EP0696323A1 - Recombinant alanine racemase and gapdh from tolypocladium - Google Patents

Abstract

The invention concerns nucleotide suquences coding for enzymes which exhibit an alanine racemase activity, plus methods of preparing alanine racemase which use these sequences. The invention also concerns methods of preparing cyclosporin and cyclosporin derivatives. The invention further relates to DNA fragments with part or all of the gene for glycerinaldehyde-3-phosphate dehydrogenase (GAPDH) from Tolypocladium niveum, its promotor and termination region, and the use thereof. Another aspect of the invention relates to vectors, and cells transformed by these vectors.

Description

 RECOMBINANT ALANINE RACEMASE AND GAPDH FROM TOLYPOCLADIUM NIVEUM

The invention relates to nucleotide sequences which code for enzymes which have an alanine racemase activity and methods for producing alanine racemase which use these sequences. The invention also relates to methods for the production of cyclosporin and cyclosporin derivatives. Furthermore, the present invention relates to new DNA fragments with part or all of the gene for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Tolypocladium niveum, its promoter and termination region, and the use thereof. In another aspect, the invention also relates to new vectors and cells that have been transformed with these vectors. The fungus Tolypocladium niveum can be classified microbiologically in the class of imperfect fungi and is of particular biotechnological interest because of its ability to form cyclosporins (Dreyfuss et al., 1976). A class of cyclic undecapeptides, which are composed of hydrophobic, aliphatic amino acids, is referred to as cyclosporins. These substances have a variety of biological effects: the main metabolite cyclosporin A is used because of its immunosuppressive effect as the most important medication to prevent organ rejection after transplantation. Accordingly, the development of suitable techniques for genetically manipulating this and related organisms that produce cyclosporins or that have an impact on cyclosporin production is of great importance. Such a technique can not only contribute to increasing the production of known cyclosporins, but also to the production of new active ingredients or other substances. In particular, the regulatory areas of the GAPDH gene, such as the promoter area, can be used for the effective transcription of various genes and are therefore important for their strong expression.

With the development of genetic engineering, the biotechnological production of numerous polypeptides using recombinant DNA has become possible in recent years. Two of the prerequisites for this are on the one hand the corresponding gene, the product of which is to be produced, and on the other hand suitable DNA constructions by means of which the gene is expressed as efficiently as possible in the corresponding host cell.

The biosynthesis of the cyclosporins takes place, as for other peptide antibiotics described, according to the non-ribosomal thiotemplate mechanism (Kleinkauf and von Döhren, 1990). It is noteworthy that the entire biosynthesis is controlled by a multienzyme, which consists of a single polypeptide chain and is called cyclosporin synthetase. This enzyme has been biochemically purified and characterized (Schmidt et al., 1992).

Cyclosporin A contains three non-proteinogenic amino acids: D-alanine in position 8, α-aminobutyric acid in position 3 and the unusual amino acid (4R) -4 - [(E) -2-butenyl] -4- methyl-L-threonine (Bmt ) at position 1. Such non-proteinogenic amino acids are characteristic components of peptide antibiotics. With regard to the incorporation of D-amino acids, it has been found in the peptide synthetases investigated to date that the L-amino acid is activated by the enzyme, that is, bound as a thioester, and then epimerized directly on the enzyme.

In contrast, cyclosporin synthetase does not have an integral epimerase function (Kleinkauf and von Döhren, 1990): it must be supplied with d-alanine as a building block for biosynthesis. Tolypocladium niveum must therefore have an alanine racemase. Since the cyclosporin biosynthesis starts at position 8 with the activation of D-alanine (Lawen et al., 1992), this racemase has a key function in the biosynthesis process. Since the cyclosporin synthetase in vitro is able to accept other amino acids at position 8 (Lawen et al., 1989), the inhibition of racemase activity or a change in specificity in vivo could lead to a new fermentative approach to cyclosporins Open variation in position 8. It is also noteworthy that all alanine racemases described so far are of prokaryotic origin. The primary function of prokaryotic alanine racemases is to provide D-alanine for cell wall synthesis. The inhibition of these enzymes as an antibiotic principle has therefore been studied very intensively (Thornberry et al., 1987). Alanine racemase from Tolypocladium niveum is the first enzyme in this class to be isolated from a eukaryotic organism.

In one aspect, the invention relates to an isolated nucleotide sequence encoding a eukaryotic enzyme, or a fragment thereof, that has alanine racemase activity. In the present description, an enzyme that has alanine racemase activity is an enzyme that converts D-alanine or L-alanine into a mixture of both enantiomers. The nucleotide sequence preferably codes for alanine racemase from Tolypocladium niveum ATCC 34921 or for an enzyme which has alanine racemase activity and is at least 70% (for example at least 80, 90 or 95%) homologous thereto. This is to mean that the invention includes, in addition to the nucleotide sequence shown in FIG. 5, one which codes for protein which has essentially similar activity and / or function, the amino acid sequence being at least 70% (at

Example at least 80, 90 or 95%) contains such amino acids as those

Amino acid sequence encoded by the nucleotide sequence shown in Figure 5, and wherein in one position or the other amino acids can be conservatively exchanged.

The following conservative exchange is possible, for example:

(i) alanine, serine and threonine;

(ii) glutamic acid and aspartic acid;

(iii) arginine and lysine;

(iv) asparagine and glutamine;

(v) isoleucine, leucine, valine and methionine;

(vi) phenylalanine, tyrosine and tryptophan.

With regard to mRNA, the following codons are synonymous, that is to say they each code for the same or conservatively interchangeable amino acid: i) UUU, UUC, UAU and UCG; ii) UUA, UUG, CUU, CUC, CUA, CUG, AUU, AUC, AUA, GUU, GUC, GUA andOLQ iii) UCU, UCC, UCA, UCG, AGU, AGC, ACU, ACC, ACA, ACG, GCU, GCC, CGA and

GCG; iv) CCU, CCC, CCA and CCG; v) UAA, UAG, and UGA; vi) CAU and CAC; vii) CAA, CAG, AAU and AAC viii) AAA, AAG, CGU, CGC, CGA, CGG, AGA and AGG; ix) GAU, GAC, GAA and GAG; x) UGU and UGC; xi) AGU and AGC; xii) GGU, GGC, GGA and GGG. With regard to the corresponding DNA sequence, triplets that are specified in the individual points above are also synonymous. Nucleotide sequences that code for the structural gene shown in Figure 5 and in which such synonymous triplets are included are also encompassed by the invention.

The present description therefore relates in one aspect to new DNA fragments with some or all of the gene for the alanine racemase from Tolypocladium niveum, its promoter and termination region, and their use for strain improvement. In another aspect, the invention also relates to new nucleotide molecules, vectors and cells that have been transformed with these vectors. The construction of strains which are particularly suitable for processes for the preparation of modified cyclosporins which contain amino acids other than D-alanine at position 8 is also described. In a further aspect, the invention relates to part or all of the GAPDH gene from Tolypocladium niveum, with "a part" meaning at least 70% (for example at least 80, 90 or 95%) homologous DNA sequence which may contain synonymous triplets, as described above for the case of alanine racemase, furthermore its promoter and its termination region, to which the above statements regarding ^" homologous DNA sequences also apply, and their use. The invention further encompasses including those genes whose gene product is bound or immunoprecipitated with antibodies to all or part of the protein encoded by the genes according to the invention, provided that these gene products have an essentially similar function or activity. The invention also encompasses nucleotide sequences which are similar to the nucleotide sequences according to the invention nt, which can hybridize against one of the sequences according to the invention. In the case of double-stranded sequences, the test sequence and the sequence according to the invention can have a TM difference of up to approximately 15 ° C. The hybridization is carried out under stringent conditions, with either the test sequence or one of the sequences according to the invention being applied to a support. Either a denatured test sequence or one of the sequences according to the invention is thus first bound to a support, whereupon the hybridization against the other sequence in a suitable time and at temperatures of about 35 to 70 ° C. in 2xSSC buffer containing 0.1% SDS , carried out becomes. The carrier is then washed at the same temperature with a buffer of reduced SSC concentration. Depending on the desired stringency and thus the degree of similarity of the sequences, such buffers are generally SSC buffers with single strength, with half strength or with 1/10 strength (lxSSC, 0.5xSSC or 0, lxSSC), each containing 0 , 1% SDS. Sequences with the highest degree of similarity are those whose hybridization is least affected by washing with buffer of reduced concentration. The test sequence and the sequence according to the invention are preferably so similar that the hybridization by washing with or incubating in 0.1 × SSC buffer (0.1% SDS) remains essentially unaffected.

The invention also encompasses recombinant nucleotide sequences which are modified with respect to the sequences according to the invention with respect to one or more codons. The modification is carried out in such a way that the modified codons of the corresponding amino acid in the organism into which the recombinant nucleotide sequence is to be introduced are favorably used for translation. Expression of the modified DNA in said organism provides essentially similar protein to the unmodified, recombinant nucleotide sequence in the organism in which the protein coding components of the recombinant nucleotide sequence are endogenous. The expression of the genes according to the invention can be improved, for example, by (i) mutating the non-coding region 5 'of the heterologous gene to increase the RNA polymerase binding, (ii) using constructions which have several promoter regions, either from the same source or from another, for example from a GAPDH gene, (iii) introducing strong promoters into the genome (preferably not accidentally) to induce the expression of autologous or heterologous genes. Examples of Tolypocladium niveum include Tolypocladium niveum ATCC 34921 and strains derived therefrom.

The alanine racemase from Tolypocladium niveum has not previously been described in the literature. In order to find access to this enzyme, it was first necessary to develop a proof of activity. The NADH method described in the literature for prokaryotic racemases was used as a starting point (Badet et al., 1984): the D-alanine formed is detected by oxidizing it to pyruvate with D-amino acid oxidase; Pyruvate is again reduced to lactate while consuming NADH. The consumption an NADH is equimolar to the D-alanine formed and is determined by the decrease in UV absorption at 340 nm. This assay is described in its "coupled" form in the literature, that is to say all the reactions mentioned (epimerization of alanine, oxidation to pyruvate and reduction to lactate) are carried out simultaneously. This method has only provided unreliable measured values in only roughly enriched enzyme extracts from Tolypocladium niveum. For this reason, the reactions were decoupled: in the first sub-step, the epimerization of L-alanine to D-alanine was carried out, and after heat inactivation of the enzymes, the D-alanine formed was converted into pyruvate and lactate in a second sub-step. This decoupling also has the advantage that the optimal conditions for the epimerization reaction can be determined without being influenced by the subsequent reactions. By carefully optimizing the reaction parameters (pH optimum, T optimum, cofactor requirement, oxidation protection) in the first step, a highly sensitive detection method for alanine racemase from Tolypocladium niveum could be established, the principle of which (decoupling of the partial reactions) also on alanine racemases can be applied from other organisms. According to the IUPAC nomenclature, the amount of protein that epimerizes 1 μmol L-alanine to D-alanine per minute is defined as the enzyme unit.

The enzyme is purified by customary methods. The. Cell disruption can be carried out from moist or lyophilized cells. If the cells are moist, pressure digestion, e.g. with a Manton Gaulin apparatus or with a French press, or digestion with a glass ball mill. Lyophilized cells, on the other hand, are expediently disrupted by mortaring under liquid nitrogen. In the case of alanine racemase, the mycelium was in a moist state and in large quantities, so that pressure digestion with a Manton Gaulin apparatus was most expedient.

The digestion is followed by a rough clarification of the crude extract by medium-speed centrifugation (around 10,000 g) and a further clarification step by precipitation of nucleic acids. All reagents customary for this can be used to precipitate the nucleic acids, such as polyethyleneimine or protamine sulfate. The appropriate concentration should be worked out for each problem. A final concentration of 0.1% of polyethyleneimine was used for the alanine racemase. The alanine racemase can be extracted from such a clarified crude extract by the usual Methods of protein purification can be enriched. Salting out with ammonium sulfate is advantageous as the first stage, since the volume of the protein solution, which is usually very large after mycelium extraction, can be concentrated at the same time. Following this, all customary chromatographic methods for purifying the alanine racemase can be used, such as, for example, ion exchange chromatography, gel permeation chromatography, hydrophobic interaction chromatography, pseudoaffinity chromatography on dye-Sepharosen, chromatography on inorganic support materials, such as, for example, hydroxylapatite, and others . In the case of alanine racemase, the first step after ammonium sulfate precipitation was to use an ion exchange step on a column combination of S-Sepharose and phosphocellulose. This combination was favorable because the enzyme was in the passage of S-Sepharose under the same buffer conditions and bound to phosphocellulose, although both materials are of the cation-exchange type. This behavior made it possible to achieve a very selective cleaning effect. The next step was gel permeation chromatography on Sephacryl S300-HR. As a last step, anion exchange chromatography on Mono-Q proved to be particularly advantageous, since high resolution of the proteins can be achieved on this column, and the sample, which is very diluted after gel permeation chromatography, is highly concentrated. After this stage, the specific racemase activity compared to the crude extract was approximately 100-fold enriched. No further purification of the alanine racemase could be achieved on dye-Sepharosen or on hydrophobic materials without high losses. According to Mono-Q, however, the enzyme preparation is already clean enough to assign the corresponding protein band to the enzyme activity. A first assignment is made by correlating the course of the enzyme activity in the successively eluting fractions from Mono-Q with the occurrence of the individual protein bands in an SDS-PAGE. Although such an assignment can be made in many cases, as with the example of alanine racemase, it is advantageous if one tries to identify the protein band directly on the basis of its activity.

In the case of alanine racemase, a radioactive, enzyme-specific labeling technique was used. It is known that amino acid racemases require pyridoxyl phosphate as an essential cofactor. In the absence of an adequate enzyme substrate, this pyridoxal phosphate is bound via a Schiff base to the epsilon amino group of a lysine in the active center of the enzyme. By reduction with NaBH ₄ can this ship sees base to a secondary amine and thus to a covalent bond between enzyme and cofactor. If tritiated NaBH _{4 is} used for this reaction, a radioactive label is simultaneously introduced on the enzyme, which can be visualized by autoradiography after SDS-PAGE and drying of the gel. With this method, all pyridoxal-containing enzymes can be clearly identified from the crude extract after appropriate enrichment, as has already been published for some racemases (Roise et al., 1984, Badet et al., 1984, Esaki and Walsh, 1986). As described in Example 3, this method could also be applied to alanine racemase from Tolypocladium niveum, which led to the identification of a protein band with an M → of 39,000. The purification method developed in the invention provides an approximately 10% enzyme preparation in which the racemase can be clearly identified. With this method, 4 mg of total protein can be obtained from about 5 kg of fermentation slurry; The proportion of racemase is therefore approximately 400 μg (2.5 enzyme units). The quality of this preparation is sufficient to be able to carry out all important protein-chemical work, such as amino acid sequencing.

The relative molar mass of the native enzyme was determined for further characterization of alanine racemase. An M → around 100,000 was determined by gel permeation chromatography. As is known, the values obtained from such analyzes can only be regarded as guidelines, since the behavior of a protein on a molecular sieve depends not only on its size, but also on its (unknown) shape, its hydrophobicity and on non-specific interactions with the gel matrix. In combination with the M, denatured protein of 39,000, it is very likely that the alanine racemase is present as a homodimer, as has been described for a number of other racemases (Inagaki et al., 1986, Inagaki et al., 1987, Wang and Walsh, 1978). The amino acid sequencing can be carried out according to customary methods. If, as in the case of alanine racemase, the enzyme is not homogeneous, the proteins are advantageously first separated by SDS-PAGE and blotted onto a protein-binding membrane. The first step is to try N-terminal sequencing. If the N-terminus is blocked, as in the case of alanine racemase, or in order to obtain internal sequence information, the protein can be cleaved directly on the membrane: the fragments are eluted from the membrane, separated by HPLC and the Gas phase sequencing fed. Regarding the GAPDH gene, a DNA was cloned from the chromosomal DNA of Tolypocladium niveum which contains the gene for glyceraldehyde-3-phosphate dehydrogenase, an enzyme of the central metabolic pathway of glycolysis. The structure of the gene and its regulatory region was analyzed and it was found that the promoter region can be used as a host strain for the construction of potent expression vectors, for example for Tolypocladium niveum.

So far, some genes for the GAPDH of individual lower eukaryotes have been cloned and analyzed, such as those from Saccharomyces cerevisiae (Holland and Holland, 1980), Asper gillus nidulans (Punt et al., 1988) or Cephalosporium acremonium (Kimura et al., 1991 ). The GAPDH gene from Tolypocladium niveum and its use for techniques of genetic manipulation in this or other organisms has not been described so far.

The GAPDH structural gene, the initiation site of the translation, the promoter-active part and the transcription termination region of the GAPDH gene can be isolated from cells of Tolypocadium niveum. Examples of Tolypocladium niveum include Tolypocladium niveum ATCC 34921 and strains derived therefrom.

The DNA for the alanine racemase gene and also for the .GAPDH gene can be obtained from chromosomal DNA from Tolypocladium niveum. The chromosomal DNA in turn can be isolated by various methods according to the prior art, such as, for example, directly from digested cells according to Kück et al. (1989) or a similar method. Another method is based on protoplasts. For this purpose, the fungal cells are protoplastized according to a known method, e.g. summarized by Peberdy (1991) or after a corresponding modification; the optimized variant for Tolypocladium niveum described in Example 18 is very suitable. After lysis of the protoplasts, the DNA is isolated and purified by the method of Cryer et al. (1975) or a corresponding modification (example 6).

In order to detect and ultimately clone the DNA which the alanine racemase gene region of the chromosomal DNA or that DNA which contains the GAPDH gene region, any method can be used which determines the existence of the alanine racemase gene or the GAPDH gene approved. In principle, for example, a method could be used which is based on a corresponding defect in the host strain alanine racemase gene or Complement the GAPDH gene. Another method would be to detect the gene from another organism by hybridization with part or all of the known alanine racemase gene or GAPDH gene. Possible other microorganisms relating to the alanine racemase gene would be, for example, Salmonella typhimuήum (Wasserman et al., 1984 (dadB), Galakatos et al., 1986 (alr)), Bacillus stearothermophilus (Inagaki et al., 1986, Tanizawa et al., 1988 ) or Bacillus subtilis (Ferrari et al., 1985). However, since these are prokaryotic genes, and in this case no pronounced homology can be expected, it is essential to first determine amino acid partial sequences of the alanine racemase protein from Tolypocladium niveum and then to derive and produce suitable specific oligonucleotide probes from them. Suitable other microorganisms relating to the GAPDH gene are, for example, Saccharomyces cerevisiae or Aspergillus nidulans. In the specific case, part of the GAPDH gene from Penicillium chrysogenum can be a useful sample. Escherichia coli is usually used as the host strain for cloning, although other organisms could of course also be used. A preferred strain is, for example, the commercially available Escherichia coli SRB (Stratagene). In principle, any vector that can be transferred into Escherichia coli can be used as the cloning vector. Mostly plasmid vectors such as pBR322, pUC18, pUC19, pUCBM20, pBluescriptII SK + and the like, or vectors based on the bacteriophage lambda, such as lambda EMBL3, or lambda DASH II, are used. In order to clone even larger DNA fragments, cosmids can be used, for example the vector Supercos 1 (Stratagene).

In order to insert fragments of the isolated chromosomal DNA into a vector, the chromosomal DNA can be cut either partially or completely with a suitable restriction enzyme. Likewise, the selected vector can be cut with the same restriction enzyme or one that creates the same ends. In the case of lambda or cosmid vectors, the two edge fragments can be produced using a known method in order to increase the cloning efficiency. Then DNA fragments and vector can be ligated together using a DNA ligase in order to obtain the corresponding recombinant DNA molecules.

The recombined DNA is then introduced into Escherichia coli. In the case of a plasmid vector, this can be done using "competent cells" (Sambrook et al., 1989) or by Electrotransformation can be performed. Lambda and cosmid molecules are introduced into Escherichia coli by in vitro packaging in bacteriophage lambda phage shells and subsequent infection of the corresponding host strain. Commercially available lysates can be used for the in vitro packaging (eg Gigapack II, Stratagene).

In order to detect those with the alanine racemase gene or those with the GAPDH gene among the recombinant clones, plaque hybridizations for lambda clones or colony hybridizations for plasmid and cosmid clones are carried out according to standard techniques (Sambrook et al., 1989), an oligonucleotide mixture which was derived from amino acid partial sequences of the alanine racemase protein as described above being used as a probe for the alanine racemase gene. A suitable mixture must first be selected in preliminary experiments, and the stringency of the corresponding hybridization must be very well optimized in Southern experiments. By repeating the plaque hybridization several times, a corresponding DNA containing the alanine racemase gene from Tolypocladium niveum can be isolated. Part of the GAPDH gene from Penicillium chrysogenum can be used as a probe for the GAPDH gene, the stringency having to be modified accordingly. By repeating this technique several times, ^" an appropriate DNA containing the GAPDH gene from Tolypocladium niveum can be isolated purely.

After restriction analysis of the corresponding DNA, individual fragments in plasmid or bacteriophage Ml 3 vectors can be subcloned using standard techniques. The nucleotide sequence of the alanine racemase gene or the GAPDH gene can be determined by a sequencing method (eg according to Maxam-Gilbert (Maxam and Gilbert 1980) or the didesoxy method (Sanger et al., 1977) or a suitable modification). Gene can be determined. After analyzing the sequence and comparing the translated sequence with the partial amino acid sequences of the identified alanine racemase, it can be verified that the alanine racemase gene is involved, and also the orientation of the gene and its promoter and termination region on the DNA can be determined become. The expression of the hybridized gene can be confirmed by Northern hybridizations of corresponding partial fragments of the alanine racemase gene or of the GAPDH gene. After analysis of the corresponding sequences, both in the case of the alanine racemase gene and of the GAPDH gene, the position of the structural gene, of the promoter and of the Termination region can be determined. This can be substantiated significantly if, in addition to the genomic DNA fragment, the corresponding RNA in the form of cDNA is also used for the investigations. In addition, the determination of the position of intron areas and the starting point of the transcription is facilitated. For this purpose, the entire RNA is first isolated from the fungal cells by the method described by Cathala et al. (1983) or a similar method. The polyA-RNA is purified from it using one of the numerous standard processes. The overwriting in c-DNA can be realized, for example, by PCR amplification technology. Then RACE ("rapid amplification of cDNA ends") using commercially available systems (for example from GIBCO BRL, from Clonetech) and with the use of gene-specific oligonucleotide primers both the beginning of the transcripts (5'-RACE) and also the end (3'-RACE), or thereby the internal gene area (testing for introns) isolated and accessible for direct sequencing or for sequencing after appropriate clone construction. This procedure was demonstrated for the characterization of the alanine racemase gene in Example 27, the exact transcription start, the transcription determination and the location of intron regions being localized. Another possibility is to incorporate the cDNA obtained after overwriting the poly-RNA into plasmid or lambda vectors using suitable linkers or adapters. The search and purification of the positive clones is carried out analogously to the above by means of plaque or colony hybridizations, it now being possible to use part of the GAPDH gene from Tolypocladium niveum. The proportion of positive clones compared to the total number of clones examined also gives an indication of the strength of the expression of the gene sought under the corresponding conditions. In the case of the GAPDH gene according to Example 13, the proportion of positive clones was very high at approximately 2.5 to 3%. After sequencing suitable cDNA fragments of the GAPDH gene, the position of the introns, as well as the promoter and termination area can be localized by comparison with the genomic sequence.

Figure 15 shows the nucleotide sequence of the GAPDH gene isolated from Tolypocladium niveum according to Examples 12, 13 and 14. The ATG codon at item 673 in Figure 15 is the start codon of translation, the beginning of the actual structural gene. In the untranslated area above the start of the transcription, structural elements can be found, like those in a similar form in others Mushroom promoters have been found. This is followed by an approx. 60 bp CT region above the presumed transcription start, which ends in a potential TATA box. A so-called CAAT box could be located another approximately 60 bp upwards (Gurr et al., 1987).

Corresponding DNA fragments which contain this promoter region can now be used for the construction of individual fusions with genes which are to be placed under the control of the GAPDH gene promoter. For the construction of the vectors in which fusions of the GAPDH gene promoter to the hygromycin resistance gene are contained, certain parts of the sequenced region were used according to Examples 20 and 26. However, these are only individual possibilities for such constructions. For example, part of the DNA can also be deleted, both at the 5 'end of the region and at the 3' end. Only parts of the promoter area can also be used (as in Example 25), for example only the part up to the starting point of the transcription. On the other hand, larger parts of the structural gene can also be used for such mergers. The same applies, of course, to the fragment used from the termination region of the gene. In addition, a small part of the promoter and terminator fragments can also be modified for special purposes, for example to further increase expression. With the help of such DNA fragments, genes whose expression one wishes to achieve can be combined to form fusion constructions. Examples of these genes can be, for example, those which serve as selection labels in the corresponding organism, as described in Examples 20 and 25, or any other genes which code for specific enzymes. In very general terms, this gene can be chemically synthesized or semisynthetically produced both from genomic DNA, from cDNA which has been formed from mRNAs.

Appropriate processes for protoplasting and transformation are essential prerequisites for the targeted modification of Tolypocladium niveum. Any strains of the Tolypocladium niveum species, but also other types of fungi can be used as host strains for the individual gene constructions. In addition to the transformation of protoplasts (as described, for example, in Example 19), another method (for example electrotransformation of protoplasts or spheroplastized mycelium, or the like) can also be used as a method for bringing these gene constructions into Tolypocladium niveum. The transformation can be done directly by the gene contraction on a vector DNA is located together with a suitable selection mark, or can be carried out by means of cotransformation. In addition to suitable vector DNA, the gene construction that is on another DNA is added to the transformation approach. Corresponding transformants can be analyzed molecularly using various hybridization techniques.

According to the above description it is therefore possible to transform Tolypocladium niveum with DNA which carries the gene for the alanine racemase or which carries the gene or a part thereof for the GAPDH gene. Strains containing several additional copies of the alanine racemase gene can be found in Southern hybridizations. The number of copies alone does not allow a compelling conclusion on the additional performance of the strains, since the locations of integration and changed regulatory mechanisms have a significant influence. These strains can be examined in test fermentations and then those which produce more cyclosporin A can be found.

By transforming Tolypocladium niveum with plasmid vectors which carry part of the alanine racemase gene (which is insufficient to produce the active enzyme), strains can be generated which have integrated the plasmid vector into the genomic alanine racemase gene by homologous recombination, as a result of which. Gene has been destroyed. It can be shown in test fermentations that these strains no longer form cyclosporin A. This is further proof that the cloned gene is actually the gene for the alanine racemase enzyme, which is essential for cyclosporin biosynthesis.

Since the biosynthesis of cyclosporin starts at position 8, ie with activation of D-alanine, strains in which the alanine racemase gene has been destroyed are particularly interesting for the incorporation of "foreign" amino acids at position 8 in the cyclosporin molecule. In particular, it was found that a nucleotide sequence which has an A (adenosine) instead of G (guanosine) at position 2318 compared to the sequence shown in Figure 5, which results in the triplet at positions 2317, 2318, and 2319 for aspartic acid instead of coding for glycine, leads to incorporation of D-serine instead of D-alanine in position 8 of the cyclosporin. By adding larger amounts of "foreign" amino acids to the fermentation medium, strains can be found which can form significant amounts of modified cyclosporins. Cyclosporins which carry an amino acid other than D-alanine in the 8-position and which can be prepared according to the present invention are disclosed and cited, for example, in US Pat. No. 5,284,826, the content of which is hereby inserted as a reference. These modified cyclosporins are used as pharmaceuticals in the fields of application disclosed and cited therein and can be used in the manner and cited therein and in the doses indicated and cited therein.

The following examples and illustrations illustrate the invention without, however, restricting it.

The restriction maps shown in Figures 1, 2, 3, 4, 6, 7, 10, 12, 17, 18 and 19 are only approximate representations of restriction sites in the DNA molecules. The distances shown are proportional to the actual distances, but the latter may differ. Not all restriction interfaces are shown, there may be other interfaces.

Figure 1: Restriction map of the approximately 15.2 kb portion of genomic DNA from Tolypocladium niveum in Lambda RAC4 (white bar). The shaded bar represents the approx. 1100 bp tl restriction fragment, which delivers a positive signal with the hybridization probe (oligonucleotide mixture R14) and was cloned into pRPl. The two hatched bars represent the neighboring fragments that were subcloned into pRP6 and pRP9, respectively.

Figure 2: Restriction map of plasmid pRPl. The shaded bar represents the approx. 1100 bp Pstl restriction fragment, which gave a positive signal with the hybridization probe (oligonucleotide mixture R14). The thinner portion represents the area of the plasmid vector pUCBM20 used.

Figure 3: Restriction map of plasmid pRP6. The shaded bar represents the approx. 1.9 kb EcoRI-SaE restriction fragment from Lambda RAC4. The thinner portion represents the area of the plasmid vector pUCBM20 used.

Figure 4: Restriction map of plasmid pRP9. The shaded bar represents the approx. 650 bp HindSl-Pst restriction fragment from Lambda RAC4. The thinner portion represents the area of the plasmid vector pBluescriptII SK + used.

Figure 5: Nucleotide sequence of the approximately 1.1 kb PstI insert in pRPl, the approximately 1.9 kb-sized EcoRI-Sall fragment from pRP6, the approx. 650 bp PstI-Hindül fragment from pRP9, and an additional 511 bp subsequent to the HindlH site comprising 3973 nucleotides (see also Figure 19). Individual recognition sites for restriction endonucleases are indicated.

Figure 6: Restriction map of a sequenced section from Figure 5. The location of the amino acid partial sequences found (Example 12) is given.

Figure 7: Restriction map of plasmid pRP12. The shaded bar represents the approximately 835 bp EcoRI- -stl restriction fragment from pRPl. The thinner portion represents the area of the plasmid vector pUCBM20 used.

Figure 8: Restriction map of plasmid pGT24. The plasmid is derived from pGT14 and contains a -βαmHI fragment (white bar) with the hygromycin resistance gene, the orientation of which is indicated by the dotted arrow.

Figure 9: Restriction map of plasmid pGTl. The shaded bar represents the Sαcl fragment isolated in Example 12 with the GAPDH gene from Tolypocladium niveum. The thinner portion represents the area of the plasmid vector pUC18 used.

Figure 10: Nucleotide sequence of the 2271 bp Sαcl fragment from pGTl

Figure 11: Restriction map of plasmid pGT4. The shaded area represents the cloned cDNA of the GAPDH gene (gpdA) (example 13). The thinner area represents the proportion of the plasmid vector pUCBM20.

Figure 12: Nucleotide sequence of the 1347 bp cDNA insert in pGT4. Items 1-14 and 1334-1347 (underlined) correspond to the adapter molecules used for the cloning and contain the recognition sites for the restriction endonucleases EcoRI (GAATTC) and NotI (GCGGCCGC).

Figure 13: Nucleotide sequence of the 1278 bp Xhol-Sall fragment from gpdcosl, which contains the promoter of the GAPDH gene (Example 14). The Sαcl identification point corresponds to that at pos. 1-6 in Figure 11.

Figure 14: Comparison of the genomic nucleotide sequence (top) with that of the cDNA (bottom) (example 14). Individual restriction interfaces are marked. The two intron areas are represented by the dash. The translation start codon ATG, as well as the translation stop codon TAA, is underlined. They mark the location of the actual GAPDH structural gene from Tolypocladium niveum.

Figure 15: Amino acid sequence of the derived GAPDH Figure 16: Restriction map of plasmid pGT12 (example 20). The gray arrow marks the area and the orientation of the selected promoter fragment of the GAPDH gene from Tolypocladium niveum. The thin area corresponds to the part of the plasmid vector pBluescript II SK + used.

Figure 17: Restriction map of plasmid pGT14 (example 20). The gray areas indicate the promoter fragment used (arrow) and the fragment from the terminator area of the GAPDH gene from Tolypocladium niveum.

Figure 18: Restriction map of plasmid pGT30 (example 26). The gray arrow marks the area and the orientation of the selected promoter fragment of the GAPDH gene from Tolypocladium niveum. The fragment marked by the white bar contains the hygromycin resistance gene, the orientation of which is indicated by the dotted arrow. The rest of the plasmid corresponds to pCSN44 (Stäben et al., 1989)

Figure 19: The amino acid sequence of the alanine racemase from Tolypocladium niveum derived from the nucleotide sequence

Figure 20: Nucleotide sequence of the 3973 bp alanine racemase gene region. The coding region of the structural gene is characterized by the representation of the amino acid sequence. The position of the intron is marked.

Figure 21: Result of the sequencing of 32 5'-RACE clones of the alanine racemase gene. The starting nucleotide is always the large A. The identical sequence areas are marked with dashes. The position numbers refer to the A of the translation start codon.

Figure 22: Result of the sequencing of 12 3'-RACE clones of the alanine racemase gene. Above the ends of the individual DNAs, the genomic sequence is shown in italics as a reference point. The position numbers refer to the A of the translation start codon. The number after the "/" stands for the length of the 3 'area after the stop codon. Example 1: Analytical determination of alanine racemase activity:

1st stage: Racemase reaction:

About 1 mU of racemase are incubated in a total volume of 120 μl in the presence of 30 mM L-alanine, 50 μM pyridoxal phosphate (Boehringer Mannheim), 20 mM DTT and 100 raM tricine pH 8.5 at 48 ° C. for 1 hour. The protein solution is then inactivated by heating at 80 ° C. for 5 minutes; the denatured proteins are centrifuged off in the Eppendorf centrifuge.

2nd stage: Detection of the D-alanine formed by reaction with D-amino acid oxidase (DAO) and lactate dehydrogenase (LDH) (both enzymes from Boehringer Mannheim):

100 μl of supernatant from the heat-inactivated racemase reaction are in one

Total volume of 500 μl in the presence of 200 μM NADH (Boehringer Mannheim),

0.3 units DAO, 1 unit LDH and 100 mM Tricin pH 8.5 measured at 30 ° C.

The procedure is carried out in 500 μl quartz cuvettes (quartz glass Suprasil micro cuvettes), and the decrease in extinction caused by the NADH consumption is measured at 340 nm for 20 minutes.

Determination of the enzyme units: According to the IUPAC nomenclature is a

Racemase unit defined as 1 μmol D-alanine, which is formed per minute. The formation of D-alanine is equimolar to the consumption of NADH.

Example 2: Enrichment of alanine racemase:

With the following protocol, about 4 mg of total protein can be obtained from 1 kg of moist mycelium (moist after spinning off, as described below), of which alanine racemase has a share of about 10% (about 0.4 mg). These 0.4 mg alanine racemase have an activity of 2.5 enzyme units, which corresponds to a 1000-fold enrichment of the enzyme activity, based on the crude extract. All steps were carried out between 0 ° C and 4 ° C. All column chromatography Separations were carried out on an FPLC system (from Pharmacia).

1st step: harvesting and breaking down the mycelium:

4-5 kg fermentation slurry was centrifuged at 16,000 g, 10 minutes. The slurry was washed twice with 2.5 l of physiological saline with the addition of 5 mM EDTA. 1 kg of the moist biomass obtained in this way was suspended in 2.5 l of buffer A (0.25 M HEPES pH 7.5; 0.4 M KC1; 5 mM EDTA; 20 gv% glycerol; 10 mM OTT) and with the aid of an Ultraturrax homogenized. The suspension was digested in the Manton Gaulin Lab 60 under 3 runs of 600 bar each (flow rate 60 1 h). The temperature was repeatedly set to 4 ° C in between. The cell debris was centrifuged in a medium-speed stand centrifuge at 16,000 g for 10 minutes. The supernatant was called the crude extract.

2nd step: removal of the nucleic acids from the crude extract:

The nucleic acids were precipitated by adding a polyethyleneimine solution (12% in water; dialyzed to remove the low molecular weight constituents) to a final concentration of 0.1%. The precipitate was removed by centrifugation at 17,000 g for 10 minutes. This clarified crude extract was called the polyethyleneimine supernatant.

3rd step: protein precipitation with ammonium sulfate:

The polyethyleneimine supernatant was added dropwise to 40% saturation of ammonium sulfate by dropwise addition of a 100% saturated ammonium sulfate solution in buffer B (0.1 M HEPES pH 7.5; 4 mM EDTA; 15 gv% glycerol; 4 mM DTT). After the addition had ended, stirring was continued for 30 minutes. The protein pellet was centrifuged at 32,000 g for 30 minutes, then dissolved in 500 ml of buffer B and dialyzed against 5 l of buffer B for 12 hours. Before the 4th step, the dialysate was diluted to twice the volume with buffer B and filtered through an 8 μ glass fiber filter. The sample thus obtained was called the ammonium sulfate fraction. 4th step: Combination chromatography on the cation exchangers S-Sepharose and phosphocellulose Pl l:

Two columns (S-Sepharose fast flow was from Pharmacia: 2.6 x 7.8 cm and phosphocellulose Pl 1 was from Whatman: 5 x 7.9 cm) were switched in tandem, in such a way that the proteins were applied first Filtered over S-Sepharose and then bound to phosphocellulose. This part of the chromatography was carried out in buffer B at a flow rate of 10 ml / min. The coupled columns were washed with Buffer B until the absorbance fell back to the baseline. The S-Sepharose was then decoupled and the phosphocellulose eluted with a salt gradient: gradient in 700 ml onto buffer C (= buffer B with 1 M NaCl). Flow rate: 5 ml / min. The active fractions were pooled and filtered through a 0.8 μ membrane filter. This sample was called the PI pool.

5th step: Concentration of the Pll pool by ultrafiltration:

The Pll pool was across a membrane with a separation limit at an M ,. concentrated from 30,000 (YM30 from Amicon) to 10 ml. Conditions: Ultrafiltration cell from Amicon, under N ₂ gassing, maximum 5 bar, at 4 ° C.

Step 6: Gel permeation chromatography on Sephacryl S300-HR:

Sephacryl S300-HR was from Pharmacia: 2.6 x 95 cm. The column was equilibrated in buffer D (50 mM Tris / HCl pH 8.2; 1 mM EDTA; 10 gv% glycerol; 4 mM OTT) with the addition of 0.2 M NaCl. The calibration was carried out under the same buffer conditions using a BioRad GPC standard. Chromatography: flow rate 1 ml / min. The activity eluted at a volume of 268-302 ml. The sample thus obtained was referred to as the S300 pool.

Step 7: anion exchange chromatography on Mono-Q:

The MonoQ column HR5 / 5 was equilibrated by Pharmacia and in buffer D. The S300 pool was cleaned in two portions using Mono-Q. The sample was applied after dialysis against buffer D at a flow rate of 0.5 ml / min. Elution of the bound proteins was carried out with a gradient: from 0 to 20% buffer E (= buffer D with 1 M NaCl) in 2 ml; from 20 to 70% E in 15 ml and from 70 to 100% E in a further 3 ml, at a flow rate of 0.2 ml / min. The main peak of racemase activity was 0.32 to 0.36 M NaCl.

Example 3: Identification of the protein band in SDS-PAGE:

A radioactive enzyme-specific labeling technique was used to correctly identify the protein band correlating with racemase activity. The racemase-containing protein solutions after the last purification step on Mono-Q (0.2 mg total protein in 200 μl) were dialyzed against 20 mM KH ₂ PO ₄ buffer pH 7 for about 10 hours before labeling. The reduction was carried out in a total volume of 300 μl with 2 μl of a 10 mg / ml NaBH ₄ solution in 0.2% NaOH and 3.7 MBq [ ³ H] -NaBH ₄ (specific activity: 331 GBq / mmol; from NEN), also carried out in 0.2% NaOH at room temperature for three hours. The batches were then dialyzed against 100 mM NH ₄ HCO _{3 for} 12 hours with repeated buffer changes and evaporated to dryness in vacuo. The pellets were taken up in 50 μl sample buffer for SDS-PAGE and boiled for 5 minutes. The electrophoresis was carried out according to Lämmli (Lämmli 1970) in a 10% gel with subsequent Coomassie Blue staining. The gel was then fixed for 30 minutes (in 25% isopropanol, 10% acetic acid, 2% glycerol) and then swirled in Amplify solution (from Amersham; with the addition of 2% glycerol) for 15 minutes. The gel was dried and exposed to a Hyperfilm ™ MP (Amersham) at -70 ° C for two to four weeks. This method clearly assigned the racemase activity to a protein band with an M. of 39,000.

Example 4: Molecular Weight Analysis of Alanine Racemase:

The M _r analysis was carried out on a TSK-3000-SWG 21.5 x 600 mm, with a TSK-SWG 21.5 x 75 mm guard column, on an HPLC system. Buffer: 0.2 M Tris / HCl pH 7.5; Flow rate: 5 ml / min. The gel column was calibrated using the calibration proteins aldolase (M, 160,000), IgG (150,000), alkaline phosphatase (140,000), BSA (68,000), ovalbumin (45,000), carbonic anhydrase (30,000) and myoglobulin (18,800). An M was determined around 100,000. Example 5: Amino acid sequences of alanine racemase:

The protein sample was subjected to SDS-PAGE (10%) in a Mini Protean II electrophoresis system (Bio Rad). After electrophoresis, the gel was equilibrated for 5 minutes in transfer buffer (10 mM CAPS (3- (cyclohexylamino) -l-propane sulfonic acid, Fluka), 10% methanol, pH 11.0 with sodium hydroxide solution). Eirie PVDF (polyvinylidene difluoride) membrane (Immobilon, Millipore) was immersed in methanol for 5 seconds and then also equilibrated in transfer buffer. The proteins were then transferred from the gel to the membrane in the Mini Trans-Blot cell (Bio Rad) within one hour at 200 mA. After the transfer, the membrane was washed in water for 5 minutes, then stained in a 0.1% solution of Coomassie Blue R-250 (Serva) in 50% methanol for 2 minutes and decolorized in 50% methanol, 10% acetic acid until the protein bands became clear be identified. The membrane was then washed with water, the bands containing alanine racemase (estimated amount of alanine racemase due to the color: 25 μg) were cut out and crushed into squares of approximately 1 mm in side length, which were dissolved in 1 ml of 0.2% PVP-40 (polyvinylpyrrolidone ( Sigma) solution was added in 100% methanol After incubation for one hour at 37 ° C. and washing in water, the membrane pieces were placed in 100 mM Tris-HCl buffer, pH 8.1 After adding 2 μg of the protease Lys-C (Boehringer Mannheim) was incubated at 37 ° C. After 20 hours of incubation, solid guanidine.HCl was added to a final concentration of 6 M. The protein was reduced by adding 300 μg DTT and 90 minutes incubation at 37 ° C. under argon and then by Addition of a 3-fold molar excess over DTT of iodoacetamide under argon for 30 minutes at room temperature in the dark, the resultant, reduced and alkylated by degradation with Lys-C The peptide mixture was applied to a 2.1 x 30 mm reversed phase column (Aquapore RP-300, 7 μm, Brownlee) and separated in a Model 130A HPLC system from Applied Biosystems. The peptides were separated by eluting the column with a gradient of 0.1% trifluoroacetic acid in water against 70% acetonitrile (containing 0.075% trifluoroacetic acid), the gradient increasing from 0% to 60% in 20 minutes and from 60% in a further 10 minutes Was driven 100%. The eluting peptides were collected and their amino acid sequence was determined on a 470A gas phase sequencer (Applied Biosystems) in accordance with the device manufacturer's instructions: as 1750: AWADEQEIAIHIDGARIW

as 1751: STLDTAAQHR

as 1753: AGHWGDPTLTGS

as 1758: EAALFVVSGTMANQIALGAL

Example 6: Isolation of high molecular genomic DNA from Totvoocladium niveum

Protoplasts were produced as described in Example 18. About 10 ⁹ protoplasts were carefully lysed in 2 ml TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) 0.1 mg / ml RNase A was added and incubated at 37 ° C for 20 min. After adding 0.5% SDS and 0.1 mg / ml Proteinase K, the mixture was incubated at 55 ° C. for a further 40 min. The mixture was extracted very gently twice with TE-saturated phenol, phenol / chloroform (1: 1) and chloroform / isoamyl alcohol (24: 1) (Maniatis et al., 1982). The aqueous, slightly viscous supernatant was mixed with a tenth volume of 3 M sodium acetate (pH 5.2), covered with 2.5 times the volume of absolute, -20 ° C cold ethanol and the DNA in the form of fine threads was wound on the phase boundary using glass rods. The DNA was dissolved in 3 ml of TE for at least 20 h. Depending on the quality of the protoplasts, approx. 500 μg / ml DNA was obtained. Analysis with FIGE (0.8% agarose, 0.5 x TBE (Maniatis et al. 1982), 6 V / cm, forward pulse 0.2 to 3 sec, pulse ratio 3.0, running time 5 h) showed a size of more than 150 kb.

Example 7: Construction of a genomic lambda library from Tolypocladium niveum

Approximately 100 μg of DNA from Example 6 were mixed with 9 or 18 units of the restriction enzyme Ndell (Boehringer Mannheim) for 1 h at 37 ° C. in 1 ml of buffer (tris acetate 33 mM, magnesium acetate 10 mM, Potassium acetate 66 mM, DTT 0.5 mM, pH 7.9) cut. Aliquots of the restrictions were checked using FIGE and resulted in a maximum of the fragments obtained at about 25 and 10 kb, respectively. Using a gradient mixer, linear NaCl- in ultracentrifuge tubes Density gradients from 30% to 5% were prepared in 3 mM EDTA pH 8.0 and the DNAs were applied. After centrifugation for 5 h at 37000 rpm and 25 ° C (Beckman ultracentrifuge L7-65, rotor SW 41), the gradient was harvested in 500 μl fractions. Only fractions with DNA of more than 12 kb and less than 25 kb were dialyzed three times for 2 hours against TE (Tris-HCl 10 mM, EDTA 1 mM pH 8.0), precipitated with ethanol and dissolved in 50 μl TE each.

Lambda DASH II (Stratagene) was used as the cloning vector. After restriction of the vector with -BαmHI and HindIII, the two vector arms were prepared as indicated by Sambrook et al. (1989). 1 μg of this was mixed with approx. 500 ng of the DNA fragments in 20 μl ligation mix (Tris-HCl 66 mM, MgCl ₂ 5 mM, DTE 1 mM, ATP 1 mM, pH 7.5) with 16 units of T4 DNA ligase (Fa. Boehringer Mannheim) ligated at 12 ° C for 16 h. 4 μl each of the batch were packed with packaging extracts (Gigapak II, Stratagene) in lambda phage casings. E.coli SRB (Stratagene) was used as the host strain for the infection; the bacteriophage lambda-competent cells were produced according to Sambrook et al. (1989). After infection, the batches were plated in aliquots on LB medium (Maniatis et al., 1982) with 10 mM MgSO ₄ , and E.coli SRB was again used as the indicator strain. Recombinant clones were identified as plaques in the bacterial lawn. Approximately 50,000 plaques were washed off with SM buffer (5.8 g / 1 NaCl, 2 g / 1 MgSO ₄ x 7H ₂ 0 and 50 mM Tris-Cl pH 7.5), and the gene bank thus obtained was stored in aliquots at 4 ° C. . A titer determination gave approx. 1 x 10 ⁸ pfu / ml.

An analysis of 30 randomly selected clones by isolation and restriction of the lambda DNA contained showed that all clones contained recombinant lambda phages; the average insert size was 15 kb.

Example 8: Construction of a genomic cosmid library from Tolypocladium niveum

Two 135 μg DNA from Example 6 were cut with 7.5 or 15 units of the restriction enzyme Ndell, as described in Example 7. Aliquots of the restrictions were checked and gave a maximum of the fragments obtained at about 45 and 30 kb, respectively.

Using a gradient mixer, linear NaCl density gradients of 30% to 5% in 3 mM EDTA pH 8.0 were produced in ultracentrifuge tubes and the DNAs applied. After centrifugation, the gradient was harvested in 500 μl fractions. Only fractions with DNA of more than 30 kb and less than 50 kb were dialysed three times for 2 hours against TE, precipitated with ethanol and dissolved in 50 μl TE each.

SCos 1 (Stratagene) was used as the cloning vector. The BamTR and Xbäl cut vector arms were made and modified as indicated by Evans et al (1989). 1 μg of this was ligated with approx. 500 ng of the DNA fragments and packed in lambda phage casings. E.coli SRB (Stratagene) was used as the host strain for the infection. After infection, the batches were plated in aliquots on LB medium with 75 μg / ml ampicillin. Recombinant clones were recognizable as colonies after 20 h at 37 ° C. A total of approximately 50,000 colonies were obtained, which were then suspended in 0.9% NaCl / 20% glycerol and stored at -70 ° C. An analysis of 40 arbitrarily selected clones by isolation and restriction of the cosmids contained showed that all clones contained recombinant cosmids; the average insert size was 36 kb.

Example 9: Selection and testing of suitable oligonucleotide mixtures

To produce the hybridization probe, the following DNA sequence could be derived from the partial amino acid sequence asl750 of alanine racemase (Example 5) by reverse translation using the universal genetic code:

ALA TRP ALA ASP GLU GLN GLU ILE ALA ILE HIS ILE ASP GLY ALA ARG ILE TRP

GCN TGG GCN GAC GAA CAA GAA ATA GCN ATA CAC ATA GAC GGN GCN CGN ATA TGG GAT GAG CAG GAG ATC ATC CAT ATC GAT AGA ATC

ATT ATT ATT AGG ATT

Based on this, three oligonucleotide mixtures were synthesized which correspond to a certain part of the sequence of the non-coding strand (underlined area):

Oligo R13: Length: 23mer 64-fold degenerate

5'- GC AAT TTC TTG TTC ATC AGC CCA - 3 'C C C G C

G T

Oligo R14: Length: 23mer 64-fold degenerate GC GAT TTC TTG TTC ATC AGC CCA - 3 'CCCGC

G T

Oligo R15: Length: 23mer 64-fold degenerate

5'- GC TAT TTC TTG TTC ATC AGC CCA - 3 'C C C G C

G

T

Approx. 10 pmol each of these oligonucleotide mixtures were gamma-coated in 20 μl buffer (50 mM Tris-Cl pH 7.6, 10 mM MgCl ₂ , 5 M dithiothreitol, 0.1 mM spermidine HC1, 0.1 mM EDTA (pH 8)) with 50 μCi ³² P-ATP (6000 Ci / mmol) and 8 units of T4 polynucleotide kinase (from Boehringer Mannheim) radioactively labeled for 45 min at 37 ° C. More than 80% of the radioactivity was incorporated into the oligonucleotides.

To test the hybridization, 10 μg of genomic DNA from Tolypocladium niveum (Example 6) were cut with SaR, EcoRI and with HindIII and examined in Southern hybridizations. The 0.8% agarose gel was vacuum-blotted (Vacublot, Pharmacia) on a nylon Membrane (Duralon-UV, from Stratagene) transferred. The pre-hybridization was 16 h at 37 ° C in 5 ml / 100 cm ² 6 x SSPE (Maniatis et al. 1982), 5 x Denhardt's solution (Maniatis et al., 1982), 0.5% SDS, 100 μg / ml heat denatured rated herring sperm DNA, 0.1 mM ATP performed. Before the corresponding ³² P-labeled oligonucleotide mixture was added, the temperature was raised to 65 ° C., then set to 55 ° C., 45 ° C. and finally to 37 ° C. for 1.5 h each. The hybridization was carried out at 37 ° C. for 16 h.

The membranes were washed for 5 min and 30 min in 6 x SSC (Maniatis et al., 1982) at 4 ° C. The membranes were then washed for 5 min at room temperature in a tetramethylammonium chloride (TMAC) washing solution (3.00 M TMAC, 50 mM Tris (pH 8.0), 2 mM EDTA, 0.1% SDS) (Wood et al., 1985). Finally, it was washed twice in TMAC washing solution at the stringent temperature of 56 ° C. for 40 minutes. The membranes were sealed in foil and exposed to Kodak intensifying foil on X-ray film (XOmatik AR, Kodak) for 14 days at -70 ° C. In the hybridizations with the oligonucleotide mixtures R13 and R15, none Signals are detected while those with R14 were positive. One band was identified in each case for the restrictions, for the restriction with SaR this was located at about 2.9 kb, for EcoRI and HindRI the sizes were each over 6 kb.

Example 10: Isolation of lambda clones using an alanine racemase-specific

Hybridize oligonucleotide

Aliquots of the lambda bank from Example 7 were applied to LB medium (Maniatis et al., 1982) with 10 mM MgSO ₄ in a suitable dilution in order to achieve a titer of approximately 2500 plaques per plate. A total of approximately 20,000 plaques were examined. The transfer to nylon membranes (Duralon-UV, from Stratagene) was carried out as recommended by the manufacturer. The screening of the gene bank was carried out under the same hybridization and washing conditions as described in Example 8. Four positive signals were found on the X-ray films. The corresponding areas of the agarose layer of the plates were cut out and resuspended in SM buffer (5.8 g / 1 NaCl, 2 g / 1 MgSO ₄ x7H ₂ 0, 50 mM Tris-Cl pH 7.5). A suitable dilution was plated again with E. coli SRB on LB medium with 10 mM MgSO ₄ and the plaques were transferred again to membranes. The positive clones were purified by renewed hybridization and subsequently by a third round of hybridization carried out analogously.

The DNA of the four lambda clones, lambda RAC1 to lambda RAC4, was isolated and investigated by restriction analyzes and subsequent hybridization with the radioactively labeled oligonucleotide mixture R14 (example 9). It was shown that, inter alia, an approximately 1.1 kb PstI restriction fragment delivers a positive signal. Figure 1 shows the restriction map of the Tolypocladium m ^' veu / n portion of such a lambda clone (= Lambda RAC4).

Example 11: Cloning of subfragments from Lambda RAC4

In order to clone the approximately 1.1 kb -P-stl fragment (Example 10), approximately 10 μg Lambda RAC4 were completely cut with Pstl and the approximately 1.1 kb Pstl fragment was eluted from a 1.0% agarose gel (Geneclean II, Fa BiolOl). The plasmid vector pUCBM20 (from Boehringer Mannheim) was also restricted with Pstl and treated with alkaline phosphatase from calf intestine (from Boehringer Mannheim) according to the manufacturer's instructions. Approx. 200 ng of purified PstI fragment from Lambda RAC4 and pUCBM21 were ligated with 1 unit of T4 DNA ligase. After transformation into E.coli XL1 Blue (from Stratagene), the corresponding plasmid was isolated. It was called pRPl and. characterized by restriction analyzes; a restriction map is shown in Figure 2.

Similarly, the approx. 1.9 kb EcoRI-Sα / I fragment from Lambda RAC4 (Figure 1) was cloned into the correspondingly cut plasmid vector pUCBM20 (Boehringer Mannheim). The resulting plasmid was called pRP6 and is shown in Figure 3.

As a further fragment, the approx. 650 bp HindlU-Pstl fragment from Lambda RAC4 (Figure 1) was inserted into the similarly cut plasmid vector pBluescript II SK + (Stratagene). The resulting plasmid was named pRP9 and is shown in Figure 4.

These last two constructions also covered the area adjacent to the Pstl fragment positive in hybridization with R14.

Example 12: Isolation of the GAPDΗ gene from Tolypocladium niveum

Aliquots of the cosmid bank from Example 8 were applied to LB medium with 70 μg / ml ampicillin in a suitable dilution in order to achieve a titer of approximately 200 colonies per plate. Transfer to nylon membranes and lysis of the colonies was carried out as recommended by the manufacturer. To prepare the hybridization probe, approximately 20 μg of the plasmid pAP21, which contains part of the GAPDH gene from Penicillium chrysogenum (Pfitzner, 1988), were completely cut with the restriction enzyme SaR. The approximately 4 kb Sα / I fragment was eluted from a 0.8% agarose gel (Geneclean II, BiolOl) and radioactively labeled with alpha- ³² P-dATP using nick translation (Sambrook et al. 1989).

To test the hybridization, 10 μg of genomic DNA from Tolypocladium niveum (Example 6) were cut with Sacl and with Hindl and examined in Southern hybridizations. The 0.8% agarose gel was transferred to a nylon membrane by vacuum blotting (Vacublot, Pharmacia). The pre-hybridization was carried out for 7 h at 42 ° C in 5 x SSC, 40% formamide, 5 x Denhardt's (Maniatis et al., 1982), 0.1% SDS, 0.25 mg / ml denatured herring sperm DNA, 25 mM NaH ₂ PO ₄ pH 6.5 in a volume of 10 ml per 100 cm ² membrane. After the labeled probe had been added, the mixture was incubated at 42 ° C. for a further 16 h. The blot was washed twice. After autoradiography with Kodak intensifying screen on X-ray film (Xomatic AR, Kodak), only one band was recognizable per restriction digest (approx. 2.2 kb fragment with Sacl, approx. 3.3 kb fragment with Hindlll).

The screening of the cosmid bank was carried out under the same hybridization and washing conditions. One positive colony was found for every 600 colonies tested. A colony was purified and the cosmid DNA isolated from it. The cosmid obtained was called gpdcosl. The inserted genomic Tolypocladium niveum DNA was determined to be approximately 36 kb by restriction digestion. Restriction fragments containing parts of the GAPDH structural gene were identified by hybridizing Southern blots with the screening probe. An approximately 2.2 kb Sαcl restriction fragment gave a clear signal; this corresponded to the fragment size in the Southern hybridizations with genomic DNA. The fragment was cloned into the plasmid vector pUC18 (from Boehringer Mannheim).

For this purpose, approximately 10 μg of gpdcosl DNA were completely cut with Sacl and the 2.2 kb Sacl fragment was eluted from a 0.7% agarose gel. The plasmid vector pUC18 was also restricted with Sacl and treated with alkaline phosphatase from calf intestine (from Boehringer Mannheim) according to the manufacturer's instructions. Approx. 200 ng of purified Sαcl fragment from gpdcosl and pUC18 were ligated with 1 unit of T4 DNA ligase. After transformation into E. coli HB101, the corresponding plasmid was isolated. It was called pGTl and characterized by restriction analysis; a restriction map is shown in Figure 9. In addition, the complete nucleotide sequence of the entire Sαcl fragment was also determined using the Sanger method (Sanger et al., 1977) using Sequenase (USB). The sequence is shown in Figure 10 and comprises 2271 nucleotides).

Example 13: Isolation of cDNA clones of the GAPDH gene from Tolypocladium niveum

In order to construct a cDNA library, the crude RNA was first isolated as described in Example 17. The poly (A ⁺ ) RNA was enriched by an oligo (dT) cell cellulose affinity chromatography as described in Maniatis et al. (1982). For this purpose, the crude RNA was dissolved in water after centrifugation and drying. After chromatography, fractions containing poly (A ⁺ ) RNA were again precipitated with ethanol and stored at -70 ° C. The integrity of the RNA was checked by gel electrophoresis in the presence of formaldehyde, the concentration was determined by UV absorption. 5 μg of the poly (A ⁺ ) RNA were converted into a complementary single-stranded DNA using reverse transcriptase and an oligo (dT) primer in the presence of the four deoxynucleoside triphosphates. A double-stranded molecule was synthesized from it by the enzymes RNaseH and DNA polymerase (Sambrook et al., 1989). After the enzymatic addition of suitable EcoRI adapters, for which polynucleotide kinase and T4-DNA ligase were used, a linear double-stranded cDNA was obtained which could be incorporated into cloning vectors. A cDNA synthesis kit (from Pharmacia) which contained the necessary enzymes and the adapter oligonucleotide was used for these reactions. The reactions were carried out according to the manufacturer's instructions. The synthesized cDNA was cloned into the vector λgtlO (Sambrook et al., 1989). 80 μl of the cDNA preparation were mixed with 16 μl λgtlO-DNA (8 μg), which had previously been cleaved with EcoRI and treated with alkaline phosphatase. After adding 3 μl of 3M sodium acetate (pH 5.2), the DNA was precipitated with ethanol. The DNA was then ligated in 30 mM Tris-Cl pH 7.5, 10 mM MgCl ₂ , 10 mM DTΕ, 2.5 mM ATP after addition of 0.5 U T4 DNA ligase for 16 h at 16 ° C. (DNA Concentration 500 μg / ml). The ligation mixture was packaged in vitro using protein extracts. The resulting λ-lysates were titled with E. coli CόOOhfl (Promega Inc.). About 4.5xl0 ⁵ pfu were obtained. The 665 bp HindIII-HindIII restriction fragment from the plasmid pGTl (see Example 12) was used as the probe for the screning. For this purpose, 10 μg of DNA from pGTl were cut with the restriction enzymes Hindlll and Hindll (from Boehringer Mannheim) according to the manufacturer's instructions and the corresponding restriction fragment was isolated from a 0.8% agarose gel. After labeling with alpha- ³² P-dATP via random primer polymerization (from Stratagene), the fragment was used for hybridization. The pre-hybridization was carried out for 20 h, the hybridization for 18 h at 42 ° C. in 6 × SSC, 50% formamide, 1% SDS, 50 μg / ml herring sperm DNA. The filters were washed 2 x 10 min in 2 x SSC / 0.1% SDS at 25 ° C and 2 x 45 min in 1 x SSC / 0.1% SDS at 60 ° C. The membrane was exposed for 14 hours on X-ray film (Xomatic AR, Kodak). kidney. 2.5 to 3.5% of all plaques showed a strong signal.

Regions with individual such positive plaques were cut out of the plate and cleaned by two further rounds of hybridization with thinner plating analogous to the first. Lambda DNA was isolated using standard methods (Sambrook et al. 1989). The approx. 1.3 kb cDNA inserts from 2 different clones were inserted as EcoRI fragments into the plasmid pUCBM20 (from Boehringer Mannheim) and the phage vector M13mpl8 (from Boehringer Mannheim) according to standard methods. The resulting constructions were pGT4 and pGT5 or Named M13GT4 and M13GT5. Single-stranded DNA was produced using the M13 clones and sequenced from both ends using the Sanger dideoxynucleotide method (Sanger et al., 1977). It was found that the insert from clone M13GT4 has a 33 bp polyA region, with clone M13GT5 2 bp at the 5 'end and 20 bp at the 3' end were missing, as well as the polyA region. A restriction map of the apparently complete cDNA clone pGT4 is shown in Figure 11. The entire nucleotide sequence of the cDNA was determined; it comprised 1333 nucleotides without adapter molecules and is shown in Figure 12. A comparison of the genomic and the cDNA sequence showed the position of two introns, one at the beginning of the Sαcl fragment, as shown in Figure 14. From this it became clear that the promoter region of the GAPDH gene is not contained on the genomic Sαcl fragment from pGTl (see Example 12).

Example 14: Isolation of the promoter region of the GAPDH gene from Tolypocladium niveum

20 μg of DNA from the cosmid clone gpdcosl (see Example 12) were cut together with the restriction enzymes Xhol and SaR. An approximately 1250 bp fragment was identified by Southern hybridization with the 665 bp Hiwdlll-Hi ^' nrfll fragment from pGTl. This was prepared from a 0.8% agarose gel and installed according to standard methods (Sambrook et al., 1989) in the Sα I-cut and dephosphorylated plasmid vector pBluescriptII SK + (from Stratagene) and in the phage vector M13mpl8, which was also treated. The complete nucleotide sequence of the insert was determined using the Sanger method (Sanger et al., 1977). It is shown in Figure 13 and corresponds to the sequence region from bp 1 to 1278 in Figure 14. The comparison of the genomic sequence of the entire present promoter and structural gene region with the cDNA- Sequence showed the location of two introns (Figure 14). The first lies in the 5 'untranslated region from pos. 550 to 664 (115 bp), the second much longer intron lies in the actual structural gene and was located at pos. 802 to 1218 (417 bp). The translation of the cDNA sequence resulted in a 338 amino acid primary sequence of GAPDH from Tolypocladium niveum with a derived molecular weight of 36121.

Example 15: Determination of partial sequences of the alanine racemase gene

The assembled nucleotide sequence of the approximately 1.1 kb Pstl insert in pRPl, the approximately 1.9 kb EcoRI-SalI fragment from pRP6, the approximately 650 bp Pstl HindIII fragment from pRP9, and additionally 511 bp following the Hindlü site is shown in Figure 5 and comprises 3973 nucleotides.

The sequencing was carried out according to the modified dideoxynucleotide method using Sequenase (United States Biochemical) according to the manufacturer's instructions.

Example 16: Comparison of the deduced amino acid sequences

If the nucleotide sequence from example 15 is translated, the region of the amino acid partial sequence as 1750, which also served to derive the screening probe, can be found from item 2557 to item 2610 of FIG. 5:

2557 2610

I I

GCT TGG GCT GAC GAG CAG GAG ATC GCC ATT CAC ATC GAC GGT GCG CGG ATA TGG

ALA TRP ALA ASP GLU GLN GLU ILE ALA ILE HIS ILE ASP GLY ALA ARG ILE TRP

= as 1750

There are also the following additional partial sequences:

2992 3021

I I

TCC ACA CTG GAC ACG GCT GCT CAG CAC CGT

SER THR LEU ASP THR ALA ALA GLN HIS ARG = as 1751

1983 2018

I I

GCA CGT CAT TGG GGA GAT CCC ACT CTC ACT GGC TCA

ALA GLY HIS TRP GLY ASP PRO THR LEU THR GLY SER

• = as 1753

2242

I.

GAA GCA GCT CTG TTT GTT GTG TCC GGG ACC ATG GCC AAC CAG ATT GCC TTA GGA

GLU ALA ALA LEU PHE VAL VAL SER GLY THR MET ALA ASN GLN ILE ALA LEU GLY

2301

I GCG CTG

ALA LEU

= as 1758

The position of the amino acid partial sequences found in the specific sequence region is shown in Figure 6. This results in a location of the gene in Sall -> Hind l direction.

Example 17: Isolation of RNA from the mycelium of Tolypocladium niveum and

Northern hybridization

An 11-Erlenmeyer flask with 100 ml medium 4 (Dreyfuss et al., 1976) was inoculated with a spore suspension of Tolypocladium niveum ATCC34921 (approx. 1x 10 ⁷ spores / ml) and shaken for 96 h at 250 rpm and 25 ° C. An 11-Erlenmeyer flask with 100 ml of medium 5 (Dreyfuss et al., 1976) was inoculated with 10 ml of the preculture and shaken at 25 ° C. and 250 rpm for 7 days. The concentration of cyclosporin A was determined (Dreyfuss et al., 1976). Approx. 100 μg / ml was reached. RNA was isolated from about 6 g of mycelium moist mass; For this purpose, the mycelium was centrifuged off, washed with 40 ml of TE (10 mM Tris-Cl, 1 mM EDTA, pH 7.5) and ground into a fine powder in a friction bowl under liquid nitrogen. RNA isolation was carried out using the slightly modified method of Chomczynski and Sacchi (1987). For this purpose, 1 g of wet mycelium was worked up with 20 ml of RNAzol (from Biomedica) according to the manufacturer's instructions. About 0.7 mg of RNA were obtained per 1 g of moist mycelium, which were stored at -20 ° C. in an ethanol-precipitated manner. 10 μg of the RNA were made up a 1% agarose gel containing 0.6 M formaldehyde, according to the Sambrook et al. (1989) method described. The samples were heated to 95 ° C. for 2 min and separated at constant 70 V for 2.5 h. The gel was shaken three times for 20 min in 2 x SSC, blotted on Duralon UV membranes (from Stratagene) by means of a vacuum and fixed by UV treatment.

The 1078 bp Pstl restriction fragment from the plasmid pRPL (see Example 11) was used as the hybridization probe, and the 665 bp Hindlll-Hindll restriction fragment from the plasmid pGTl (Example 12) was used as the hybridization probe for the GAPDH gene.

For this purpose, about 10 μg of DNA were cut from the plasmids with the corresponding restriction enzymes (Boehringer Mannheim) according to the manufacturer's instructions and the corresponding restriction fragment from a 0.8% agarose gel by means of adsorption on glass beads (Geneclean II, BiolOl ) isolated. After labeling with alpha- ³² P-dATP via random primer polymerization (from Stratagene), the fragment was used for hybridization.

The pre-hybridization was 20 h, the hybridization 18 h at 42 ° C in 6 x SSC, 50% formamide, 5 x Denhardt's (Maniatis et al., 1982), 0.1% SDS, 0.25 mg / ml denatured herring sperm DNA, 25 mM NaH ₂ Pθ ₄ pH 6.5 carried out in a volume of 10 ml per 100 cm ² membrane. The blot was washed twice for 10 min with 2 x SSC / 0.1% SDS at 25 ° C and twice for 30 min with 0.5 x SSC / 0.1% SDS at 60 ° C. After car radiography with Kodak intensifying screen on X-ray film (Xomatic AR, Kodak) for approx. 48-96 h at -70 ° C, a band was visible on the X-ray film both in the case of the alanine racemase gene and of the GAPDH gene .

Example 18: Protoplasting of Tolypocladium niveum

200 ml medium 1 (maltose (monohydrate) 50 g / 1, casein peptone, tryptically digested (Fluka 70169) 10 g / 1, KH ₂ PO ₄ 5 g / 1, KC1 2.5 g / 1 pH 5.6) in an Erlenmeyer flask were mixed with 10 Inoculated ⁹ spores of Tolypocladium niveum ATCC34921 and incubated at 27 ° C, 250 rpm for approx. 70 h. 200 μl (0.1%) of β-mercaptoethanol were added and the mixture was incubated for a further 16 h. The mycelium was harvested by centrifugation (Beckman centrifuge J2-21, rotor JA 14, 8000 rpm, 20 ° C, 5 min), in 40 ml TPS (NaCl 0.6 M, KH ₂ PO ₄ / Na ^ O, 66 mM pH 6.2) washed and the pellet volume measured by centrifugation in calibrated tubes at 2000 g (in Beckman centrifuge GPR, rotor GH3.7, 3000 rpm, 5 min). The mycelium was suspended in TPS (3 ml TPS was used for each 1 ml pellet volume) and the same volume of protoplasting solution was added (Novozym 234 10 mg / ml (Novo Industri, Batch PPM-2415), cytohelicase 5 mg / ml (Fa. IBF), Zymolyase 20T 1 mg / ml (Seikagaku Kogyo, C.No. 120491) in TPS). It was incubated at 27 ° C. and 80 rpm for approx. 60 min. The protoplasts were filtered through milk filters, centrifuged (700 g, 10 min) and taken up in a total of 4 ml TPS. 1 ml each of this suspension was applied to 4 ml of 35% sucrose solution and centrifuged at 600 g, 20 ° C. for 20 min. The protoplast bands at the phase interface were removed, diluted to 10 ml with TPS, centrifuged, carefully resuspended in 200 μl TPS and the suspensions were combined. About 2 x 10 ⁸ protoplasts were obtained per 1 ml pellet volume of starting mycelium (see above).

Example 19: Transformation of Tolypocladium niveum

The protoplast suspension from Example 18 was centrifuged off (700 g, 10 min) and suspended in 1 M sorbitol, 50 mM CaCl ₂ at a density of 1 × 10 ⁸ . In each case 90 μl of this suspension were mixed with 10 μl of the vector DNA to be transformed (1-10 μg, dissolved in Tris-HCl 10 mM, EDTA 1 mM, pH 8.0) and 25 μl PEG 6000 solution (25% PEG 6000 , 50 mM CaCl ₂ , 10 mM Tris-HCl, pH 7.5, freshly prepared from the stock solutions: 60% PEG 6000 (Fa.BDH), 250 mM Tris-HCl pH 7.5, 250 mM CaCl ₂ ). The transformation mixture was placed on ice for 20 min and then a further 500 μl of the mixed PEG 6000 solution were added and mixed thoroughly. After 5 minutes at room temperature, 1 ml of 0.9 M NaCl, 50 mM CaCl _{2 was} added, the whole batch was added to 7 ml of melted soft agar of the corresponding selection medium and heated to 45 ° C. and poured onto appropriate, preheated plates. In the event that the vector DNA to be transformed contains the amdS gene from Aspergillus nidulans, for example plasmid p3SR2 (Hynes et al., 1983), the entire batch was converted into 7 ml of soft agar TMMAAC + which was heated to 45 ° C. Given N and poured onto preheated TMMAAC + N plates. Medium TMMAAC + N contains glucose 6 g / 1, KH ₂ PO ₄ 3 g 1, KC1 0.5 g / 1, MgSO ₄ * 7 H ₂ O 0.4 g / 1, CaCl ₂ * 2 H ₂ O 0.2 g / 1, acrylamide 8 mM, CsCl 2.1 g / 1, trace element solution 1 ml / 1, 0.6 M NaCl; for plates 15 g / 1 for white chagar 7 g / 1 agar agar (Merck) added The trace element solution contains 1 mg / ml FeSO ₄ * 7 H ₂ O, 9 mg / ml ZnSO ₄ * 7 H ₂ O, 0.4 mg / ml CuSO ₄ * 5 H ₂ O, 0.1 mg / ml MnSO ₄ * H ₂ O, 0.1 mg / ml H ₃ BO ₃ and 0.1 mg / ml Na ₂ MoO ₄ * H ₂ O. Transformants were able to use acrylamide as a nitrogen source in the medium and could therefore be identified as colonies against weak background growth after about three weeks at 25 ° C.

For the transformation with the hygromycin resistance gene, the mixture was dissolved in 7 ml TM88-NaCl soft agar (20 g / 1 malt extract, 4 g / 1 yeast extract, 10 g / 1 Bacto agar, 0.6 M NaCl, pH 5.7) (45 ° C) and placed on TM88-NaCl plates (approx. 20 ml TM88-NaCl agar: 20 g / 1 malt extract, 4 g / 1 yeast extract, 30 g / 1 Bacto agar, 0.6 M NaCl, pH 5.7) poured out. After 15-20 h at 25 ° C., 7 ml of TM88-NaCl soft agar with 500 μg / ml hygromycin (Boehringer Mannheim) (45 ° C.) were overlaid. Hygromycin-resistant transformants were detected as colonies on the plates after 7 days at 25 ° C.

Example 20: Construction of the vector pGT24

The following oligonucleotides were derived and synthesized based on the determined nucleotide sequence of the GAPDH gene (see Example 14):

P3 5 'CGACCTCGAGAACATTCGTTGTGCACCGT 3'

P4 5 'GGGGATCCATGGTGTACGCTGCGGAGTTAGCGG 3'

P3 corresponds from its position 5 to 29 to the region from position 1 to 25 of the nucleotide sequence of Figure 14 of the GAPDH gene, ie it contains the natural Xhό interface (CTCGAG); P4 corresponds to the range from pos. 670 to 650 (complementary to the sequence of the GAPDH gene). The first 12 nucleotides of P4 contain the recognition sites for the restriction enzymes Ncol (CCATGG) and BamYR (GGATCC). With the aid of these primers, the region lying between the primers was amplified from the genomic DNA of Tolypocladium niveum (35 cycles: 2 min 95 ° C., 1 min 20 sec 56 ° C., 1 min 20 sec 72 ° C.). The DNA fragment of approximately 680 bp in size was cut after the chloroform extraction and ethanol precipitation with the restriction endonucleases Bam → T and Xhόl (after Information from the manufacturer, Boehringer Mannheim) and incorporated into the likewise prepared plasmid vector DNA pBluescriptII SK + (from Stratagene) according to standard methods. The resulting plasmid was called pGT12 and is shown in FIG. 16. The following oligonucleotides were derived and synthesized analogously from the nucleotide sequence of the GAPDH gene:

P8: 5 'GGGGCGGCCGCCATGGAGAATAGACACG 3'

P9: 5 'CCCCGCGGGCTCΓTCΓTTTTCTGTTG 3'

Items 10 to 28 of primer P8 correspond to items 2301 to 2319 in Figure 14, items 4 to 11 contain a recognition site for the restriction enzyme Notl (GCGGCCGC). Items 9 to 28 of primer P9 correspond to the complementary strand of items 2855 to 2838 in Figure 14, items 3 to 8 represent the recognition site for the enzyme Kspl (CCGCGG). The primers close the range of the suspected Termination area of the GAPDH gene. With their help, as described above, the corresponding DNA fragment was amplified from the genomic DNA from Tolypocladium niveum ^* The corresponding DNA fragment was amplified from the genomic DNA from Tolypocladium niveum. After restriction of this amplified DNA with the enzymes Notl and Kspl (according to the manufacturer, Boehringer Mannheim), the fragment was inserted into the vector pGT12 prepared in the same way by standard methods. The resulting vector plasmid was named pGT14 and is shown in Figure 17

DNA of the plasmid pMAT5 (Mohr, 1988) was completely cut with the enzyme -BαmHI (according to the manufacturer, Boehringer Mannheim) and the approximately 1.1 kb DNA fragment was prepared from the agarose gel after electrophoresis. The plasmid pGT14 was also cut with BamHl and treated with calf intestine using alkaline phosphatase (according to the manufacturer, Boehringer Mannheim). The approximately 1.1 kb large jBα «HI fragment from pMAT5 was ligated in according to standard methods, transformed into E. coli XLl-Blue (Stratagene) and the plasmid DNA of some resulting clones was isolated. The resulting vector plasmid was named pGT24. pGT24 contains the hygromycin resistance gene in the correct orientation to the GAPDH promoter and is in Figure 8 shown.

Example 21: Destruction of the Alanine Racemase Gene in Tolypocladium niveum

The approximately 835 bp EcoRI-PstI fragment from pRPl was inserted into the plasmid vector pUCBM20 (from Boehringer Mannheim) analogously to the procedure shown in Example 11, the constructed plasmid was called pRP12 and is shown in Figure 7 Plasmid pGT24 used, which contains the hygromycin resistance gene under the control of the Tolypocladium niveum GAPDH gene. Together with this DNA, equimolar amounts of pRP12 DNA were also used in the same transformation approach. These cotransformations were carried out according to the method described in Example 19, using Tolypocladium niveum ATCC 34921 as the starting strain.

Genomic DNA from hygromycin-resistant transformants was isolated using a rapid method. For this purpose, the mycelium was removed from an area of approximately 1 cm ^{2 in} the corresponding colony and transferred to Εppendorf homogenizers. 1 ml of lysis buffer (50 M EDTA, 0.2% SDS) and 100 mg of aluminum oxide (type A%, from Sigma) were added and homogenized well for about 5 minutes. After centrifugation (5 min, 11,000 rpm), the supernatant was extracted once with tris-saturated phenol, phenol / chloroform (1: 1) and chloroform / isoamyl alcohol (24: 1) and the DNA was precipitated with isopropanol according to the standard procedure ( Sambrook et al., 1989).

The DNA was completely restricted with the restriction enzyme SaR, separated by gel electrophoresis and examined in Southern hybridizations. The 0.8% agarose gel was transferred to a nylon membrane (Duralon-UV, from Stratagene) by means of vacuum blotting (Vacublot, from Pharmacia) and fixed by UV. The pre-hybridization was carried out for approx. 8-16 h at 42 ° C in 6 x SSC, 50% formamide, 5 x Denhardt's (Maniatis et al., 1982), 0.1% SDS, 0.25 mg / ml denatured herring sperm DNA, 25 mM NaH ₂ PO ₄ pH 6.5 carried out in a volume of 10 ml per 100 cm ² membrane. After adding the labeled probe, the mixture was incubated at 42 ° C. for a further 16-20 h. The blot was washed twice for 10 min with 2 x SSC / 0.1% SDS at 25 ° C and twice for 30 min with 0.5 x SSC / 0.1% SDS at 60 ° C. After autoradiography with Kodak intensifying screen on X-ray film (Xomatic AR, Kodak) for approx. 48-96 h at -70 ° C, bands were found visible on the x-ray film.

Most of the DNAs examined showed the signal of the native approximately 2.9 kb SaR fragment, which contains the approximately 835 bp EcoRI-PstI fragment (Figure 1). About 60 - 70% of the DNAs also showed additional bands, which are due to non-homologous integrations of the plasmid pRP12. In addition to these types of transformant DNAs, there were also isolated DNAs that no longer had the signal of the native Sα / I fragment. In such strains, the alanine racemase gene has been destroyed by integration of the plasmid pRP12.

Strains verified in this way were examined in test fermentations in the shake flask for cyclosporin A formation, as described by Dreyfuss et al. (1976). While cyclosporin A was still formed in the experiments carried out in parallel with the untransformed and intact starting strain Tolypocladium niveum ATCC 34921, in experiments with those strains in which the alanine racemase gene was destroyed, practically no more cyclosporin A could be detected (<5 mg /1).

Example 22: Cotransformation with Lambda RAC4

Analogously to example 21, the transformation vector pGT24 was used. Together with this DNA, equimolar amounts of lambda RAC4 (example 10) were also used in the same transformation approach. Tolypocladium niveum ATCC 34921 was used as the starting strain for these cotransformations.

Genomic DNA from hygromycin resistant transformants was isolated and examined by Southern hybridizations as described in Example 21. As a probe for the hybridizations, restriction fragments of the Lambda DASH II gene bank vector were labeled with alpha ³² P dATP by "random primer" labeling (from Stratagene). Some of the examined DNAs showed hybridization signals which are due to integration of Lambda RAC4. Transformant strains verified in this way were examined in a test fermentation in a shake flask for cyclosporin A formation, as described by Dreyfuss et al. (1976). While in the experiment carried out in parallel with the non-transformed starting strain Tolypocladium niveum ATCC 34921 approx. 90-100 μg / ml cyclosporin A was formed, in the experiment with the strain in which additional copies of the alanine racemase gene could be obtained by integrating Lambda RAC4 150 μg / ml cyclosporin A are present.

Example 23: Preparation of 8-D-serine cyclosporin A by strains with a destroyed gene for the alanine racemase

Strains of transformants in which the alanine racemase gene had been destroyed by integration of the plasmid pRP12 by the method described in Example 21, and the starting strain Tolypocladium niveum ATCC 34921, were investigated in shake flask fermentations in which D-serine was offered in the medium. For this purpose, 100 ml of preculture medium (75 g / 1 glucose, 10 g / 1 peptone, 250 mg / 1 KH ₂ PO ₄ , 1.5 g / 1 KCl, pH 7.4) were placed in 500 ml Erlenmeyer flasks with approx. 10 ⁷ spores of the corresponding one to be examined Inoculated strain and incubated for 4 to 7 days at 27 ° C and 200 rpm. Based on this, 20 ml of main culture medium (40 g / 1 glucose, 40 g / 1 fructose, 10 g / 1 peptone, 5 g / 1 KH ₂ PO ₄ , 2 g / 1 KCl, 5 g / 1 DL-2-aminobutyric acid, 4 g / 1 D-serine, pH 5.5) inoculated with 2 ml of preculture and fermented under the same conditions for a further 7-20 days. The cyclosporin A (CyA) and 8-D-serine cyclosporin A. (DSA) formed were determined. It was found that the starting strain Tolypocladium niveum ATCC 34921 forms about 50 mg / 1 CyA and less than 5 mg / 1 DSA under these conditions. An investigated "gene disruption" strain from example 21, on the other hand, formed <5 mg / 1 CyA and approx. 60 mg / 1 DSA.

Example 24: Transformation of Tolypocladium niveum with pGT24

DNA of the plasmid pGT24 was used for the transformation as described in Example 19. As a result, obtained hygromycin-resistant Tolypocladium m ^'vewm colonies numerous. This confirmed that the gene incorporated into the expression vector pGT14 (hygromycin resistance gene from E. coli) was expressed efficiently. By isolating the DNA of such transformants, restricting the DNA, for example using βαmHI, electrophoresis and blotting on nylon membranes (according to standard techniques, Sambrook et al., 1989), hybridization with the approximately 1.1 kb -βαmHI fragment was able to confirm that the Plasmid pGT24 is present one or more times in the genome. Example 25: Construction of the vector pGT30

Based on the DNA sequence shown in Figure 13, an oligonucleotide was synthesized which has the following sequence:

5'GG ATC GAT TTT GTA CGC TGC GGA GTT AGC 3 '

Positions 9 to 29 of this oligonucleotide are complementary to the sequence shown in Figure 13 (positions 652 to 672); it therefore covers the area immediately before the start codon. The first eight positions correspond to a C / αl recognition region (ATCGAT). A second oligonucleotide has the sequence:

5 'GG ACTAGTACCTTGTTGGAGTGGTGAGAT3'

This corresponds to positions 62 to 82 of the nucleotide sequence in Figure 13. The first eight nucleotides contain a Spel recognition region. 20 ng of DNA from Tolypocladium niveum was amplified with the oligonucleotides described above (Sambrook et al., 1989): 30 cycles: 1 min 30 sec 94 ^° C.; 2 min 30 sec 55 ° C; 6 min 72 ° C. A DNA of approximately 620 bp was produced. After chloroform extraction, this DNA was purified by ultrafiltration (Ultrafree MC 100,000; Millipore) and cleaved in the appropriate buffer with the Spei and Clal enzymes. 50 ng of this DNA were ligated with 50 ng Spei and C / αl-cleaved DNA of the plasmid pCSN44 (Stäben et al., 1989). A restriction map of this plasmid (pGT30) is shown in Figure 18.

Example 26: Transformation of Tolypocladium niveum with pGT30

The plasmid pGT30 can be used to transform Tolypocladium niveum, as described in Example 19. DNA from such transformants was cleaved with -BαmHI and blotted onto a nylon membrane after gel electrophoresis. The 0.6 kb Spe / -C / α / fragment from pGT30 was used as the radioactive probe. In this way, transformants can be identified in which the plasmid pGT30 is integrated one or more times in the genome. Example 27: Sequencing of cDNA and localization of the structural gene

As can be seen from the comparison of the partial amino acid sequences (see Example 16), the reading frame changes between the sequences coding for asl758, which suggests an intron. RNA was therefore isolated and checked for the presence of the alanine racemase transcript by Northern hybridization (see example 17). The first strand synthesis was carried out using an adapter primer (5'-GGCCACGCGTCGACT (T) ₁₇ ) (from GIBCO BRL) and then with the primers S 11 (5'-ATTGGGGAGATCCCACTCTC, items 1990 - 2009, (Figure 20)) and PRP8 / 6 (5'-ACCGCAAAGGACTTTGACTTGCCT, pos. 3145 - 3122, (Figure 20)) the corresponding region was amplified, the DNA fragments purified, cloned into the plasmid vector pGEM-T (from PROMEGA) and the DNA of verified clones also sequenced. In this way the complete sequence between asl753 and asl751 from cDNA was completed. A comparison against the genomic sequence showed that there is an intron of 76 bp at pos. 2035-2110.

Isolated RNA (see Example 17) was used to carry out 5'-RACE experiments using a kit (from GIBCO BRL). The oligonucleotide 5 '-CUACUACUACÜAGGCCACGCGTCGACTAGTACGGGIIGGGπGG-GIIG was used as the "anchor primer". S7 (5'-CTCGTCAGCCCAAGCCTT, items 2571 - 2554 (Figure 20)) and S10 (5'-ACAACAAACAGAGCTGCTTC, items 2261 - 2243 (Figure 20)) were used as gene-specific primers. The fragments obtained were cloned into the plasmid vector pGEM-T (from PROMEGA) and sequenced. A total of 32 independent clones were characterized. As the result in Figure 21 shows, 3 different starts were found. If one wants to use the total number of 32 individual clones for a statistical evaluation, then 75% start at pos. 8, 16% at pos. 14 and 9% at pos. 26. The positions refer to the postulated ATG translation start codon (see below).

Analogously, the end of the transcript was examined by 3'-RACE experiments (GIBCO BRL). PRP8 / 2 ((5'-AGGCAAGTCAAAGTCCTTTGCGGT, item 3122 - 3145 (Figure 21)) and S13 (5'-CTCAGCACCGTGACATACGC, item 3011 - 3030 (Figure 21)) were used as gene-specific primers. A total of 12 clones were sequenced , the 3 'ends of which are shown in Figure 23. All sequenced messengers wear a polyA tail. Its length is between 16 and 43 nucleotides.

Figure 20 shows the sequence of the alanine racemase gene region. The first ORF methionine codon is at item 1953. However, this is also the only Met codon that can be used on the sequenced transcript, since the partial sequence was found 9 codons later than 1753. After splicing the intron, there is a continuous open reading frame that ends at item 3178. It contains 383 codons (amino acid sequence see Figure 20). The molecular weight of the derived protein is 41002 Da.

Analysis of the sequence region above the structural gene for promoter elements revealed two options. Either a very distinctive TATA region at around -146. the distance from the experimentally found transcription starting points is somewhat large, but still within the usual scope. The CAAT box at approx. -200 would also fit very well from a distance. In the case of the TATA box at approx. -60 with the matching CAAT box at -121, the distances to the transcription start points (-8, -14, -26) match the expectations very well.

Literature list:

Badet B., Roise D. and Walsh C: Inactivation of the dadB Salmonella typhimuήum alanine racemase by D and L isomers of ß-substituted alanines: Kinetics, stoichiometry, active site peptide sequencing, and reaction mechanism. Biochemistry 23 (1984) 5188-5194.

Badet B. and Walsh C: Purification of an alanine racemase from Streptococcus faecalis and analysis of its inactivation by (l-aminoethyl) phosphonic acid enantiomers. Biochemistry 24 (1985) 1333-1341.

Cannon P.F .: International Commission on the taxonomy of fungi (ICTF): name changes in fungi of microbiological, industrial and medical importance. Part 2. Microbiological Sciences 3 No. 9 (1986) 285-287.

Cathala G., Savouret J.F., Mendez B., West B.L., Kavin M., Martial J. and Baxter J.D .: A method for isolation of intact translationally active ribonucleic acid. DNA 2 (1983) 329-335.

Chomczynski P. and Sacchi N .: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.Bioche. 162 (1987) 156-159.

Cryer D.R., Eccleshall R. and Marmur J .: Isolation of yeast DNA. Method in Cell Biology XII (1975) 39-44.

Dreyfuss M., Harri E., Hofmann H., Kobel H., Pache W. and Tscherter H .: Cyclosporin A and C. European J. Appl. Microbiology 3 (1976), pp. 125-133.

Evans G.A., Lewis K. and Rothenberg B.E .: High efficiency vectors for cosmid microcloning and genomic analysis. Gene 79 (1989) 9-20.

Gurr S.J., Unkles S.E. and Kinghorn J .: The structure and organization of nuclear genes of filamentous fungi. In: Kinghorn J.R. (Ed.): Gene structure in eukaryotic microbes. IRL Press, Oxford 1987.

Esaki N. and Walsh C: Biosynthetic alanine racemase of Salmonella typhimurium: Purification and characterization of the enzyme encoded by the alr gene. Biochemistry 25 (1986) 3261-3267.

Ferrari E., Henner DJ. and Yang MY: Isolation of an alanine racemase gene from Bacillus subtilis and its use for plasmid maintenance in B. subtilis. Biotechnology 3 (1985) 1003-1007. Galakatos NG, Daub E., Botstein D. and Walsh C: Biosynthetic alr alanine racemase from Salmonella typhimurium: DNA and protein sequence determination. Biochemistry 25 (1986) 3255-3260.

Holland J.P. and Holland M.J .: Structural comparison of two nontandemly repeated yeast glyceraldehyde-3-phosphate dehydrogenase genes. J.Biol.Chem. 255 (1980) 2596-2605.

Hynes M.J., Corrick CM. and King J.A .: Isolation of genomic clones containing the amdS gene of Aspergillus nidulans and their use in the analysis of structural and regulatory mutations. Molec.Cell.Biol. 3 (1983) 1430-1439.

Inagaki K., Tanizawa K., Badet B., Walsh C, Tanaka H. and Soda K .: Thermostable alanine racemase from Bacillus stearothermophilus: Molecular cloning of the gene, enzyme purification, and characterization. Biochemistry 25 (1986) 3268-3274.

Inagaki K., Tanizawa K., Tanaka H. and Soda K .: Purification and characterization of amino acid racemase with very broad Substrate specificity from Aeromonas caviae. Agric. Biol. Chem. 51 (1987) 173-180.

Kimura H., Sumino Y. and Suzuki M .: Cloning and sequencing of the putative glyceraldehyde-3-phosphate dehydrogenase gene from Cephalosporium acremonium and its application to heterologous gene expression. J.FermentBioeng. 71: 145-150 (1991).

Retail purchase H. and v. Döhren H .: Nonribosomal biosynthesis of. peptide antibiotics. Eur. J. Biochem. 192 (1990) 1-15.

Kück U., Walz M., Mohr G. and Mracek M .: The 5 '-sequence of the isopenicillin N- synthetase gene (pcbC) from Cephalosporium acremonium directs the expression of the prokaryotic hygromycin B phosphotransferase gene (hph) in Aspergillus niger Appl.Microbio Biotechnol. 31: 358-365 (1989).

Lämmli U.K .: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970) 680-685.

Lawen A., Traber R., Geyl D., Zocher R. and Kleinkauf H .: Cell-free biosynthesis of new cyclosporins. J. Antibiotics 42 (1989) 1283-1289.

Lawen A., Dittmann J., Schmidt B., Riesner, D. and Kleinkauf H .: Enzymatic biosynthesis of cyclosporin A and analogues. Biochimie 74 (1992) 511-516.

Lawen A. and Zocher R .: Cyclosporin Synthetase. The most complex peptides synthesizing multienzyme polypeptides so far described. J. Biol. Chem. 265 (1990) 11355-11360. Maniatis T., Fritsch EF and Sambrook J .: Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor 1982.

Maxam A.M., and Gilbert W .: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods in Enzymology 65 (1980) 499-560.

Mohr, G .: Fundamentals, applications and possibilities of strain improvement of biotechnologically relevant hyphae through genetic engineering: integrative transformation of Aspergillus niger. Dissertation Ruhr University Bochum (1988).

Peberdy J.F .: Fungal Protoplasts. In: Bennett J.W. and Lasure L.L. (Eds): More gene manipulations in fungi. Acad.Press Inc., San Diego, 1991.

Pfitzner A .: Cloning of two glycolysis genes from Penicillium chrysogenum. Dissertation Technical University Vienna (1989).

Punt P.J., Dingemanse M.A., Jacobs-Meijsing B.J.M., Pouwels P.H. and van den Hondel C.A.M.J.J .: Isolation and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. Gene 69 (1988) 49-57.

Roise D., Soda K., Yagi T. and Walsh C: Inactivation of the Pseudomonas striata broad specificity amino acid racemase by D and L isomers of ß-substituted alanines: Kinetics, stoichiometry, active site peptide, and mechanistic studies. Biochemistry 23 (1984) 5195-5201.

Sambrook J., Fritsch E.F. and Maniatis T .: Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989.

Sanger F., Nickier S. and Coulson A.R .: DNA sequencing with chain-terminating inhibitors. Proc.Natl.Acad.Sci.USA 74 (1977) 5463-5467.

Schmidt B., Riesner D., Lawen A. and Kleinkauf H .: Cyclosporin synthetase is a 1.4 MDa multienzyme polypeptide. FEBS Letters 307 (1992) 355-360.

Stäben C, Jensen B., Singer M., Pollock J., Schechtman M., Kinsey J. and Selker E .: Use of a bacterial hygromycin B resistance gene as a dominant selectable marker in Neurospora crassa transformation. Fungal Genetics Newsletter 36 (1989) 79.

Tanizawa K., Ohshima A., Scheidegger A "Inagaki K., Tanaka H. ans Soda K .: Thermostable alanine racemase from Bacillus stearothermophilus: DNA and protein sequence determination and secondary structure prediction. Biochemistry 27 (1988) 1311-1316.

Thornberry NA, Bull HG, Taub D., Greenlee WJ, Patchett AA and Cordes EH: 3-Halovinylglycines. Efficient irreversible inhibitors of E. coli alanine racemase. J. Am. Chem. Soc. 109 (1987) 7543-7544.

Walsh C, Badet R., Daub E., Esaki N. and Galakatos N .: Bacterial alanine racemases: Targets for antibacterial agents. Spec. Publ. - R. Soc. Chem. 55 (1985) 193-209.

Wang E. and Walsh C: Suicide Substrates for the alanine racemase of Escherichia coli B. Biochemistry 17 (1978) 1313-1321.

Wartburg A. v. and Traber R. Chemistry of the natural cyclosporin metabolites, in: Ciclosporin (Borel JF, ed., series Progress in Allergy, Ishizaka K., Lachmann PJ, Kallόs P. and Waksman BH, eds.), Karger Verlag 1986, 28- 45.

Wasserman S.A., Daub E., Grisafi P., Botstein D. and Walsh C: Catabolic alanine racemase from Salmonella typhimurium: DNA sequence, enzyme purification, and characterization. Biochemistry 23 (1984) 5182-5187.

Wood W.I., Gitschier J., Lasky L.A. and Lawn R.M .: Base composition-independent hybridization in tetramethylammonium Chloride: A method for oligonucleotide screening of highly complex libraries. Proc.Natl.Acad.Sci. USA 82 (1985) 1585.

The content of the cited references is hereby inserted as a reference in the application.

Used abbreviations:

μCi microcurie μg microgram μl microliter μm micrometer μM micromolar amdS acetamidase gene

ACV aminoadipyl-cysteinyl-valine

ATCC American Type Culture Collection

ATP adenosine triphosphate as amino acids, amino acid sequence bp base pairs cDNA complementary deoxyribonucleic acid

DAO D-amino acid oxidase

DNA deoxyribonucleic acid

DTE dithioerythritol

DTT dithiothreitol

E. coli Escherichia coli

EDTA ethylenediaminetetraacetic acid

FIGE Feldin version gel electrophoresis

FPLC Fast Performance Liquid Chromatography g grams

(g / v)% weight / volume in% gv% weight / volume in%

GAPDH glyceraldehyde-3-phosphate dehydrogenase

GBq Giga-Bequerel gpdA gene for the GAPDH h hours

HEPES N-2-hydroxyethyl-piperazine-N-2-propanesulfonic acid

HP-RPC High Pressure - Reversed Phase Chromatography kb Kilobase; 1000 nucleotides kDa kilodalton

1 liter

LDH lactate dehydrogenase

MBq Mega-Bequerel mg milligrams min minutes ml milliliters mM millimolar

MOPS 3-morpholinopropanesulfonic acid

M, relative molar mass mRNA messenger ribonucleic acid mU milli-units

NADH Nicotinamide adenine dinucleotide, reduced ng nanogram nm nm

PEG polyethylene glycol pfu plaque-forming units pH pH

Pos position

RNA ribonucleic acid

SDS sodium dodecyl sulfate

SDS-PAGE SDS-polyacrylamide gel electrophoresis sec seconds

SSC 150 mM NaCl, 15 mM sodium citrate, pH 7.0

SSPE 180 mM NaCl, 10 mM sodium phosphate, 1 mM EDTA, pH 7.7

TE 10mM Tris-Cl pH 7.5, 1mM EDTA

TM medium melting range

Tricin N-tris (hydroxymethyl) methylglycine

Tris Tri s (hydroxymethyl) aminomethane

Rpm revolutions per minute

V volume

(v / v)% volume percent

° C degrees Celsius

In addition, the abbreviations customary for restriction endonucleases were used (Sau3A, Hindlll, EcoRI, Hindlll, Clal, ..; Maniatis et al., 1982). The nucleotide abbreviations A, T, C, G were used for DNA sequences and the amino acid abbreviations (Arg, Asn, Asp, Cys, ..; or R, N, D, C, ...) were used for polypeptides ( Sambrook et al., 1989).

Claims

Expectations:

1. Isolated or recombinant nucleotide sequence which codes for a eukaryotic enzyme, or a fragment thereof, which has alanine racemase activity.

2. Isolated or recombinant nucleotide sequence according to claim 1, which codes for alanine racemase from Tolypocladium niveum ATCC 34921 or codes for an enzyme which has alanine racemase activity and is at least 70% homologous thereto.

3. An isolated or recombinant nucleotide sequence according to claim 1 or claim 2, which has a restriction map, as shown in Figure 6.

4. An isolated or recombinant nucleotide sequence according to claim 3, which comprises either the complete nucleotide sequence as shown in Figure 5 or a fragment thereof which has alanine racemase activity.

5. Isolated nucleotide sequence that hybridizes to a nucleotide sequence according to claim 4.

6. nucleotide molecule containing an isolated nucleotide sequence according to one of claims 1 to 5.

7. Vector containing an isolated nucleotide sequence according to one of claims 1 to 6.

8. Vector according to claim 7 in the form of a plasmid, a cosmid, a PI vector or a YAC vector.

9. host cell which carries a vector according to one of claims 7 or 8.

10. A method for producing alanine racemase by culturing a host cell according to claim 9 and causing the host cell to express alanine racemase.

11. Alanine racemase produced by means of a method according to claim 10.

12. A method for producing a cyclosporin derivative containing a selected amino acid other than D-alanine at position 8 by deactivating that part of the genomic DNA of a cyclosporin-producing host which codes for alanine racemase

Cultivation of the cyclosporin-producing host in a fermentation broth containing the selected amino acid and - if necessary, cause the cyclosporin-producing host to produce the cyclosporin derivative.

13. Process for the preparation of a cyclosporin derivative which contains a selected amino acid in position 8 which is different from D-alanine by transforming a cyclosporin-producing host with a vector which effects the biosynthesis of the selected amino acid

optionally deactivating that part of the genomic DNA of a cyclosporin-producing host which codes for alanine racemase

- Cultivation of the cyclosporin-producing host with the motivation to produce the selected amino acid and the cyclosporin derivative.

14. A method for improving the production of a cyclosporin by transforming a cyclosporin-producing host with a vector according to claim 7 or 8 and

- causing the host cell to express alanine racemase.

15. Isolated DNA from Tolypocladium niveum, which codes for the enzyme glyceraldehyde-3-phosphate dehydrogenase and optionally contains the promoter region and / or the termination region of the gene.

16. Isolated DNA according to claim 15, which has all or only parts of the following sequence (coding strand):

1 CTCGAGAACATΓCGTTGTGCACCGTGCTGGAGCTACCGATGGGGTTGTCGTTAGCGGGAC

61 AACCTTGTTGGAGTGGTGAGATCACCCGCTGTGGCTTCAACCACTGGGAGCTGCGGGCAG

121 CGGCGTGCCGCGAGAGGGTTGGACAGCGTCGCACAGGTGCCACCGGCGTGGTCAAGGAAG

181 GCC AGGTCGCCCTTCTGCTGCTGGTCCC AAAA AT AGTCC A ATGC AATATGTGCCTC ATCC

241 GATGCCGCCTTGGTGTTTTAGGTGCTGACGTGCCGTCCATGTTCGTAGCAGGTCTACGGA ^'

301 GTACTCCAGCAAGTCCAGGTAGGCAAAGGTAATTATGTAACCTAGGTGCTACGTAAGGGA

361 GTCGCAATATCCATCCGTCGCGCCTCCCCTCCTCGGAGCTGCCACCCACGCCTCCATGCT

421 AGTTAGGAGGTACCTACATATTATTTTTCCCTGTCCCTCCCCTCCCTCCGTCCTTTCTCT

481 TCCTTTTCCTCCTCCCC ATACC ACCCCCTC ACG AG AACCTC ATCCTCGCTATCC AGTCCC

541 A ACCTTCCGGTACGTACGCGACGCAGCTTTCGCCCTGG ACGGGCG AGAGCTCCTCTTGCC

601 CCGCCTGCGAAGCTTGCTTGCCCTCTGCCGCTCCGGCGTCGAAGCTCCCCCGCTAACTCC

661 GCAGCGTACAAAATGGCTCCCATCAAGGTCGGCATCAACGGCTTCGGTCGCATTGGCCGT

721 ATCGTCTTCCGCAACGCCGTCGAGCACCCCGATATCCAGGTCGTCGCCGTCAATGACCCC

781 TTC ATCG AG ACC AAATACGCTGTGAGTTTTTGCCGGTTGCTGCTGCCCCTCCCCCTCCCC

841 CTCCTTG ACC ATCCTTGCCCCTCCTTTTGGCCGCAATCGCCCCCAAC ACGCCTCAACAAC

901 ACCACCGTCACCCCGCCGTCATGGAATTTTCTGGCCACGCTATGCTGCCCCTCCATGATA

961 TCATCAATGAGCGACGCACCACCAGCTTCACAATTGCTCGTGGTGCGCTCTATTCAATTC 1021 GTGAGAGATGCAACGGCATTGCAGCATTGCCAGCAGTTCCTCCCCGCTCCATTGATGCGG 1081 CCAAGGCGCCTGGCCC AGTCTTGCTTTCTCATGTCAAGCAG ACGGGG AACCGCCATAAAT CACAATCTCATCAGCCAATTCACCACATCTATGCTTTCCGCGCAGTATGCTGACCTCCGT 1141 1201 1261 CTCTTCTCCACGCCATAGGAGTACATGCTCAAGTATGACTCCTCCCACGGTAACTTCAAG GGCGACATCGCCGTCGACGGCAACGACCTGGTTGTCAACGGCAGCAAGGTCAAGTTCTAC TCCGAGCGCGACCCCGCCGCCATCCCCTGGAAGGACACTGGCGCCGACTACATCGTCGAG 1321 1381 1441 TCCACTGGTGTCTTCACCACCACCGACAAGGCCAAGGCTCACTTGGTTGGCGGTGCCAAG AAGGTCATCATCTCGGCTCCCTCTGCCGATGCCCCCATGTACGTAATGGGCGTCAACGAG AAGACCTACGACGGCAAGGCCGATGTCATCTCCAACGCCTCGTGCACCACCAACTGCCTG 1501 1561 1621 GCTCCCCTCGCCAAGGTCATCCACGACAAGTTCACCATTGTTGAGGGTCTTATGACCACC GTCCACTCCTACACCGCCACCCAGAAGACCGTTGACGGCCCCTCCGGCAAGGACTGGCGC GGTGGCCGTGGTGCTGCCCAGAACATCATCCCCAGCAGCACTGGCGCCGCCAAGGCCGTC 1681 1741 GGC AAGGTCATCCCCG ACCTCAACGGCAAGCTC ACCGGCATGTCCATGCGTGTGCCCACT GCCAACGTCTCCGTCGTTGACCTGACTGTCCGCACCGAGAAGCCCGCCAGCTACGAGGCC 1801 1861 ATC ACC AAGGCGGCCATC AAGG AAGCCGCC AACGGTCCCCTCAAGGGCATCCTCGCCTAC 1921 GAGGACGACATCGTCTCCAGCGACATGAACGGCAACACCAACTCCTCCATCTTCGATGCC 1981 AAGGCCGGCATCTCCCTCAACGACCACTTCGCCAAGCTGGTCTCCTGGTACGACAACGAG 2041 TGGGGCTACTCCCGCCGTGTCCTCGACCTCCTGGCCTACATTGCCAAGGTTGATGCTGGC 2101 AAGTAAATGCTGCCTATTGCAGGAAAGCCAGTAGGGCGAAAACTGGTTGGTGGCTAGTGG 2161 CCGAGAGACTGAATCAATATGAAATGCTCGCACCTATTTTCGGTCGAGAAATTATCAGTA 2221 CTCGGAAGAACACACATTCAAGTACATCCTCCGGGGGTGGAGCAGTGGAAATATGTTCCC 2281 CGGAGCAATGGTTTAGTGTAGCCATGGAGAATAGACACGCCCGTCCATCCACATGTACTG 2341 TGTCCCGTCGCATG A AAGCGCTCTGTGACATGAGTCAAGC ACGTATTC ATTGCATCGTTT 2401 CATGTTCATGTTTTGCCATTTCATCTGAGCTAGGTATCTAACCTGTGAACTCCTGCGTGA 2461 ATGCCCGCCGTCCTGGCCATTTCGACCTTTGACGCCAGAACACCAGCTCAGGCTCTGACT 2521 GTGCATGTATAAGCAAGTAGCGGCCGTGCCTCCGCTTTTCTGTAGATCTGGTCATTATAG 2581 ACGATCCATTACCGCGTCTCGCGATTATGATCCATCCTGCTCGTGCTGTTGATCGATGCG 2641 TCGGG AACA ATA AA AG AGGCG ATTTGTC AAAA ATAG AGTCG ATA ATAAGCCGGCG A AG AG 2701 AAGAAGACCCAAAATCCTCTAGGTAGGAGAAAAAAGAAAACGGAAAAAAGAGAAAGTATT 2761 TGTCCTGCTCGGCCGGCAGTGCGTCGTGGGCCGAGGGGGTGGGATATCATCA CGTACATG 2821 TACAACAAAAACGGGAACAACAGAAAAAGAAGAGCTC

17. Recombinant DNA molecule containing DNA according to claims 15 or 16.

18. Fungus transformed with a recombinant DNA molecule according to claim 16 or a fragment thereof.