was performed in lx TBE buffer for 90 min at 110 volts. The gel was subsequently stained with ethidium bromide (1 ⁇ g/ml) 5 for 30 min, destained for 15 min, and photographed by ultraviolet (UV) illumination. The electrophoresed DNA was then transferred to a nylon membrane by alkaline transfer (Reed and Mann (1985)) and fixed to the membrane by UV radiation (Church (1984)). The membrane

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Biophysics (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Analytical Chemistry (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (3)

Publications (2)

Family

ID=22252059

Family Applications (1)

Country Status (5)

Families Citing this family (14)

Citations (2)

Family Cites Families (1)

• 1994
  • 1994-07-25 EP EP94924010A patent/EP0710296A4/de not_active Withdrawn
  • 1994-07-25 JP JP7505384A patent/JPH09500539A/ja active Pending
  • 1994-07-25 CA CA002167840A patent/CA2167840A1/en not_active Abandoned
  • 1994-07-25 WO PCT/US1994/008390 patent/WO1995003432A1/en not_active Application Discontinuation
  • 1994-07-25 CN CN94192853A patent/CN1127533A/zh active Pending

Patent Citations (2)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events