EP0654077A1 - Method and reagent for treatment of animal diseases - Google Patents
Method and reagent for treatment of animal diseasesInfo
- Publication number
- EP0654077A1 EP0654077A1 EP93918144A EP93918144A EP0654077A1 EP 0654077 A1 EP0654077 A1 EP 0654077A1 EP 93918144 A EP93918144 A EP 93918144A EP 93918144 A EP93918144 A EP 93918144A EP 0654077 A1 EP0654077 A1 EP 0654077A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- ribozyme
- rna molecule
- rna
- ribozymes
- enzymatic rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6489—Metalloendopeptidases (3.4.24)
- C12N9/6491—Matrix metalloproteases [MMP's], e.g. interstitial collagenase (3.4.24.7); Stromelysins (3.4.24.17; 3.2.1.22); Matrilysin (3.4.24.23)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/121—Hammerhead
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/122—Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/123—Hepatitis delta
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/126—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes involving RNAse P
Definitions
- This invention relates to methods for inhibition of various animal diseases, including: a) inflammatory disease, in particular the inhibition of genetic expression which leads to the reduction or elimination of immune cell proliferation in inflammation or pre- inflammatory conditions; b) osteoarthritis, in particular, inhibition of genetic expression which leads to a reduction or elimination of extracellular matrix digestion by matrix etalloproteinases; c) a stenotic condition, in particular the inhibition of genetic expression which leads to the reduction or elimination of cellular proliferation in the areas of restenotic plaques; and d) cardiovascular disease such as hypertension, and in particular, those mediated by angiotensin converting enzyme activity.
- Inflammatory disease in particular the inhibition of genetic expression which leads to the reduction or elimination of immune cell proliferation in inflammation or pre- inflammatory conditions
- osteoarthritis in particular, inhibition of genetic expression which leads to a reduction or elimination of extracellular matrix digestion by matrix etalloproteinases
- a stenotic condition in particular the inhibition of genetic expression which leads to the reduction or elimination of cellular proliferation in the areas of rest
- Inflammation is a tissue reaction to irritation, infection or injury marked by localized heat, swelling, redness, pain and sometimes loss of function.
- the afflicted cells synthesize and/or release chemicals (cytokines and cellular adhesion molecules) which attract lymphoid cells and accelerate cell growth which is required for healing.
- the infiltration of lymphoid cells to the wound leads to the release of more biological response modifying molecules, which include vasoregulatory substances such as bradykinin and immunoregulatory molecules exemplified by the interleukin family of proteins.
- vasoregulatory substances such as bradykinin and immunoregulatory molecules exemplified by the interleukin family of proteins.
- a persistent inflammatory condition may be acute or chronic and is generically referred to as inflammatory disease.
- Inflammatory disease is exemplified by psoriasis, which is a skin disease caused by excessive growth of basal keratinocytes in the epidermis. It is believed that this uncontrolled growth of the keratinocytes results from stimulation by infiltrating T-cells.
- the conversion of normal skin to a psoriatic lesion is initiated by injury to the tissue and subsequent recognition of the injury by circulating immune cells.
- An acute inflammatory reaction ensues and results in the release of various cytokines and growth factors, including tumor necrosis factor alpha
- TNF- ⁇ interleukin-1
- IL-1 interleukin-1
- Induction of the acute phase inflammatory reactants results in the production of IL-1 and TNF-alpha; both of these molecules induce the appearance of the T-cell homing proteins, I-CAM, ELAM-1 and VCAM-1 on the cell surface of keratinocytes.
- TNF- ⁇ also induces the production of TGF- ⁇ , IL-6 and IL-8 by the keratinocytes.
- the cytokines and growth factors produced by the keratinocytes and infiltrating leukocytes cause uncontrolled keratinocyte proliferation. As the basal layer keratinocytes proliferate, the suprabasal keratinocytes are pushed closer to the surface of the skin where they normally form the cornified envelope layer and the stratum corneum.
- the abnormal rate of proliferation by the basal keratinocytes results in improper formation of the epidermis and stratum corneum and the ultimate development of the red, scaly appearance which is characteristic of psoriatic skin.
- the lack of keratinocyte growth regulation has been attributed to an unidentified mutation in a single gene or group of genes in which the keratinocytes no longer respond to the termination signal for wound healing.
- corticosteroids There are 3 million patients in the United States afflicted with psoriasis. The available treatments for psoriasis are corticosteroids. The most widely prescribed are TEMOVATE (clobetasol propionate) , LIDEX (fluocinonide) , DIPROLENE (betamethasone propionate) , PSORCON (diflorasone diacetate) and TRIAMCINOLONE formulated for topical application. The mechanism of action of corticosteroids is multifactorial and probably not due to simple inhibition of cell replication. This is a palliative therapy because the underlying cause of the disease remains, and upon discontinuation of the treatment the disease returns.
- Corticosteroids are not recommended for prolonged treatments or when treatment of large and/or inflamed areas is required.
- Alternative treatments include retinoids, such as etretinate, which has been approved for treatment of severe, refractory psoriasis.
- Alternative retinoid-based treatments are in advanced clinical trials. Retinoids act by converting keratinocytes to a differentiated state and restoration of normal skin development. Immunosuppressive drugs such as cyclosporine are also in the advanced stages of clinical trials.
- Lymphocytes are present at the sites of tissue damage, but their role may be as mediators to amplify the eosinophilic response.
- interleukin-5 which is released by T-lymphocytes, is important in retaining and priming eosinophil action in the airway.
- osteoarthritis is a slowly progressive disease characterized by degeneration of articular cartilage with proliferation and remodeling of subchondral bone. It presents with a clinical picture of pain, deformity, and loss of joint motion.
- Rheumatoid arthritis is a chronic systemic inflammatory disease. Rheumatoid arthritis may be mild and relapsing or severe and progressive, leading to joint deformity and incapacitation.
- Arthritis is the major contributor to functional impairment among the older population. It is the major cause of disability and accounts for a large proportion of the hospitalizations and health care expenditures of the elderly. Arthritis is estimated to be the principal cause of total incapacitation for about one million persons aged 55 and older and is thought to be an important contributing cause for about one million more. Estimating the incidence of osteoarthritis is difficult for several reasons. First, osteoarthritis is diagnosed objectively on the basis of reading radiographs, but many people with radiologic evidence of disease have no obvious symptoms. Second, the estimates of prevalence are based upon clinical evaluations because radiographic data is not available for all afflicted joints.
- rheumatoid arthritis has a world-wide distribution and affects all racial and ethnic groups. The exact prevalence in the US is unknown but has been estimated to range between 0.5% and 1.5%. Rheumatoid arthritis occurs at all age levels and generally increases in prevalence with advancing age. It is 2-3 times more prevalent in women than in men and peak incidence occurs between 40-60 years of age. In addition to i munological factors, environmental, occupational and psychosocial factors have been studied for potential etiologic roles in the disease.
- the extracellular matrix of multicellular organisms plays an important role in the formation and maintenance of tissues.
- the meshwork of the extracellular matrix is deposited by resident cells and provides a framework for cell adhesion and migration, as well as a permeability barrier in cell-cell communication.
- Connective tissue turnover during normal growth and development or under pathological conditions is thought to be mediated by a family of neutral metalloproteinases, which are zinc-containing enzymes that require calcium for full activity.
- the regulation of metalloproteinase expression is cell-type specific and may vary among species.
- interstitial collagenase The best characterized of the matrix metalloproteinases, interstitial collagenase (MMP-1) , is specific for collagen types I, II, and III. MMP-1 cleaves all three ⁇ chains of the triple helix at a single point initiating sequential breakdown of the interstitial collagens. Interstitial collagenase activity has been observed in rheumatoid synovial cells as well as in the synovial fluid of patients with inflammatory arthritis.
- Gelatinases (MMP-2) represent a subgroup of the metalloproteinases consisting of two distinct gene products; a 70 kDa gelatinase expressed by most connective tissue cells, and a 92 kDa gelatinase expressed by inflammatory phagocytes and tumor cells.
- the larger enzyme is expressed by macrophages, SV-40 transformed fibroblasts, and neutrophils.
- the smaller enzyme is secreted by H-ras transformed bronchial epithelial cells and tumor cells, as well as normal human skin fibroblasts. These enzymes degrade gelatin (denatured collagen) as well as native collagen type XI.
- Stromelysin (MMP-3) has a wide spectrum of action on molecules composing the extracellular matrix. It digests proteoglycans, fibronectin, laminin, type IV and IX collagens and gelatin, and can remove the N-terminal propeptide region from procollagen, thus activating the collagenase. It has been found in human cartilage extracts, rheumatoid synovial cells, and in the synovium and chondrocytes of joints in rats with collagen-induced arthritis.
- tissue growth factor- ⁇ has been shown to block epidermal growth factor (EGF) induction of stromelysin synthesis in vitro.
- Experimental protocols involving gene therapy approaches include the controlled expression of the metalloproteinase inhibitors TIMP-1 and TIMP-2. Of the latter three approaches, only gamma-interferon treatment is currently feasible in a clinical application.
- Stenosis is the occurrence of a blockage in a blood vessel. Such blockages may lead to impairment of functions or even death, dependent upon which vessel it occurs in and its size. These may be prevented as described below.
- Restenosis is a disease state which occurs as a sequelae to percutaneous transluminal angioplasty (PCTA) or coronary artery bypass grafting (CABG) treatments of cardiovascular disease.
- PCTA percutaneous transluminal angioplasty
- CABG coronary artery bypass grafting
- Acute or immediate restenosis occurs in approximately 10% of the patients undergoing PCTA and slower-developing restenosis (six month onset) occurs in approximately 30% of those patients.
- the estimated number of PCTA patients in 1990 was 300,000 - 400,000. Thus, there are about 150,000 cases of restenosis per year in the United States.
- the presently preferred chemotherapeutic treatment of patients is the use of streptokinase, urokinase or other thrombolytic compounds, such as fish oil, anticoagulants, ACE (angiotensin converting enzyme) inhibitors, aspirin and cholesterol lowering compounds; alternative treatment includes the surgical incorporation of endoluminal stents. It is reported that none of the current therapies have significantly impacted the rates of restenosis occurrence. A number of compounds are currently in preclinical evaluations. Platelet inhibitors include GR32191, Sultroban, Ketanserin, and fish oil.
- Angiopeptin is being tested as a growth factor inhibitor and Lovostatin, Enoxaparin, RD Heparin, Cilazapril and Fosinopril are being investigated as smooth muscle cell proliferation inhibitors. While platelet inhibitors are being tested for prevention of restenosis, it appears that these compounds will not be efficacious as short-term treatments.
- One of the biggest problems with current therapies is the occurrence of pharmacologic side-effects. These effects not only create other physiological problems, but also decrease the levels of patient compliance, thereby reducing the therapeutic efficacy of the treatments.
- the proliferation of antherophils may be induced through a host of genetic activations, but the best candidate for targeting smooth muscle proliferation is the c-myb gene.
- the c-myb protein binds DNA and activates DNA replication and cellular growth.
- the role of c-myb in smooth muscle cell replication has been documented in bovine cells, and the expression of c-myb has been shown to activate cellular replication in chicken embryo fibroblasts and human T-lymphocytes.
- NF-KB cascade NF-KB protein activates cellular transcription and induces increases in cellular synthetic pathways. In a resting cell, this protein is found in the cytoplasm, complexed with its inhibitor, 1KB.
- NF-KB NF-KB protein
- the complex Upon phosphorylation of the 1KB molecule, the complex dissociates and NFKB is released for transport to the nucleus, where it binds DNA and induces transcriptional activity in (NF-KB) -responsive genes.
- One of the (NF-KB) -responsive genes is the NF-KB gene.
- release of the NF-KB protein from the complex results in a cascade of gene expression which is auto- induced.
- the invention features use of ribozy es to treat or prevent various animal diseases, in particular, those human diseases noted above.
- psoriasis which can be treated, e.g. , by inhibiting the synthesis of tumor necrosis factor in activated lymphocytes, and basal keratinocytes.
- the invention also features use of ribozymes to treat chronic asthma, e.g. , by inhibiting the synthesis of IL-5 in lymphocytes and preventing the recruitment and activation of eosinophils. Cleavage of targeted mRNAs (tumor necrosis factor and IL-5 mRNAs) expressed in keratinocytes, T-lymphocytes, monocytes or macrophages inhibits the synthesis of tumor necrosis factor and IL-5, respectively.
- targeted mRNAs tumor necrosis factor and IL-5 mRNAs
- cytokines may also be involved in the activation of inflammation in asthmatic patients, including platelet activating factor, IL-1, IL-3, IL-4, GM-CSF, TNF ⁇ , gamma interferon, ILAM-1, ELAM-1 and EoCSF.
- platelet activating factor IL-1, IL-3, IL-4, GM-CSF, TNF ⁇ , gamma interferon, ILAM-1, ELAM-1 and EoCSF.
- any cellular receptors which mediate the activities of the cytokines are also good targets for intervention in inflammatory diseases. These targets include, but are not limited to, the IL-1R and TNF ⁇ R on keratinocytes, epithelial and endothelial cells in airways. Recent data suggest that certain neuropeptides may play a role in asthmatic symptoms.
- peptides include substance P, neurokinin A and calcitonin-gene-related peptides.
- target genes may have more general roles in inflammatory diseases, but are currently assumed to have a role only in asthma.
- Other genes which are considered to play a role in asthma are the c-myb and c-myc genes, which may be triggered to induce endothelial cell proliferation and contribute to blockage of the airways.
- ribozymes which will reduce the risk or occurrence of inflammatory disease, such as the interleukins (1, 3, 4, 6, and 8), glycerol transferase, selectins (E-selectin, MEL-14) , cell adhesion molecules (ICAM-1, ELAM-1, VCAM-1, GMP-140, MAM), TGF- ⁇ , IL-1R, TGFCR, EoCSF, ⁇ -, ⁇ - or ⁇ -interferon, EoCSF, GM-CSF and protein kinase C (PKC) .
- interleukins 1, 3, 4, 6, and 8
- selectins E-selectin, MEL-14
- IAM cell adhesion molecules
- TGF- ⁇ IL-1R
- TGFCR protein kinase C
- EoCSF protein kinase C
- a ribozyme to TNF ⁇ nucleotides 374 to 393 can be use to inhibit TNF ⁇ protein production.
- This region may not a very good region to target because of secondary RNA structure in this region.
- An adjoining region which begins at nucleotide 380 in the previous reference and extends to nucleotide 412 (408-440, our sequence numbers see below) appears to contain a relatively more accessible RNA structure, and therefore represents an improved target over the region between nucleotides 374-393 (402-421, our sequence numbers) .
- Another disease is arthritis, which can be treated by inhibition of collagenase and stromelysin production in the synovial membrane of joints.
- Ribozyme treatment can be a partner to current treatments which primarily target immune cells reacting to pre-existing tissue damage. Early ribozyme treatment which reduces the collagenase or stromelysin-induced damage can be followed by treatment with the anti-inflammatories or retinoids, if necessary. In this manner, expression of the proteinases can be controlled at both transcriptional and translational levels. Ribozyme treatment can be given to patients expressing radiological signs of osteoarthritis prior to the expression of clinical symptoms. Ribozyme treatment can impact the expression of stromelysin without introducing the non-specific effects upon gene expression which accompany treatment with the retinoids and dexamethasone.
- stromelysin to activate procollagenase indicates that a ribozyme which reduces stromelysin expression can also be used in the treatment of both osteoarthritis (which is primarily a stromelysin- associated pathology) and rheumatoid arthritis (which is primarily related to enhanced collagenase activity) . While a number of cytokines and growth factors induce metalloproteinase activities during wound healing and tissue injury of a pre-osteoarthritic condition, these molecules are not preferred targets for therapeutic intervention. Primary emphasis is placed upon inhibiting the molecules which are responsible for the disruption of the extracellular matrix, because most people will be presenting radiologic or clinical symptoms prior to treatment.
- the most versatile of the metalloproteinases is stromelysin. Additionally, this molecule can activate procollagenase, which in turn causes further damage to the collagen backbone of the extracellular matrix.
- TIMPs tissue inhibitors of MMP
- the invention features use of ribozymes to treat or prevent arthritis, particularly osteoarthritis, e.g. , by inhibiting the synthesis of the prostromelysin molecule in synovial cells, or by inhibition of other matrix metalloproteinases discussed above.
- Cleavage of targeted mRNAs (stromelysin mRNAs) expressed in macrophages, neutrophils and synovial cells represses the synthesis of the zymogen form of stromelysin, prostromelysin.
- ribozymes which will reduce the risk or occurrence of pathologic degradation of the extracellular matrix such as the collagenase and gelatinase metalloproteinases, other proteinases which can activate the proenzyme forms of the metalloproteinases in synovial fluid or cartilaginous cells, cytokines or growth factors which activate the expression of the metalloproteinases and adhesion molecules which attract macrophage and neutrophils to the areas of tissue injury.
- Another disease is stenosis, which is treated, e.g. , by inhibiting the activation of smooth muscle proliferation by inhibiting the expression of the cellular c-myb gene.
- Cleavage of targeted mRNAs c-myb mRNAs expressed in endothelial cells and smooth muscle cells represses activation of cellular replication and abnormal proliferation of the smooth muscle or endothelial cells.
- Other potential targets suitable for treatment with ribozymes, which will reduce the risk or occurrence of cellular proliferation in the areas of restenotic risk include mRNAs encoding TGF- ⁇ , NF-KB, PDGF, bFGF, endothelium-derived relaxing factor, CGRP, and angiotensin II.
- cardiovascular disease which can be treated, e.g. , by inhibiting the activation of angiotensin by angiotensin converting enzyme (ACE) , or by inhibition of the activity of endothelin converting enzyme (ECE) .
- ACE angiotensin converting enzyme
- ECE endothelin converting enzyme
- ribozymes which will reduce the risk or occurrence of cardiovascular disease, such as mRNAs encoding HMG CoA reductase, renin, bradykinin, plasminogen, factors IX, X and II, 2-5A synthetase, ADH and fibrinogen.
- Ribozymes are RNA molecules having an enzymatic activity which is able to repeatedly cleave other separate RNA molecules in a nucleotide base sequence specific manner. It is alleged that such enzymatic R ⁇ A molecules can be targeted to virtually any R ⁇ A transcript and efficient cleavage has been achieved in vitro . Kim et al., 84 Proc. ⁇ atl. Acad. Sci. USA 8788, 1987; Haseloff and Gerlach, 334 Nature 585, 1988; Cech, 260 JAMA 3030, 1988; and Jefferies et al., 17 Nucleic Acids Research 1371, 1989.
- Ribozymes act by first binding to a target RNA. Such binding occurs through the target RNA binding portion of a ribozyme which is held in close proximity to an enzymatic portion of the RNA which acts to cleave the target RNA. Thus, the ribozyme first recognizes and then binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After a ribozyme has bound and cleaved its RNA target it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
- ribozyme The enzymatic nature of a ribozyme is advantageous over other technologies, such as antisense technology (where a nucleic acid molecule simply binds to a nucleic acid target to block its translation) since the effective concentration of ribozyme necessary to effect a therapeutic treatment is lower than that of an antisense oligonucleotide.
- This advantage reflects the ability of the ribozyme to act enzymatically.
- a single ribozyme molecule is able to cleave many molecules of target RNA.
- the ribozyme is a highly specific inhibitor, with the specificity of inhibition depending not only on the base pairing mechanism of binding, but also on the mechanism by which the molecule inhibits the expression of the RNA to which it binds. That is, the inhibition is caused by cleavage of the RNA target and so specificity is defined as the ratio of the rate of cleavage of the targeted RNA over the rate of cleavage of non-targeted RNA. This cleavage mechanism is dependent upon factors additional to those involved in base pairing. Thus, it is thought that the specificity of action of a ribozyme is greater than that of antisense oligonucleotide binding the same R ⁇ A site.
- This class of chemicals exhibits a high degree of specificity for cleavage of the intended target mR ⁇ A. Consequently, the ribozyme agent will only affect cells expressing that particular gene, and will not be toxic to normal tissues.
- the invention can be used to treat or prevent (prophylactically) psoriasis, asthma and other inflammatory diseases, and restenosis or other cardiovascular conditions, including hypertension.
- the preferred administration protocol is in vivo administration to reduce the level of those genes and the encoded mR ⁇ As noted above.
- the invention features an enzymatic R ⁇ A molecule (or ribozyme) which cleaves mR ⁇ A associated with development or maintenance of a psoriatic or asthmatic condition, e.g. , mR ⁇ A encoding T ⁇ F- ⁇ , IL-5, IL-1, IL-3, IL-4, IL-6, IL-8, glycerol transferase, selectins, E-selectin, MEL-14, ICAM-1, ELAM-1, VCAM-1, GMP-140, MAM, TGF ⁇ , T ⁇ F ⁇ R, IL-lR, ⁇ -, ⁇ - or ⁇ -interferon, GM-CSF and protein kinase C, and in particular, those mRNA targets disclosed in Table 1.
- the invention features and enzymatic RNA molecule which cleaves mRNA associated with development and maintenance of osteoarthritis or other pathological conditions which are mediated by metalloproteinase activation.
- the preferred administration protocol is in vivo administration to reduce the level of stromelysin activity.
- the invention features an enzymatic RNA molecule (or ribozyme) which cleaves mRNA associated with development or maintenance of an arthritic condition, e.g. , mRNA encoding stromelysin, and in particular, those mR ⁇ A targets disclosed in Table 2.
- mRNA associated with development or maintenance of an arthritic condition e.g. , mRNA encoding stromelysin, and in particular, those mR ⁇ A targets disclosed in Table 2.
- the invention features an enzymatic RNA molecule (or ribozyme) which cleaves mRNA associated with development or maintenance of a restenotic condition, e.g. , mRNA encoding c-myb (or other mRNAs noted above) , and in particular, those mRNA targets disclosed in Table 3.
- a restenotic condition e.g. , mRNA encoding c-myb (or other mRNAs noted above)
- the invention features an enzymatic RNA molecule (or ribozyme) which cleaves mRNA associated with development or maintenance of a cardiovascular condition, e.g. , mRNA encoding ACE or
- enzymatic RNA molecule an RNA molecule which has complementarity in a substrate binding region to a specified mRNA target, and also has an enzymatic activity which is active to specifically cleave that mRNA. That is, the enzymatic R ⁇ A molecule is able to intermolecularly cleave mR ⁇ A and thereby inactivate a target mR ⁇ A molecule.
- This complementarity functions to allow sufficient hybridization of the enzymatic R ⁇ A molecule to the target R ⁇ A to allow the cleavage to occur.
- One hundred percent complementarity is preferred, but complementarity as low as 50-75% may also be useful in this invention. For in vivo treatment, complementarity between 30 and 45 bases is preferred.
- the enzymatic RNA molecule is formed in a hammerhead motif, but may also be formed in the motif of a hairpin, hepatitis delta virus, group I intron or RNaseP-like RNA (in association with an RNA guide sequence) .
- hammerhead motifs are described by Rossi et al., 8 Aids Research and Human Retroviruses 183, 1992, of hairpin motifs by Hampel and Tritz, 28 Biochemistry 4929, 1989; and Hampel et al., 18 Nucleic Acids Research 299, 1990, and an example of the hepatitis delta virus motif is described by Perrotta and Been, 31 Biochemistry 16,
- the invention features a mammalian cell which includes an enzymatic RNA molecule as described above.
- the mammalian cell is a human cell.
- the invention features an expression vector which includes nucleic acid encoding an enzymatic RNA molecule described above, located in the vector, e.g. , in a manner which allows expression of that enzymatic RNA molecule within a mammalian cell.
- the invention features a method for treatment of a disease noted above by administering to a patient an enzymatic RNA molecule as described above.
- the invention provides a class of chemical cleaving agents which exhibit a high degree of specificity for the mRNA causative of a psoriatic or arthritic or cardiovascular condition. Such a condition includes any measurable indication of susceptibility to cardiac problems, and thus includes predisposition to such conditions or cardiovascular disease.
- Such enzymatic RNA molecules can be delivered exogenously or endogenously to infected cells.
- the small size (less than 40 nucleotides, preferably between 32 and 36 nucleotides in length) of the molecule allows the cost of treatment to be reduced.
- ribozyme delivered for any type of treatment reported to date is an in vi tro transcript having a length of 142 nucleotides. Synthesis of ribozymes greater than 100 nucleotides in length is very difficult using automated methods, and the therapeutic cost of such molecules is prohibitive. Delivery of ribozymes by expression vectors is primarily feasible using only ex vivo treatments. This limits the utility of this approach.
- an alternative approach uses smaller ribozyme motifs (e.g. , of the hammerhead structure, shown generally in Fig. 1) and exogenous delivery. The simple structure of these molecules also increases the ability of the ribozyme to invade targeted regions of the mRNA structure.
- RNA molecules of this invention can be used to treat psoriatic or pre-psoriatic, asthmatic or pre-asthmatic, arthritic or prearthritic, stenotic or prestenotic conditions. Such treatment can also be extended to other related genes in nonhuman primates. Affected animals can be treated at the time of disease risk or detection, or in a prophylactic manner. This timing of treatment will reduce the chance of further disease damage.
- Ribozymes of this invention may be used as diagnostic tools to examine genetic drift and mutations within diseased cells.
- the close relationship between ribozyme activity and the structure of the target RNA allows the detection of mutations in any region of the molecule which alters the base-pairing and three- dimensional structure of the target RNA.
- By using multiple ribozymes described in this invention one may map nucleotide changes which are important to RNA structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with ribozymes may be used to inhibit gene expression and define the role (essentially) of specified gene products in the progression of disease. In this manner, other genetic targets may be defined as important mediators of the disease.
- Fig. 1 is a diagrammatic representation of a hammerhead motif ribozyme showing stems I, II and III (marked (I) , (II) and (III) respectively) interacting with a target region. The 5' and 3' ends of both ribozyme and target are shown. Dashes indicate base- paired nucleotides. Target Sites
- Ribozymes targeting selected regions of mRNA associated with a selected disease are chosen to cleave the target RNA in a manner which preferably inhibits translation of the RNA. Genes are selected such that inhibition of translation will preferably inhibit cell replication, e.g. , by inhibiting production of a necessary protein. Selection of effective target sites within these critical regions of mRNA entails testing the accessibility of the target RNA to hybridization with various oligonucleotide probes. These studies can be performed using RNA probes and assaying accessibility by cleaving the hybrid molecule with RNaseH (see below) .
- ribozyme probes designed from secondary structure predictions of the mRNAs, and assaying cleavage products by polyacrylamide gel electrophoresis (PAGE) , to detect the presence of cleaved and uncleaved molecules.
- PAGE polyacrylamide gel electrophoresis
- the method involves identifying potential cleavage sites for a hammerhead ribozyme, and then testing each of these sites to determine their suitability as targets by ensuring that secondary structure formation is minimal.
- the mRNA sequences are compared in an appropriate target region. Putative ribozyme cleavage sites are found. These sites represent the preferable sites for hammerhead ribozyme cleavage within these target mRNAs.
- Short RNA substrates corresponding to each of the mRNA sites are designed.
- Each substrate is composed of two to three nucleotides at the 5' and 3' ends that will not base pair with a corresponding ribozyme recognition region.
- the unpaired regions flanked a central region of 12-14 nucleotides to which comple ⁇ mentary arms in the ribozyme are designed.
- the structure of each substrate sequence is predicted using a standard PC fold computer program. Sequences which give a positive free energy of binding are accepted. Sequences which give a negative free energy are modified by trimming one or two bases from each of the ends. If the modified sequences are still predicted to have a strong secondary structure, they are rejected.
- ribozymes are designed to each of the RNA substrates. Ribozyme folding is also analyzed using PC fold.
- Ribozyme molecules are sought which form hammerhead motif stem II (see Fig. 1) regions and contain flanking arms which are devoid of intramolecular base pairing. Often the ribozymes are modified by trimming a base from the ends of the ribozyme, or by introducing additional base pairs in stem II to achieve the desired fold. Ribozymes with incorrect folding are rejected. After substrate/ribozyme pairs are found to contain correct intramolecular structures, the molecules are folded together to predict intermolecular interactions. A schematic representation of a ribozyme with its coordinate base pairing to its cognate target sequence is shown in Fig. 1.
- ribonuclease H assay provides a quick test of the use of the target site without requiring synthesis of a ribozyme. It can be used to screen for sites most suited for ribozyme attack.
- Ribozymes useful in this invention can be produced by gene transcription as described by Cech, supra, or by chemical synthesis. Chemical synthesis of RNA is similar to that for DNA synthesis.
- RNA requires a different protecting group strategy to deal with selective 3'-5' internucleotide bond formation, and with RNA susceptibility to degradation in the presence of bases.
- the recently developed method of RNA synthesis utilizing the t-butyldimethylsilyl group for the protection of the 2' hydroxyl is the most reliable method for synthesis of ribozymes.
- the method reproducibly yields RNA with the correct 3'-5' internucleotide linkages, with average coupling yields in excess of 99%, and requires only a two-step deprotection of the polymer.
- a method, based upon H-phosphonate chemistry of phosphoroamidites gives a relatively lower coupling efficiency than a method based upon phosphoroamidite chemistry. This is a problem for synthesis of DNA as well.
- a promising approach to scale-up of automatic oligonucleotide synthesis has been described recently for the H-phosphonates.
- a combination of a proper coupling time and additional capping of "failure" sequences gave high yields in the synthesis of oligodeoxynucleotides in scales in the range of 14 ⁇ moles with as little as 2 equivalents of a monomer in the coupling step.
- Another alternative approach is to use soluble polymeric supports (e.g.
- ribozyme structure can be made to enhance the utility of ribozymes. Such modifications will enhance shelf-life, half-life in vi tro, stability, and ease of introduction of such ribozymes to the target site, e.g. , to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
- Exogenous delivery of ribozymes benefits from chemical modification of the backbone, e.g. , by the overall negative charge of the ribozyme molecule being reduced to facilitate diffusion across the cell membrane.
- the present strategies for reducing the oligonucleotide charge include: modification of internucleotide linkages by methylphosphonates, use of phosphoramidites, linking oligonucleotides to positively charged molecules, and creating complex packages composed of oligonucleotides, lipids and specific receptors or effectors for targeted cells. Examples of such modifications include sulfur-containing ribozymes containing phosphorothioates and phosphorodithioates as internucleotide linkages in RNA.
- Ribozymes may also contain ribose modified ribonucleotides.
- Pyrimidine analogues are prepared from uridine using a procedure employing diethylamino sulphur trifluoride (DAST) as a starting reagent.
- Ribozymes can also be either electrostatically or covalently attached to polymeric cations for the purpose of reducing charge.
- the polymer can be attached to the ribozyme by simply converting the 3'-end to a ribonucleoside dialdehyde which is obtained by a periodate cleavage of the terminal 2',3'-cis diol system.
- other possible modifications may include different linker arms containing carboxyl, amino or thiol functionalities.
- Yet further examples include use of methylphosphonates and 2'-O-methylribose and 5' or 3' capping or blocking with m 7 GpppG or m 3 2 ' 2,7 GpppG.
- a kinased ribozyme is contacted with guanosine triphosphate and guanyltransferase to add an m 3 G cap to the ribozyme.
- the ribozyme can be gel purified using standard procedure. To ensure that the ribozyme has the desired activity, it may be tested with and without the 5' cap using standard procedures to assay both its enzymatic activity and its stability.
- Synthetic ribozymes including those containing various modifiers, can be purified by high pressure liquid chromatography (HPLC) .
- HPLC high pressure liquid chromatography
- Other liquid chromatography techniques, employing reverse phase columns and anion exchangers on silica and polymeric supports may also be used.
- Synthesis is done on a 1 ⁇ mole scale using a 1 ⁇ ole RNA reaction column (Glen Research) .
- the average coupling efficiencies are between 97% and 98% for the 394 model, and between 97% and 99% for the 380B model, as deter ⁇ mined by a calorimetric measurement of the released trityl cation.
- Blocked ribozymes are cleaved from the solid support (e.g. , CPG) , and the bases and diphosphoester moiety deprotected in a sterile vial by dry ethanolic ammonia (2 mL) at 55°C for 16 hours. The reaction mixture is cooled on dry ice. Later, the cold liquid is transferred into a sterile screw cap vial and lyophilized.
- the solid support e.g. , CPG
- the residue is suspended in 1 M tetra-n-butylammonium fluoride in dry THF (TBAF) , using a 20 fold excess of the reagent for every silyl group, for 16 hours at ambient temperature (about 15- 25°C) .
- THF dry THF
- the reaction is quenched by adding an equal volume of sterile 1 M triethylamine acetate, pH 6.5.
- the sample is cooled and concentrated on a SpeedVac to half the initial volume.
- the ribozymes are purified in two steps by HPLC on a C4 300 A 5 mm DeltaPak column in an acetonitrile gradient.
- the first step is a separation of 5'-DMT-protected ribozyme(s) from failure sequences lacking a 5'-DMT group.
- Solvents used for this step are: A (0.1 M triethylammonium acetate, pH 6.8) and B (acetonitrile).
- the elution profile is: 20% B for 10 minutes, followed by a linear gradient of 20% B to 50% B over 50 minutes, 50% B for 10 minutes, a linear gradient of 50% B to 100% B over 10 minutes, and a linear gradient of 100% B to 0% B over 10 minutes.
- the second step is a purification of a completely deblocked ribozyme by a treatment of 2% trifluoroacetic acid on a C4 300 A 5 mm DeltaPak column in an acetonitrile gradient.
- Solvents used for this second step are: A (0.1 M triethylammonium acetate, pH 6.8) and B (80% acetonitrile, 0.1 M triethylammonium acetate, pH 6.8).
- the elution profile is: 5% B for 5 minutes, a linear gradient of 5% B to 15% B over 60 minutes, 15% B for 10 minutes, and a linear gradient of 15% B to 0% B over 10 minutes.
- the fraction containing ribozyme is cooled and lyophilized on a SpeedVac. Solid residue is dissolved in a minimum amount of ethanol and sodium perchlorate in acetone. The ribozyme is collected by centrifugation, washed three times with acetone, and lyophilized.
- ribozymes While synthetic ribozymes are preferred in this invention, those produced by expression vectors can also be used. In designing a suitable ribozyme expression vector the following factors are important to consider. The final ribozyme must be kept as small as possible to minimize unwanted secondary structure within the ribozyme.
- a promoter e.g. , the human cytomegalovirus immediate early promoter or human beta actin promoter
- Such a promoter should express the ribozyme at a level suitable to effect production of enough ribozyme to destroy a target RNA, but not at too high a level to prevent other cellular activities from occurring (unless cell death itself is desired) .
- a hairpin at the 5' end of the ribozyme is useful to ensure that the required transcription initiation sequence (GG or GGG or GGGAG) does not bind to some other part of the ribozyme and thus affect regulation of the transcription process.
- the 5' hairpin is also useful to protect the ribozyme from 5'-3' exonucleases.
- a selected hairpin at the 3' end of the ribozyme gene is useful since it acts as a transcription termination signal, and protects the ribozyme from 3'-5' exonuclease activity.
- a known termination signal is that present on the T7 RNA polymerase system. This signal is about 30 nucleotides in length.
- Other 3' hairpins of shorter length can be used to provide good termination and RNA stability.
- Such hairpins can be inserted within the vector sequences to allow standard ribozymes to be placed in an appropriate orientation and expressed with such sequences attached.
- Poly(A) tails are also useful to protect the 3' end of the ribozyme.
- ribozyme testing Once the desired ribozymes are selected, synthesized and purified, they are tested in kinetic and other experiments to determine their utility.
- RNA is resuspended in 50-100 ⁇ l TE (TRIS 10 mM, EDTA 1 mM, pH 7.2). An aliquot of this solution is diluted 100-fold into 1 ml TE, half of which is used to spectrophotometrically quantitate the ribozyme solution. The concentration of this dilute stock is typically 150-800 nM. Purity of the ribozyme is confirmed by the presence of a single band on a denaturing polyacrylamide gel.
- a ribozyme may advantageously be synthesized in two or more portions. Each portion of a ribozyme will generally have only limited or no enzymatic activity, and the activity will increase substantially (by at least 5-10 fold) when all portions are ligated (or otherwise juxtaposed) together.
- a specific example of hammerhead ribozyme synthesis is provided below.
- the method involves synthesis of two (or more) shorter "half" ribozymes and ligation of them together using T4 RNA ligase.
- T4 RNA ligase For example, to make a 34 mer ribozyme, two 17 ers are synthesized, one is phosphorylated, and both are gel purified. These purified 17 mers are then annealed to a DNA splint strand complementary to the two 17 mers. (Such a splint is not always necessary.) This DNA splint has a sequence designed to locate the two 17 mer portions with one end of each adjacent each other. The juxtaposed RNA molecules are then treated with T4 RNA ligase in the presence of ATP. The 34 mer RNA so formed is then HPLC purified.
- a substrate solution is made IX in assay buffer (75 mM Tris-HCl, pH 7.6; 0.1 mM EDTA, 10 mM MgCl 2 ) such that the concentration of substrate is less than 1 nM.
- a ribozyme solution (typically 20 nM) is made IX in assay buffer and four dilutions are made using IX assay buffer. Fifteen ⁇ l of each ribozyme dilution
- the reaction is started by mixing 15 ⁇ l of substrate into each ribozyme tube by rapid pipetting (note that final ribozyme concentrations are 10, 8, 6, 4, 2 nM) .
- Five ⁇ l aliquots are removed at 15 or 30 second intervals and quenched with 5 ⁇ l stop solution (95% formamide, 20 mM EDTA xylene cyanol, and bromphenol blue dyes) .
- 5 ⁇ l stop solution 95% formamide, 20 mM EDTA xylene cyanol, and bromphenol blue dyes
- the samples are separated on either 15% or 20% polyacrylamide gels. Each gel is visualized and quantitated with an Ambis beta scanner (Ambis Systems, San Diego, CA) .
- the substrates are prepared by transcription using T7 RNA polymerase and defined templates containing a T7 promoter, and DNA encoding appropriate nucleotides of the target RNA.
- the substrate solution is made IX in assay buffer (75 mM Tris-HCl, pH 7.6; 0.1 mM EDTA; 10 mM MgCl 2 ) and contains 58 nanomolar concentration of the long RNA molecules.
- the reaction is started by addition of gel purified ribozymes to 1 ⁇ M concentration. Aliquots are removed at 20, 40, 60, 80 and 100 minutes, then quenched by the addition of 5 ⁇ l stop solution. Cleavage products are separated using denaturing PAGE. The bands are visualized and quantitated with an Ambis beta scanner.
- Kinetic Analysis A simple reaction mechanism for ribozyme- mediated cleavage is: k x k 2
- the boxed step is important only in substrate excess.
- the rate of the reaction is the rate of disappearance of substrate with time:
- Lipid molecules are dissolved in a volatile organic solvent (CHC1 3 , methanol, diethylether, ethanol, etc.). The organic solvent is removed by evaporation.
- the lipid is hydrated into suspension with O.lx phosphate buffered saline (PBS) , then freeze-thawed 3x using liquid nitrogen and incubation at room temperature.
- PBS O.lx phosphate buffered saline
- the suspension is extruded sequentially through a 0.4 ⁇ m, 0.2 ⁇ m and 0.1 ⁇ m polycarbonate filters at maximum pressure of 800 psi.
- the ribozyme is mixed with the extruded liposome suspension and lyophilized to dryness.
- the lipid/ribozyme powder is rehydrated with water to one-tenth the original volume.
- the suspension is diluted to the minimum volume required for extrusion (0.4 ml for 1.5 ml barrel and 1.5 ml for 10 ml barrel) with lxPBS and re-extruded through 0.4 ⁇ m, 0.2 ⁇ m, 0.1 ⁇ m polycarbonate filters.
- the liposome entrapped ribozyme is separated from untrapped ribozyme by gel filtration chromatography (SEPHAROSE CL-4B, BIOGEL A5M) .
- the liposome extractions are pooled and sterilized by filtration through a 0.2 ⁇ m filter.
- the free ribozyme is pooled and recovered by ethanol precipitation.
- the liposome concentration is determined by incorporation of a radioactive lipid.
- the ribozyme concentration is determined by labeling with 32 P. Rossi et al., 1992, supra (and references cited therein) describe other methods suitable for preparation of liposomes.
- liposomes composed of DPPG/DPPC/Cholesterol (in a ratio of: 50/17/33) gave a punctate pattern of fluorescence, while DOPE/Egg PC/Cholesterol (30/37/33) gave a diffuse, homogeneous pattern of fluorescence in the cytoplasm.
- Cell fractionation showed that 80% of the entrapped contents from the DPPG/DPPC/Cholesterol formulation was localized in the membrane fraction, whereas the DOPE/Egg PC/Cholesterol formulation was localized in the cytoplasm. Further characterization of the latter formulation showed that after 3 hours, 70% of the fluorescence was cytoplasmic and 30% was in the membrane. After 24 hours, uptake had increased 5 fold and the liposome contents were distributed 50/50 between the cytoplasmic and membrane fractions.
- Liposomes containing 15 ribozymes ( 32 P-labeled) targeted to the HSV ICP4 mRNA were prepared and incubated with the cells. After 24 hours, 25% of the liposome dose was taken up with approximately 60,000 liposomes per cell. Thirty percent of the delivered ribozyme was intact after 24 hours. Cell fractionation studies showed 40% of the intact ribozyme to be in the membrane fraction and 52% of the intact ribozyme to be in the cytoplasmic fraction. In Vivo Assay
- the efficacy of action of a chosen ribozyme may be tested in vivo using standard procedures in transformed cells or animals which express the target mRNA.
- the accumulation of target mRNA in cells or the cleavage of the RNA by ribozymes or RNaseH can be quantified using an RNase protection assay.
- antisense riboprobes are transcribed from template DNA using T7 RNA polymerase (U.S. Biochemical) in 20 ⁇ l reactions containing IX transcription buffer (supplied by the manufacturer), 0.2 mM ATP, GTP and UTP, 1 U/ ⁇ l pancreatic RNase inhibitor (Boehringer Mannheim Biochemicals) and 200 ⁇ Ci 32 P- labeled CTP (800 Ci/mmol, New England Nuclear) for 1 hour at 37°C.
- Template DNA is digested with 1 U RNase- free DNasel (U.S. Biochemical, Cleveland, OH) at 37°C for 15 minutes and unincorporated nucleotides removed by G-50 SEPHADEX spin chromatography.
- the target RNA can be transcribed in vi tro using a suitable DNA template.
- the transcript is purified by standard methods and digested with ribozyme at 37°C according to methods described later.
- afflicted (mRNA-expressing) cells are harvested into 1 ml of PBS) transferred to a 1.5 ml EPPENDORF tube, pelleted for 30 seconds at low speed in a microcentrifuge, and lysed in 70 ⁇ l of hybridization buffer (4 M guanidine isothiocyanate, 0.1% sarcosyl, 25 mM sodium citrate, pH 7.5).
- Cell lysate 45 ⁇ l or defined amounts of in vi tro transcript (also in hybridization buffer) is then combined with 5 ⁇ l of hybridization buffer containing 5 x 10 5 cpm of each antisense riboprobe in 0.5 ml Eppendorf tubes, overlaid with 25 ⁇ l mineral oil, and hybridization accomplished by heating overnight at 55°C.
- hybridization reactions are diluted into 0.5 ml RNase solution (20 U/ml RNaseA, 2 U/ml RNaseTl, 10 U/ml RNase-free DNasel in 0.4 M NaCl), heated for 30 minutes at 37°C, and 10 ⁇ l of 20% SDS and 10 ⁇ l of Proteinase K (10 mg/ml) added, followed by an additional 30 minutes incubation at 37°C.
- Hybrids are partially purified by extraction with 0.5 ml of a 1:1 mixture of phenol/chloroform; aqueous phases are combined with 0.5 ml isopropanol, and RNase- resistant hybrids pelleted for 10 minutes at room temperature (about 20°C) in a microcentrifuge.
- Pellets are dissolved in 10 ⁇ l loading buffer (95% formamide, IX TBE, 0.1% bromophenol blue, 0.1% xylene cylanol) , heated to 95°C for five minutes, cooled on ice, and analyzed on 4% polyacrylamide/7 M urea gels under denaturing conditions.
- the chosen ribozyme can be tested to determine its stability, and thus its potential utility. Such a test can also be used to determine the effect of various chemical modifications (e.g. , addition of a poly(A) tail) on the ribozyme stability and thus aid selection of a more stable ribozyme.
- a reaction mixture contains 1 to 5 pmoles of 5' (kinased) and/or 3' labeled ribozyme, 15 ⁇ g of cytosolic extract and 2.5 mM MgCl 2 in a total volume of 100 ⁇ l. The reaction is incubated at 37°C.
- a 3'-labeled ribozyme can be formed by incorporation of the 32 P-labeled cordycepin at the 3' OH using poly(A) polymerase.
- the poly(A) polymerase reaction contains 40 mM Tris, pH 8, 10 mM MgCl 2 , 250 mM NaCl, 2.5 mM MnCl 2 , ; 3 ⁇ l 32 P cordycepin, 500 Ci/mM; and 6 units poly(A) polymerase in a total volume of 50 ⁇ l. The reaction mixture is incubated for 30 minutes at 37°C. Effect of Base Substitution Upon Ribozyme Activity
- minor base changes can be made in the substrate cleavage region recognized by a specific ribozyme.
- the substrate sequences can be changed at the central "C" nucleotide, changing the cleavage site from a GUC to a GUA motif.
- the K cat / ⁇ ⁇ -_ values for cleavage using each substrate are then analyzed to determine if such a change increases ribozyme cleavage rates.
- Similar experiments can be performed to address the effects of changing bases complementary to the ribozyme binding arms. Changes predicted to maintain strong binding to the complementary substrate are preferred.
- cleavage rates of ribozymes containing varied arm lengths, but targeted to the same length of short RNA substrate can be tested. Minimal arm lengths are required and effective cleavage varies with ribozyme/substrate combinations.
- the cleavage activity of selected ribozymes can be assessed using target mRNA substrates.
- the assays are performed in ribozyme excess and approximate K cat /K I . in values obtained. Comparison of values obtained with short and long substrates indicates utility in vivo of a ribozyme. Intracellular Stability of Liposome-delivered Ribozymes
- Ribozymes are 32 P- end labeled, entrapped in liposomes and delivered to target mRNA-containing cells for three hours.
- the cells are fractionated and ribozyme is purified by phenol/chloroform extraction.
- cells lxlO 7 , T-175 flask
- the cells are homogenized by douncing 35 times in 4 ml of TSE (10 mM Tris, pH 7.4, 0.25 M Sucrose, mM EDTA). Nuclei are pelleted at lOOxg for 10 minutes.
- Subcellular organelles are pelleted at 200,000xg for two hours using an SW60 rotor.
- the pellet is resuspended in 1 ml of H buffer (0.25 M Sucrose, 50 mM HEPES, pH 7.4).
- the supernatant contains the cytoplasmic fraction (in approximately 3.7 ml).
- the nuclear pellet is resuspended in 1 ml of 65% sucrose in TM (50 mM Tris, pH 7.4, 2.5 mM MgCl 2 ) and banded on a sucrose step gradient (1 ml nuclei in 65% sucrose TM, 1 ml 60% sucrose TM, 1 ml 55% sucrose TM, 50% sucrose TM, 300 ⁇ l 25% sucrose TM) for one hour at 37,000xg with an SW60 rotor.
- the nuclear band is harvested and diluted to 10% sucrose with TM buffer. Nuclei are pelleted at 37,000xg using an SW60 rotor for 15 minutes and the pellet resuspended in 1 ml of TM buffer. Aliquots are size fractionated on denaturing polyacrylamide gels and the intracellular localization determined. By comparison to the migra' ion rate of newly synthesized ribozyme, the various fractions containing intact ribozyme can be determined.
- the cells may be fractioned as above and the purity of each fraction assessed by assaying enzyme activity known to exist in that fraction.
- the various cell fractions are frozen at -70°C and used to determine relative nuclease resistances of modified ribozyme molecules.
- Ribozyme molecules may be synthesized with 5 phosphorothioate (ps) , or 2'-Omethyl (2'-OMe) modifications at each end of the molecule. These molecules and a phosphodiester version of the ribozyme are end-labeled with 32 P and ATP using T4 polynucleotide kinase.
- Equal concentrations are added to the cell cytoplasmic extracts and aliquots of each taken at 10 minute intervals.
- the samples are size fractionated by denaturing PAGE and relative rates of nuclease resistance analyzed by scanning the gel with an Ambis ⁇ -scanner. The results show whether the ribozymes are digested by the cytoplasmic extract, and which versions are relatively more nuclease resistant.
- Modified ribozymes generally maintain 80-90% of the catalytic activity of the native ribozyme when short RNA substrates are employed.
- Unlabeled, 5' end-labeled or 3' end-labeled ribozymes can be used in the assays. These experiments can also be performed with human cell extracts to verify the observations.
- Vero or HeLa cells were grown to 90-95% confluency in 175 cm 2 tissue culture flasks, scraped into 10 ml of cold phosphate buffered saline
- sucrose TM 50 mM Tris, pH 7.4; 2.5 mM MgCl 2
- sucrose TM solutions were layered on top of the sample: 1 ml 60%, 1 ml 55%, and 25% sucrose to the top of the tube.
- Subcellular organelles and membrane components in the post nuclear supernatant were separated from the cytoplasmic fraction by centrifugation at 200,000g for 2 hours in an SW60 rotor.
- the pellet contained the membrane fraction, which was resuspended in 1 ml of H buffer (0.25 M sucrose; 50 mM HEPES, pH 7.4), and the supernatant contained the cytoplasmic fraction.
- the assays were as follows: For N-acetyl-beta-hexosaminidase, the reaction mixture contained 0.3 mg/ l 4-methylumbelliferyl-N- acetyl-glucosaminide; 20 mM sodium citrate; pH 4.5; 0.01% Triton X-100; and 100 ⁇ l of sample in a final volume of 500 ⁇ l (Harding et al. , 64 Cell 393, 1991). The reactions were incubated at 37°C for 1 hour and stopped by the addition of 1.5 ml of stop buffer (0.13 M glycine, 0.07 M NaCl, 0.08 M sodium carbonate, pH 10.6). The reaction product was quantitated in a Hitachi F-4010 fluorescence spectrophotometer by excitation of the fluorophore at 360 nm and analysis of the emission at 448 nm.
- the assay medium contained 25 mM CAPS (3-(Cyclohexylamino) - propanesulfonic acid), pH 10.6; 0.05% Triton X-100; 15 mM MgCl 2 ; 1.25 mg/ml Thymidine-5'-monophosphate-p- nitrophenyl ester; and 100 ⁇ l of sample in a total reaction volume of 200 ⁇ l.
- the reactions were incubated at 37°C for 2 hours, then diluted to 1 ml with H 2 0 and the absorbance was measured at 400 nm (Razell and Khorana, 234 J. Biol. Chem. 739, 1959) .
- the reaction contained 85 nM sodium citrate, pH 5.9; 0.12% Triton X- 100; 0.1% sodium taurocholate; 5 M 4-methylumbelliferyl ⁇ -D-glucopyranoside; and 125 ⁇ l of sample in a total volume of 250 ⁇ l (Kennedy and Cooper, 252 Biochem. J. 739, 1988) .
- the reaction was incubated at 37°C for 1 hour and stopped by the addition of 0.75 ml of stop buffer.
- Product formation was measured in a fluorescence spectrophotometer by using an excitation wavelength of 360 nm and analysis of the emission at 448 nm.
- the cytoplasmic enzyme marker, lactate dehydrogenase was assayed in an assay mixture containing 0.2 M Tris; pH 7.4; 0.22 mM NADH; 1 mM sodium pyruvate; and 50 ⁇ l of sample in a final volume of 1.05 ml. Enzyme levels were determined by decreased absorbency at 350 nm resulting from the oxidation of
- Lactate dehydrogenase was found predominantly in the cytoplasmic fractions of both Vero and HeLa cells, while ⁇ -glucocerebrosidase and alkaline phosphodiesterase were found almost exclusively in the membranous fractions.
- the hexosaminidase activity in Vero cell fractions was concentrated in the membranous fraction (70%) with about 20% in the cytoplasmic fraction.
- the isolation of enzyme markers with the appropriate cellular compartment demonstrated that cytoplasmic, membranous and nuclear fractions can be isolated with minimal intercompartmental contamination using this fractionation scheme.
- the basic oligonucleotide digestion reaction contained substrate nucleic acid (an RNA oligonucleotide of 36 nucleotides) and cell fraction extract in a total volume of 100 ⁇ l. Aliquots (7 ⁇ l) were taken after various periods of incubation at 37°C and added to 7 ⁇ l of gel loading buffer (95% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol, and 20 mM EDTA) . The samples were separated by electrophoresis on a 7 M urea, 20% polyacrylamide gel.
- substrate nucleic acid an RNA oligonucleotide of 36 nucleotides
- cell fraction extract in a total volume of 100 ⁇ l. Aliquots (7 ⁇ l) were taken after various periods of incubation at 37°C and added to 7 ⁇ l of gel loading buffer (95% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol, and 20 mM EDTA) . The
- Intact ribozymes were visualized either by staining with Stains-all (United States Biochemical, Cleveland, OH) , or autoradiography of 32 P-labeled ribozyme. The stained gels and X-ray films were scanned on a Bio 5000 density scanner (U.S. Biochemical). Ribozymes were 5' end- labeled with T4 polynucleotide kinase (U.S. Biochemical) using 10 ⁇ Ci of 32 P ⁇ -ATP (3,000 Ci/mmole, New England Nuclear, Boston, MA), and 20-25 pmoles of ribozymes. The unincorporated nucleotides were separated from the product by G-50 spin chromatography.
- Nuclease assays contained 1-2 pmoles of 32 P-labeled ribozyme. All oligonucleotides were synthesized on an Applied Biosystems 394 DNA/RNA synthesizer (Applied Biosysterns Inc., Foster City, CA) according to manufacturer's protocols. The nuclear fractions were resuspended in a buffer containing 2.5 mM MgCl 2 . Experiments involving the nuclear fractions were performed in the presence of 1 mM Mg +2 , or in combination with 1 mM Mn +2 , Ca +2 , or Zn +2 .
- RNA probes were produced from PCR-amplified template DNA using T7 RNA polymerase (U.S. Biochemical) in the presence of 32 P ⁇ -CTP (3,000 Ci/mmole, New England Nuclear, Boston, MA) . Template DNA was inactivated with 1 unit of RNase-free DNasel for 15 minutes at 37°C.
- Hybridization reactions were covered with mineral oil and incubated at 55°C for 12-16 hours, after which the hybridization reaction was mixed with 500 ⁇ l of RNase buffer (0.4 M NaCl, 20 ⁇ g/ml RNaseA, 2 units/ml Tl RNase) and incubated for 30 minutes at 37°C. RNase activity was quenched by incubation with 10 ⁇ l of 20% SDS and 10 ⁇ l of proteinase K (20 mg/ml) , and the RNA was extracted using a phenol/chloroform mixture. The protected RNA fragment was purified by precipitation with an equal volume of isopropanol in the presence of 20 ⁇ g of carrier yeast tRNA.
- RNase buffer 0.4 M NaCl, 20 ⁇ g/ml RNaseA, 2 units/ml Tl RNase
- RNA pellets were resuspended in gel loading buffer, heated to 95°C for 5 minutes and separated by electrophoresis on a 5% polyacrylamide, 7 M urea gel. Protected fragments were visualized by autoradiography, and the films were scanned with a Bio 5000 density scanner.
- the rate of digestion of ribozymes in Vero cell extracts was similar, demonstrating the lack of significant phosphatase activity in Vero cellular fractions. Similar results were observed with HeLa cellular fractions. In most extracts, ladders of digested fragments were observed; such ladders would not be expected if digestion was an artifact of phosphatase action.
- digestion using 5' end-labeled ribozymes is an accurate assessment of nuclease action in cellular extracts.
- ribozymes were incubated in various Vero and HeLa cellular fractions. Incubation of ribozymes in either membranous or nuclear fractions resulted in a linear decrease of intact molecules over time. In contrast, no digestion of ribozymes occurred during a 24 hour incubation in Vero cytoplasmic extracts, and HeLa cytoplasmic extracts exhibited a 20-30 minute delay in the onset of RNA digestion. After this refractory period, the rate of digestion was linear but not as rapid as the rates observed in any of the nuclear or membranous fractions.
- the effect of four divalent cations (Mg +2 , Mn +2 , Ca +2 , and Zn +2 ) on the nuclease activity of the cellular fractions was assessed. Vero cytoplasmic extracts were stimulated by the addition of 1 mM Mg +2 or Mn +2 , while Ca +2 or Zn +2 had no effect. Nuclease activity in HeLa cytoplasmic extracts was enhanced only by the addition of 1 mM Zn +2 .
- Vero and HeLa membranous fractions exhibited maximum nuclease activity with the addition of Mg +2 or Mn +2 ions, while the addition of Ca +2 significantly reduced activity of the HeLa membranous fraction and abolished nuclease activity in the Vero membranous fraction.
- Addition of Zn +2 to both membranous fractions resulted in a loss of all RNase activity.
- the Vero nuclear extract demonstrated roughly equivalent nuclease activity in the presence of either Mg +2 alone or a Mg +2 and Mn +2 ion combination, less in the presence of Mg +2 and Ca +2 , and no activity in the presence of Mg +2 and Zn +2 .
- nuclease assays were performed using 1 mM Mg +2 in the presence and absence of 20 mM EDTA.
- the Mg +2 was replaced with 1 mM Zn +2 .
- the presence of 20 mM EDTA completely abolished nuclease activity in the Vero and HeLa cytoplasmic fractions and Vero nuclear fractions.
- Nuclease activity in the HeLa membranous and nuclear fractions was partially inhibited by the addition of EDTA, while EDTA had no effect on the nuclease activity in the Vero membranous fraction.
- reactions using DNA oligonucleotides were performed using different Vero fractions. All DNase activity in Vero cytoplasmic, membranous, and nuclear fractions was inhibited by 20 mM EDTA.
- RNA oligonucleotides and HSV-1 mRNA were compared in the presence and absence of activity-enhancing divalent cations (1 mM Mg +2 , Vero cells; 1 mM Zn +2 , HeLa cells) .
- Total cellular RNA from HSV-1 infected Vero cells (8 mg) and tracer amounts of 32 P-5'-end-labeled RNA oligonucleotides (1 pmole) were incubated with Vero or HeLa cytoplasmic extracts. In the absence of divalent cations, no substantial decrease of intact ribozymes was detected in assays, although mRNA was digested in both Vero and HeLa cytoplasmic extracts.
- hammerhead ribozymes were compared in both Vero and HeLa cell cytoplasmic, membranous and nuclear fractions.
- Vero cytoplasmic and nuclear fractions were found to require Mg +2 for optimal nuclease activity, while the membranous fraction was not altered by the addition of divalent cations.
- HeLa membranous and nuclear fractions were also activated by Mg +2 , while the cytoplasmic fractions required Zn" 2 for nuclease activation.
- Relative stabilities of ribozymes and mRNAs were compared in Vero and HeLa cytoplasmic fractions.
- Selected ribozymes can be administered prophylactically, or to patients having disease conditions, e.g. , by exogenous delivery of the ribozyme to a desired tissue by means of an appropriate delivery vehicle, e.g. , a liposome, a controlled release vehicle, by use of iontophoresis, electroporation or ion paired molecules, or covalently attached adducts, and other pharmacologically approved methods of delivery.
- routes of administration include intramuscular, aerosol, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal.
- Expression vectors for immunization with ribozymes and/or delivery of ribozymes are also suitable.
- any selected ribozyme will depend on the use of the ribozyme. Generally, a specific delivery program for each ribozyme will focus on unmodified ribozyme uptake with regard to intracellular localization, followed by demonstration of efficacy. Alternatively, delivery to these same cells in an organ or tissue of an animal can be pursued. Uptake studies will include uptake assays to evaluate cellular ribozyme uptake, regardless of the delivery vehicle or strategy. Such assays will also determine the intracellular localization of the ribozyme following uptake, ultimately establishing the requirements for maintenance of steady-state concentrations within the cellular compartment containing the target sequence (nucleus and/or cytoplasm) .
- Toxicity will not only include cell viability but also cell function.
- Some methods of delivery that may be used include: a. encapsulation in liposomes, b. transduction by retroviral vectors, c. conjugation with cholesterol, d. localization to nuclear compartment utilizing nuclear targeting site found on most nuclear proteins, e. neutralization of charge of ribozyme by using nucleotide derivatives, and f. use of blood stem cells to distribute ribozymes throughout the body.
- At least three types of delivery strategies are useful in the present invention, including: ribozyme modifications, particle carrier drug delivery vehicles, and retroviral expression vectors.
- Unmodified ribozymes like most small molecules, are taken up by cells, albeit slowly. To enhance cellular uptake, the ribozyme may be modified essentially at random, in ways which reduce its charge but maintains specific functional groups. This results in a molecule which is able to diffuse across the cell membrane, thus removing the permeability barrier.
- ribozymes Modification of ribozymes to reduce charge is just one approach to enhance the cellular uptake of these larger molecules.
- the random approach is not advisable since ribozymes are structurally and functionally more complex than small drug molecules.
- the structural requirements necessary to maintain ribozyme catalytic activity are well understood by those in the art. These requirements are taken into consideration when designing modifications to enhance cellular delivery. The modifications are also designed to reduce susceptibility to nuclease degradation. Both of these characteristics should greatly improve the efficacy of the ribozyme.
- Cellular uptake can be increased by several orders of magnitude without having to alter the phosphodiester linkages necessary for ribozyme cleavage activity.
- Drug delivery vehicles are effective for both systemic and topical administration. They can be designed to serve as a slow release reservoir, or to deliver their contents directly to the target cell.
- An advantage of using direct delivery drug vehicles is that multiple molecules are delivered per uptake. Such vehicles have been shown to increase the circulation half-life of drugs which would otherwise be rapidly cleared from the blood stream.
- Some examples of such specialized drug delivery vehicles which fall into this category are liposomes, hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres.
- liposomes are preferred. Liposomes increase intracellular stability, increase uptake efficiency and improve biological activity.
- Liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids which make up the cell membrane. They have an internal aqueous space for entrapping water soluble compounds and range in size from 0.05 to several microns in diameter. Several studies have shown that liposomes can deliver RNA to cells and that the RNA remains biologically active.
- Lipofectin a liposome delivery vehicle originally designed as a research tool, Lipofectin, has been shown to deliver intact mRNA molecules to cells yielding production of the corresponding protein.
- Liposomes offer several advantages: They are non-toxic and biodegradable in composition; they display long circulation half-lives; and recognition molecules can be readily attached to their surface for targeting to tissues. Finally, cost effective manufacture of liposome-based pharmaceuticals, either in a liquid suspension or lyophilized product, has demonstrated the viability of this technology as an acceptable drug delivery system.
- Other controlled release drug delivery systems such as nonoparticles and hydrogels may be potential delivery vehicles for a ribozyme. These carriers have been developed for chemotherapeutic agents and protein- based pharmaceuticals, and consequently, can be adapted for ribozyme delivery.
- Topical administration of ribozymes is advantageous since it allows localized concentration at the site of administration with minimal systemic adsorption. This simplifies the delivery strategy of the ribozyme to the disease site and reduces the extent of toxicological characterization. Furthermore, the amount of material to be applied is far less than that required for other administration routes. Effective delivery requires the ribozyme to diffuse into the infected cells. Chemical modification of the ribozyme to neutralize negative charge may be all that is required for penetration. However, in the event that charge neutralization is insufficient, the modified ribozyme can be co-formulated with permeability enhancers, such as Azone or oleic acid, in a liposome.
- permeability enhancers such as Azone or oleic acid
- the liposomes can either represent a slow release presentation vehicle in which the modified ribozyme and permeability enhancer transfer from the liposome into the infected cell, or the liposome phospholipids can participate directly with the modified ribozyme and permeability enhancer in facilitating cellular delivery.
- both the ribozyme and permeability enhancer can be formulated into a suppository formulation for slow release.
- Ribozymes may also be systemically administered.
- Systemic absorption refers to the accumulation of drugs in the blood stream followed by distribution throughout the entire body. Administration routes which lead to systemic absorption include: intravenous, subcutaneous, intraperitoneal, intranasal, intrathecal and ophthalmic.
- Each of these administration routes expose the ribozyme to an accessible diseased tissue.
- Subcutaneous administration drains into a localized lymph node which proceeds through the lymphatic network into the circulation.
- the rate of entry into the circulation has been shown to be a function of molecular weight or size.
- the use of a liposome or other drug carrier localizes the ribozyme at the lymph node.
- the ribozyme can be modified to diffuse into the cell, or the liposome can directly participate in the delivery of either the unmodified or modified ribozyme to the cell.
- a liposome formulation containing phosphatidyl- ethanolomidomethylthiosuccinimide which can deliver oligonucleotides to lymphocytes and macrophages is useful for certain conditions. Furthermore, a 200 nm diameter liposome of this composition was internalized as well as 100 nm diameter liposomes. The 200 nm liposomes exhibit a ten-fold greater packaging capacity than the 100 nm liposomes and can accommodate larger molecules such as a ribozyme expression vector. This ribozyme delivery system prevents mRNA expression in afflicted primary immune cells. Whole blood studies show that the formulation is taken up by 90% of the lymphocytes after 8 hours at 37°C.
- Most preferred delivery methods include liposomes (10-400 nm) , hydrogels, controlled-release polymers, microinjection or electroporation (for ex vivo treatments) and other pharmaceutically applicable vehicles.
- the dosage will depend upon the disease indication and the route of administration but should be between 100-200 mg/kg of body weight/day.
- the duration of treatment will extend through the course of the disease symptoms, possibly continuously.
- the number of doses will depend upon disease delivery vehicle and efficacy data from clinical trials.
Abstract
An enzymatic RNA molecule which cleaves mRNA associated with development of maintenance of an inflammatory disease, an arthritic condition, a stenotic condition, or a cardiovascular condition.
Description
DESCRIPTION
METHOD AND REAGENT FOR TREATMENT OF ANIMAL DISEASES
Background of the Invention This invention relates to methods for inhibition of various animal diseases, including: a) inflammatory disease, in particular the inhibition of genetic expression which leads to the reduction or elimination of immune cell proliferation in inflammation or pre- inflammatory conditions; b) osteoarthritis, in particular, inhibition of genetic expression which leads to a reduction or elimination of extracellular matrix digestion by matrix etalloproteinases; c) a stenotic condition, in particular the inhibition of genetic expression which leads to the reduction or elimination of cellular proliferation in the areas of restenotic plaques; and d) cardiovascular disease such as hypertension, and in particular, those mediated by angiotensin converting enzyme activity. Inflammatory disease
Inflammation is a tissue reaction to irritation, infection or injury marked by localized heat, swelling, redness, pain and sometimes loss of function. When tissues sustain physiological injury, the afflicted cells synthesize and/or release chemicals (cytokines and cellular adhesion molecules) which attract lymphoid cells and accelerate cell growth which is required for healing. The infiltration of lymphoid cells to the wound leads to the release of more biological response modifying molecules, which include vasoregulatory substances such as bradykinin and immunoregulatory molecules exemplified by the interleukin family of proteins. As healing occurs, the immune cell infiltration wanes and the inflammatory process ceases. Under certain physiological conditions, such as those observed in psoriasis, asthma, head injuries
and systemic inflammatory response syndrome (SIRS) , the condition persists because of inappropriate cellular controls. A persistent inflammatory condition may be acute or chronic and is generically referred to as inflammatory disease.
Inflammatory disease is exemplified by psoriasis, which is a skin disease caused by excessive growth of basal keratinocytes in the epidermis. It is believed that this uncontrolled growth of the keratinocytes results from stimulation by infiltrating T-cells. The conversion of normal skin to a psoriatic lesion is initiated by injury to the tissue and subsequent recognition of the injury by circulating immune cells. An acute inflammatory reaction ensues and results in the release of various cytokines and growth factors, including tumor necrosis factor alpha
(TNF-α) and interleukin-1 (IL-1) . A number of the cytokines released by infiltrating leukocytes induce production of cell adhesion molecules on the surface of the keratinocytes, while others induce the proliferation of basal keratinocytes and result in the release of keratinocyte factors which either auto-stimulate further growth or inhibit normal controls which limit keratinocyte proliferation. The injury further results in the local activation of T-cells which return to the circulation and may cause subsequent psoriatic conditions which are quite distant from the original site of injury.
Induction of the acute phase inflammatory reactants results in the production of IL-1 and TNF-alpha; both of these molecules induce the appearance of the T-cell homing proteins, I-CAM, ELAM-1 and VCAM-1 on the cell surface of keratinocytes. TNF-α also induces the production of TGF-α, IL-6 and IL-8 by the keratinocytes. The cytokines and growth factors produced by the keratinocytes and infiltrating leukocytes cause uncontrolled keratinocyte proliferation. As the basal layer keratinocytes proliferate, the suprabasal keratinocytes are pushed closer to the surface of the skin
where they normally form the cornified envelope layer and the stratum corneum. The abnormal rate of proliferation by the basal keratinocytes results in improper formation of the epidermis and stratum corneum and the ultimate development of the red, scaly appearance which is characteristic of psoriatic skin. The lack of keratinocyte growth regulation has been attributed to an unidentified mutation in a single gene or group of genes in which the keratinocytes no longer respond to the termination signal for wound healing.
There are 3 million patients in the United States afflicted with psoriasis. The available treatments for psoriasis are corticosteroids. The most widely prescribed are TEMOVATE (clobetasol propionate) , LIDEX (fluocinonide) , DIPROLENE (betamethasone propionate) , PSORCON (diflorasone diacetate) and TRIAMCINOLONE formulated for topical application. The mechanism of action of corticosteroids is multifactorial and probably not due to simple inhibition of cell replication. This is a palliative therapy because the underlying cause of the disease remains, and upon discontinuation of the treatment the disease returns. Discontinuation of treatment is often prompted by the appearance of adverse effects such as atrophy, telangiectasias and purpura. Corticosteroids are not recommended for prolonged treatments or when treatment of large and/or inflamed areas is required. Alternative treatments include retinoids, such as etretinate, which has been approved for treatment of severe, refractory psoriasis. Alternative retinoid-based treatments are in advanced clinical trials. Retinoids act by converting keratinocytes to a differentiated state and restoration of normal skin development. Immunosuppressive drugs such as cyclosporine are also in the advanced stages of clinical trials. Due to the nonspecific mechanism of action of corticosteroids, retinoids and immunosuppressives, all current treatments of psoriasis exhibit severe side effects and should not be used for
extended periods of time unless the condition is life- threatening or disabling. There is a need for a less toxic, effective therapeutic agent in psoriatic patients. Asthma affects nearly 5% of the population in industrialized nations, yet it is underdiagnosed and undertreated. There is evidence that the incidence and prevalence of asthma are rising. These trends are occurring despite increases in the available therapies for asthma, which suggests that current methods of treating asthma are inadequate or not being utilized appropriately. Recently, it has been recognized that chronic asthma involves a characteristic inflammatory response in the airways.
Although it has long been acknowledged that fatal asthma is associated with inflammatory changes in the submucosal surfaces of the airways, it is now apparent that inflammation is present in patients with very mild asthma. Biopsies of patients have shown that infiltration of immune cells, especially eosinophils and lymphocytes, and epithelial shedding are prominent features. Further, there is a strong correlation between the degree of eosinophilia and the degree of bronchial hyperresponsiveness. Eosinophils are localized to areas of epithelial damage in the airways of patients. The basic proteins released by the eosinophils may be responsible for the damage observed in these patients. The role of mast cells and neutrophils in the disease is uncertain. Lymphocytes are present at the sites of tissue damage, but their role may be as mediators to amplify the eosinophilic response. In fact, interleukin-5, which is released by T-lymphocytes, is important in retaining and priming eosinophil action in the airway. Arthritis
There are several types of arthritis, with osteoarthritis and rheumatoid arthritis being predominant. Osteoarthritis is a slowly progressive disease characterized by degeneration of articular cartilage with
proliferation and remodeling of subchondral bone. It presents with a clinical picture of pain, deformity, and loss of joint motion. Rheumatoid arthritis is a chronic systemic inflammatory disease. Rheumatoid arthritis may be mild and relapsing or severe and progressive, leading to joint deformity and incapacitation.
Arthritis is the major contributor to functional impairment among the older population. It is the major cause of disability and accounts for a large proportion of the hospitalizations and health care expenditures of the elderly. Arthritis is estimated to be the principal cause of total incapacitation for about one million persons aged 55 and older and is thought to be an important contributing cause for about one million more. Estimating the incidence of osteoarthritis is difficult for several reasons. First, osteoarthritis is diagnosed objectively on the basis of reading radiographs, but many people with radiologic evidence of disease have no obvious symptoms. Second, the estimates of prevalence are based upon clinical evaluations because radiographic data is not available for all afflicted joints. In the NHANESI survey of 1989, data were based upon a thorough musculoskeletal evaluation during which any abnormalities of the spine, knee, hips, and peripheral joints were noted as well as other specific diagnoses. Based on these observations, 12% of the US population between 25 and 74 years of age have osteoarthritis.
It is generally agreed that rheumatoid arthritis has a world-wide distribution and affects all racial and ethnic groups. The exact prevalence in the US is unknown but has been estimated to range between 0.5% and 1.5%. Rheumatoid arthritis occurs at all age levels and generally increases in prevalence with advancing age. It is 2-3 times more prevalent in women than in men and peak incidence occurs between 40-60 years of age. In addition to i munological factors, environmental, occupational and
psychosocial factors have been studied for potential etiologic roles in the disease.
The extracellular matrix of multicellular organisms plays an important role in the formation and maintenance of tissues. The meshwork of the extracellular matrix is deposited by resident cells and provides a framework for cell adhesion and migration, as well as a permeability barrier in cell-cell communication. Connective tissue turnover during normal growth and development or under pathological conditions is thought to be mediated by a family of neutral metalloproteinases, which are zinc-containing enzymes that require calcium for full activity. The regulation of metalloproteinase expression is cell-type specific and may vary among species.
The best characterized of the matrix metalloproteinases, interstitial collagenase (MMP-1) , is specific for collagen types I, II, and III. MMP-1 cleaves all three α chains of the triple helix at a single point initiating sequential breakdown of the interstitial collagens. Interstitial collagenase activity has been observed in rheumatoid synovial cells as well as in the synovial fluid of patients with inflammatory arthritis. Gelatinases (MMP-2) represent a subgroup of the metalloproteinases consisting of two distinct gene products; a 70 kDa gelatinase expressed by most connective tissue cells, and a 92 kDa gelatinase expressed by inflammatory phagocytes and tumor cells. The larger enzyme is expressed by macrophages, SV-40 transformed fibroblasts, and neutrophils. The smaller enzyme is secreted by H-ras transformed bronchial epithelial cells and tumor cells, as well as normal human skin fibroblasts. These enzymes degrade gelatin (denatured collagen) as well as native collagen type XI. Stromelysin (MMP-3) has a wide spectrum of action on molecules composing the extracellular matrix. It digests proteoglycans, fibronectin, laminin, type IV and IX collagens and
gelatin, and can remove the N-terminal propeptide region from procollagen, thus activating the collagenase. It has been found in human cartilage extracts, rheumatoid synovial cells, and in the synovium and chondrocytes of joints in rats with collagen-induced arthritis.
Both osteoarthritis and rheumatoid arthritis are treated mainly with compounds that inhibit cytokine or growth-factor induced synthesis of the matrix metalloproteinases which are involved in the extracellular matrix destruction observed in these diseases. Current clinical treatments rely upon dexamethasone and retinoid compounds, which are potent suppressors of a variety of metalloproteinases. The global effects of dexamethasone and retinoid treatment upon gene expression in treated cells make the development of alternative therapies desirable, especially for long term treatments. Recently, it was shown that ga ma-interferon suppressed lipopolysaccharide induced collagenase and stromelysin production in cultured macrophages. Also, tissue growth factor-β (TGF-β) has been shown to block epidermal growth factor (EGF) induction of stromelysin synthesis in vitro. Experimental protocols involving gene therapy approaches include the controlled expression of the metalloproteinase inhibitors TIMP-1 and TIMP-2. Of the latter three approaches, only gamma-interferon treatment is currently feasible in a clinical application. Stenosis
Stenosis is the occurrence of a blockage in a blood vessel. Such blockages may lead to impairment of functions or even death, dependent upon which vessel it occurs in and its size. These may be prevented as described below. One example of this condition is restenosis. Restenosis is a disease state which occurs as a sequelae to percutaneous transluminal angioplasty (PCTA) or coronary artery bypass grafting (CABG) treatments of cardiovascular disease. The condition is caused, primarily, by the proliferation of smooth muscle cells
(atherophils) in the lamina propria layer of the intima in the vessel wall and secondarily, by the proliferation of other cell types present in the lamina propria. A secondary effect of the cellular proliferation is the increase in collagen and matrix protein synthesis. The cellular proliferation of the intimacytes and surrounding connective tissues results in intimal thickening, loss of vessel elasticity and reduction in blood flow through the afflicted region of the vessel. While inflammation may play a role in the pathology of restenosis, other pathologic mechanisms are involved and possibly represent the underlying cause of the disease. Pathologic mechanisms associated with restenosis can be divided into three categories based upon when the restenosis occurs. The three categories and their mechanisms are 1) pre- and post-PCTA: thrombosis, platelet activation and thrombin generation; 2) immediate, after PCTA: elastic recoil; and 3) delayed, after PCTA: fibrocellular proliferation. Acute or immediate restenosis occurs in approximately 10% of the patients undergoing PCTA and slower-developing restenosis (six month onset) occurs in approximately 30% of those patients. The estimated number of PCTA patients in 1990 was 300,000 - 400,000. Thus, there are about 150,000 cases of restenosis per year in the United States.
The presently preferred chemotherapeutic treatment of patients is the use of streptokinase, urokinase or other thrombolytic compounds, such as fish oil, anticoagulants, ACE (angiotensin converting enzyme) inhibitors, aspirin and cholesterol lowering compounds; alternative treatment includes the surgical incorporation of endoluminal stents. It is reported that none of the current therapies have significantly impacted the rates of restenosis occurrence. A number of compounds are currently in preclinical evaluations. Platelet inhibitors include GR32191, Sultroban, Ketanserin, and fish oil. Angiopeptin is being tested as a growth factor inhibitor
and Lovostatin, Enoxaparin, RD Heparin, Cilazapril and Fosinopril are being investigated as smooth muscle cell proliferation inhibitors. While platelet inhibitors are being tested for prevention of restenosis, it appears that these compounds will not be efficacious as short-term treatments. One of the biggest problems with current therapies is the occurrence of pharmacologic side-effects. These effects not only create other physiological problems, but also decrease the levels of patient compliance, thereby reducing the therapeutic efficacy of the treatments.
The proliferation of antherophils may be induced through a host of genetic activations, but the best candidate for targeting smooth muscle proliferation is the c-myb gene. The c-myb protein binds DNA and activates DNA replication and cellular growth. The role of c-myb in smooth muscle cell replication has been documented in bovine cells, and the expression of c-myb has been shown to activate cellular replication in chicken embryo fibroblasts and human T-lymphocytes.
Cellular growth factors may also play a role in local proliferation of intimacytes. Trauma to the area may induce the release of many factors such as TGF-β, PDGF, bFGF, endothelium-derived relaxing factor, CGRP and angiotensin II. Each of these factors could play a role in the induction of cellular proliferation in restenotic plaques, but these factors are soluble proteins which exert their effects through secondary messenger systems in the target cells. One such messenger system is the NF-KB cascade. NF-KB protein activates cellular transcription and induces increases in cellular synthetic pathways. In a resting cell, this protein is found in the cytoplasm, complexed with its inhibitor, 1KB. Upon phosphorylation of the 1KB molecule, the complex dissociates and NFKB is released for transport to the nucleus, where it binds DNA and induces transcriptional activity in (NF-KB) -responsive genes. One of the (NF-KB) -responsive genes is the NF-KB
gene. Thus, release of the NF-KB protein from the complex results in a cascade of gene expression which is auto- induced.
Summary of the Invention The invention features use of ribozy es to treat or prevent various animal diseases, in particular, those human diseases noted above.
One such disease is psoriasis, which can be treated, e.g. , by inhibiting the synthesis of tumor necrosis factor in activated lymphocytes, and basal keratinocytes. The invention also features use of ribozymes to treat chronic asthma, e.g. , by inhibiting the synthesis of IL-5 in lymphocytes and preventing the recruitment and activation of eosinophils. Cleavage of targeted mRNAs (tumor necrosis factor and IL-5 mRNAs) expressed in keratinocytes, T-lymphocytes, monocytes or macrophages inhibits the synthesis of tumor necrosis factor and IL-5, respectively.
A number of other cytokines may also be involved in the activation of inflammation in asthmatic patients, including platelet activating factor, IL-1, IL-3, IL-4, GM-CSF, TNFα, gamma interferon, ILAM-1, ELAM-1 and EoCSF. In addition to these cytokines, it is appreciated that any cellular receptors which mediate the activities of the cytokines are also good targets for intervention in inflammatory diseases. These targets include, but are not limited to, the IL-1R and TNFαR on keratinocytes, epithelial and endothelial cells in airways. Recent data suggest that certain neuropeptides may play a role in asthmatic symptoms. These peptides include substance P, neurokinin A and calcitonin-gene-related peptides. These target genes may have more general roles in inflammatory diseases, but are currently assumed to have a role only in asthma. Other genes which are considered to play a role in asthma are the c-myb and c-myc genes, which may be triggered to induce endothelial cell proliferation and contribute to blockage of the airways. Those skilled in
the art will recognize the other potential targets noted above are also suitable for treatment with ribozymes, which will reduce the risk or occurrence of inflammatory disease, such as the interleukins (1, 3, 4, 6, and 8), glycerol transferase, selectins (E-selectin, MEL-14) , cell adhesion molecules (ICAM-1, ELAM-1, VCAM-1, GMP-140, MAM), TGF-α, IL-1R, TGFCR, EoCSF, α-, β- or γ-interferon, EoCSF, GM-CSF and protein kinase C (PKC) .
In particularly preferred embodiments, a ribozyme to TNFα nucleotides 374 to 393 can be use to inhibit TNFα protein production. This region may not a very good region to target because of secondary RNA structure in this region. An adjoining region which begins at nucleotide 380 in the previous reference and extends to nucleotide 412 (408-440, our sequence numbers see below) appears to contain a relatively more accessible RNA structure, and therefore represents an improved target over the region between nucleotides 374-393 (402-421, our sequence numbers) . Another disease is arthritis, which can be treated by inhibition of collagenase and stromelysin production in the synovial membrane of joints. Ribozyme treatment can be a partner to current treatments which primarily target immune cells reacting to pre-existing tissue damage. Early ribozyme treatment which reduces the collagenase or stromelysin-induced damage can be followed by treatment with the anti-inflammatories or retinoids, if necessary. In this manner, expression of the proteinases can be controlled at both transcriptional and translational levels. Ribozyme treatment can be given to patients expressing radiological signs of osteoarthritis prior to the expression of clinical symptoms. Ribozyme treatment can impact the expression of stromelysin without introducing the non-specific effects upon gene expression which accompany treatment with the retinoids and dexamethasone. The ability of stromelysin to activate procollagenase indicates that a ribozyme which reduces
stromelysin expression can also be used in the treatment of both osteoarthritis (which is primarily a stromelysin- associated pathology) and rheumatoid arthritis (which is primarily related to enhanced collagenase activity) . While a number of cytokines and growth factors induce metalloproteinase activities during wound healing and tissue injury of a pre-osteoarthritic condition, these molecules are not preferred targets for therapeutic intervention. Primary emphasis is placed upon inhibiting the molecules which are responsible for the disruption of the extracellular matrix, because most people will be presenting radiologic or clinical symptoms prior to treatment. The most versatile of the metalloproteinases (the molecule which can do the most structural damage to the extracellular matrix, if not regulated) is stromelysin. Additionally, this molecule can activate procollagenase, which in turn causes further damage to the collagen backbone of the extracellular matrix. Under normal conditions, the conversion of prostromelysin to active stromelysin is regulated by the presence of inhibitors called TIMPs (tissue inhibitors of MMP) . Because the level of TIMP in synovial cells exceeds the level of prostromelysin and stromelysin activity is generally absent from the synovial fluid associated with non-arthritic tissues, the toxic effects of inhibiting stromelysin activity in non-target cells should be negligible.
Thus, the invention features use of ribozymes to treat or prevent arthritis, particularly osteoarthritis, e.g. , by inhibiting the synthesis of the prostromelysin molecule in synovial cells, or by inhibition of other matrix metalloproteinases discussed above. Cleavage of targeted mRNAs (stromelysin mRNAs) expressed in macrophages, neutrophils and synovial cells represses the synthesis of the zymogen form of stromelysin, prostromelysin. Those in the art will recognize the other potential targets discussed above are also suitable for
treatment with ribozymes, which will reduce the risk or occurrence of pathologic degradation of the extracellular matrix such as the collagenase and gelatinase metalloproteinases, other proteinases which can activate the proenzyme forms of the metalloproteinases in synovial fluid or cartilaginous cells, cytokines or growth factors which activate the expression of the metalloproteinases and adhesion molecules which attract macrophage and neutrophils to the areas of tissue injury. Another disease is stenosis, which is treated, e.g. , by inhibiting the activation of smooth muscle proliferation by inhibiting the expression of the cellular c-myb gene. Cleavage of targeted mRNAs (c-myb mRNAs) expressed in endothelial cells and smooth muscle cells represses activation of cellular replication and abnormal proliferation of the smooth muscle or endothelial cells. Other potential targets suitable for treatment with ribozymes, which will reduce the risk or occurrence of cellular proliferation in the areas of restenotic risk include mRNAs encoding TGF-β, NF-KB, PDGF, bFGF, endothelium-derived relaxing factor, CGRP, and angiotensin II.
Yet another disease is cardiovascular disease, which can be treated, e.g. , by inhibiting the activation of angiotensin by angiotensin converting enzyme (ACE) , or by inhibition of the activity of endothelin converting enzyme (ECE) . Cleavage of targeted mRNAs (ACE mRNAs) expressed in endothelial cells elicits decreased levels of the vasoactive form of angiotensin. Those in the art will recognize many other potential targets suitable for treatment with ribozymes, which will reduce the risk or occurrence of cardiovascular disease, such as mRNAs encoding HMG CoA reductase, renin, bradykinin, plasminogen, factors IX, X and II, 2-5A synthetase, ADH and fibrinogen.
Ribozymes are RNA molecules having an enzymatic activity which is able to repeatedly cleave other separate
RNA molecules in a nucleotide base sequence specific manner. It is alleged that such enzymatic RΝA molecules can be targeted to virtually any RΝA transcript and efficient cleavage has been achieved in vitro . Kim et al., 84 Proc. Νatl. Acad. Sci. USA 8788, 1987; Haseloff and Gerlach, 334 Nature 585, 1988; Cech, 260 JAMA 3030, 1988; and Jefferies et al., 17 Nucleic Acids Research 1371, 1989.
Ribozymes act by first binding to a target RNA. Such binding occurs through the target RNA binding portion of a ribozyme which is held in close proximity to an enzymatic portion of the RNA which acts to cleave the target RNA. Thus, the ribozyme first recognizes and then binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After a ribozyme has bound and cleaved its RNA target it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
The enzymatic nature of a ribozyme is advantageous over other technologies, such as antisense technology (where a nucleic acid molecule simply binds to a nucleic acid target to block its translation) since the effective concentration of ribozyme necessary to effect a therapeutic treatment is lower than that of an antisense oligonucleotide. This advantage reflects the ability of the ribozyme to act enzymatically. Thus, a single ribozyme molecule is able to cleave many molecules of target RNA. In addition, the ribozyme is a highly specific inhibitor, with the specificity of inhibition depending not only on the base pairing mechanism of binding, but also on the mechanism by which the molecule inhibits the expression of the RNA to which it binds. That is, the inhibition is caused by cleavage of the RNA target and so specificity is defined as the ratio of the rate of cleavage of the targeted RNA over the rate of
cleavage of non-targeted RNA. This cleavage mechanism is dependent upon factors additional to those involved in base pairing. Thus, it is thought that the specificity of action of a ribozyme is greater than that of antisense oligonucleotide binding the same RΝA site.
This class of chemicals exhibits a high degree of specificity for cleavage of the intended target mRΝA. Consequently, the ribozyme agent will only affect cells expressing that particular gene, and will not be toxic to normal tissues.
The invention can be used to treat or prevent (prophylactically) psoriasis, asthma and other inflammatory diseases, and restenosis or other cardiovascular conditions, including hypertension. The preferred administration protocol is in vivo administration to reduce the level of those genes and the encoded mRΝAs noted above.
Thus, in the first aspect, the invention features an enzymatic RΝA molecule (or ribozyme) which cleaves mRΝA associated with development or maintenance of a psoriatic or asthmatic condition, e.g. , mRΝA encoding TΝF-α, IL-5, IL-1, IL-3, IL-4, IL-6, IL-8, glycerol transferase, selectins, E-selectin, MEL-14, ICAM-1, ELAM-1, VCAM-1, GMP-140, MAM, TGFα, TΝFαR, IL-lR, α-, β- or γ-interferon, GM-CSF and protein kinase C, and in particular, those mRNA targets disclosed in Table 1.
Table 1
TΝF-α mRΝA Nucleotide
Number Sequence SEQ.ID.NO.
27 CAGCAGAGGACCAGCUA ID.NO. 01
56 GCAACUACAGACCC ID.NO. 02
70 CCCCUGAAAACAACCCUCAGACGC ID.NO. 03 94 CACAUCCCCUGACAAGCUGCCAGGCAGG ID.NO. 04
134 CACAUACUGACCCA ID.NO. 05
157 CCUCUCUCCCCUGGAAAGG ID.NO. 06
176 ACACCAUGAGCACUGAAAGCAUGAUCCGGGAC
253 GCCCCAGGGCUCCAGGC
270 GGUGCUUGUUCCUCAGCCUCUUC
311 CCACCACGCUCUUC 362 AAGAGUUCCCCAG
408 AGUCAGAUCAUCUUCUCGAACCCCGAGUGACAA
446 UAGCCCAUGUUGUAGCAAACCCUCAAGCUGAGGG
574 UACCUCAUCUACUCC
599 UCAAGGGCCAAGGCUGCCCCUC 621 CACCCAUGUGCUCCUCACCCA
652 CGCAUCGCCGUCUCCUACCAGACCAA
694 GCCAUCAAGAG
824 CCGACUAUCUCGACUUUGCC
869 UCAUUGCCCUGUGAGGAGGACGAACAUCCAACCU 991 CUUAGGGUCGGAACCCAA
1043 AAACCUGGGAUUCAGGAA
1084 CUGGCAACCACUAAGAAU
1115 UCCAGAACUCACUGG
1187 UGGCCAGAAUGCUGCAGGACUUGAGA 1213 AGACCUCACCUAGAAAUUGACACAAGU
1276 CUUCCUUGAGA
1322 UCUAUUUAUGUUUGCACUUGUG
1344 AUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUA
1378 CAGAUGAAUGUAUUUAUUU 1402 ACCGGGGUAUCC
1419 GACCCAAUGUAGGAGCUGCCUUGGCUCAG
1495 AGCCCCCUGGC
1513 CCUUCUUUUGAUUAUGUUUUUUAAAAUAUUUAUC
1557 GUCUAAACAAUGCU 1587 GUCACUCAUUGCUGAG
1639 CUACUAUUCAGU
1656 GAAAUAAAGUUUGCUU
IL-5 mRNA Nucleotide Number Sequence SEP.ID.NO.
10 CUUUGCCAAAGGCAAAC ID.NO. 39
33 CGUUUCAGAGCCAUGAGGAUGC ID.NO. 40
61 AUUUGAGUUUGCUAGCUCUUGGAGCUG ID.NO. 41
88 CCUACGUGUAUGCCAUCC ID.NO. 42
139 AGACCUUGGCACUG ID.NO. 43 158 UACUCAUCGAACUCUGCUGAUA ID.NO. 44
209 UGUACAUAAAAA ID.NO. 45
275 AAACUGUGCAA ID.NO. 46
299 AAAGACUAUUCAAAAACUUGUCC ID.NO. 47
370 AGACGGAGAGUAAACCAAUUCCUAGACUACCUGC ID.NO. 48 522 AAGAAAGAGUCA ID.NO. 49
558 ACUUCAGAGGGAAAG ID.NO. 50
578 AUUUCAGGCAUACUGACACUUUGCCAGAAAGCA ID.NO. 51
635 AUAUCAGAAUCA ID.NO. 52
667 CAAAAUUGAUAUACUUUUUUCUUAUUUAA ID.NO. 53 738 GAAAUGGUUAAGAAUUUG ID.NO. 54
In a second aspect, the invention features and enzymatic RNA molecule which cleaves mRNA associated with development and maintenance of osteoarthritis or other pathological conditions which are mediated by metalloproteinase activation. The preferred administration protocol is in vivo administration to reduce the level of stromelysin activity.
Thus, in this aspect, the invention features an enzymatic RNA molecule (or ribozyme) which cleaves mRNA associated with development or maintenance of an arthritic condition, e.g. , mRNA encoding stromelysin, and in particular, those mRΝA targets disclosed in Table 2. Table 2
Nucleotide
Number Sequence SEQ. ID. NO.
20 UAGAGCUAAGUAAAGCCAG ID.NO. 01 126 ACACCAGCAUGAA ID.NO. 02
147 AGAAAUAUCUAGA ID.NO. 03
171 ACCUCAAAAAAGAUGUGAAACAGU ID.NO. 04
240 AAAUGCAGAAGUUC ID.NO. 05
287 GACACUCUGGAGGUGAUGCGCAAGCCCAGGUGU ID.NO. 06
327 CUGAUGUUGGUCACUUCAGAAC ID.NO. 07
357 GCAUCCCGAAGUGGAGGAAAACCCACCUUACAU ID.NO. 08 402 AUUAUACACCAGAUUUGCCAAAAGAUG ID.NO. 09
429 CUGUUGAUUCUGCUGUUGAGA ID.NO. 10
455 CUGAAAGUCUGGGAAGAGGUGA ID.NO. 11
513 CUGAUAUAAUGA ID.NO. 12
592 UGCCUAUGCCCC ID.NO. 13 624 AUGCCCACUUUGAUGAUGAUGAACAAUGGACA ID.NO. 14
679 AUUUCUCGUUGCUGCUCAUG ID.NO. 15
725 CACUCAGCCAACACUGA ID.NO. 16
801 AAGAUGAUAUAAAUGGCAUUCAGUCC ID.NO. 17
827 CUCUAUGGACCUCCCCCUGACUCCCCU ID.NO. 18 859 CCCCCUGGUACCCA ID.NO. 19
916 UCCUGCUUUGUCCUUUGAUGCUGUCAGCAC ID.NO. 20
958 AAUCCUGAUCUUUAAAGA ID.NO. 21
975 CAGGCACUUUUGGCGCAAAUCCC ID.NO. 22
1018 AUUGCAUUUGAUCUCUUCAUUUUGGCCAUC ID.NO. 23 1070 GCAUAUGAAGUUA ID.NO. 24
1203 AAAUCGAUGCAGCCAUUUCUGA ID.NO. 25
1274 UUUGAUGAGAAGAGAAAUUCCAUGGAGC ID.NO. 26
1302 CAGGCUUUCCCAAGCAAAUAGCUGAAGAC ID.NO. 27
1420 CCCAAAUGCAAAG ID.NO. 28 1485 AUGUAGAAGGCACAAUAUGGGCACUUUAAA ID.NO. 29
1623 UCUUGCCGGUCAUUUUUAUGUUAU ID.NO. 30
1665 GCUGCUGCUUAGC ID.NO. 31
1733 CAACAGACAAGUGACUGUAUCU ID.NO. 32
1769 CUUAUUUAAUA ID.NO. 33
In the third aspect, the invention features an enzymatic RNA molecule (or ribozyme) which cleaves mRNA associated with development or maintenance of a restenotic condition, e.g. , mRNA encoding c-myb (or other mRNAs noted above) , and in particular, those mRNA targets disclosed in Table 3.
Table 3
Nucleotide
Number Seguence Seq. ID. No. 1 GGCGGCAGCGCCCUGCCGACGCCGGGG ID.NO.01
77 CCGCGGCUCUCGGC ID.NO.02
111 GCCAUGGCCCGAA ID.NO.03
129 CGGCACAGCAUAUAUAGCAGUGACGAGGA ID.NO.04
165 GACUUUGAGAUGUGUGACCAUGACUAUGAUGGG ID.NO.05 211 CUGGAAAGCGUC ID.NO.06
248 GGAAGAGGAUGAAAAACUGAAGAAG ID.NO.07
267 GAAGAACUGGUGGAACAGAAUGGAAC ID.NO.08
299 CUGGAAAGUUAUUGCCAA ID.NO.09
323 CCCGAAUCGAACAGAUGUGCAG ID.NO.10 362 GAAAGUACUAAACCCUGAG ID.NO.11
394 CUUGGACCAAAGAAGAAGAUCAGAGAGUGAUA ID.NO.12
433 ACAGAAAUACGGUCCGAAACGUUGGUCUG ID.NO.13
463 UUAUUGCCAAGCACUUAAAGGGGAGAAUUGGAA ID.NO.14
527 GAAUCCAGAAGUUAAGAA ID.NO.15 563 GGAAGACAGAAUUAUUUACCAGGCACA ID.NO.16
590 CAAGAGACUGGGGAACAGAU ID.NO.17
616 AAAUCGCAAAGCUA ID.NO.18
636 GGACGAACUGAUAAUGCUAUCAAGAACC ID.NO.19
664 ACUGGAAUUCUACAAUGCGUCGGAAGGUCGAACA ID.NO.20 732 CAGCCAGCAGUGGCCACAA ID.NO.21
768 CAUUUGAUGGGUUUUGCUCAGGCUCCGCCUACA ID.NO.22
801 GCUCAACUCCCUGCCACUGGCCAGCCC ID.NO.23
834 AACAACGACUAUUCCUAUUACCACA ID.NO.24
870 CAAAAUGUCUCCAGUCAUGUUCCAUACCCU ID.NO.25 914 AAAUAUAGUCAAUGUCCCUCAGCCAGCUGCCGCA ID.NO.26
955 AGAGACACUAUAAUGAUGAAGACCCUGAGAAGGA ID.NO.27
989 AAAGCGAAUAAAGGAAUUAGAAUUG ID.NO.28
3179 CGGUGUACUUACUGCC ID.NO.29
1036 AGCUAAAAGGACAGCAGGUGCUACCAACACAGAA ID.NO.30 1086 CCCGGGUGGCACAGCACCACCAUUGCCGACCACA ID.NO.31
1162 AACACCACUCCACUCCAUCUCUGCCAGCGGAUCC ID.NO.32
1204 UACCUGAAGAAA ID.NO.33
1236 AUGAUCGUCCACCAGGGCACCAUU ID.NO.34
1291 CAGAAACACUCCAAUUUA ID.NO.35
1343 AAACUCAGACU ID.NO.36
1359 AUGCCUUCUUUAAC ID.NO.37 1405 UUACAACACCA ID.NO.38
1440 ACUCAAAAGGAAAAUACUGUUUUUAGAACCC ID.NO.39
1471 CAGCUAUCAAAAGGUCAAUCUUAGAAAGCU ID.NO.40
1501 CUCCAAGAACUCCUACACCAUUCAA ID.NO.41
1526 ACAUGCACUUGCAGCUCAAGAA ID.NO.42 1554 UACGGUCCCCUGAAGAUGCUACCUCAGA ID.NO.43
1582 CACCCUCUCAUCUAGUAGAAGAUCUGCAGGA ID.NO.44
1618 UCAAACAGGAAUCUGAUGAAUCUGGA ID.NO.45
1660 AAGAAAAUGGA ID.NO.46
1676 CUUACUGAAGAAAAUCAAACAAGA ID.NO.47 1705 AAUCUCCAACUGAUAAAUCAG ID.NO.48
1738 GCUCACACCACUGGGA ID.NO.49
1789 CCUCGCCUGUGCGAGAUGCACCGAAUAUUC ID.NO.50
1838 GGCACCAGCAUCAGAAGAUGAAGAC ID.NO.51
1876 CAUUUACAGUACC ID.NO.52 1900 CCCUGGCGAGCCCCUUGCA ID.NO.53
1919 GCCUUGUAGCAGUACCUGGGA ID.NO.54
1984 GUCAAGCUCGUAAAUACGUGAA ID.NO.55
2067 GAACAGUUCAA ID.NO.56
2106 AUGAAACUUUUCAU ID.NO.57 2229 AAAAUAAAUAACAGUC ID.NO.58
2265 UGAAUUGUAGCC ID.NO.59
2282 UUAAUAUCUUAAU ID.NO.60
2325 AUUUAUCUGGUAUUUUAAAGGAUCCAACAGAUC ID.NO.61
2410 CCAGUAUUUCA ID.NO.62 2426 CUCGAUCACUAAACAUAUG ID.NO.63
2445 CAUAUAUUUUUAAAAAUC ID.NO.64
2695 UGCUAUGGUCUUAGCCU ID.NO.65
2726 AGUAUCAGAGG ID.NO.66
2776 UAGGUAAUUGACUAU ID.NO.67 2798 UAUUUCAGACUUUUUAAUUUUAUAUAUAUAUACA ID.NO.68
2847 CAAUACAUUUGAAAACUUGUUUGGGAGACUCUGC ID.NO.69
2891 GUGGUUUUUUUGUUAUUGUUGGUUU ID.NO.70
2935 UUCUUUUUUGGGAGAU ID.NO.71
2967 CUAUGUUUUGUUUUG ID.NO.72
2987 AGCCUGACUGUUUUAUA ID.NO.73
3016 UCGAUUUGAUC ID.NO.74 3072 UGGAUCCUGUGUU ID.NO.75
3111 UUGAUAGCCAGUCACUGCCUUAAGA ID.NO.76
3136 ACAUUUGAUGCAAGAUGGCCAGCACU ID.NO.77
In a fourth aspect, the invention features an enzymatic RNA molecule (or ribozyme) which cleaves mRNA associated with development or maintenance of a cardiovascular condition, e.g. , mRNA encoding ACE or
ECE, and in particular, those mRNA targets disclosed in Table 4. Table 4
Nucleotide
Number Sequence
38 GCUACUGCAGGACUUCCCAGC 59 CUCCUCUUCCUGCUGCUCGCUAGG
105 GCCAGGAGGCAUC
120 AACAGGUGACAGUCACCCAUG
210 CCCAGAGCCCAAACCUGGUGA
247 CAGCAAGUUUGUGGAGGAAUAUGA 271 CCGGACAUCCCA
292 GAACGAGUAUGCCGAGGCC
311 AACUGGAACUACAACAC
341 GAGACCAGCAAGAUUCUGCUG
369 ACAUGCAAAUAG 387 ACACCCUGAAGUACGGCACCCAG
424 GUGAACCAGUUGCAGAACACCACUA
474 AGGACCUAGAA
491 GCGCUGCCUGCCCAGGAGCUGGAG
515 GAGUACAACAAGAUCCUGUUGGA 535 GGAUAUGGAAACCACCUACAGC
564 CUGUGUGCCACCCGAAUGGC
598 CGAGCCAGAUCUGACGAAUGUGAUG
627 CAUCCCGGAAAUAUGAAGACCUG
646 CCUGUUAUGGGCAUGGG
667 CUGGCGAGACAAGGCGGG
706 CCCGAAAUACG 725 AUCAACCAGG
755 GUAGAUGCAGGGGACUC
775 AGGUCUAUGUACGAGACACCAUCC
831 AGCUGCAGCCACUCUACCUCAAC
844 CUGCAUGCCUACGUGCGCCG 899 CAGCAUCAAC
921 CCAUUCCUGCUCAC
956 CAGACCUGGUCCAAC
971 AUCUAUGACUUGGUGG
996 CUUCAGCCCCCUCGAUGGAC 1015 CACCACAGAGGCUAUGCUAA
1040 GGCUGGACGC
1054 GAGGAUGUUUAAGGAGGCUGAUGA
1071 CUGAUGAUUUCUUCACCUCC
1107 UGCCUCCUGAGUUCUGGAACA 1127 AAGUCGAUGCUGGAGAAG
1173 ACGCCUCGGCCUGGGACUUCUACAA
1203 AGGACUUCCGGAUCAAGCAGUGCA
1227 CCACCGUGAACUUGGAGGACCUGG
1275 AC UCCAGUAUUUC 1291 GCAGUACAAAGACUUACCUGUGG
1315 CUUGAGGGAGGGUGCCAACC
1335 CCGGCUUCCAUGAGGCCAUUGG
1358 GACGUGCUAG
1376 GUGUCUACGCCCAAGCACCUGCACA 1401 GUCUCAACCUGCUGAGCAG
1429 CAGCGACGAGCAUGACAUCAAC
1450 CUUUCUGAUGAAGAUGGCCCUUG
1469 CUUGACAAGAUCGCC
1500 ACCUCGUCGAUCAGUGGCG 1536 GAAGCAUCACC
1553 AACUAUAACCAGGAGUGG
1565 GCCUCAGGCUGAAGUA
1591 CCAGGGCCUCUGCCCCCCAG ID.NO. 57
1616 AGGACUCAAGGUGAC ID.NO. 58
1630 CUUUGACCCAGGGGCC ID.NO. 59
1662 CUAGCGUGCCUUAC ID.NO. 60 1699 CAUCCAGUUCCAGUUCCACG ID.NO. 61
1701 GUUCCACGAGGCACUG ID.NO. 62
1749 GCCCCCUGCACAAGUGUGACAUC ID.NO. 63
1771 CUACCAGUCCAAGGAG ID.NO. 64
1894 GAGCUACUUCAAGCUGCUGG ID.NO. 65 1915 GGACUGGCUCCGCACGG ID.NO. 66
1968 AGUACAACUGGACGCC ID.NO. 67
1984 GAACUCCGCUCGCUCAGAAGG ID.NO. 68
2005 GCCCCUCCCAGACAG ID.NO. 69
2046 ACCUGGAUGCGCAGCA ID.NO. 70 2076 AGUGGCUGCUGC ID.NO. 71
2101 CGCCCUGCUGGUAGCCACCC ID.NO. 72
2147 AUCCGCCACCGCAGCCUCC ID.NO. 73
2212 ACACUCCUGAGGUGACCCGG ID.NO. 74
2316 GCCCACCCUGC ID.NO. 75 2337 CUGUCCCUGUCCCCCUCCCC ID.NO. 76
2365 CUCCAGACCACC ID.NO. 77
2386 AGCCCCUUCUCCCAGCACAC ID.NO. 78
2408 CUGCCUGACACUGAGCCC ID.NO. 79
2426 CACCUCUCCAAGUCUCUCUG ID.NO. 80 2446 UGAAUACAAUUAAAGGUCCUG ID.NO. 81
By "enzymatic RNA molecule" it is meant an RNA molecule which has complementarity in a substrate binding region to a specified mRNA target, and also has an enzymatic activity which is active to specifically cleave that mRNA. That is, the enzymatic RΝA molecule is able to intermolecularly cleave mRΝA and thereby inactivate a target mRΝA molecule. This complementarity functions to allow sufficient hybridization of the enzymatic RΝA molecule to the target RΝA to allow the cleavage to occur. One hundred percent complementarity
is preferred, but complementarity as low as 50-75% may also be useful in this invention. For in vivo treatment, complementarity between 30 and 45 bases is preferred. In preferred embodiments, the enzymatic RNA molecule is formed in a hammerhead motif, but may also be formed in the motif of a hairpin, hepatitis delta virus, group I intron or RNaseP-like RNA (in association with an RNA guide sequence) . Examples of such hammerhead motifs are described by Rossi et al., 8 Aids Research and Human Retroviruses 183, 1992, of hairpin motifs by Hampel and Tritz, 28 Biochemistry 4929, 1989; and Hampel et al., 18 Nucleic Acids Research 299, 1990, and an example of the hepatitis delta virus motif is described by Perrotta and Been, 31 Biochemistry 16,
1992, of the RNaseP motif by Guerrier-Takada et al., 35 Cell 849, 1983, and of the group I intron by Cech et al., U.S. Patent 4,987,071. These specific motifs are not limiting in the invention and those skilled in the art will recognize that all that is important in an enzymatic RNA molecule of this invention is that it has a specific substrate binding site which is complementary to one or more of the target gene RNA regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart an RNA cleaving activity to the molecule.
In a related aspect, the invention features a mammalian cell which includes an enzymatic RNA molecule as described above. Preferably, the mammalian cell is a human cell.
In another related aspect, the invention features an expression vector which includes nucleic acid encoding an enzymatic RNA molecule described above, located in the vector, e.g. , in a manner which allows expression of that enzymatic RNA molecule within a mammalian cell.
In yet another related aspect, the invention features a method for treatment of a disease noted above by administering to a patient an enzymatic RNA molecule as described above. The invention provides a class of chemical cleaving agents which exhibit a high degree of specificity for the mRNA causative of a psoriatic or arthritic or cardiovascular condition. Such a condition includes any measurable indication of susceptibility to cardiac problems, and thus includes predisposition to such conditions or cardiovascular disease. Such enzymatic RNA molecules can be delivered exogenously or endogenously to infected cells. In the preferred hammerhead motif the small size (less than 40 nucleotides, preferably between 32 and 36 nucleotides in length) of the molecule allows the cost of treatment to be reduced.
The smallest ribozyme delivered for any type of treatment reported to date (by Rossi et al. , 1992, supra) is an in vi tro transcript having a length of 142 nucleotides. Synthesis of ribozymes greater than 100 nucleotides in length is very difficult using automated methods, and the therapeutic cost of such molecules is prohibitive. Delivery of ribozymes by expression vectors is primarily feasible using only ex vivo treatments. This limits the utility of this approach. In this invention, an alternative approach uses smaller ribozyme motifs (e.g. , of the hammerhead structure, shown generally in Fig. 1) and exogenous delivery. The simple structure of these molecules also increases the ability of the ribozyme to invade targeted regions of the mRNA structure. Thus, unlike the situation when the hammerhead structure is included within longer transcripts, there are no non-ribozyme flanking sequences to interfere with correct folding of the ribozyme structure, as well as complementary binding of the ribozyme to the mRNA target.
The enzymatic RNA molecules of this invention can be used to treat psoriatic or pre-psoriatic, asthmatic or pre-asthmatic, arthritic or prearthritic, stenotic or prestenotic conditions. Such treatment can also be extended to other related genes in nonhuman primates. Affected animals can be treated at the time of disease risk or detection, or in a prophylactic manner. This timing of treatment will reduce the chance of further disease damage. Ribozymes of this invention may be used as diagnostic tools to examine genetic drift and mutations within diseased cells. The close relationship between ribozyme activity and the structure of the target RNA allows the detection of mutations in any region of the molecule which alters the base-pairing and three- dimensional structure of the target RNA. By using multiple ribozymes described in this invention, one may map nucleotide changes which are important to RNA structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with ribozymes may be used to inhibit gene expression and define the role (essentially) of specified gene products in the progression of disease. In this manner, other genetic targets may be defined as important mediators of the disease. These experiments will lead to better treatment of the disease progression by affording the possibility of combinational therapies (e.g. , multiple ribozymes targeted to different genes, ribozymes coupled with known small molecule inhibitors, or intermittent treatment with combinations of ribozymes and/or other chemical or biological molecules) .
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.
Description of the Preferred Embodiments The drawing will first briefly be described. Drawing
Fig. 1 is a diagrammatic representation of a hammerhead motif ribozyme showing stems I, II and III (marked (I) , (II) and (III) respectively) interacting with a target region. The 5' and 3' ends of both ribozyme and target are shown. Dashes indicate base- paired nucleotides. Target Sites
Ribozymes targeting selected regions of mRNA associated with a selected disease are chosen to cleave the target RNA in a manner which preferably inhibits translation of the RNA. Genes are selected such that inhibition of translation will preferably inhibit cell replication, e.g. , by inhibiting production of a necessary protein. Selection of effective target sites within these critical regions of mRNA entails testing the accessibility of the target RNA to hybridization with various oligonucleotide probes. These studies can be performed using RNA probes and assaying accessibility by cleaving the hybrid molecule with RNaseH (see below) . Alternatively, such a study can use ribozyme probes designed from secondary structure predictions of the mRNAs, and assaying cleavage products by polyacrylamide gel electrophoresis (PAGE) , to detect the presence of cleaved and uncleaved molecules.
The following is but one example of a method by which suitable target sites can be identified and is not limiting in this invention. Generally, the method involves identifying potential cleavage sites for a hammerhead ribozyme, and then testing each of these sites to determine their suitability as targets by ensuring that secondary structure formation is minimal. The mRNA sequences are compared in an appropriate target region. Putative ribozyme cleavage sites are found. These sites represent the preferable
sites for hammerhead ribozyme cleavage within these target mRNAs.
Short RNA substrates corresponding to each of the mRNA sites are designed. Each substrate is composed of two to three nucleotides at the 5' and 3' ends that will not base pair with a corresponding ribozyme recognition region. The unpaired regions flanked a central region of 12-14 nucleotides to which comple¬ mentary arms in the ribozyme are designed. The structure of each substrate sequence is predicted using a standard PC fold computer program. Sequences which give a positive free energy of binding are accepted. Sequences which give a negative free energy are modified by trimming one or two bases from each of the ends. If the modified sequences are still predicted to have a strong secondary structure, they are rejected.
After substrates are chosen, ribozymes are designed to each of the RNA substrates. Ribozyme folding is also analyzed using PC fold.
Ribozyme molecules are sought which form hammerhead motif stem II (see Fig. 1) regions and contain flanking arms which are devoid of intramolecular base pairing. Often the ribozymes are modified by trimming a base from the ends of the ribozyme, or by introducing additional base pairs in stem II to achieve the desired fold. Ribozymes with incorrect folding are rejected. After substrate/ribozyme pairs are found to contain correct intramolecular structures, the molecules are folded together to predict intermolecular interactions. A schematic representation of a ribozyme with its coordinate base pairing to its cognate target sequence is shown in Fig. 1.
Those targets thought to be useful as ribozyme targets can be tested to determine accessibility to nucleic acid probes in a ribonuclease H assay (see below) . This assay provides a quick test of the use of
the target site without requiring synthesis of a ribozyme. It can be used to screen for sites most suited for ribozyme attack. Synthesis of Ribozymes Ribozymes useful in this invention can be produced by gene transcription as described by Cech, supra, or by chemical synthesis. Chemical synthesis of RNA is similar to that for DNA synthesis. The additional 2'-OH group in RNA, however, requires a different protecting group strategy to deal with selective 3'-5' internucleotide bond formation, and with RNA susceptibility to degradation in the presence of bases. The recently developed method of RNA synthesis utilizing the t-butyldimethylsilyl group for the protection of the 2' hydroxyl is the most reliable method for synthesis of ribozymes. The method reproducibly yields RNA with the correct 3'-5' internucleotide linkages, with average coupling yields in excess of 99%, and requires only a two-step deprotection of the polymer.
A method, based upon H-phosphonate chemistry of phosphoroamidites gives a relatively lower coupling efficiency than a method based upon phosphoroamidite chemistry. This is a problem for synthesis of DNA as well. A promising approach to scale-up of automatic oligonucleotide synthesis has been described recently for the H-phosphonates. A combination of a proper coupling time and additional capping of "failure" sequences gave high yields in the synthesis of oligodeoxynucleotides in scales in the range of 14 μmoles with as little as 2 equivalents of a monomer in the coupling step. Another alternative approach is to use soluble polymeric supports (e.g. , polyethylene glycols) , instead of the conventional solid supports. This method can yield short oligonucleotides in hundred milligram quantities per batch utilizing about 3 equivalents of a monomer in a coupling step.
Various modifications to ribozyme structure can be made to enhance the utility of ribozymes. Such modifications will enhance shelf-life, half-life in vi tro, stability, and ease of introduction of such ribozymes to the target site, e.g. , to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
Exogenous delivery of ribozymes benefits from chemical modification of the backbone, e.g. , by the overall negative charge of the ribozyme molecule being reduced to facilitate diffusion across the cell membrane. The present strategies for reducing the oligonucleotide charge include: modification of internucleotide linkages by methylphosphonates, use of phosphoramidites, linking oligonucleotides to positively charged molecules, and creating complex packages composed of oligonucleotides, lipids and specific receptors or effectors for targeted cells. Examples of such modifications include sulfur-containing ribozymes containing phosphorothioates and phosphorodithioates as internucleotide linkages in RNA. Synthesis of such sulfur-modified ribozymes is achieved by use of the sulfur-transfer reagent, 3H-l,2-benzenedithiol-3-one 1,1- dioxide. Ribozymes may also contain ribose modified ribonucleotides. Pyrimidine analogues are prepared from uridine using a procedure employing diethylamino sulphur trifluoride (DAST) as a starting reagent. Ribozymes can also be either electrostatically or covalently attached to polymeric cations for the purpose of reducing charge. The polymer can be attached to the ribozyme by simply converting the 3'-end to a ribonucleoside dialdehyde which is obtained by a periodate cleavage of the terminal 2',3'-cis diol system. Depending on the specific requirements for delivery systems, other possible modifications may include different linker arms containing carboxyl, amino or thiol functionalities. Yet further examples include use of methylphosphonates
and 2'-O-methylribose and 5' or 3' capping or blocking with m7GpppG or m3 2'2,7GpppG.
For example, a kinased ribozyme is contacted with guanosine triphosphate and guanyltransferase to add an m3G cap to the ribozyme. After such synthesis, the ribozyme can be gel purified using standard procedure. To ensure that the ribozyme has the desired activity, it may be tested with and without the 5' cap using standard procedures to assay both its enzymatic activity and its stability.
Synthetic ribozymes, including those containing various modifiers, can be purified by high pressure liquid chromatography (HPLC) . Other liquid chromatography techniques, employing reverse phase columns and anion exchangers on silica and polymeric supports may also be used.
There follows an example of the synthesis of one ribozyme. A solid phase phosphoramidite chemistry is employed. Monomers used are 2'-tert-butyl- dimethylsilyl cyanoethylphosphoramidities of uridine, N- benzoyl-cytosine, N-phenoxyacetyl adenosine and guanosine (Glen Research, Sterling, VA) . Solid phase synthesis is carried out on either an ABI 394 or 380B DNA/RNA synthesizer using the standard protocol provided with each machine. The only exception is that the coupling step is increased from 10 to 12 minutes. The phosphoramidite concentration is 0.1 M. Synthesis is done on a 1 μmole scale using a 1 μ ole RNA reaction column (Glen Research) . The average coupling efficiencies are between 97% and 98% for the 394 model, and between 97% and 99% for the 380B model, as deter¬ mined by a calorimetric measurement of the released trityl cation.
Blocked ribozymes are cleaved from the solid support (e.g. , CPG) , and the bases and diphosphoester moiety deprotected in a sterile vial by dry ethanolic ammonia (2 mL) at 55°C for 16 hours. The reaction
mixture is cooled on dry ice. Later, the cold liquid is transferred into a sterile screw cap vial and lyophilized.
To remove the 2'-tert-butyl-dimethylsilyl groups from the ribozyme, the residue is suspended in 1 M tetra-n-butylammonium fluoride in dry THF (TBAF) , using a 20 fold excess of the reagent for every silyl group, for 16 hours at ambient temperature (about 15- 25°C) . The reaction is quenched by adding an equal volume of sterile 1 M triethylamine acetate, pH 6.5. The sample is cooled and concentrated on a SpeedVac to half the initial volume.
The ribozymes are purified in two steps by HPLC on a C4 300 A 5 mm DeltaPak column in an acetonitrile gradient.
The first step, or "trityl on" step, is a separation of 5'-DMT-protected ribozyme(s) from failure sequences lacking a 5'-DMT group. Solvents used for this step are: A (0.1 M triethylammonium acetate, pH 6.8) and B (acetonitrile). The elution profile is: 20% B for 10 minutes, followed by a linear gradient of 20% B to 50% B over 50 minutes, 50% B for 10 minutes, a linear gradient of 50% B to 100% B over 10 minutes, and a linear gradient of 100% B to 0% B over 10 minutes. The second step is a purification of a completely deblocked ribozyme by a treatment of 2% trifluoroacetic acid on a C4 300 A 5 mm DeltaPak column in an acetonitrile gradient. Solvents used for this second step are: A (0.1 M triethylammonium acetate, pH 6.8) and B (80% acetonitrile, 0.1 M triethylammonium acetate, pH 6.8). The elution profile is: 5% B for 5 minutes, a linear gradient of 5% B to 15% B over 60 minutes, 15% B for 10 minutes, and a linear gradient of 15% B to 0% B over 10 minutes. The fraction containing ribozyme is cooled and lyophilized on a SpeedVac. Solid residue is dissolved in a minimum amount of ethanol and sodium perchlorate in
acetone. The ribozyme is collected by centrifugation, washed three times with acetone, and lyophilized. Expression Vector
While synthetic ribozymes are preferred in this invention, those produced by expression vectors can also be used. In designing a suitable ribozyme expression vector the following factors are important to consider. The final ribozyme must be kept as small as possible to minimize unwanted secondary structure within the ribozyme. A promoter (e.g. , the human cytomegalovirus immediate early promoter or human beta actin promoter) should be chosen to be a relatively strong promoter, and expressible both in vitro and in vivo (e.g. , the human cytomegalovirus immediate early promoter or human beta actin promoter) . Such a promoter should express the ribozyme at a level suitable to effect production of enough ribozyme to destroy a target RNA, but not at too high a level to prevent other cellular activities from occurring (unless cell death itself is desired) . A hairpin at the 5' end of the ribozyme is useful to ensure that the required transcription initiation sequence (GG or GGG or GGGAG) does not bind to some other part of the ribozyme and thus affect regulation of the transcription process. The 5' hairpin is also useful to protect the ribozyme from 5'-3' exonucleases. A selected hairpin at the 3' end of the ribozyme gene is useful since it acts as a transcription termination signal, and protects the ribozyme from 3'-5' exonuclease activity. One example of a known termination signal is that present on the T7 RNA polymerase system. This signal is about 30 nucleotides in length. Other 3' hairpins of shorter length can be used to provide good termination and RNA stability. Such hairpins can be inserted within the vector sequences to allow standard ribozymes to be placed in an appropriate orientation and expressed with such sequences attached.
Poly(A) tails are also useful to protect the 3' end of the ribozyme. These can be provided by either including a poly(A) signal site in the expression vector (to signal a cell to add the poly(A) tail in vivo) , or by introducing a poly(A) sequence directly into the expression vector. In the first approach the signal must be located to prevent unwanted secondary structure formation with other parts of the ribozyme. In the second approach, the poly(A) stretch may reduce in size over time when expressed in vivo, and thus the vector may need to be checked over time. Care must be taken in addition of a poly(A) tail which binds poly(A) binding proteins which prevent the ribozyme from acting. Ribozyme Testing Once the desired ribozymes are selected, synthesized and purified, they are tested in kinetic and other experiments to determine their utility. An example of such a procedure is provided below. Preparation of Ribozyme Crude synthetic ribozyme (typically 350 μg at a time) is purified by separation on a 15% denaturing polyacrylamide gel (0.75 mm thick, 40 cm long) and visualized by UV shadowing. Once excised, gel slices containing full length ribozyme are soaked in 5 ml gel elution buffer (0.5 M NH4OAc, 1 mM EDTA) overnight with shaking at 4°C. The eluent is desalted over a C-18 matrix (Sep-Pak cartridges, Millipore, Milford, MA) and vacuum dried. The dried RNA is resuspended in 50-100 μl TE (TRIS 10 mM, EDTA 1 mM, pH 7.2). An aliquot of this solution is diluted 100-fold into 1 ml TE, half of which is used to spectrophotometrically quantitate the ribozyme solution. The concentration of this dilute stock is typically 150-800 nM. Purity of the ribozyme is confirmed by the presence of a single band on a denaturing polyacrylamide gel.
A ribozyme may advantageously be synthesized in two or more portions. Each portion of a ribozyme will
generally have only limited or no enzymatic activity, and the activity will increase substantially (by at least 5-10 fold) when all portions are ligated (or otherwise juxtaposed) together. A specific example of hammerhead ribozyme synthesis is provided below.
The method involves synthesis of two (or more) shorter "half" ribozymes and ligation of them together using T4 RNA ligase. For example, to make a 34 mer ribozyme, two 17 ers are synthesized, one is phosphorylated, and both are gel purified. These purified 17 mers are then annealed to a DNA splint strand complementary to the two 17 mers. (Such a splint is not always necessary.) This DNA splint has a sequence designed to locate the two 17 mer portions with one end of each adjacent each other. The juxtaposed RNA molecules are then treated with T4 RNA ligase in the presence of ATP. The 34 mer RNA so formed is then HPLC purified.
Preparation of Substrates Approximately 10-30 pmoles of unpurified substrate is radioactively 5' end-labeled with T4 polynucleotide kinase using 25 pmoles of [γ-32P] ATP. The entire labeling mix is separated on a 20% denaturing polyacrylamide gel and visualized by autoradiography. The full length band is excised and soaked overnight at 4°C in 100 μl of TE (10 mM Tris-HCl pH 7.6, 0.1 mM EDTA) .
Kinetic Reactions
For reactions using short substrates (between 8 and 16 bases) a substrate solution is made IX in assay buffer (75 mM Tris-HCl, pH 7.6; 0.1 mM EDTA, 10 mM MgCl2) such that the concentration of substrate is less than 1 nM. A ribozyme solution (typically 20 nM) is made IX in assay buffer and four dilutions are made using IX assay buffer. Fifteen μl of each ribozyme dilution
(i.e., 20, 16, 12, 8 and 4 nM) is placed in a separate
tube. These tubes and the substrate tube are pre- incubated at 37°C for at least five minutes.
The reaction is started by mixing 15 μl of substrate into each ribozyme tube by rapid pipetting (note that final ribozyme concentrations are 10, 8, 6, 4, 2 nM) . Five μl aliquots are removed at 15 or 30 second intervals and quenched with 5 μl stop solution (95% formamide, 20 mM EDTA xylene cyanol, and bromphenol blue dyes) . Following the final ribozyme time point, an aliquot of the remaining substrate is removed as a zero ribozyme control.
The samples are separated on either 15% or 20% polyacrylamide gels. Each gel is visualized and quantitated with an Ambis beta scanner (Ambis Systems, San Diego, CA) .
For the most active ribozymes, kinetic analyses are performed in substrate excess to determine K„, and Kcat values.
For kinetic reactions with long RNA substrates (greater than 15 bases in length) the substrates are prepared by transcription using T7 RNA polymerase and defined templates containing a T7 promoter, and DNA encoding appropriate nucleotides of the target RNA. The substrate solution is made IX in assay buffer (75 mM Tris-HCl, pH 7.6; 0.1 mM EDTA; 10 mM MgCl2) and contains 58 nanomolar concentration of the long RNA molecules. The reaction is started by addition of gel purified ribozymes to 1 μM concentration. Aliquots are removed at 20, 40, 60, 80 and 100 minutes, then quenched by the addition of 5 μl stop solution. Cleavage products are separated using denaturing PAGE. The bands are visualized and quantitated with an Ambis beta scanner. Kinetic Analysis A simple reaction mechanism for ribozyme- mediated cleavage is:
kx k2
R + S ** [R : S] * [R : P] → R + P k_! where R = ribozyme, S = substrate, and P = products.
The boxed step is important only in substrate excess.
Because ribozyme concentration is in excess over substrate concentration, the concentration of the ribozyme-substrate complex ([R:S]) is constant over time except during the very brief time when the complex is being initially formed, i.e., : dfR:Sl = 0 dt where t = time, and thus:
(R) (S)kx = (RS) (k2 + kx) .
The rate of the reaction is the rate of disappearance of substrate with time:
Rate = ά^ = k2(RS)
Substituting these expressions:
(R) (S) i = l/k2 -d(S) (k2 + k. dt or: -d(S) = k,k, (R) dt
S (k2 + *._,)
Integrating this expression with respect to time yields:
-In S_ = k,k, (R) t S0 (k2 + kx) where S0 = initial substrate. Therefore, a plot of the negative log of fraction substrate uncut versus time (in minutes) yields a straight line with slope: slope = k.k, (R) = kobs (k2 + k
where kobs = observed rate constant. A plot of slope (kobs) versus ribozyme concentration yields a straight line with a slope which is: slope = nk-, which is k^,. (k2 + kx) I ,
Using these equations the data obtained from the kinetic experiments provides the necessary information to determine which ribozyme tested is most useful, or active. Such ribozymes can be selected and tested in in vivo or ex vivo systems. Liposo e Preparation
Lipid molecules are dissolved in a volatile organic solvent (CHC13, methanol, diethylether, ethanol, etc.). The organic solvent is removed by evaporation. The lipid is hydrated into suspension with O.lx phosphate buffered saline (PBS) , then freeze-thawed 3x using liquid nitrogen and incubation at room temperature. The suspension is extruded sequentially through a 0.4 μm, 0.2 μm and 0.1 μm polycarbonate filters at maximum pressure of 800 psi. The ribozyme is mixed with the extruded liposome suspension and lyophilized to dryness. The lipid/ribozyme powder is rehydrated with water to one-tenth the original volume. The suspension is diluted to the minimum volume required for extrusion (0.4 ml for 1.5 ml barrel and 1.5 ml for 10 ml barrel) with lxPBS and re-extruded through 0.4 μm, 0.2 μm, 0.1 μm polycarbonate filters. The liposome entrapped ribozyme is separated from untrapped ribozyme by gel filtration chromatography (SEPHAROSE CL-4B, BIOGEL A5M) . The liposome extractions are pooled and sterilized by filtration through a 0.2 μm filter. The free ribozyme is pooled and recovered by ethanol precipitation. The liposome concentration is determined by incorporation of a radioactive lipid. The ribozyme concentration is determined by labeling with 32P. Rossi et al., 1992, supra (and references cited therein)
describe other methods suitable for preparation of liposomes.
Examples of other useful liposome preparations which display similar degrees of uptake of both a radioactive lipid marker and an entrapped fluorophore by Vero cells showed different fluorescent staining patterns. Specifically, liposomes composed of DPPG/DPPC/Cholesterol (in a ratio of: 50/17/33) gave a punctate pattern of fluorescence, while DOPE/Egg PC/Cholesterol (30/37/33) gave a diffuse, homogeneous pattern of fluorescence in the cytoplasm. Cell fractionation showed that 80% of the entrapped contents from the DPPG/DPPC/Cholesterol formulation was localized in the membrane fraction, whereas the DOPE/Egg PC/Cholesterol formulation was localized in the cytoplasm. Further characterization of the latter formulation showed that after 3 hours, 70% of the fluorescence was cytoplasmic and 30% was in the membrane. After 24 hours, uptake had increased 5 fold and the liposome contents were distributed 50/50 between the cytoplasmic and membrane fractions.
Liposomes containing 15 ribozymes (32P-labeled) targeted to the HSV ICP4 mRNA were prepared and incubated with the cells. After 24 hours, 25% of the liposome dose was taken up with approximately 60,000 liposomes per cell. Thirty percent of the delivered ribozyme was intact after 24 hours. Cell fractionation studies showed 40% of the intact ribozyme to be in the membrane fraction and 52% of the intact ribozyme to be in the cytoplasmic fraction. In Vivo Assay
The efficacy of action of a chosen ribozyme may be tested in vivo using standard procedures in transformed cells or animals which express the target mRNA.
Ribonuclease Protection Assay
The accumulation of target mRNA in cells or the cleavage of the RNA by ribozymes or RNaseH ( in vi tro or in vivo) can be quantified using an RNase protection assay.
In this method, antisense riboprobes are transcribed from template DNA using T7 RNA polymerase (U.S. Biochemical) in 20 μl reactions containing IX transcription buffer (supplied by the manufacturer), 0.2 mM ATP, GTP and UTP, 1 U/μl pancreatic RNase inhibitor (Boehringer Mannheim Biochemicals) and 200 μCi 32P- labeled CTP (800 Ci/mmol, New England Nuclear) for 1 hour at 37°C. Template DNA is digested with 1 U RNase- free DNasel (U.S. Biochemical, Cleveland, OH) at 37°C for 15 minutes and unincorporated nucleotides removed by G-50 SEPHADEX spin chromatography.
In a manner similar to the transcription of antisense probe, the target RNA can be transcribed in vi tro using a suitable DNA template. The transcript is purified by standard methods and digested with ribozyme at 37°C according to methods described later.
Alternatively, afflicted (mRNA-expressing) cells are harvested into 1 ml of PBS) transferred to a 1.5 ml EPPENDORF tube, pelleted for 30 seconds at low speed in a microcentrifuge, and lysed in 70 μl of hybridization buffer (4 M guanidine isothiocyanate, 0.1% sarcosyl, 25 mM sodium citrate, pH 7.5). Cell lysate (45 μl) or defined amounts of in vi tro transcript (also in hybridization buffer) is then combined with 5 μl of hybridization buffer containing 5 x 105 cpm of each antisense riboprobe in 0.5 ml Eppendorf tubes, overlaid with 25 μl mineral oil, and hybridization accomplished by heating overnight at 55°C. The hybridization reactions are diluted into 0.5 ml RNase solution (20 U/ml RNaseA, 2 U/ml RNaseTl, 10 U/ml RNase-free DNasel in 0.4 M NaCl), heated for 30 minutes at 37°C, and 10 μl of 20% SDS and 10 μl of Proteinase K (10 mg/ml) added,
followed by an additional 30 minutes incubation at 37°C. Hybrids are partially purified by extraction with 0.5 ml of a 1:1 mixture of phenol/chloroform; aqueous phases are combined with 0.5 ml isopropanol, and RNase- resistant hybrids pelleted for 10 minutes at room temperature (about 20°C) in a microcentrifuge. Pellets are dissolved in 10 μl loading buffer (95% formamide, IX TBE, 0.1% bromophenol blue, 0.1% xylene cylanol) , heated to 95°C for five minutes, cooled on ice, and analyzed on 4% polyacrylamide/7 M urea gels under denaturing conditions.
Ribozyme Stability
The chosen ribozyme can be tested to determine its stability, and thus its potential utility. Such a test can also be used to determine the effect of various chemical modifications (e.g. , addition of a poly(A) tail) on the ribozyme stability and thus aid selection of a more stable ribozyme. For example, a reaction mixture contains 1 to 5 pmoles of 5' (kinased) and/or 3' labeled ribozyme, 15 μg of cytosolic extract and 2.5 mM MgCl2 in a total volume of 100 μl. The reaction is incubated at 37°C. Eight μl aliquots are taken at timed intervals and mixed with 8 μl of a stop mix (20 mM EDTA, 95% formamide) . Samples are separated on a 15% acrylamide sequencing gel, exposed to film, and scanned with an Ambis.
A 3'-labeled ribozyme can be formed by incorporation of the 32P-labeled cordycepin at the 3' OH using poly(A) polymerase. For example, the poly(A) polymerase reaction contains 40 mM Tris, pH 8, 10 mM MgCl2, 250 mM NaCl, 2.5 mM MnCl2, ; 3 μl 32P cordycepin, 500 Ci/mM; and 6 units poly(A) polymerase in a total volume of 50 μl. The reaction mixture is incubated for 30 minutes at 37°C.
Effect of Base Substitution Upon Ribozyme Activity
To determine which primary structural characteristics could change ribozyme cleavage of substrate, minor base changes can be made in the substrate cleavage region recognized by a specific ribozyme. For example, the substrate sequences can be changed at the central "C" nucleotide, changing the cleavage site from a GUC to a GUA motif. The Kcat/ϊ~-_ values for cleavage using each substrate are then analyzed to determine if such a change increases ribozyme cleavage rates. Similar experiments can be performed to address the effects of changing bases complementary to the ribozyme binding arms. Changes predicted to maintain strong binding to the complementary substrate are preferred. Minor changes in nucleotide content can alter ribozyme/substrate interactions in ways which are unpredictable based upon binding strength alone. Structures in the catalytic core region of the ribozyme recognize trivial changes in either substrate structure or the three dimensional structure of the ribozyme/substrate complex.
To begin optimizing ribozyme design, the cleavage rates of ribozymes containing varied arm lengths, but targeted to the same length of short RNA substrate can be tested. Minimal arm lengths are required and effective cleavage varies with ribozyme/substrate combinations.
The cleavage activity of selected ribozymes can be assessed using target mRNA substrates. The assays are performed in ribozyme excess and approximate Kcat/KI.in values obtained. Comparison of values obtained with short and long substrates indicates utility in vivo of a ribozyme.
Intracellular Stability of Liposome-delivered Ribozymes
To test the stability of a chosen ribozyme in vivo the following test is useful. Ribozymes are 32P- end labeled, entrapped in liposomes and delivered to target mRNA-containing cells for three hours. The cells are fractionated and ribozyme is purified by phenol/chloroform extraction. Alternatively, cells (lxlO7, T-175 flask) are scraped from the surface of the flask and washed twice with cold PBS. The cells are homogenized by douncing 35 times in 4 ml of TSE (10 mM Tris, pH 7.4, 0.25 M Sucrose, mM EDTA). Nuclei are pelleted at lOOxg for 10 minutes. Subcellular organelles (the membrane fraction) are pelleted at 200,000xg for two hours using an SW60 rotor. The pellet is resuspended in 1 ml of H buffer (0.25 M Sucrose, 50 mM HEPES, pH 7.4). The supernatant contains the cytoplasmic fraction (in approximately 3.7 ml). The nuclear pellet is resuspended in 1 ml of 65% sucrose in TM (50 mM Tris, pH 7.4, 2.5 mM MgCl2) and banded on a sucrose step gradient (1 ml nuclei in 65% sucrose TM, 1 ml 60% sucrose TM, 1 ml 55% sucrose TM, 50% sucrose TM, 300 μl 25% sucrose TM) for one hour at 37,000xg with an SW60 rotor. The nuclear band is harvested and diluted to 10% sucrose with TM buffer. Nuclei are pelleted at 37,000xg using an SW60 rotor for 15 minutes and the pellet resuspended in 1 ml of TM buffer. Aliquots are size fractionated on denaturing polyacrylamide gels and the intracellular localization determined. By comparison to the migra' ion rate of newly synthesized ribozyme, the various fractions containing intact ribozyme can be determined.
To investigate modifications which would lengthen the half-life of ribozyme molecules intracellularly, the cells may be fractioned as above and the purity of each fraction assessed by assaying enzyme activity known to exist in that fraction.
The various cell fractions are frozen at -70°C and used to determine relative nuclease resistances of modified ribozyme molecules. Ribozyme molecules may be synthesized with 5 phosphorothioate (ps) , or 2'-Omethyl (2'-OMe) modifications at each end of the molecule. These molecules and a phosphodiester version of the ribozyme are end-labeled with 32P and ATP using T4 polynucleotide kinase. Equal concentrations are added to the cell cytoplasmic extracts and aliquots of each taken at 10 minute intervals. The samples are size fractionated by denaturing PAGE and relative rates of nuclease resistance analyzed by scanning the gel with an Ambis β-scanner. The results show whether the ribozymes are digested by the cytoplasmic extract, and which versions are relatively more nuclease resistant.
Modified ribozymes generally maintain 80-90% of the catalytic activity of the native ribozyme when short RNA substrates are employed.
Unlabeled, 5' end-labeled or 3' end-labeled ribozymes can be used in the assays. These experiments can also be performed with human cell extracts to verify the observations.
In one example, Vero or HeLa cells were grown to 90-95% confluency in 175 cm2 tissue culture flasks, scraped into 10 ml of cold phosphate buffered saline
(PBS) , then washed once in 10 ml of cold PBS and once in 10 ml of cold TSE (10 mM Tris, pH 7.4; 0.25 M sucrose; 1 mM EDTA) . The cell pellets were resuspended in 4 ml of TSE, dounced 35x on ice, and the released nuclei pelleted by centrifugation at lOOOg for 10 minutes. The nuclear pellet was resuspended in 1 ml of 65% sucrose TM (50 mM Tris, pH 7.4; 2.5 mM MgCl2) and transferred to Beckman ultra-clear tubes. The following sucrose TM solutions were layered on top of the sample: 1 ml 60%, 1 ml 55%, and 25% sucrose to the top of the tube.
Gradients were spun in an SW60 rotor at 37,000g for 1 hour. HeLa nuclei banded at the 55-60% sucrose boundary
and Vero nuclei banded at the 50-55% sucrose boundary. Nuclear bands were harvested, diluted to 10% sucrose with TM buffer, and pelleted by centrifugation at 37,000g for 15 minutes using an SW60 rotor. The nuclear pellet was resuspended in 1 ml of TM buffer.
Subcellular organelles and membrane components in the post nuclear supernatant were separated from the cytoplasmic fraction by centrifugation at 200,000g for 2 hours in an SW60 rotor. The pellet contained the membrane fraction, which was resuspended in 1 ml of H buffer (0.25 M sucrose; 50 mM HEPES, pH 7.4), and the supernatant contained the cytoplasmic fraction.
Purity of the various fractions was assessed using enzymatic markers specific for the cytoplasmic and membranous fractions. Three enzyme markers for the membranous fraction were used; hexosaminidase and β- glucocerebrosidase are localized in lysosomes, while alkaline phosphodiesterase is specific to endosomes. Specifically, the assays were as follows: For N-acetyl-beta-hexosaminidase, the reaction mixture contained 0.3 mg/ l 4-methylumbelliferyl-N- acetyl-glucosaminide; 20 mM sodium citrate; pH 4.5; 0.01% Triton X-100; and 100 μl of sample in a final volume of 500 μl (Harding et al. , 64 Cell 393, 1991). The reactions were incubated at 37°C for 1 hour and stopped by the addition of 1.5 ml of stop buffer (0.13 M glycine, 0.07 M NaCl, 0.08 M sodium carbonate, pH 10.6). The reaction product was quantitated in a Hitachi F-4010 fluorescence spectrophotometer by excitation of the fluorophore at 360 nm and analysis of the emission at 448 nm.
For Alkaline Phosphodiesterase, the assay medium contained 25 mM CAPS (3-(Cyclohexylamino) - propanesulfonic acid), pH 10.6; 0.05% Triton X-100; 15 mM MgCl2; 1.25 mg/ml Thymidine-5'-monophosphate-p- nitrophenyl ester; and 100 μl of sample in a total reaction volume of 200 μl. The reactions were incubated
at 37°C for 2 hours, then diluted to 1 ml with H20 and the absorbance was measured at 400 nm (Razell and Khorana, 234 J. Biol. Chem. 739, 1959) .
For β-glucocerebrosidase, the reaction contained 85 nM sodium citrate, pH 5.9; 0.12% Triton X- 100; 0.1% sodium taurocholate; 5 M 4-methylumbelliferyl β-D-glucopyranoside; and 125 μl of sample in a total volume of 250 μl (Kennedy and Cooper, 252 Biochem. J. 739, 1988) . The reaction was incubated at 37°C for 1 hour and stopped by the addition of 0.75 ml of stop buffer. Product formation was measured in a fluorescence spectrophotometer by using an excitation wavelength of 360 nm and analysis of the emission at 448 nm. The cytoplasmic enzyme marker, lactate dehydrogenase, was assayed in an assay mixture containing 0.2 M Tris; pH 7.4; 0.22 mM NADH; 1 mM sodium pyruvate; and 50 μl of sample in a final volume of 1.05 ml. Enzyme levels were determined by decreased absorbency at 350 nm resulting from the oxidation of
NADH at room temperature (Silverstein and Boyer, 239 J. Biol. Chem. 3901, 1964) .
Lactate dehydrogenase was found predominantly in the cytoplasmic fractions of both Vero and HeLa cells, while β-glucocerebrosidase and alkaline phosphodiesterase were found almost exclusively in the membranous fractions. The hexosaminidase activity in Vero cell fractions was concentrated in the membranous fraction (70%) with about 20% in the cytoplasmic fraction. The isolation of enzyme markers with the appropriate cellular compartment demonstrated that cytoplasmic, membranous and nuclear fractions can be isolated with minimal intercompartmental contamination using this fractionation scheme. Nuclease Stability of Ribozymes and mRNA
The simplest and most sensitive way to monitor nuclease activity in cell fractions is to use end-
labeled oligonucleotides. However, high levels of phosphatase activity in some biological extracts gives ambiguous results in nuclease experiments when 32P-5'- end-labeled oligonucleotides are used as substrates. To determine the phosphatase activity in the extracts, cellular fractions were incubated with cold ribozymes and trace amounts of 5'-end-labeled ribozyme in the presence of 1 mM Mg+2 (or Zn+2 with HeLa cytoplasmic extracts) to optimize digestion. After polyacrylamide gel electrophoresis of samples, digestion of the oligonucleotide was assessed both by staining and by autoradiography.
Specifically, the basic oligonucleotide digestion reaction contained substrate nucleic acid (an RNA oligonucleotide of 36 nucleotides) and cell fraction extract in a total volume of 100 μl. Aliquots (7 μl) were taken after various periods of incubation at 37°C and added to 7 μl of gel loading buffer (95% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol, and 20 mM EDTA) . The samples were separated by electrophoresis on a 7 M urea, 20% polyacrylamide gel. Intact ribozymes were visualized either by staining with Stains-all (United States Biochemical, Cleveland, OH) , or autoradiography of 32P-labeled ribozyme. The stained gels and X-ray films were scanned on a Bio 5000 density scanner (U.S. Biochemical). Ribozymes were 5' end- labeled with T4 polynucleotide kinase (U.S. Biochemical) using 10 μCi of 32P γ-ATP (3,000 Ci/mmole, New England Nuclear, Boston, MA), and 20-25 pmoles of ribozymes. The unincorporated nucleotides were separated from the product by G-50 spin chromatography. Nuclease assays contained 1-2 pmoles of 32P-labeled ribozyme. All oligonucleotides were synthesized on an Applied Biosystems 394 DNA/RNA synthesizer (Applied Biosysterns Inc., Foster City, CA) according to manufacturer's protocols. The nuclear fractions were resuspended in a buffer containing 2.5 mM MgCl2. Experiments involving
the nuclear fractions were performed in the presence of 1 mM Mg+2, or in combination with 1 mM Mn+2, Ca+2, or Zn+2.
To measure the stability of mRNA, Vero cells were infected with herpes simplex virus (HSV) at a M.O.I, of 5 and total RNA was extracted (Chomczynski and Sacchi, 162 Anal. Biochem. 156, 1987) . An RNase protection assay was used to detect mRNA after incubation of total infected cellular RNA in cytoplasmic extracts. RNA probes were produced from PCR-amplified template DNA using T7 RNA polymerase (U.S. Biochemical) in the presence of 32P α-CTP (3,000 Ci/mmole, New England Nuclear, Boston, MA) . Template DNA was inactivated with 1 unit of RNase-free DNasel for 15 minutes at 37°C. Unincorporated nucleotides were removed by G-50 spin chromatography. Samples (6 μl) were taken from the nuclease assays after various periods of incubation at 37°C, added to 40 μl of 4 M GUSCN buffer (4 M guanidinium thiocyanate; 25 mM sodium citrate, pH 7; 0.5% sarcosyl; and 0.1 M 2-mercaptoethanol) , and 5 μl of 32P-labeled RNA probe (5xl05 cpm/5 μl, specific activity of 1.8xl06 cpm/μg) in 4 M GUSCN buffer. Hybridization reactions were covered with mineral oil and incubated at 55°C for 12-16 hours, after which the hybridization reaction was mixed with 500 μl of RNase buffer (0.4 M NaCl, 20 μg/ml RNaseA, 2 units/ml Tl RNase) and incubated for 30 minutes at 37°C. RNase activity was quenched by incubation with 10 μl of 20% SDS and 10 μl of proteinase K (20 mg/ml) , and the RNA was extracted using a phenol/chloroform mixture. The protected RNA fragment was purified by precipitation with an equal volume of isopropanol in the presence of 20 μg of carrier yeast tRNA. The RNA pellets were resuspended in gel loading buffer, heated to 95°C for 5 minutes and separated by electrophoresis on a 5% polyacrylamide, 7 M urea gel. Protected fragments were visualized by autoradiography, and the films were scanned with a Bio 5000 density scanner.
In experiments using these methods, the rate of digestion of ribozymes in Vero cell extracts was similar, demonstrating the lack of significant phosphatase activity in Vero cellular fractions. Similar results were observed with HeLa cellular fractions. In most extracts, ladders of digested fragments were observed; such ladders would not be expected if digestion was an artifact of phosphatase action. Thus, digestion using 5' end-labeled ribozymes is an accurate assessment of nuclease action in cellular extracts.
In other experiments, labeled ribozymes were incubated in various Vero and HeLa cellular fractions. Incubation of ribozymes in either membranous or nuclear fractions resulted in a linear decrease of intact molecules over time. In contrast, no digestion of ribozymes occurred during a 24 hour incubation in Vero cytoplasmic extracts, and HeLa cytoplasmic extracts exhibited a 20-30 minute delay in the onset of RNA digestion. After this refractory period, the rate of digestion was linear but not as rapid as the rates observed in any of the nuclear or membranous fractions. The effect of four divalent cations (Mg+2, Mn+2, Ca+2, and Zn+2) on the nuclease activity of the cellular fractions was assessed. Vero cytoplasmic extracts were stimulated by the addition of 1 mM Mg+2 or Mn+2, while Ca+2 or Zn+2 had no effect. Nuclease activity in HeLa cytoplasmic extracts was enhanced only by the addition of 1 mM Zn+2. Both Vero and HeLa membranous fractions exhibited maximum nuclease activity with the addition of Mg+2 or Mn+2 ions, while the addition of Ca+2 significantly reduced activity of the HeLa membranous fraction and abolished nuclease activity in the Vero membranous fraction. Addition of Zn+2 to both membranous fractions resulted in a loss of all RNase activity. The Vero nuclear extract demonstrated roughly equivalent nuclease activity in the presence of either Mg+2 alone or a Mg+2
and Mn+2 ion combination, less in the presence of Mg+2 and Ca+2, and no activity in the presence of Mg+2 and Zn+2. The effects of cation addition were not as dramatic with HeLa nuclear extracts. The nuclease activity of these fractions was greatest in the presence of Mg+2 alone or Mg+2 and Ca+2 and decreased slightly with the addition of Mn+2 or Zn+2 to the Mg+2 present in the extracts.
To verify that nuclease activity was dependent upon added divalent cations, nuclease assays were performed using 1 mM Mg+2 in the presence and absence of 20 mM EDTA. For the HeLa cytoplasmic fractions, the Mg+2 was replaced with 1 mM Zn+2. The presence of 20 mM EDTA completely abolished nuclease activity in the Vero and HeLa cytoplasmic fractions and Vero nuclear fractions. Nuclease activity in the HeLa membranous and nuclear fractions was partially inhibited by the addition of EDTA, while EDTA had no effect on the nuclease activity in the Vero membranous fraction. For comparative purposes, reactions using DNA oligonucleotides were performed using different Vero fractions. All DNase activity in Vero cytoplasmic, membranous, and nuclear fractions was inhibited by 20 mM EDTA.
The stability of RNA oligonucleotides and HSV-1 mRNA were compared in the presence and absence of activity-enhancing divalent cations (1 mM Mg+2, Vero cells; 1 mM Zn+2, HeLa cells) . Total cellular RNA from HSV-1 infected Vero cells (8 mg) and tracer amounts of 32P-5'-end-labeled RNA oligonucleotides (1 pmole) were incubated with Vero or HeLa cytoplasmic extracts. In the absence of divalent cations, no substantial decrease of intact ribozymes was detected in assays, although mRNA was digested in both Vero and HeLa cytoplasmic extracts. After addition of divalent cations, digestion of ribozymes occurred in both Vero and HeLa cytoplasmic fractions. The rate of ribozyme digestion in HeLa extracts increased to levels similar to those observed with mRNA, while the rate of mRNA digestion remained
greater than the rate of ribozyme digestion in Vero cytoplasmic fractions.
Thus, the stability of hammerhead ribozymes were compared in both Vero and HeLa cell cytoplasmic, membranous and nuclear fractions. Vero cytoplasmic and nuclear fractions were found to require Mg+2 for optimal nuclease activity, while the membranous fraction was not altered by the addition of divalent cations. HeLa membranous and nuclear fractions were also activated by Mg+2, while the cytoplasmic fractions required Zn"2 for nuclease activation. Relative stabilities of ribozymes and mRNAs were compared in Vero and HeLa cytoplasmic fractions. In the absence of appropriate divalent cations, little ribozyme digestion was observed in either cytoplasmic preparation while mRNA was rapidly digested. The addition of Mg+2 to Vero cytoplasmic extracts and Zn+2 to the HeLa cytoplasmic extracts stimulated ribozyme degradation and enhanced mRNA digestion. These data show that the nuclease sensitivity of ribozymes is cell-type specific, varies with the intracellular compartment studied and may not be able to be predicted from studies with mRNA. Notably, however, ribozymes appear stable in such cellular fractions for a period of time potentially sufficient to have a therapeutically useful activity. Administration of Ribozyme
Selected ribozymes can be administered prophylactically, or to patients having disease conditions, e.g. , by exogenous delivery of the ribozyme to a desired tissue by means of an appropriate delivery vehicle, e.g. , a liposome, a controlled release vehicle, by use of iontophoresis, electroporation or ion paired molecules, or covalently attached adducts, and other pharmacologically approved methods of delivery. Routes of administration include intramuscular, aerosol, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal. Expression vectors
for immunization with ribozymes and/or delivery of ribozymes are also suitable.
The specific delivery route of any selected ribozyme will depend on the use of the ribozyme. Generally, a specific delivery program for each ribozyme will focus on unmodified ribozyme uptake with regard to intracellular localization, followed by demonstration of efficacy. Alternatively, delivery to these same cells in an organ or tissue of an animal can be pursued. Uptake studies will include uptake assays to evaluate cellular ribozyme uptake, regardless of the delivery vehicle or strategy. Such assays will also determine the intracellular localization of the ribozyme following uptake, ultimately establishing the requirements for maintenance of steady-state concentrations within the cellular compartment containing the target sequence (nucleus and/or cytoplasm) . Efficacy and cytotoxicity can then be tested. Toxicity will not only include cell viability but also cell function. Some methods of delivery that may be used include: a. encapsulation in liposomes, b. transduction by retroviral vectors, c. conjugation with cholesterol, d. localization to nuclear compartment utilizing nuclear targeting site found on most nuclear proteins, e. neutralization of charge of ribozyme by using nucleotide derivatives, and f. use of blood stem cells to distribute ribozymes throughout the body. At least three types of delivery strategies are useful in the present invention, including: ribozyme modifications, particle carrier drug delivery vehicles, and retroviral expression vectors. Unmodified ribozymes, like most small molecules, are taken up by cells, albeit slowly. To enhance cellular uptake, the
ribozyme may be modified essentially at random, in ways which reduce its charge but maintains specific functional groups. This results in a molecule which is able to diffuse across the cell membrane, thus removing the permeability barrier.
Modification of ribozymes to reduce charge is just one approach to enhance the cellular uptake of these larger molecules. The random approach, however, is not advisable since ribozymes are structurally and functionally more complex than small drug molecules. The structural requirements necessary to maintain ribozyme catalytic activity are well understood by those in the art. These requirements are taken into consideration when designing modifications to enhance cellular delivery. The modifications are also designed to reduce susceptibility to nuclease degradation. Both of these characteristics should greatly improve the efficacy of the ribozyme. Cellular uptake can be increased by several orders of magnitude without having to alter the phosphodiester linkages necessary for ribozyme cleavage activity.
Chemical modifications of the phosphate backbone will reduce the negative charge allowing free diffusion across the membrane. This principle has been successfully demonstrated for antisense DNA technology. The similarities in chemical composition between DNA and RNA make this a feasible approach. In the body, maintenance of an external concentration will be necessary to drive the diffusion of the modified ribozyme into the cells of the tissue. Administration routes which allow the diseased tissue to be exposed to a transient high concentration of the drug, which is slowly dissipated by systemic adsorption are preferred. Intravenous administration with a drug carrier designed to increase the circulation half-life of the ribozyme can be used. The size and composition of the drug carrier restricts rapid clearance from the blood stream.
The carrier, made to accumulate at the site of infection, can protect the ribozyme from degradative processes.
Drug delivery vehicles are effective for both systemic and topical administration. They can be designed to serve as a slow release reservoir, or to deliver their contents directly to the target cell. An advantage of using direct delivery drug vehicles is that multiple molecules are delivered per uptake. Such vehicles have been shown to increase the circulation half-life of drugs which would otherwise be rapidly cleared from the blood stream. Some examples of such specialized drug delivery vehicles which fall into this category are liposomes, hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres.
From this category of delivery systems, liposomes are preferred. Liposomes increase intracellular stability, increase uptake efficiency and improve biological activity.
Liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids which make up the cell membrane. They have an internal aqueous space for entrapping water soluble compounds and range in size from 0.05 to several microns in diameter. Several studies have shown that liposomes can deliver RNA to cells and that the RNA remains biologically active.
For example, a liposome delivery vehicle originally designed as a research tool, Lipofectin, has been shown to deliver intact mRNA molecules to cells yielding production of the corresponding protein.
Liposomes offer several advantages: They are non-toxic and biodegradable in composition; they display long circulation half-lives; and recognition molecules can be readily attached to their surface for targeting to tissues. Finally, cost effective manufacture of
liposome-based pharmaceuticals, either in a liquid suspension or lyophilized product, has demonstrated the viability of this technology as an acceptable drug delivery system. Other controlled release drug delivery systems, such as nonoparticles and hydrogels may be potential delivery vehicles for a ribozyme. These carriers have been developed for chemotherapeutic agents and protein- based pharmaceuticals, and consequently, can be adapted for ribozyme delivery.
Topical administration of ribozymes is advantageous since it allows localized concentration at the site of administration with minimal systemic adsorption. This simplifies the delivery strategy of the ribozyme to the disease site and reduces the extent of toxicological characterization. Furthermore, the amount of material to be applied is far less than that required for other administration routes. Effective delivery requires the ribozyme to diffuse into the infected cells. Chemical modification of the ribozyme to neutralize negative charge may be all that is required for penetration. However, in the event that charge neutralization is insufficient, the modified ribozyme can be co-formulated with permeability enhancers, such as Azone or oleic acid, in a liposome. The liposomes can either represent a slow release presentation vehicle in which the modified ribozyme and permeability enhancer transfer from the liposome into the infected cell, or the liposome phospholipids can participate directly with the modified ribozyme and permeability enhancer in facilitating cellular delivery. In some cases, both the ribozyme and permeability enhancer can be formulated into a suppository formulation for slow release. Ribozymes may also be systemically administered. Systemic absorption refers to the accumulation of drugs in the blood stream followed by
distribution throughout the entire body. Administration routes which lead to systemic absorption include: intravenous, subcutaneous, intraperitoneal, intranasal, intrathecal and ophthalmic. Each of these administration routes expose the ribozyme to an accessible diseased tissue. Subcutaneous administration drains into a localized lymph node which proceeds through the lymphatic network into the circulation. The rate of entry into the circulation has been shown to be a function of molecular weight or size. The use of a liposome or other drug carrier localizes the ribozyme at the lymph node. The ribozyme can be modified to diffuse into the cell, or the liposome can directly participate in the delivery of either the unmodified or modified ribozyme to the cell.
A liposome formulation containing phosphatidyl- ethanolomidomethylthiosuccinimide which can deliver oligonucleotides to lymphocytes and macrophages is useful for certain conditions. Furthermore, a 200 nm diameter liposome of this composition was internalized as well as 100 nm diameter liposomes. The 200 nm liposomes exhibit a ten-fold greater packaging capacity than the 100 nm liposomes and can accommodate larger molecules such as a ribozyme expression vector. This ribozyme delivery system prevents mRNA expression in afflicted primary immune cells. Whole blood studies show that the formulation is taken up by 90% of the lymphocytes after 8 hours at 37°C. Preliminary biodistribution and pharmacokinetic studies yielded 70% of the injected dose/gm of tissue in the spleen after one hour following intravenous administration. Liposomes injected intravenously show accumulation in the liver, lung and spleen. The composition and size can be adjusted so that this accumulation represents 30% to 40% of the injected dose. The remaining dose circulates in the blood stream for up to 24 hours.
The chosen method of delivery should result in cytoplasmic accumulation and molecules should have some nuclease-resistance for optimal dosing. Nuclear delivery may be used but is less preferable. Most preferred delivery methods include liposomes (10-400 nm) , hydrogels, controlled-release polymers, microinjection or electroporation (for ex vivo treatments) and other pharmaceutically applicable vehicles. The dosage will depend upon the disease indication and the route of administration but should be between 100-200 mg/kg of body weight/day. The duration of treatment will extend through the course of the disease symptoms, possibly continuously. The number of doses will depend upon disease delivery vehicle and efficacy data from clinical trials.
Establishment of therapeutic levels of ribozyme within the cell is dependent upon the rate of uptake and degradation. Decreasing the degree of degradation will prolong the intracellular half-life of the ribozyme. Thus, chemically modified ribozymes, e.g. , with modification of the phosphate backbone, or capping of the 5' and 3' ends of the ribozyme with nucleotide analogs may require different dosaging. Descriptions of useful systems are provided in the art cited above, all of which is hereby incorporated by reference herein. Other embodiments are within the following claims.
Claims
1. An enzymatic RNA molecule which cleaves mRNA associated with development or maintenance of an inflammatory, arthritic, stenotic or cardiovascular disease or condition.
2. The enzymatic RNA molecule of claim 1, which cleaves mRNA produced from: a) the genes encoding tumor necrosis factor-α, interleukin-5, -1, -3, -4, -6, -8, ICAM-1, ELAM-1, VCAM-1, TGF-α, TNFOR, IL-1R, α-, β- or γ-interferon, EoCSF, GM-CSF, glycerol transferase, the selectins, E-selectin, MEL-14, GMP-140, MAM and protein kinase C; b) from a gene encoding a matrix metalloproteinase; c) a gene selected from one encoding c-myb, TGF-β, NF-KB, PDGF, bFGF, CGRP, angiotensin II, and endothelium-derived relaxing factor; and d) the gene encoding ACE or ECE.
3. The enzymatic RNA molecule of claim 1, which cleaves target mRNA having a sequence selected from SEQ. ID. NOS. 1-54 in table 1; SEQ. ID. NOS 1-33 in table 2; SEQ. ID. NOS. 1-77 in table 3; and SEQ. ID. NOS. 1-81 in table 4.
4. The enzymatic RNA molecule of claims 1, 2 or 3, wherein said RNA molecule is in a hammerhead motif.
5. The enzymatic RNA molecule of claim 4, wherein said RNA molecule is in a hairpin, hepatitis Delta virus, group 1 intron, or RNaseP RNA motif.
6. The enzymatic RNA molecule of claim 4, wherein said ribozyme comprises between 5 and 23 bases complementary to said mRNA.
7. The enzymatic RNA molecule of claim 6, wherein said ribozyme comprises between 10 and 18 bases complementary to said mRNA.
8. A mammalian cell including an enzymatic RNA molecule of claims 1, 2 or 3.
9. The cell of claim 8, wherein said cell is a human cell.
10. An expression vector including nucleic acid encoding the enzymatic RNA molecule of claims 1, 2 or 3, in a manner which allows expression of that enzymatic RNA molecule within a mammalian cell.
11. A method for treatment of an inflammatory disease, an arthritic condition, a stenotic condition, or a cardiovascular condition by administering to a patient an enzymatic RNA molecule of claims 1, 2 or 3.
.12. The method of claim 11, wherein said patient is a human.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP02005642A EP1251170A3 (en) | 1992-07-17 | 1993-07-02 | Method and reagent for treatment of NF-kappaB dependent animal diseases |
EP97101534A EP0786522A2 (en) | 1992-07-17 | 1993-07-02 | Enzymatic RNA molecules for treatment of stenotic conditions |
Applications Claiming Priority (11)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US91676392A | 1992-07-17 | 1992-07-17 | |
US916763 | 1992-07-17 | ||
US98984892A | 1992-12-07 | 1992-12-07 | |
US98984992A | 1992-12-07 | 1992-12-07 | |
US98713292A | 1992-12-07 | 1992-12-07 | |
US987132 | 1992-12-07 | ||
US989849 | 1992-12-07 | ||
US889593A | 1993-01-19 | 1993-01-19 | |
US8895 | 1993-01-19 | ||
PCT/US1993/006316 WO1994002595A1 (en) | 1992-07-17 | 1993-07-02 | Method and reagent for treatment of animal diseases |
US989848 | 1997-12-12 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP02005642A Division EP1251170A3 (en) | 1992-07-17 | 1993-07-02 | Method and reagent for treatment of NF-kappaB dependent animal diseases |
EP97101534.2 Division-Into | 1997-01-31 |
Publications (2)
Publication Number | Publication Date |
---|---|
EP0654077A1 true EP0654077A1 (en) | 1995-05-24 |
EP0654077A4 EP0654077A4 (en) | 1996-03-13 |
Family
ID=27533301
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP02005642A Withdrawn EP1251170A3 (en) | 1992-07-17 | 1993-07-02 | Method and reagent for treatment of NF-kappaB dependent animal diseases |
EP93918144A Pending EP0654077A4 (en) | 1992-07-17 | 1993-07-02 | Method and reagent for treatment of animal diseases. |
EP97101534A Withdrawn EP0786522A2 (en) | 1992-07-17 | 1993-07-02 | Enzymatic RNA molecules for treatment of stenotic conditions |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP02005642A Withdrawn EP1251170A3 (en) | 1992-07-17 | 1993-07-02 | Method and reagent for treatment of NF-kappaB dependent animal diseases |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP97101534A Withdrawn EP0786522A2 (en) | 1992-07-17 | 1993-07-02 | Enzymatic RNA molecules for treatment of stenotic conditions |
Country Status (6)
Country | Link |
---|---|
EP (3) | EP1251170A3 (en) |
JP (1) | JPH07509133A (en) |
AU (2) | AU4769893A (en) |
CA (1) | CA2140343A1 (en) |
MX (1) | MX9304329A (en) |
WO (1) | WO1994002595A1 (en) |
Families Citing this family (505)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6469158B1 (en) | 1992-05-14 | 2002-10-22 | Ribozyme Pharmaceuticals, Incorporated | Synthesis, deprotection, analysis and purification of RNA and ribozymes |
US5686599A (en) * | 1992-05-14 | 1997-11-11 | Ribozyme Pharmaceuticals, Inc. | Synthesis, deprotection, analysis and purification of RNA and ribozymes |
US5977343A (en) | 1992-05-14 | 1999-11-02 | Ribozyme Pharmaceuticals, Inc. | Synthesis, deprotection, analysis and purification of RNA and ribozymes |
US5804683A (en) * | 1992-05-14 | 1998-09-08 | Ribozyme Pharmaceuticals, Inc. | Deprotection of RNA with alkylamine |
US5646042A (en) * | 1992-08-26 | 1997-07-08 | Ribozyme Pharmaceuticals, Inc. | C-myb targeted ribozymes |
US5891684A (en) * | 1992-10-15 | 1999-04-06 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US5658780A (en) * | 1992-12-07 | 1997-08-19 | Ribozyme Pharmaceuticals, Inc. | Rel a targeted ribozymes |
US5616488A (en) * | 1992-12-07 | 1997-04-01 | Ribozyme Pharmaceuticals, Inc. | IL-5 targeted ribozymes |
US5612215A (en) * | 1992-12-07 | 1997-03-18 | Ribozyme Pharmaceuticals, Inc. | Stromelysin targeted ribozymes |
US5837542A (en) * | 1992-12-07 | 1998-11-17 | Ribozyme Pharmaceuticals, Inc. | Intercellular adhesion molecule-1 (ICAM-1) ribozymes |
US5811300A (en) * | 1992-12-07 | 1998-09-22 | Ribozyme Pharmaceuticals, Inc. | TNF-α ribozymes |
DK0748382T3 (en) | 1993-09-02 | 2003-02-17 | Ribozyme Pharm Inc | Enzymatic nucleic acid containing non-nucleotide |
AU8088694A (en) * | 1993-10-27 | 1995-05-22 | Ribozyme Pharmaceuticals, Inc. | 2'-amido and 2'-peptido modified oligonucleotides |
CA2176035A1 (en) | 1993-11-08 | 1995-05-18 | Nassim Usman | Base-modified enzymatic nucleic acid |
ATE226254T1 (en) * | 1993-11-12 | 2002-11-15 | Ribozyme Pharm Inc | REAGENT FOR THE TREATMENT OF ARTHRITIC CONDITIONS |
US5693532A (en) * | 1994-11-04 | 1997-12-02 | Ribozyme Pharmaceuticals, Inc. | Respiratory syncytial virus ribozymes |
US5639647A (en) * | 1994-03-29 | 1997-06-17 | Ribozyme Pharmaceuticals, Inc. | 2'-deoxy-2'alkylnucleotide containing nucleic acid |
CA2183992A1 (en) * | 1994-02-23 | 1995-08-31 | Dan T. Stinchcomb | Method and reagent for inhibiting the expression of disease related genes |
US5902880A (en) * | 1994-08-19 | 1999-05-11 | Ribozyme Pharmaceuticals, Inc. | RNA polymerase III-based expression of therapeutic RNAs |
US5631359A (en) * | 1994-10-11 | 1997-05-20 | Ribozyme Pharmaceuticals, Inc. | Hairpin ribozymes |
US5834440A (en) * | 1994-03-07 | 1998-11-10 | Immusol Incorporated | Ribozyme therapy for the inhibition of restenosis |
US5627053A (en) * | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US6103890A (en) * | 1994-05-18 | 2000-08-15 | Ribozyme Pharmaceuticals, Inc. | Enzymatic nucleic acids that cleave C-fos |
US20030026782A1 (en) * | 1995-02-07 | 2003-02-06 | Arthur M. Krieg | Immunomodulatory oligonucleotides |
US6350934B1 (en) | 1994-09-02 | 2002-02-26 | Ribozyme Pharmaceuticals, Inc. | Nucleic acid encoding delta-9 desaturase |
US5599706A (en) * | 1994-09-23 | 1997-02-04 | Stinchcomb; Dan T. | Ribozymes targeted to apo(a) mRNA |
US5716824A (en) * | 1995-04-20 | 1998-02-10 | Ribozyme Pharmaceuticals, Inc. | 2'-O-alkylthioalkyl and 2-C-alkylthioalkyl-containing enzymatic nucleic acids (ribozymes) |
CA2207593A1 (en) * | 1994-12-13 | 1996-06-20 | John Gustofson | Method and reagent for treatment of arthritic conditions, induction of graft tolerance and reversal of immune responses |
US5672501A (en) * | 1994-12-23 | 1997-09-30 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US5705388A (en) * | 1994-12-23 | 1998-01-06 | Ribozyme Pharmaceuticals, Inc. | CETP Ribozymes |
US5663064A (en) * | 1995-01-13 | 1997-09-02 | University Of Vermont | Ribozymes with RNA protein binding site |
DE69633272T2 (en) | 1995-02-08 | 2005-09-08 | Takara Bio Inc., Otsu | Methods for cancer treatment and control |
US5877021A (en) | 1995-07-07 | 1999-03-02 | Ribozyme Pharmaceuticals, Inc. | B7-1 targeted ribozymes |
US6346398B1 (en) | 1995-10-26 | 2002-02-12 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor |
US7034009B2 (en) | 1995-10-26 | 2006-04-25 | Sirna Therapeutics, Inc. | Enzymatic nucleic acid-mediated treatment of ocular diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R) |
US5998203A (en) | 1996-04-16 | 1999-12-07 | Ribozyme Pharmaceuticals, Inc. | Enzymatic nucleic acids containing 5'-and/or 3'-cap structures |
WO1997032018A2 (en) * | 1996-02-29 | 1997-09-04 | Immusol, Inc. | Hepatitis c virus ribozymes |
JP2000509969A (en) * | 1996-04-02 | 2000-08-08 | コモンウェルス・サイエンティフィック・アンド・インダストリアル・リサーチ・オーガニゼーション | Asymmetric hammerhead ribozyme |
ATE449851T1 (en) | 1996-10-01 | 2009-12-15 | Geron Corp | HUMAN TELOMERASE REVERSE TRANSCRIPTASE PROMOTER |
US5807743A (en) * | 1996-12-03 | 1998-09-15 | Ribozyme Pharmaceuticals, Inc. | Interleukin-2 receptor gamma-chain ribozymes |
US7008776B1 (en) | 1996-12-06 | 2006-03-07 | Aventis Pharmaceuticals Inc. | Compositions and methods for effecting the levels of high density lipoprotein (HDL) cholesterol and apolipoprotein AI very low density lipoprotein (VLDL) cholesterol and low density lipoprotein (LDL) cholesterol |
US6248878B1 (en) | 1996-12-24 | 2001-06-19 | Ribozyme Pharmaceuticals, Inc. | Nucleoside analogs |
US6057156A (en) | 1997-01-31 | 2000-05-02 | Robozyme Pharmaceuticals, Inc. | Enzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors |
US6159951A (en) * | 1997-02-13 | 2000-12-12 | Ribozyme Pharmaceuticals Inc. | 2'-O-amino-containing nucleoside analogs and polynucleotides |
AU7071598A (en) * | 1997-04-10 | 1998-10-30 | Erasmus University Rotterdam | Diagnosis method and reagents |
US5942395A (en) * | 1997-05-09 | 1999-08-24 | Universite De Montreal | Hybrid ribozymes and methods of use |
US6548657B1 (en) | 1997-06-09 | 2003-04-15 | Ribozyme Pharmaceuticals, Inc. | Method for screening nucleic acid catalysts |
US6280936B1 (en) | 1997-06-09 | 2001-08-28 | Ribozyme Pharmaceuticals, Inc. | Method for screening nucleic acid catalysts |
US6183959B1 (en) | 1997-07-03 | 2001-02-06 | Ribozyme Pharmaceuticals, Inc. | Method for target site selection and discovery |
US6316612B1 (en) | 1997-08-22 | 2001-11-13 | Ribozyme Pharmaceuticals, Inc. | Xylofuranosly-containing nucleoside phosphoramidites and polynucleotides |
US6656731B1 (en) | 1997-09-22 | 2003-12-02 | Max Planck Gesellschaft Zur Forderung Der Wissenschaften E.V. | Nucleic acid catalysts with endonuclease activity |
CA2304813A1 (en) * | 1997-09-22 | 1999-04-08 | Fritz Eckstein | Nucleic acid catalysts with endonuclease activity |
AU9509798A (en) | 1997-09-25 | 1999-04-12 | University Of Florida | Antisense oligonucleotide compositions targeted to angiotensi n converting enzy me mrna and methods of use |
US6127535A (en) | 1997-11-05 | 2000-10-03 | Ribozyme Pharmaceuticals, Inc. | Nucleoside triphosphates and their incorporation into oligonucleotides |
US6617438B1 (en) | 1997-11-05 | 2003-09-09 | Sirna Therapeutics, Inc. | Oligoribonucleotides with enzymatic activity |
BR9814294B1 (en) | 1997-12-18 | 2011-10-18 | b cry3bb polypeptide, modified thuringiensis, composition comprising the same, process for producing said composition, polynucleotide, vector, virus, transgenic microorganism and methods for killing and controlling a coleopteran insect population and for preparing a transgenic plant resistant to beetles and a Coleoptera-resistant plant seed and a Coleoptera-resistant plant seed. | |
US20020147143A1 (en) | 1998-03-18 | 2002-10-10 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of lung cancer |
US6200754B1 (en) | 1998-03-19 | 2001-03-13 | Variagenics, Inc. | Inhibitors of alternative alleles of genes encoding products that mediate cell response to environmental changes |
EP1071753A2 (en) | 1998-04-20 | 2001-01-31 | Ribozyme Pharmaceuticals, Inc. | Nucleic acid molecules with novel chemical compositions capable of modulating gene expression |
CA2230203A1 (en) | 1998-04-29 | 1999-10-29 | Universite De Sherbrooke | Delta ribozyme for rna cleavage |
US6228642B1 (en) * | 1998-10-05 | 2001-05-08 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of tumor necrosis factor-(α) (TNF-α) expression |
US6080580A (en) * | 1998-10-05 | 2000-06-27 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide modulation of tumor necrosis factor-α (TNF-α) expression |
US6995259B1 (en) | 1998-10-23 | 2006-02-07 | Sirna Therapeutics, Inc. | Method for the chemical synthesis of oligonucleotides |
AU4807400A (en) | 1999-04-30 | 2000-11-17 | University Of Florida | Adeno-associated virus-delivered ribozyme compositions and methods of use |
US6831171B2 (en) | 2000-02-08 | 2004-12-14 | Yale University | Nucleic acid catalysts with endonuclease activity |
US20070026394A1 (en) | 2000-02-11 | 2007-02-01 | Lawrence Blatt | Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies |
US8273866B2 (en) | 2002-02-20 | 2012-09-25 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA) |
US8202979B2 (en) | 2002-02-20 | 2012-06-19 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid |
US20040002068A1 (en) | 2000-03-01 | 2004-01-01 | Corixa Corporation | Compositions and methods for the detection, diagnosis and therapy of hematological malignancies |
US7153839B2 (en) | 2000-03-24 | 2006-12-26 | Biocell Laboratories | Method of protecting erythricytes, in particular for improvement of blood cytopenia |
US6737271B1 (en) * | 2000-03-24 | 2004-05-18 | Biocell Laboratories | Compound, composition and method for the treatment of inflammatory and inflammatory-related disorders |
GB0018307D0 (en) | 2000-07-26 | 2000-09-13 | Aventis Pharm Prod Inc | Polypeptides |
CA2404688C (en) | 2000-03-31 | 2012-07-31 | Aventis Pharmaceuticals Products Inc. | Nuclear factor .kappa.b inducing factor |
JP2004513615A (en) | 2000-06-28 | 2004-05-13 | コリクサ コーポレイション | Compositions and methods for treatment and diagnosis of lung cancer |
US7754435B2 (en) | 2000-09-21 | 2010-07-13 | Philadelphia Health And Education Corporation | Prostate cancer-related compositions, methods, and kits based on DNA macroarray proteomics platforms |
CA2441071C (en) | 2001-03-14 | 2010-06-22 | Myriad Genetics, Inc. | Tsg101-gag interaction and use thereof |
JP2005504513A (en) | 2001-05-09 | 2005-02-17 | コリクサ コーポレイション | Compositions and methods for treatment and diagnosis of prostate cancer |
US20050148530A1 (en) | 2002-02-20 | 2005-07-07 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
US9994853B2 (en) | 2001-05-18 | 2018-06-12 | Sirna Therapeutics, Inc. | Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference |
US7205399B1 (en) | 2001-07-06 | 2007-04-17 | Sirna Therapeutics, Inc. | Methods and reagents for oligonucleotide synthesis |
ES2405790T3 (en) | 2001-12-17 | 2013-06-03 | Corixa Corporation | Compositions and methods for therapy and diagnosis of inflammatory bowel disease |
US9181551B2 (en) | 2002-02-20 | 2015-11-10 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
AU2003207708A1 (en) | 2002-02-20 | 2003-09-09 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of map kinase genes |
US9657294B2 (en) | 2002-02-20 | 2017-05-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
US7956176B2 (en) | 2002-09-05 | 2011-06-07 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
US20080260744A1 (en) | 2002-09-09 | 2008-10-23 | Omeros Corporation | G protein coupled receptors and uses thereof |
JP2006507841A (en) * | 2002-11-14 | 2006-03-09 | ダーマコン, インコーポレイテッド | Functional and ultrafunctional siRNA |
US7605249B2 (en) | 2002-11-26 | 2009-10-20 | Medtronic, Inc. | Treatment of neurodegenerative disease through intracranial delivery of siRNA |
US7829694B2 (en) | 2002-11-26 | 2010-11-09 | Medtronic, Inc. | Treatment of neurodegenerative disease through intracranial delivery of siRNA |
US7618948B2 (en) | 2002-11-26 | 2009-11-17 | Medtronic, Inc. | Devices, systems and methods for improving and/or cognitive function through brain delivery of siRNA |
US7994149B2 (en) | 2003-02-03 | 2011-08-09 | Medtronic, Inc. | Method for treatment of Huntington's disease through intracranial delivery of sirna |
ES2394799T3 (en) | 2003-12-31 | 2013-02-05 | The Penn State Research Foundation | Methods to predict and overcome chemotherapy resistance in ovarian cancer |
EP1735009A4 (en) | 2004-03-12 | 2011-03-30 | Alnylam Pharmaceuticals Inc | iRNA AGENTS TARGETING VEGF |
CA2605574A1 (en) | 2004-04-20 | 2005-11-03 | Galapagos N.V. | Methods, compositions and compound assays for inhibiting amyloid-beta protein production |
EP2259063B1 (en) | 2004-04-27 | 2012-05-23 | Galapagos N.V. | Compound screening assays for inducing differentiation of undifferentiated mammalian cells into osteoblasts |
US20060040882A1 (en) | 2004-05-04 | 2006-02-23 | Lishan Chen | Compostions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells |
US10508277B2 (en) | 2004-05-24 | 2019-12-17 | Sirna Therapeutics, Inc. | Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference |
DE602005019156D1 (en) | 2004-05-26 | 2010-03-18 | Anima Cell Metrology | METHOD OF EVALUATING RIBONUCLEOTIDE SEQUENCES |
EP2270160A1 (en) | 2004-06-14 | 2011-01-05 | Galapagos N.V. | Methods for identification, and compounds useful for the treatment of degenerative and inflammatory diseases |
JP2008503712A (en) | 2004-06-21 | 2008-02-07 | ガラパゴス・ナムローゼ・フェンノートシャップ | Methods and means for treatment of osteoarthritis |
EP1758999B1 (en) | 2004-06-22 | 2011-03-09 | The Board Of Trustees Of The University Of Illinois | METHODS OF INHIBITING TUMOR CELL PROLIFERATION WITH FOXM1 siRNA |
USRE48960E1 (en) | 2004-06-28 | 2022-03-08 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
SI2206781T1 (en) | 2004-06-28 | 2016-05-31 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
WO2006020049A2 (en) | 2004-07-15 | 2006-02-23 | Amr Technology, Inc. | Aryl-and heteroaryl-substituted tetrahydroisoquinolines and use thereof to block reuptake of norepinephrine, dopamine, and serotonin |
US7485468B2 (en) | 2004-10-15 | 2009-02-03 | Galapagos Bv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases |
PL1866414T3 (en) | 2005-03-31 | 2012-10-31 | Calando Pharmaceuticals Inc | Inhibitors of ribonucleotide reductase subunit 2 and uses thereof |
ES2382814T3 (en) | 2005-05-17 | 2012-06-13 | Merck Sharp & Dohme Ltd. | Cis-4 - [(4-chlorophenyl) sulfonyl] -4- (2,5-difluorophenyl) cyclohexanopropanoic acid for cancer treatment |
AU2006261732B2 (en) | 2005-06-27 | 2011-09-15 | Alnylam Pharmaceuticals, Inc. | RNAi modulation of HIF-1 and theraputic uses thereof |
US9133517B2 (en) | 2005-06-28 | 2015-09-15 | Medtronics, Inc. | Methods and sequences to preferentially suppress expression of mutated huntingtin |
US7956050B2 (en) | 2005-07-15 | 2011-06-07 | Albany Molecular Research, Inc. | Aryl- and heteroaryl-substituted tetrahydrobenzazepines and use thereof to block reuptake of norepinephrine, dopamine, and serotonin |
US20070213292A1 (en) | 2005-08-10 | 2007-09-13 | The Rockefeller University | Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof |
JP4879988B2 (en) | 2005-09-29 | 2012-02-22 | メルク・シャープ・エンド・ドーム・コーポレイション | Acylated spiropiperidine derivatives as melanocortin-4 receptor modulators |
EP3936621A1 (en) | 2006-01-20 | 2022-01-12 | Cell Signaling Technology, Inc. | Translocation and mutant ros kinase in human non-small cell lung carcinoma |
US20120208824A1 (en) | 2006-01-20 | 2012-08-16 | Cell Signaling Technology, Inc. | ROS Kinase in Lung Cancer |
GB0603041D0 (en) | 2006-02-15 | 2006-03-29 | Angeletti P Ist Richerche Bio | Therapeutic compounds |
US7846908B2 (en) | 2006-03-16 | 2010-12-07 | Alnylam Pharmaceuticals, Inc. | RNAi modulation of TGF-beta and therapeutic uses thereof |
KR101547579B1 (en) | 2006-03-31 | 2015-08-27 | 알닐람 파마슈티칼스 인코포레이티드 | DsRNA for inhibiting expression of Eg5 gene |
US7741469B2 (en) | 2006-04-05 | 2010-06-22 | University Of Iowa Research Foundation | Compositions for treating hearing loss and methods of use thereof |
EP2010226B1 (en) | 2006-04-07 | 2014-01-15 | The Research Foundation of State University of New York | Transcobalamin receptor polypeptides, nucleic acids, and modulators thereof, and related methods of use in modulating cell growth and treating cancer and cobalamin deficiency |
EP3266867A1 (en) | 2006-04-14 | 2018-01-10 | Cell Signaling Technology, Inc. | Gene defects and mutant alk kinase in human solid tumors |
US8377448B2 (en) | 2006-05-15 | 2013-02-19 | The Board Of Trustees Of The Leland Standford Junior University | CD47 related compositions and methods for treating immunological diseases and disorders |
US9273356B2 (en) | 2006-05-24 | 2016-03-01 | Medtronic, Inc. | Methods and kits for linking polymorphic sequences to expanded repeat mutations |
US8598333B2 (en) | 2006-05-26 | 2013-12-03 | Alnylam Pharmaceuticals, Inc. | SiRNA silencing of genes expressed in cancer |
EP2471815B1 (en) | 2006-07-11 | 2016-03-30 | University Of Medicine And Dentistry Of New Jersey | Proteins, nucleic acids encoding the same and associated methods of use |
RU2553561C2 (en) | 2006-07-21 | 2015-06-20 | Сайленс Терапьютикс Аг | Means for inhibiting proteinkinase 3 expression |
EP1900749A1 (en) | 2006-09-12 | 2008-03-19 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Nucleic acids for expressing a polynucleotide of interest in mammalian cancer cells |
CA2770486C (en) | 2006-09-22 | 2014-07-15 | Merck Sharp & Dohme Corp. | Use of platencin and platensimycin as fatty acid synthesis inhibitors to treat obesity, diabetes and cancer |
EP2069501A2 (en) | 2006-10-02 | 2009-06-17 | Aprea Ab | Rna interference against wrap53 to treat hyperproliferative diseases |
EP2099467B1 (en) | 2006-10-03 | 2017-05-10 | University Of Medicine And Dentistry Of New Jersey | Atap peptides, nucleic acids encoding the same and associated methods of use |
US20110218176A1 (en) | 2006-11-01 | 2011-09-08 | Barbara Brooke Jennings-Spring | Compounds, methods, and treatments for abnormal signaling pathways for prenatal and postnatal development |
US9375440B2 (en) | 2006-11-03 | 2016-06-28 | Medtronic, Inc. | Compositions and methods for making therapies delivered by viral vectors reversible for safety and allele-specificity |
US8481506B2 (en) | 2006-12-05 | 2013-07-09 | Rosetta Genomics, Ltd. | Nucleic acids involved in viral infection |
PL2109608T3 (en) | 2007-01-10 | 2011-08-31 | Msd Italia Srl | Amide substituted indazoles as poly(adp-ribose)polymerase (parp) inhibitors |
WO2008092099A2 (en) | 2007-01-26 | 2008-07-31 | Rosetta Genomics, Ltd. | Compositions and methods for treating hematopoietic malignancies |
US9006206B2 (en) | 2007-02-27 | 2015-04-14 | Rosetta Genomics Ltd. | Composition and methods for modulating cell proliferation and cell death |
CA2699418A1 (en) | 2007-02-27 | 2008-09-04 | Moshe Oren | Composition and methods for modulating cell proliferation and cell death |
WO2008106551A2 (en) | 2007-02-28 | 2008-09-04 | The Govt. Of The U.S.A. As Represented By The Secretary Of The Dept. Of Health & Human Serv. | Brachyury polypeptides and methods for use |
EP2468864A1 (en) | 2007-03-02 | 2012-06-27 | Marina Biotech, Inc. | Nucleic acid compounds for inhibiting VEGF family gene expression and uses thereof |
AU2008233662B2 (en) | 2007-04-02 | 2012-08-23 | Msd K.K. | Indoledione derivative |
AU2008239594B2 (en) | 2007-04-13 | 2013-10-24 | Beth Israel Deaconess Medical Center | Methods for treating cancer resistant to ErbB therapeutics |
LT2494993T (en) | 2007-05-04 | 2018-12-27 | Marina Biotech, Inc. | Amino acid lipids and uses thereof |
CA2690685A1 (en) | 2007-06-20 | 2008-12-24 | Galapagos N.V. | Molecular targets and compounds, and methods to identify the same, useful in the treatment of bone and joint degenerative diseases |
JP5501227B2 (en) | 2007-06-27 | 2014-05-21 | メルク・シャープ・アンド・ドーム・コーポレーション | 4-Carboxybenzylamino derivatives as histone deacetylase inhibitors |
EP2188383B1 (en) | 2007-10-09 | 2017-01-18 | Anima Cell Metrology, Inc. | Systems and methods for measuring translation activity in viable cells |
CA2702686C (en) | 2007-10-18 | 2023-04-04 | Cell Signaling Technology, Inc. | Translocation and mutant ros kinase in human non-small cell lung carcinoma |
US9133522B2 (en) | 2007-10-31 | 2015-09-15 | Rosetta Genomics Ltd. | Compositions and methods for the diagnosis and prognosis of mesothelioma |
JP2011514881A (en) | 2007-11-09 | 2011-05-12 | ザ ソルク インスティテュート フォー バイオロジカル スタディーズ | Use of TAM receptor inhibitors as immunopotentiators and use of TAM activators as immunosuppressants |
CA2910760C (en) | 2007-12-04 | 2019-07-09 | Muthiah Manoharan | Targeting lipids |
EP2224912B1 (en) | 2008-01-02 | 2016-05-11 | TEKMIRA Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
JP2011515343A (en) | 2008-03-03 | 2011-05-19 | タイガー ファーマテック | Tyrosine kinase inhibitor |
CA2720473A1 (en) | 2008-04-04 | 2009-10-08 | Calando Pharmaceuticals, Inc. | Compositions and use of epas1 inhibitors |
CA2721183C (en) | 2008-04-11 | 2019-07-16 | Alnylam Pharmaceuticals, Inc. | Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components |
NZ588583A (en) | 2008-04-15 | 2012-08-31 | Protiva Biotherapeutics Inc | Novel lipid formulations for nucleic acid delivery |
WO2009134443A2 (en) | 2008-05-02 | 2009-11-05 | The Brigham And Women's Hospital, Inc. | Rna-induced translational silencing and cellular apoptosis |
AU2009246134B2 (en) | 2008-05-16 | 2016-03-03 | The Children's Hospital Of Philadelphia | Genetic alterations on chromosomes 21q, 6q and 15q and methods of use thereof for the diagnosis and treatment of type I diabetes |
ATE550024T1 (en) | 2008-05-30 | 2012-04-15 | Univ Yale | TARGETED OLIGONUCLEOTIDE COMPOSITIONS FOR MODIFYING GENE EXPRESSION |
WO2009149182A1 (en) | 2008-06-04 | 2009-12-10 | The Board Of Regents Of The University Of Texas System | Modulation of gene expression through endogenous small rna targeting of gene promoters |
US9156812B2 (en) | 2008-06-04 | 2015-10-13 | Bristol-Myers Squibb Company | Crystalline form of 6-[(4S)-2-methyl-4-(2-naphthyl)-1,2,3,4-tetrahydroisoquinolin-7-yl]pyridazin-3-amine |
CA2736425A1 (en) | 2008-09-11 | 2010-03-18 | Galapagos Nv | Method for identifying compounds useful for increasing the functional activity and cell surface expression of cf-associated mutant cystic fibrosis transmembrane conductance regulator |
JP2012513953A (en) | 2008-09-23 | 2012-06-21 | アルニラム ファーマスーティカルズ インコーポレイテッド | Chemical modification of monomers and oligonucleotides using cycloaddition |
WO2010042877A1 (en) | 2008-10-09 | 2010-04-15 | Tekmira Pharmaceuticals Corporation | Improved amino lipids and methods for the delivery of nucleic acids |
AU2009305639B2 (en) | 2008-10-16 | 2016-06-23 | Marina Biotech, Inc. | Processes and compositions for liposomal and efficient delivery of gene silencing therapeutics |
WO2010048586A1 (en) | 2008-10-24 | 2010-04-29 | Avi Biopharma, Inc. | Multiple exon skipping compositions for dmd |
IT1391866B1 (en) * | 2008-10-30 | 2012-01-27 | Mastelli S R L | INJECTIONABLE COMPOSITION OF POLYNUCLEOTIDS FOR THE TREATMENT OF OSTEOARTICULAR DISEASES. |
KR20220150995A (en) | 2008-11-10 | 2022-11-11 | 알닐람 파마슈티칼스 인코포레이티드 | Novel lipids and compositions for the delivery of therapeutics |
CA2751342C (en) | 2009-01-29 | 2019-05-07 | Alnylam Pharmaceuticals, Inc. | Lipid formulations comprising cationic lipid and a targeting lipid comprising n-acetyl galactosamine for delivery of nucleic acid |
PT2881402T (en) | 2009-02-12 | 2017-08-23 | Cell Signaling Technology Inc | Mutant ros expression in human liver cancer |
WO2010091878A2 (en) | 2009-02-13 | 2010-08-19 | Silence Therapeutics Ag | Means for inhibiting the expression of opa1 |
US8829179B2 (en) | 2009-02-18 | 2014-09-09 | Silence Therapeutics Gmbh | Means for inhibiting the expression of ANG2 |
EP2398481A2 (en) | 2009-02-19 | 2011-12-28 | Galapagos N.V. | Methods for identifying and compounds useful for the diagnosis and treatment of diseases involving inflammation |
EP2398479A2 (en) | 2009-02-19 | 2011-12-28 | Galapagos N.V. | Methods for identifying and compounds useful for the diagnosis and treatment of diseases involving inflammation |
WO2010094732A1 (en) | 2009-02-19 | 2010-08-26 | Biofocus Dpi B.V. | Methods for identifying and compounds useful for the diagnosis and treatment of diseases involving inflammation |
US8975389B2 (en) | 2009-03-02 | 2015-03-10 | Alnylam Pharmaceuticals, Inc. | Nucleic acid chemical modifications |
CA2754961C (en) | 2009-03-11 | 2018-04-10 | Promedior, Inc. | Treatment and diagnostic methods for hypersensitive disorders |
AU2010224172B2 (en) | 2009-03-11 | 2016-01-21 | Promedior, Inc. | Treatment methods for autoimmune disorders |
EP2408458A1 (en) | 2009-03-19 | 2012-01-25 | Merck Sharp&Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 6 (STAT6) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
MX2011009724A (en) | 2009-03-19 | 2011-10-14 | Merck Sharp & Dohme | RNA INTERFERENCE MEDIATED INHIBITION OF BTB AND CNC HOMOLOGY 1, BASIC LEUCINE ZIPPER TRANSCRIPTION FACTOR 1 (BACH 1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) SEQUENCE LISTING. |
EP2408916A2 (en) | 2009-03-19 | 2012-01-25 | Merck Sharp&Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF CONNECTIVE TISSUE GROWTH FACTOR (CTGF) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
EP2408915A2 (en) | 2009-03-19 | 2012-01-25 | Merck Sharp&Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF GATA BINDING PROTEIN 3 (GATA3) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
WO2010111471A2 (en) | 2009-03-27 | 2010-09-30 | Merck Sharp & Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 1 (STAT1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
US20120004281A1 (en) | 2009-03-27 | 2012-01-05 | Merck Sharp & Dohme Corp | RNA Interference Mediated Inhibition of the Nerve Growth Factor Beta Chain (NGFB) Gene Expression Using Short Interfering Nucleic Acid (siNA) |
JP2012521765A (en) | 2009-03-27 | 2012-09-20 | メルク・シャープ・エンド・ドーム・コーポレイション | RNA interference-mediated inhibition of intracellular adhesion molecule 1 (ICAM-1) gene expression using small interfering nucleic acids (siNA) |
WO2010111464A1 (en) | 2009-03-27 | 2010-09-30 | Merck Sharp & Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF APOPTOSIS SIGNAL-REGULATING KINASE 1 (ASK1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
EP2411520A2 (en) | 2009-03-27 | 2012-02-01 | Merck Sharp&Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF THE THYMIC STROMAL LYMPHOPOIETIN (TSLP) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
WO2010112569A1 (en) | 2009-03-31 | 2010-10-07 | Robert Zimmermann | Modulation of adipose triglyceride lipase for prevention and treatment of cachexia, loss of weight and muscle atrophy and methods of screening therefor |
WO2010115825A2 (en) | 2009-03-31 | 2010-10-14 | Robert Zimmermann | Modulation of adipose triglyceride lipase for prevention and treatment of cachexia, loss of weight and muscle atrophy and methods of screening therefor |
EP3043179B1 (en) | 2009-04-01 | 2020-05-06 | Galapagos N.V. | Methods and means for treatment of osteoarthritis |
WO2010114780A1 (en) | 2009-04-01 | 2010-10-07 | Merck Sharp & Dohme Corp. | Inhibitors of akt activity |
EP2421972A2 (en) | 2009-04-24 | 2012-02-29 | The Board of Regents of The University of Texas System | Modulation of gene expression using oligomers that target gene regions downstream of 3' untranslated regions |
AU2010245933B2 (en) | 2009-05-05 | 2016-06-16 | Arbutus Biopharma Corporation | Methods of delivering oligonucleotides to immune cells |
SG10201402054UA (en) | 2009-05-05 | 2014-09-26 | Muthiah Manoharan | Lipid compositions |
DK2429296T3 (en) | 2009-05-12 | 2018-03-12 | Albany Molecular Res Inc | 7 - ([1,2,4,] TRIAZOLO [1,5, -A] PYRIDIN-6-YL) -4- (3,4-DICHLORPHENYL) -1,2,3,4- TETRAHYDROISOQUINOLINE AND USE thereof |
KR20120034644A (en) | 2009-05-12 | 2012-04-12 | 알바니 몰레큘라 리써치, 인크. | Aryl, heteroaryl, and heterocycle substituted tetrahydroisoquinolines and use thereof |
JP5739415B2 (en) | 2009-05-12 | 2015-06-24 | ブリストル−マイヤーズ スクウィブ カンパニー | (S) -7-([1,2,4] triazolo [1,5-a] pyridin-6-yl) -4- (3,4-dichlorophenyl) -1,2,3,4-tetrahydroisoquinoline Crystal forms and uses thereof |
UA110323C2 (en) | 2009-06-04 | 2015-12-25 | Promedior Inc | Derivative of serum amyloid p and their receipt and application |
CN104873464B (en) | 2009-06-10 | 2018-06-22 | 阿布特斯生物制药公司 | Improved lipid formulations |
US8283333B2 (en) | 2009-07-01 | 2012-10-09 | Protiva Biotherapeutics, Inc. | Lipid formulations for nucleic acid delivery |
US9512164B2 (en) | 2009-07-07 | 2016-12-06 | Alnylam Pharmaceuticals, Inc. | Oligonucleotide end caps |
WO2011015572A1 (en) | 2009-08-03 | 2011-02-10 | Galapagos Nv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of neurodegenerative diseases |
WO2011015573A1 (en) | 2009-08-03 | 2011-02-10 | Galapagos Nv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of neurodegenerative diseases |
AU2010299444B2 (en) | 2009-09-24 | 2015-12-10 | Anima Cell Metrology, Inc. | Systems and methods for measuring translation of target proteins in cells |
US8859776B2 (en) | 2009-10-14 | 2014-10-14 | Merck Sharp & Dohme Corp. | Substituted piperidines that increase p53 activity and the uses thereof |
US20120270930A1 (en) | 2009-10-29 | 2012-10-25 | Academisch Ziekenhuis Leiden H.O.D.N. Lumc | Methods and compositions for dysferlin exon-skipping |
KR102487132B1 (en) | 2009-11-12 | 2023-01-10 | 더 유니버시티 오브 웨스턴 오스트레일리아 | Antisense Molecules and Methods for Treating Pathologies |
CN102712928B (en) | 2009-11-13 | 2017-08-04 | 萨雷普塔治疗公司 | Antisense antiviral compound and the method for treating influenza infection |
CA3044884A1 (en) | 2009-12-07 | 2011-06-16 | Arbutus Biopharma Corporation | Compositions for nucleic acid delivery |
KR101692063B1 (en) | 2009-12-09 | 2017-01-03 | 닛토덴코 가부시키가이샤 | MODULATION OF hsp47 EXPRESSION |
US20130017223A1 (en) | 2009-12-18 | 2013-01-17 | The University Of British Columbia | Methods and compositions for delivery of nucleic acids |
WO2011094580A2 (en) | 2010-01-28 | 2011-08-04 | Alnylam Pharmaceuticals, Inc. | Chelated copper for use in the preparation of conjugated oligonucleotides |
US9068185B2 (en) | 2010-03-12 | 2015-06-30 | Sarepta Therapeutics, Inc. | Antisense modulation of nuclear hormone receptors |
WO2011120023A1 (en) | 2010-03-26 | 2011-09-29 | Marina Biotech, Inc. | Nucleic acid compounds for inhibiting survivin gene expression uses thereof |
WO2011123621A2 (en) | 2010-04-01 | 2011-10-06 | Alnylam Pharmaceuticals Inc. | 2' and 5' modified monomers and oligonucleotides |
WO2011133584A2 (en) | 2010-04-19 | 2011-10-27 | Marina Biotech, Inc. | Nucleic acid compounds for inhibiting hras gene expression and uses thereof |
US9725479B2 (en) | 2010-04-22 | 2017-08-08 | Ionis Pharmaceuticals, Inc. | 5′-end derivatives |
WO2011133868A2 (en) | 2010-04-22 | 2011-10-27 | Alnylam Pharmaceuticals, Inc. | Conformationally restricted dinucleotide monomers and oligonucleotides |
US10913767B2 (en) | 2010-04-22 | 2021-02-09 | Alnylam Pharmaceuticals, Inc. | Oligonucleotides comprising acyclic and abasic nucleosides and analogs |
SG184876A1 (en) | 2010-04-23 | 2012-11-29 | Univ Florida | Raav-guanylate cyclase compositions and methods for treating leber's congenital amaurosis-1 (lca1) |
WO2011139843A2 (en) | 2010-04-28 | 2011-11-10 | Marina Biotech, Inc. | Multi-sirna compositions for reducing gene expression |
ES2816898T3 (en) | 2010-05-13 | 2021-04-06 | Sarepta Therapeutics Inc | Compounds that modulate the signaling activity of interleukins 17 and 23 |
AU2011255203B2 (en) | 2010-05-21 | 2016-01-21 | Peptimed, Inc. | Reagents and methods for treating cancer |
EP2576579B1 (en) | 2010-06-02 | 2018-08-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods directed to treating liver fibrosis |
US20130236968A1 (en) | 2010-06-21 | 2013-09-12 | Alnylam Pharmaceuticals, Inc. | Multifunctional copolymers for nucleic acid delivery |
KR101553753B1 (en) | 2010-06-24 | 2015-09-16 | 쿠아크 파마수티칼스 인코퍼레이티드 | Double stranded rna compounds to rhoa and use thereof |
EP2584903B1 (en) | 2010-06-24 | 2018-10-24 | Merck Sharp & Dohme Corp. | Novel heterocyclic compounds as erk inhibitors |
PT2591114T (en) | 2010-07-06 | 2016-08-02 | Glaxosmithkline Biologicals Sa | Immunisation of large mammals with low doses of rna |
HUE047796T2 (en) | 2010-07-06 | 2020-05-28 | Glaxosmithkline Biologicals Sa | Delivery of rna to trigger multiple immune pathways |
US20130171241A1 (en) | 2010-07-06 | 2013-07-04 | Novartis Ag | Liposomes with lipids having an advantageous pka-value for rna delivery |
BR112013000392B8 (en) | 2010-07-06 | 2022-10-04 | Novartis Ag | PHARMACEUTICAL COMPOSITION CONTAINING VIRION-LIKE DISTRIBUTION PARTICLE FOR SELF-REPLICATING RNA MOLECULES AND THEIR USE |
EP2596352B1 (en) | 2010-07-22 | 2016-08-31 | Ramot at Tel Aviv University, Ltd. | Systems and methods for detection of cellular stress |
WO2012016188A2 (en) | 2010-07-30 | 2012-02-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for delivery of active agents |
WO2012016184A2 (en) | 2010-07-30 | 2012-02-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for delivery of active agents |
JP6043285B2 (en) | 2010-08-02 | 2016-12-14 | サーナ・セラピューティクス・インコーポレイテッドSirna Therapeutics,Inc. | RNA interference-mediated inhibition of catenin (cadherin-binding protein) β1 (CTNNB1) gene expression using small interfering nucleic acids (siNA) |
CA2807440A1 (en) | 2010-08-04 | 2012-02-09 | Cizzle Biotechnology Limited | Methods and compounds for the diagnosis and treatment of cancer |
US20120101108A1 (en) | 2010-08-06 | 2012-04-26 | Cell Signaling Technology, Inc. | Anaplastic Lymphoma Kinase In Kidney Cancer |
RU2624045C2 (en) | 2010-08-17 | 2017-06-30 | Сирна Терапьютикс,Инк | RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
US8883801B2 (en) | 2010-08-23 | 2014-11-11 | Merck Sharp & Dohme Corp. | Substituted pyrazolo[1,5-a]pyrimidines as mTOR inhibitors |
KR20130137160A (en) | 2010-08-24 | 2013-12-16 | 머크 샤프 앤드 돔 코포레이션 | Single-stranded rnai agents containing an internal, non-nucleic acid spacer |
WO2012027467A1 (en) | 2010-08-26 | 2012-03-01 | Merck Sharp & Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF PROLYL HYDROXYLASE DOMAIN 2 (PHD2) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
DK4066819T3 (en) * | 2010-08-31 | 2023-04-24 | Glaxosmithkline Biologicals Sa | Small liposomes for delivery of RNA encoding immunogen |
ES2935009T3 (en) | 2010-08-31 | 2023-03-01 | Glaxosmithkline Biologicals Sa | Pegylated liposomes for delivery of RNA encoding immunogen |
EP2613782B1 (en) | 2010-09-01 | 2016-11-02 | Merck Sharp & Dohme Corp. | Indazole derivatives useful as erk inhibitors |
US9242981B2 (en) | 2010-09-16 | 2016-01-26 | Merck Sharp & Dohme Corp. | Fused pyrazole derivatives as novel ERK inhibitors |
CA2812940A1 (en) | 2010-09-27 | 2012-04-12 | The Children's Hospital Of Philadelphia | Compositions and methods useful for the treatment and diagnosis of inflammatory bowel disease |
SG188666A1 (en) | 2010-09-30 | 2013-05-31 | Agency Science Tech & Res | Methods and reagents for detection and treatment of esophageal metaplasia |
US20140134231A1 (en) | 2010-10-11 | 2014-05-15 | Sanford-Burnham Medical Research Institute | Mir-211 expression and related pathways in human melanoma |
AU2011316707A1 (en) | 2010-10-11 | 2013-05-09 | Novartis Ag | Antigen delivery platforms |
EP2632472B1 (en) | 2010-10-29 | 2017-12-13 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of gene expression using short interfering nucleic acids (sina) |
SG190088A1 (en) | 2010-11-01 | 2013-06-28 | Peptimed Inc | Compositions of a peptide targeting system for treating cancer |
EP2648763A4 (en) | 2010-12-10 | 2014-05-14 | Alnylam Pharmaceuticals Inc | Compositions and methods for inhibiting expression of klf-1 and bcl11a genes |
WO2012078967A2 (en) | 2010-12-10 | 2012-06-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for increasing erythropoietin (epo) production |
WO2012087772A1 (en) | 2010-12-21 | 2012-06-28 | Schering Corporation | Indazole derivatives useful as erk inhibitors |
WO2012093384A1 (en) | 2011-01-03 | 2012-07-12 | Rosetta Genomics Ltd. | Compositions and methods for treatment of ovarian cancer |
WO2012099755A1 (en) | 2011-01-11 | 2012-07-26 | Alnylam Pharmaceuticals, Inc. | Pegylated lipids and their use for drug delivery |
US20120263754A1 (en) | 2011-02-15 | 2012-10-18 | Immune Design Corp. | Methods for Enhancing Immunogen Specific Immune Responses by Vectored Vaccines |
CA2828002A1 (en) | 2011-03-03 | 2012-09-07 | Quark Pharmaceuticals, Inc. | Compositions and methods for treating lung disease and injury |
US8420617B2 (en) | 2011-03-11 | 2013-04-16 | Biocell Laboratories | Multiantivirus compound, composition and method for treatment of virus diseases |
JP6108628B2 (en) | 2011-03-29 | 2017-04-05 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Composition and method for inhibiting expression of TMPRSS6 gene |
EA027236B1 (en) | 2011-04-08 | 2017-07-31 | Иммьюн Дизайн Корп. | Immunogenic compositions and methods of using the compositions for inducing humoral and cellular immune responses |
CN103732592A (en) | 2011-04-21 | 2014-04-16 | 默沙东公司 | Insulin-like growth factor-1 receptor inhibitors |
US10196637B2 (en) | 2011-06-08 | 2019-02-05 | Nitto Denko Corporation | Retinoid-lipid drug carrier |
TWI658830B (en) | 2011-06-08 | 2019-05-11 | 日東電工股份有限公司 | Retinoid-liposomes for enhancing modulation of hsp47 expression |
CA2839896A1 (en) | 2011-06-21 | 2012-12-27 | Alnylam Pharmaceuticals, Inc. | Assays and methods for determining activity of a therapeutic agent in a subject |
WO2012177595A1 (en) | 2011-06-21 | 2012-12-27 | Oncofactor Corporation | Compositions and methods for the therapy and diagnosis of cancer |
CN103890000B (en) | 2011-06-21 | 2017-09-01 | 阿尔尼拉姆医药品有限公司 | (ANGPTL3) the iRNA compositions of angiopoietin-like 3 and its application method |
EP3366312A1 (en) | 2011-06-23 | 2018-08-29 | Alnylam Pharmaceuticals, Inc. | Serpina 1 sirnas: compositions of matter and methods of treatment |
US20140227293A1 (en) | 2011-06-30 | 2014-08-14 | Trustees Of Boston University | Method for controlling tumor growth, angiogenesis and metastasis using immunoglobulin containing and proline rich receptor-1 (igpr-1) |
US11896636B2 (en) | 2011-07-06 | 2024-02-13 | Glaxosmithkline Biologicals Sa | Immunogenic combination compositions and uses thereof |
WO2013012752A2 (en) | 2011-07-15 | 2013-01-24 | Sarepta Therapeutics, Inc. | Methods and compositions for manipulating translation of protein isoforms from alternative initiation start sites |
EP2557089A2 (en) | 2011-07-15 | 2013-02-13 | Fundació Institut d'Investigació Biomèdica de Bellvitge (IDIBELL) | Compositions and methods for immunomodulation |
US20140328811A1 (en) | 2011-08-01 | 2014-11-06 | Alnylam Pharmaceuticals, Inc. | Method for improving the success rate of hematopoietic stem cell transplants |
WO2013049328A1 (en) | 2011-09-27 | 2013-04-04 | Alnylam Pharmaceuticals, Inc. | Di-aliphatic substituted pegylated lipids |
US9023865B2 (en) | 2011-10-27 | 2015-05-05 | Merck Sharp & Dohme Corp. | Compounds that are ERK inhibitors |
JP6368243B2 (en) | 2011-11-11 | 2018-08-08 | フレッド ハッチンソン キャンサー リサーチ センター | T-cell immunotherapy targeted to cyclin A1 for cancer |
PT2788487T (en) | 2011-12-08 | 2018-07-03 | Sarepta Therapeutics Inc | Oligonucleotide analogues targeting human lmna |
DK2790736T3 (en) | 2011-12-12 | 2018-05-07 | Oncoimmunin Inc | In vivo delivery of oligonucleotides |
CA2858630A1 (en) | 2012-01-12 | 2013-07-18 | Quark Pharmaceuticals, Inc. | Combination therapy for treating hearing and balance disorders |
EP2617434A1 (en) | 2012-01-20 | 2013-07-24 | Laboratorios Del. Dr. Esteve, S.A. | HIV-1 integrase deficient immunogens and methods for loading dendritic cells with said immunogens |
WO2013123996A1 (en) | 2012-02-24 | 2013-08-29 | Astrazeneca Uk Limited | Novel sirna inhibitors of human icam-1 |
KR102239887B1 (en) | 2012-02-24 | 2021-04-13 | 아뷰터스 바이오파마 코포레이션 | Trialkyl cationic lipids and methods of use thereof |
US9133461B2 (en) | 2012-04-10 | 2015-09-15 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the ALAS1 gene |
EP3336181B1 (en) | 2012-04-18 | 2022-01-12 | Cell Signaling Technology, Inc. | Egfr and ros1 in cancer |
US9127274B2 (en) | 2012-04-26 | 2015-09-08 | Alnylam Pharmaceuticals, Inc. | Serpinc1 iRNA compositions and methods of use thereof |
US20150299696A1 (en) | 2012-05-02 | 2015-10-22 | Sirna Therapeutics, Inc. | SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS |
EP2872147B1 (en) | 2012-07-13 | 2022-12-21 | Wave Life Sciences Ltd. | Method for making chiral oligonucleotides |
WO2014018375A1 (en) | 2012-07-23 | 2014-01-30 | Xenon Pharmaceuticals Inc. | Cyp8b1 and uses thereof in therapeutic and diagnostic methods |
US9611474B2 (en) | 2012-09-12 | 2017-04-04 | Quark Pharmaceuticals, Inc. | Double-stranded oligonucleotide molecules to DDIT4 and methods of use thereof |
WO2014043292A1 (en) | 2012-09-12 | 2014-03-20 | Quark Pharmaceuticals, Inc. | Double-stranded oligonucleotide molecules to p53 and methods of use thereof |
CA2882950A1 (en) | 2012-09-28 | 2014-04-03 | Merck Sharp & Dohme Corp. | Novel compounds that are erk inhibitors |
RU2660349C2 (en) | 2012-11-28 | 2018-07-05 | Мерк Шарп И Доум Корп. | Compositions and methods for treatment of malignant tumour |
EP3336187A1 (en) | 2012-12-05 | 2018-06-20 | Alnylam Pharmaceuticals, Inc. | Pcsk9 irna compositions and methods of use thereof |
WO2014100065A1 (en) | 2012-12-20 | 2014-06-26 | Merck Sharp & Dohme Corp. | Substituted imidazopyridines as hdm2 inhibitors |
AU2013364158A1 (en) | 2012-12-20 | 2015-07-09 | Sarepta Therapeutics, Inc. | Improved exon skipping compositions for treating muscular dystrophy |
WO2014114649A1 (en) | 2013-01-22 | 2014-07-31 | Technische Universität Graz | Lipase inhibitors |
WO2014120748A1 (en) | 2013-01-30 | 2014-08-07 | Merck Sharp & Dohme Corp. | 2,6,7,8 substituted purines as hdm2 inhibitors |
US20150366890A1 (en) | 2013-02-25 | 2015-12-24 | Trustees Of Boston University | Compositions and methods for treating fungal infections |
BR122020016865B1 (en) | 2013-03-14 | 2022-12-27 | Sarepta Therapeutics, Inc. | ANTISENSE OLIGONUCLEOTIDE, PHARMACEUTICAL COMPOSITION INCLUDING THE SAME AND USE OF SAID COMPOSITION FOR THE TREATMENT OF DUCHENNE MUSCULAR DYSTROPHY (DMD) |
WO2014139884A2 (en) | 2013-03-14 | 2014-09-18 | Galapagos Nv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of fibrosis |
PL2970964T3 (en) | 2013-03-14 | 2019-06-28 | Sarepta Therapeutics, Inc. | Exon skipping compositions for treating muscular dystrophy |
JP2016522675A (en) | 2013-03-14 | 2016-08-04 | ガラパゴス・ナムローゼ・フェンノートシャップGalapagos N.V. | Molecular targets useful in the treatment of diseases associated with epithelial-mesenchymal transition and inhibitors of said targets |
WO2014139883A1 (en) | 2013-03-14 | 2014-09-18 | Galapagos Nv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of fibrotic diseases |
HUE034987T2 (en) | 2013-03-14 | 2018-05-02 | Alnylam Pharmaceuticals Inc | Complement component c5 irna compositions and methods of use thereof |
CA2906812A1 (en) | 2013-03-15 | 2014-09-18 | Sarepta Therapeutics, Inc. | Improved compositions for treating muscular dystrophy |
CA2918194C (en) | 2013-03-27 | 2022-12-06 | The General Hospital Corporation | Methods and agents for treating alzheimer's disease |
AR096203A1 (en) | 2013-05-06 | 2015-12-16 | Alnylam Pharmaceuticals Inc | DOSAGES AND METHODS FOR MANAGING NUCLEIC ACID MOLECULES FORMULATED IN LIPIDS |
US20160186263A1 (en) | 2013-05-09 | 2016-06-30 | Trustees Of Boston University | Using plexin-a4 as a biomarker and therapeutic target for alzheimer's disease |
BR112015029276B1 (en) | 2013-05-22 | 2022-07-12 | Alnylam Pharmaceuticals, Inc | DUAL STRIP IRNA AGENT CAPABLE OF INHIBITING THE EXPRESSION OF TMPRSS6, PHARMACEUTICAL COMPOSITION AND USE THEREOF |
PT2999785T (en) | 2013-05-22 | 2018-07-09 | Alnylam Pharmaceuticals Inc | Serpina1 irna compositions and methods of use thereof |
WO2014203189A1 (en) | 2013-06-18 | 2014-12-24 | Rosetta Genomics Ltd. | Nanocarrier system for micrornas and uses thereof |
DK3019200T3 (en) | 2013-07-11 | 2022-06-20 | Alnylam Pharmaceuticals Inc | OLIGONUCLEOTIDE-LIGAND CONJUGATES AND METHOD OF PREPARATION |
WO2015020960A1 (en) | 2013-08-09 | 2015-02-12 | Novartis Ag | Novel lncrna polynucleotides |
EP3041938A1 (en) | 2013-09-03 | 2016-07-13 | Moderna Therapeutics, Inc. | Circular polynucleotides |
EP2853595A1 (en) | 2013-09-30 | 2015-04-01 | Soluventis GmbH | NOTCH 1 specific siRNA molecules |
EP3052626A1 (en) | 2013-10-02 | 2016-08-10 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
UA124961C2 (en) | 2013-10-04 | 2021-12-22 | Елнілем Фармасьютикалз, Інк. | Compositions and methods for inhibiting expression of the alas1 gene |
CN114053395A (en) | 2013-10-08 | 2022-02-18 | 普罗麦迪奥股份有限公司 | Methods for treating fibrotic cancer |
IL282401B (en) | 2013-12-12 | 2022-08-01 | Alnylam Pharmaceuticals Inc | Complement component irna compositions and methods of use thereof |
CN112274641A (en) | 2014-01-28 | 2021-01-29 | 巴克老龄化研究所 | Methods and compositions for killing senescent cells and for treating senescence-associated diseases and disorders |
EP3960860A3 (en) | 2014-02-11 | 2022-06-08 | Alnylam Pharmaceuticals, Inc. | Ketohexokinase (khk) irna compositions and methods of use thereof |
ES2738582T3 (en) | 2014-02-14 | 2020-01-23 | Immune Design Corp | Cancer immunotherapy through a combination of local and systemic immunostimulation |
TW201607559A (en) | 2014-05-12 | 2016-03-01 | 阿尼拉製藥公司 | Methods and compositions for treating a SERPINC1-associated disorder |
AU2015264038B2 (en) | 2014-05-22 | 2021-02-11 | Alnylam Pharmaceuticals, Inc. | Angiotensinogen (AGT) iRNA compositions and methods of use thereof |
CA2955015A1 (en) | 2014-07-15 | 2016-01-21 | Immune Design Corp. | Prime-boost regimens with a tlr4 agonist adjuvant and a lentiviral vector |
SG11201701402QA (en) | 2014-08-27 | 2017-03-30 | Peptimed Inc | Anti-tumor compositions and methods |
WO2016040589A1 (en) | 2014-09-12 | 2016-03-17 | Alnylam Pharmaceuticals, Inc. | Polynucleotide agents targeting complement component c5 and methods of use thereof |
WO2016044271A2 (en) | 2014-09-15 | 2016-03-24 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation |
JOP20200115A1 (en) | 2014-10-10 | 2017-06-16 | Alnylam Pharmaceuticals Inc | Compositions And Methods For Inhibition Of HAO1 (Hydroxyacid Oxidase 1 (Glycolate Oxidase)) Gene Expression |
WO2016061487A1 (en) | 2014-10-17 | 2016-04-21 | Alnylam Pharmaceuticals, Inc. | Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof |
EP3904519A1 (en) | 2014-10-30 | 2021-11-03 | Genzyme Corporation | Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof |
JOP20200092A1 (en) | 2014-11-10 | 2017-06-16 | Alnylam Pharmaceuticals Inc | HEPATITIS B VIRUS (HBV) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
AU2015350120B2 (en) | 2014-11-17 | 2021-05-27 | Alnylam Pharmaceuticals, Inc. | Apolipoprotein C3 (APOC3) iRNA compositions and methods of use thereof |
US20180057839A1 (en) | 2014-11-26 | 2018-03-01 | The Regents Of The University Of California | Therapeutic compositions comprising transcription factors and methods of making and using the same |
WO2016083624A1 (en) | 2014-11-28 | 2016-06-02 | Silence Therapeutics Gmbh | Means for inhibiting the expression of edn1 |
CA2976445A1 (en) | 2015-02-13 | 2016-08-18 | Alnylam Pharmaceuticals, Inc. | Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof |
EP3268475B1 (en) | 2015-03-11 | 2020-10-21 | Yissum Research and Development Company of the Hebrew University of Jerusalem Ltd. | Decoy oligonucleotides for the treatment of diseases |
WO2016164746A1 (en) | 2015-04-08 | 2016-10-13 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
WO2016201301A1 (en) | 2015-06-12 | 2016-12-15 | Alnylam Pharmaceuticals, Inc. | Complement component c5 irna compositions and methods of use thereof |
WO2016205323A1 (en) | 2015-06-18 | 2016-12-22 | Alnylam Pharmaceuticals, Inc. | Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof |
WO2016209862A1 (en) | 2015-06-23 | 2016-12-29 | Alnylam Pharmaceuticals, Inc. | Glucokinase (gck) irna compositions and methods of use thereof |
US10494632B2 (en) | 2015-07-10 | 2019-12-03 | Alnylam Pharmaceuticals, Inc. | Insulin-like growth factor binding protein, acid labile subunit (IGFALS) compositions and methods of use thereof |
AU2016295168B2 (en) | 2015-07-17 | 2021-08-19 | Alnylam Pharmaceuticals, Inc. | Multi-targeted single entity conjugates |
CN108697659A (en) | 2015-08-21 | 2018-10-23 | 费城儿童医院 | For treating and the composition being applied in combination and method of diagnosis of autoimmune disease |
CN114525280A (en) | 2015-09-02 | 2022-05-24 | 阿尔尼拉姆医药品有限公司 | iRNA compositions of programmed cell death 1 ligand 1(PD-L1) and methods of use thereof |
EP3653216A1 (en) | 2015-09-30 | 2020-05-20 | Sarepta Therapeutics, Inc. | Methods for treating muscular dystrophy |
WO2017069958A2 (en) | 2015-10-09 | 2017-04-27 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
WO2017075451A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting pou2af1 |
EP3368689B1 (en) | 2015-10-28 | 2020-06-17 | The Broad Institute, Inc. | Composition for modulating immune responses by use of immune cell gene signature |
WO2017075465A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting gata3 |
WO2017184586A1 (en) | 2016-04-18 | 2017-10-26 | The Trustees Of Columbia University In The City Of New York | Therapeutic targets involved in the progression of nonalcoholic steatohepatitis (nash) |
MA45295A (en) | 2016-04-19 | 2019-02-27 | Alnylam Pharmaceuticals Inc | HIGH DENSITY LIPOPROTEIN BINDING PROTEIN (HDLBP / VIGILINE) RNA COMPOSITION AND METHODS FOR USING THEM |
NZ747685A (en) | 2016-04-29 | 2023-05-26 | Sarepta Therapeutics Inc | Oligonucleotide analogues targeting human lmna |
JP2019518028A (en) | 2016-06-10 | 2019-06-27 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Complement component C5i RNA composition and its use for treating paroxysmal nocturnal hemoglobinuria (PNH) |
AU2017290231A1 (en) | 2016-06-30 | 2019-02-07 | Sarepta Therapeutics, Inc. | Exon skipping oligomers for muscular dystrophy |
EP3269734A1 (en) | 2016-07-15 | 2018-01-17 | Fundació Privada Institut d'Investigació Oncològica de Vall-Hebron | Methods and compositions for the treatment of cancer |
US20190262399A1 (en) | 2016-09-07 | 2019-08-29 | The Broad Institute, Inc. | Compositions and methods for evaluating and modulating immune responses |
US20200016202A1 (en) | 2016-10-07 | 2020-01-16 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
TW202313978A (en) | 2016-11-23 | 2023-04-01 | 美商阿尼拉製藥公司 | Serpina1 irna compositions and methods of use thereof |
EP3330276A1 (en) | 2016-11-30 | 2018-06-06 | Universität Bern | Novel bicyclic nucleosides and oligomers prepared therefrom |
KR20230166146A (en) | 2016-12-16 | 2023-12-06 | 알닐람 파마슈티칼스 인코포레이티드 | Methods for treating or preventing ttr-associated diseases using transthyretin(ttr) irna compositions |
MD3554553T2 (en) | 2016-12-19 | 2022-10-31 | Sarepta Therapeutics Inc | Exon skipping oligomer conjugates for muscular dystrophy |
BR112019012664A2 (en) | 2016-12-19 | 2020-01-21 | Sarepta Therapeutics Inc | exon jump oligomer conjugates for muscular dystrophy |
MX2019006989A (en) | 2016-12-19 | 2019-08-16 | Sarepta Therapeutics Inc | Exon skipping oligomer conjugates for muscular dystrophy. |
KR20200015895A (en) | 2017-04-18 | 2020-02-13 | 알닐람 파마슈티칼스 인코포레이티드 | How to treat a subject infected with hepatitis B virus (HBV) |
WO2019014530A1 (en) | 2017-07-13 | 2019-01-17 | Alnylam Pharmaceuticals Inc. | Lactate dehydrogenase a (ldha) irna compositions and methods of use thereof |
EA201991450A1 (en) | 2017-09-22 | 2019-12-30 | Сарепта Терапьютикс, Инк. | OLIGOMER CONJUGATES FOR EXONISM SKIP IN MUSCULAR DYSTROPHY |
US20200254002A1 (en) | 2017-09-28 | 2020-08-13 | Sarepta Therapeutics, Inc. | Combination therapies for treating muscular dystrophy |
JP2020536060A (en) | 2017-09-28 | 2020-12-10 | サレプタ セラピューティクス, インコーポレイテッド | Combination therapy to treat muscular dystrophy |
US20210145852A1 (en) | 2017-09-28 | 2021-05-20 | Sarepta Therapeutics, Inc. | Combination Therapies for Treating Muscular Dystrophy |
WO2019089922A1 (en) | 2017-11-01 | 2019-05-09 | Alnylam Pharmaceuticals, Inc. | Complement component c3 irna compositions and methods of use thereof |
EP3706742B1 (en) | 2017-11-08 | 2023-03-15 | Merck Sharp & Dohme LLC | Prmt5 inhibitors |
US20200385719A1 (en) | 2017-11-16 | 2020-12-10 | Alnylam Pharmaceuticals, Inc. | Kisspeptin 1 (kiss1) irna compositions and methods of use thereof |
WO2019100039A1 (en) | 2017-11-20 | 2019-05-23 | Alnylam Pharmaceuticals, Inc. | Serum amyloid p component (apcs) irna compositions and methods of use thereof |
JP2021508491A (en) | 2017-12-18 | 2021-03-11 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | High Mobility Group Box-1 (HMGB1) iRNA Composition and How to Use It |
CN112105625A (en) | 2018-03-07 | 2020-12-18 | 赛诺菲 | Nucleotide precursors, nucleotide analogs, and oligomeric compounds containing the same |
TW202016304A (en) | 2018-05-14 | 2020-05-01 | 美商阿尼拉製藥公司 | Angiotensinogen (agt) irna compositions and methods of use thereof |
US10765760B2 (en) | 2018-05-29 | 2020-09-08 | Sarepta Therapeutics, Inc. | Exon skipping oligomer conjugates for muscular dystrophy |
EP3806868A4 (en) | 2018-06-13 | 2022-06-22 | Sarepta Therapeutics, Inc. | Exon skipping oligomers for muscular dystrophy |
TW202020153A (en) | 2018-07-27 | 2020-06-01 | 美商薩羅塔治療公司 | Exon skipping oligomers for muscular dystrophy |
US20210309688A1 (en) | 2018-08-07 | 2021-10-07 | Merck Sharp & Dohme Corp. | Prmt5 inhibitors |
WO2020033282A1 (en) | 2018-08-07 | 2020-02-13 | Merck Sharp & Dohme Corp. | Prmt5 inhibitors |
SG11202100715WA (en) | 2018-08-13 | 2021-02-25 | Alnylam Pharmaceuticals Inc | HEPATITIS B VIRUS (HBV) dsRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF |
TW202020157A (en) | 2018-08-16 | 2020-06-01 | 美商艾爾妮蘭製藥公司 | Compositions and methods for inhibiting expression of the lect2 gene |
JP2022500003A (en) | 2018-09-18 | 2022-01-04 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Ketohexokinase (KHK) iRNA composition and its usage |
US10913951B2 (en) | 2018-10-31 | 2021-02-09 | University of Pittsburgh—of the Commonwealth System of Higher Education | Silencing of HNF4A-P2 isoforms with siRNA to improve hepatocyte function in liver failure |
US20220025367A1 (en) | 2018-11-23 | 2022-01-27 | Sanofi | Novel rna compositions and methods for inhibiting angptl8 |
EA202191601A1 (en) | 2018-12-13 | 2022-01-19 | Сарепта Терапьютикс, Инк. | OLIGOMER CONJUGATES FOR EXON SKIP IN MUSCULAR DYSTROPHY |
AU2019406186A1 (en) | 2018-12-20 | 2021-07-15 | Praxis Precision Medicines, Inc. | Compositions and methods for the treatment of KCNT1 related disorders |
TW202039000A (en) | 2018-12-20 | 2020-11-01 | 瑞士商休曼斯生物醫藥公司 | Combination hbv therapy |
WO2020187998A1 (en) | 2019-03-19 | 2020-09-24 | Fundació Privada Institut D'investigació Oncològica De Vall Hebron | Combination therapy with omomyc and an antibody binding pd-1 or ctla-4 for the treatment of cancer |
MX2021011498A (en) | 2019-03-28 | 2022-01-04 | Sarepta Therapeutics Inc | Methods for treating muscular dystrophy with casimersen. |
US20220193246A1 (en) | 2019-04-18 | 2022-06-23 | Sarepta Therapeutics, Inc. | Compositions for treating muscular dystrophy |
US20220296633A1 (en) | 2019-06-19 | 2022-09-22 | Sarepta Therapeutics, Inc. | Methods for treating muscular dystrophy |
WO2021009273A1 (en) | 2019-07-16 | 2021-01-21 | Université Cote D'azur | Method of assessing the sensitivity or resistance of a subject to an oncolytic virus, recombinant virus, preparation and uses thereof |
WO2021022108A2 (en) | 2019-08-01 | 2021-02-04 | Alnylam Pharmaceuticals, Inc. | CARBOXYPEPTIDASE B2 (CPB2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
EP4007812A1 (en) | 2019-08-01 | 2022-06-08 | Alnylam Pharmaceuticals, Inc. | Serpin family f member 2 (serpinf2) irna compositions and methods of use thereof |
WO2021030522A1 (en) | 2019-08-13 | 2021-02-18 | Alnylam Pharmaceuticals, Inc. | SMALL RIBOSOMAL PROTEIN SUBUNIT 25 (RPS25) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF |
ES2918001A2 (en) | 2019-08-14 | 2022-07-13 | Acuitas Therapeutics Inc | Improved lipid nanoparticles for delivery of nucleic acids |
EP4022061A1 (en) | 2019-08-27 | 2022-07-06 | Sanofi | Compositions and methods for inhibiting pcsk9 |
US20220290152A1 (en) | 2019-09-03 | 2022-09-15 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
JP2022547888A (en) | 2019-09-05 | 2022-11-16 | サノフイ | Oligonucleotides containing nucleotide analogues |
CA3147641A1 (en) | 2019-09-23 | 2021-04-01 | Omega Therapeutics, Inc. | Compositions and methods for modulating apolipoprotein b (apob) gene expression |
US20220348908A1 (en) | 2019-09-23 | 2022-11-03 | Omega Therapeutics, Inc. | COMPOSITIONS AND METHODS FOR MODULATING HEPATOCYTE NUCLEAR FACTOR 4-ALPHA (HNF4alpha) GENE EXPRESSION |
US20220389429A1 (en) | 2019-10-04 | 2022-12-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing ugt1a1 gene expression |
AU2020363372A1 (en) | 2019-10-07 | 2022-05-19 | University Of Virginia Patent Foundation | Modulating lymphatic vessels in neurological disease |
EP3808763A1 (en) | 2019-10-17 | 2021-04-21 | Fundació Institut d'Investigació Biomèdica de Bellvitge (IDIBELL) | Compounds for immunomodulation |
EP4045652A1 (en) | 2019-10-18 | 2022-08-24 | Alnylam Pharmaceuticals, Inc. | Solute carrier family member irna compositions and methods of use thereof |
TW202134435A (en) | 2019-10-22 | 2021-09-16 | 美商阿尼拉製藥公司 | Complement component c3 irna compositions and methods of use thereof |
EP4051796A1 (en) | 2019-11-01 | 2022-09-07 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing dnajb1-prkaca fusion gene expression |
TW202132567A (en) | 2019-11-01 | 2021-09-01 | 美商阿尼拉製藥公司 | Huntingtin (htt) irna agent compositions and methods of use thereof |
MX2022005692A (en) | 2019-11-13 | 2022-06-08 | Alnylam Pharmaceuticals Inc | Methods and compositions for treating an angiotensinogen- (agt-) associated disorder. |
EP4061945A1 (en) | 2019-11-22 | 2022-09-28 | Alnylam Pharmaceuticals, Inc. | Ataxin3 (atxn3) rnai agent compositions and methods of use thereof |
KR20220115995A (en) | 2019-12-13 | 2022-08-19 | 알닐람 파마슈티칼스 인코포레이티드 | Human chromosome 9 open reading frame 72 (C9orf72) iRNA preparation compositions and methods of using the same |
WO2021126734A1 (en) | 2019-12-16 | 2021-06-24 | Alnylam Pharmaceuticals, Inc. | Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof |
US20230067811A1 (en) | 2020-01-24 | 2023-03-02 | University Of Virginia Patent Foundation | Modulating lymphatic vessels in neurological disease |
WO2021154941A1 (en) | 2020-01-31 | 2021-08-05 | Alnylam Pharmaceuticals, Inc. | Complement component c5 irna compositions for use in the treatment of amyotrophic lateral sclerosis (als) |
IL295445A (en) | 2020-02-10 | 2022-10-01 | Alnylam Pharmaceuticals Inc | Compositions and methods for silencing vegf-a expression |
MX2022010052A (en) | 2020-02-18 | 2022-09-05 | Alnylam Pharmaceuticals Inc | Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof. |
WO2021178736A1 (en) | 2020-03-06 | 2021-09-10 | Alnylam Pharmaceuticals, Inc. | KETOHEXOKINASE (KHK) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
WO2021178778A1 (en) | 2020-03-06 | 2021-09-10 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of transthyretin (ttr) |
WO2021183720A1 (en) | 2020-03-11 | 2021-09-16 | Omega Therapeutics, Inc. | Compositions and methods for modulating forkhead box p3 (foxp3) gene expression |
EP4121534A1 (en) | 2020-03-18 | 2023-01-25 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant |
WO2021195307A1 (en) | 2020-03-26 | 2021-09-30 | Alnylam Pharmaceuticals, Inc. | Coronavirus irna compositions and methods of use thereof |
EP4127171A2 (en) | 2020-03-30 | 2023-02-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing dnajc15 gene expression |
CA3179411A1 (en) | 2020-04-06 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing myoc expression |
WO2021206917A1 (en) | 2020-04-07 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | ANGIOTENSIN-CONVERTING ENZYME 2 (ACE2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
WO2021206922A1 (en) | 2020-04-07 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Transmembrane serine protease 2 (tmprss2) irna compositions and methods of use thereof |
CN116134135A (en) | 2020-04-07 | 2023-05-16 | 阿尔尼拉姆医药品有限公司 | Compositions and methods for silencing SCN9A expression |
CA3181400A1 (en) | 2020-04-27 | 2021-11-04 | Alnylam Pharmaceuticals, Inc. | Apolipoprotein e (apoe) irna agent compositions and methods of use thereof |
WO2021222549A1 (en) | 2020-04-30 | 2021-11-04 | Alnylam Pharmaceuticals, Inc. | Complement factor b (cfb) irna compositions and methods of use thereof |
WO2021231692A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of otoferlin (otof) |
EP4150077A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of transmembrane channel-like protein 1 (tmc1) |
WO2021231673A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of leucine rich repeat kinase 2 (lrrk2) |
EP4150078A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of argininosuccinate lyase (asl) |
WO2021231675A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of argininosuccinate synthetase (ass1) |
WO2021231680A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of methyl-cpg binding protein 2 (mecp2) |
EP4150089A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of retinoschisin 1 (rs1) |
EP4150087A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of gap junction protein beta 2 (gjb2) |
EP4153746A1 (en) | 2020-05-21 | 2023-03-29 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting marc1 gene expression |
AR122534A1 (en) | 2020-06-03 | 2022-09-21 | Triplet Therapeutics Inc | METHODS FOR THE TREATMENT OF NUCLEOTIDE REPEAT EXPANSION DISORDERS ASSOCIATED WITH MSH3 ACTIVITY |
BR112022024420A2 (en) | 2020-06-18 | 2023-01-17 | Alnylam Pharmaceuticals Inc | XANTHINE DEHYDROGENASE (XDH) IRNA COMPOSITIONS AND METHODS OF USE THEREOF |
AU2021296848A1 (en) | 2020-06-24 | 2023-02-09 | Humabs Biomed Sa | Engineered hepatitis B virus neutralizing antibodies and uses thereof |
WO2022066847A1 (en) | 2020-09-24 | 2022-03-31 | Alnylam Pharmaceuticals, Inc. | Dipeptidyl peptidase 4 (dpp4) irna compositions and methods of use thereof |
EP4225917A1 (en) | 2020-10-05 | 2023-08-16 | Alnylam Pharmaceuticals, Inc. | G protein-coupled receptor 75 (gpr75) irna compositions and methods of use thereof |
US20240035029A1 (en) | 2020-10-16 | 2024-02-01 | Sanofi | Rna compositions and methods for inhibiting lipoprotein(a) |
JP2023546103A (en) | 2020-10-16 | 2023-11-01 | サノフイ | Novel RNA compositions and methods for inhibiting ANGPTL3 |
CN116368146A (en) | 2020-10-20 | 2023-06-30 | 赛诺菲 | Novel ligands for asialoglycoprotein receptors |
AU2021365822A1 (en) | 2020-10-21 | 2023-06-08 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for treating primary hyperoxaluria |
WO2022087329A1 (en) | 2020-10-23 | 2022-04-28 | Alnylam Pharmaceuticals, Inc. | Mucin 5b (muc5b) irna compositions and methods of use thereof |
IL302709A (en) | 2020-11-13 | 2023-07-01 | Alnylam Pharmaceuticals Inc | COAGULATION FACTOR V (F5) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
EP4256053A1 (en) | 2020-12-01 | 2023-10-11 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression |
WO2022125490A1 (en) | 2020-12-08 | 2022-06-16 | Alnylam Pharmaceuticals, Inc. | Coagulation factor x (f10) irna compositions and methods of use thereof |
EP4274896A1 (en) | 2021-01-05 | 2023-11-15 | Alnylam Pharmaceuticals, Inc. | Complement component 9 (c9) irna compositions and methods of use thereof |
JP2024508714A (en) | 2021-02-12 | 2024-02-28 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | Superoxide dismutase 1 (SOD1) iRNA composition and method for using the same for treating or preventing superoxide dismutase 1- (SOD1-) related neurodegenerative diseases |
JP2024509783A (en) | 2021-02-25 | 2024-03-05 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | Prion protein (PRNP) IRNA compositions and methods of use thereof |
KR20230150844A (en) | 2021-02-26 | 2023-10-31 | 알닐람 파마슈티칼스 인코포레이티드 | Ketohexokinase (KHK) iRNA compositions and methods of using the same |
CA3212128A1 (en) | 2021-03-04 | 2022-09-09 | Alnylam Pharmaceuticals, Inc. | Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof |
WO2022192519A1 (en) | 2021-03-12 | 2022-09-15 | Alnylam Pharmaceuticals, Inc. | Glycogen synthase kinase 3 alpha (gsk3a) irna compositions and methods of use thereof |
WO2022212231A2 (en) | 2021-03-29 | 2022-10-06 | Alnylam Pharmaceuticals, Inc. | Huntingtin (htt) irna agent compositions and methods of use thereof |
IL307298A (en) | 2021-03-31 | 2023-11-01 | Entrada Therapeutics Inc | Cyclic cell penetrating peptides |
WO2022212153A1 (en) | 2021-04-01 | 2022-10-06 | Alnylam Pharmaceuticals, Inc. | Proline dehydrogenase 2 (prodh2) irna compositions and methods of use thereof |
IL307926A (en) | 2021-04-26 | 2023-12-01 | Alnylam Pharmaceuticals Inc | Transmembrane protease, serine 6 (tmprss6) irna compositions and methods of use thereof |
EP4330396A1 (en) | 2021-04-29 | 2024-03-06 | Alnylam Pharmaceuticals, Inc. | Signal transducer and activator of transcription factor 6 (stat6) irna compositions and methods of use thereof |
EP4330395A1 (en) | 2021-04-30 | 2024-03-06 | Sarepta Therapeutics, Inc. | Treatment methods for muscular dystrophy |
WO2022240721A1 (en) | 2021-05-10 | 2022-11-17 | Entrada Therapeutics, Inc. | Compositions and methods for modulating interferon regulatory factor-5 (irf-5) activity |
CA3217463A1 (en) | 2021-05-10 | 2022-11-17 | Ziqing QIAN | Compositions and methods for modulating mrna splicing |
IL308353A (en) | 2021-05-10 | 2024-01-01 | Entrada Therapeutics Inc | Compositions and methods for modulating tissue distribution of intracellular therapeutics |
WO2022245583A1 (en) | 2021-05-18 | 2022-11-24 | Alnylam Pharmaceuticals, Inc. | Sodium-glucose cotransporter-2 (sglt2) irna compositions and methods of use thereof |
EP4341405A1 (en) | 2021-05-20 | 2024-03-27 | Korro Bio, Inc. | Methods and compositions for adar-mediated editing |
WO2022256283A2 (en) | 2021-06-01 | 2022-12-08 | Korro Bio, Inc. | Methods for restoring protein function using adar |
EP4347823A1 (en) | 2021-06-02 | 2024-04-10 | Alnylam Pharmaceuticals, Inc. | Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof |
CN117561334A (en) | 2021-06-04 | 2024-02-13 | 阿尔尼拉姆医药品有限公司 | Human chromosome 9 open reading frame 72 (C9 ORF 72) iRNA pharmaceutical compositions and methods of use thereof |
WO2022260939A2 (en) | 2021-06-08 | 2022-12-15 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for treating or preventing stargardt's disease and/or retinal binding protein 4 (rbp4)-associated disorders |
AU2022298774A1 (en) | 2021-06-23 | 2023-12-14 | Entrada Therapeutics, Inc. | Antisense compounds and methods for targeting cug repeats |
WO2023278410A1 (en) | 2021-06-29 | 2023-01-05 | Korro Bio, Inc. | Methods and compositions for adar-mediated editing |
US20230194709A9 (en) | 2021-06-29 | 2023-06-22 | Seagate Technology Llc | Range information detection using coherent pulse sets with selected waveform characteristics |
KR20240026203A (en) | 2021-06-30 | 2024-02-27 | 알닐람 파마슈티칼스 인코포레이티드 | Methods and compositions for treating angiotensinogen (AGT)-related disorders |
WO2023283359A2 (en) | 2021-07-07 | 2023-01-12 | Omega Therapeutics, Inc. | Compositions and methods for modulating secreted frizzled receptor protein 1 (sfrp1) gene expression |
WO2023283403A2 (en) | 2021-07-09 | 2023-01-12 | Alnylam Pharmaceuticals, Inc. | Bis-rnai compounds for cns delivery |
WO2023003805A1 (en) | 2021-07-19 | 2023-01-26 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder |
AU2022314619A1 (en) | 2021-07-21 | 2024-01-04 | Alnylam Pharmaceuticals, Inc. | Metabolic disorder-associated target gene irna compositions and methods of use thereof |
WO2023003995A1 (en) | 2021-07-23 | 2023-01-26 | Alnylam Pharmaceuticals, Inc. | Beta-catenin (ctnnb1) irna compositions and methods of use thereof |
WO2023009687A1 (en) | 2021-07-29 | 2023-02-02 | Alnylam Pharmaceuticals, Inc. | 3-hydroxy-3-methylglutaryl-coa reductase (hmgcr) irna compositions and methods of use thereof |
WO2023014677A1 (en) | 2021-08-03 | 2023-02-09 | Alnylam Pharmaceuticals, Inc. | Transthyretin (ttr) irna compositions and methods of use thereof |
KR20240042016A (en) | 2021-08-04 | 2024-04-01 | 알닐람 파마슈티칼스 인코포레이티드 | iRNA compositions and methods for silencing angiotensinogen (AGT) |
WO2023014938A1 (en) | 2021-08-05 | 2023-02-09 | Sanegene Bio Usa Inc. | 1'-alkyl modified ribose derivatives and methods of use |
IL310407A (en) | 2021-08-13 | 2024-03-01 | Alnylam Pharmaceuticals Inc | Factor xii (f12) irna compositions and methods of use thereof |
WO2023044370A2 (en) | 2021-09-17 | 2023-03-23 | Alnylam Pharmaceuticals, Inc. | Irna compositions and methods for silencing complement component 3 (c3) |
CA3232420A1 (en) | 2021-09-20 | 2023-03-23 | Alnylam Pharmaceuticals, Inc. | Inhibin subunit beta e (inhbe) modulator compositions and methods of use thereof |
US20230241224A1 (en) | 2021-09-22 | 2023-08-03 | Sanegene Bio Usa Inc. | 2'-alkyl or 3'- alkyl modified ribose derivatives and methods of use |
AU2022361238A1 (en) | 2021-10-05 | 2024-04-11 | Sanegene Bio Usa Inc. | Polyhydroxylated cyclopentane derivatives and methods of use |
WO2023064530A1 (en) | 2021-10-15 | 2023-04-20 | Alnylam Pharmaceuticals, Inc. | Extra-hepatic delivery irna compositions and methods of use thereof |
CA3234811A1 (en) | 2021-10-20 | 2023-04-27 | Steven Goldman | Rejuvenation treatment of age-related white matter loss |
CA3234835A1 (en) | 2021-10-22 | 2023-04-27 | Korro Bio, Inc. | Methods and compositions for disrupting nrf2-keap1 protein interaction by adar mediated rna editing |
CA3234636A1 (en) | 2021-10-29 | 2023-05-04 | Alnylam Pharmaceuticals, Inc. | Complement factor b (cfb) irna compositions and methods of use thereof |
TW202334418A (en) | 2021-10-29 | 2023-09-01 | 美商艾拉倫製藥股份有限公司 | Huntingtin (htt) irna agent compositions and methods of use thereof |
WO2023091704A1 (en) | 2021-11-18 | 2023-05-25 | Circularis Biotechnologies, Inc. | Compositions and methods for production of circular nucleic acid molecules |
WO2023122762A1 (en) | 2021-12-22 | 2023-06-29 | Camp4 Therapeutics Corporation | Modulation of gene transcription using antisense oligonucleotides targeting regulatory rnas |
WO2023141314A2 (en) | 2022-01-24 | 2023-07-27 | Alnylam Pharmaceuticals, Inc. | Heparin sulfate biosynthesis pathway enzyme irna agent compositions and methods of use thereof |
WO2023144792A1 (en) | 2022-01-31 | 2023-08-03 | Genevant Sciences Gmbh | Poly(alkyloxazoline)-lipid conjugates and lipid particles containing same |
WO2023144798A1 (en) | 2022-01-31 | 2023-08-03 | Genevant Sciences Gmbh | Ionizable cationic lipids for lipid nanoparticles |
US20230346819A1 (en) | 2022-02-22 | 2023-11-02 | Sanegene Bio Usa Inc. | 5'-modified carbocyclic ribonucleotide derivatives and methods of use |
WO2023178230A1 (en) | 2022-03-17 | 2023-09-21 | Sarepta Therapeutics, Inc. | Phosphorodiamidate morpholino oligomer conjugates |
WO2023240277A2 (en) | 2022-06-10 | 2023-12-14 | Camp4 Therapeutics Corporation | Methods of modulating progranulin expression using antisense oligonucleotides targeting regulatory rnas |
WO2024015796A1 (en) | 2022-07-11 | 2024-01-18 | Sanegene Bio Usa Inc. | Optimized 2'- modified ribose derivatives and methods of use |
WO2024039776A2 (en) | 2022-08-18 | 2024-02-22 | Alnylam Pharmaceuticals, Inc. | Universal non-targeting sirna compositions and methods of use thereof |
WO2024059165A1 (en) | 2022-09-15 | 2024-03-21 | Alnylam Pharmaceuticals, Inc. | 17b-hydroxysteroid dehydrogenase type 13 (hsd17b13) irna compositions and methods of use thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994010301A1 (en) * | 1992-11-03 | 1994-05-11 | Gene Shears Pty. Limited | TNF-α RIBOZYMES AND DEGRADATION RESISTANT mRNA DERIVATIVES LINKED TO TNF-α RIBOZYMES |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5168053A (en) * | 1989-03-24 | 1992-12-01 | Yale University | Cleavage of targeted RNA by RNAase P |
US5272263A (en) * | 1989-04-28 | 1993-12-21 | Biogen, Inc. | DNA sequences encoding vascular cell adhesion molecules (VCAMS) |
IE911115A1 (en) * | 1990-04-10 | 1991-10-23 | Canji Inc | Gene therapy for cell proliferative diseases |
GB9106678D0 (en) * | 1991-03-28 | 1991-05-15 | Ferguson Mark W J | Wound healing |
CA2183992A1 (en) * | 1994-02-23 | 1995-08-31 | Dan T. Stinchcomb | Method and reagent for inhibiting the expression of disease related genes |
-
1993
- 1993-07-02 EP EP02005642A patent/EP1251170A3/en not_active Withdrawn
- 1993-07-02 EP EP93918144A patent/EP0654077A4/en active Pending
- 1993-07-02 AU AU47698/93A patent/AU4769893A/en not_active Abandoned
- 1993-07-02 EP EP97101534A patent/EP0786522A2/en not_active Withdrawn
- 1993-07-02 WO PCT/US1993/006316 patent/WO1994002595A1/en not_active Application Discontinuation
- 1993-07-02 CA CA002140343A patent/CA2140343A1/en not_active Abandoned
- 1993-07-02 JP JP6504490A patent/JPH07509133A/en active Pending
- 1993-07-16 MX MX9304329A patent/MX9304329A/en unknown
-
1998
- 1998-01-16 AU AU52096/98A patent/AU5209698A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994010301A1 (en) * | 1992-11-03 | 1994-05-11 | Gene Shears Pty. Limited | TNF-α RIBOZYMES AND DEGRADATION RESISTANT mRNA DERIVATIVES LINKED TO TNF-α RIBOZYMES |
Non-Patent Citations (5)
Title |
---|
EDGINGTON, S.M.: "ribozymes: stop making sense" BIOTECHNOLOGY, vol. 10, pages 256-262, NEW YORK US * |
KISICH, K. & ERICKSON, K.: "ANTI-TUMOR NECROSIS FACTOR - ALPHA RIBOZYMES CAN SPECIFICALLY CLEAVE TUMOR NECROSIS FACTOR - ALPHA MESSENGER RNA WITHIN MAMMALIAN CELLS." J. LEUKOCYTE BIOL. 0 (SUPPL. 2). 1991. 70, & TWENTY-EIGHTH NATIONAL MEETING OF THE SOCIETY FOR LEUKOCYTE BIOLOGY AND THE TWENTY-FIRST LEUKOCYTE CULTURE CONFERENCE, ASPEN, COLORADO, USA, 28 September 1991 (1991-09-28), * |
KISICH, K. ET AL.: "REGULATION OF TUMOR NECROSIS FACTOR - ALPHA GENE EXPRESSION FOLLOWING RIBOZYME TRANSFECTION A GENETICALLY ENGINEERED MODEL FOR THE TREATMENT OF TOXIC SHOCK." CLIN RES 41 (2). 137A, & JOINT MEETING OF THE ASSOCIATION OF AMERICAN PHYSICIANS, THE AMERICAN SOCIETY FOR CLINICAL INVESTIGATION, AND THE AMERICAN FEDERATION FOR CLINICAL RESEARCH, WASHINGTON, DC, USA, APRIL 30-MAY 3, 1993., * |
See also references of WO9402595A1 * |
SIOUD, M. ET AL.: "Preformed ribozyme destroys tumor necrosis factor mRNA in human cells" J. MOL. BIOL. 223 (4), 831-5, 20 February 1992 (1992-02-20), * |
Also Published As
Publication number | Publication date |
---|---|
AU4769893A (en) | 1994-02-14 |
EP1251170A3 (en) | 2002-10-30 |
EP0786522A3 (en) | 1997-08-27 |
EP0786522A2 (en) | 1997-07-30 |
JPH07509133A (en) | 1995-10-12 |
EP0654077A4 (en) | 1996-03-13 |
CA2140343A1 (en) | 1994-02-03 |
EP1251170A2 (en) | 2002-10-23 |
WO1994002595A1 (en) | 1994-02-03 |
AU5209698A (en) | 1998-03-19 |
MX9304329A (en) | 1994-05-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1251170A2 (en) | Method and reagent for treatment of NF-kappaB dependent animal diseases | |
US5989906A (en) | Method and reagent for inhibiting P-glycoprotein (mdr-1-gene) | |
EP0725788B1 (en) | 2'-amido and 2'-peptido modified oligonucleotides | |
US6159692A (en) | Method and reagent for inhibiting human immunodeficiency virus replication | |
US6831171B2 (en) | Nucleic acid catalysts with endonuclease activity | |
US5750390A (en) | Method and reagent for treatment of diseases caused by expression of the bcl-2 gene | |
US6017756A (en) | Method and reagent for inhibiting hepatitis B virus replication | |
AU687001B2 (en) | Method and reagent for inhibiting cancer development | |
US5972699A (en) | Method and reagent for inhibiting herpes simplex virus replication | |
US5616490A (en) | Ribozymes targeted to TNF-α RNA | |
EP0728205B1 (en) | Reagent for treatment of arthritic conditions | |
WO1995004818A1 (en) | Method and reagent for inhibiting human immunodeficiency virus replication | |
US5599704A (en) | ErbB2/neu targeted ribozymes | |
US5801158A (en) | Enzymatic RNA with activity to RAS | |
WO1998032846A2 (en) | Enzymatic nucleic acid treatment of diseases or conditions related to levels of c-fos | |
US5639655A (en) | PML-RARA targeted ribozymes | |
CA2398750A1 (en) | Nucleozymes with endonuclease activity | |
WO1994029452A2 (en) | Enzymatic rna molecules and their application in the treatment of fibrosis and fibrous tissue disease | |
US6544755B1 (en) | Method and reagent for treatment of diseases by expression of the c-Myc gene | |
US6492512B1 (en) | Method and reagent for treatment of lung cancer and other malignancies caused by the deregulation of L-MYC gene expression | |
AU5661700A (en) | Method and reagent for treatment of animal diseases | |
CA2168566A1 (en) | Method and reagent for inhibiting human immunodeficiency virus replication | |
AU7375594A (en) | Method and reagent for inhibiting human immunodeficiency virus replication | |
AU6879501A (en) | Methods and compositions for treatment of restenosis and cancer using ribozymes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 19950216 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
RHK1 | Main classification (correction) |
Ipc: C12N 15/52 |
|
A4 | Supplementary search report drawn up and despatched | ||
AK | Designated contracting states |
Kind code of ref document: A4 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
17Q | First examination report despatched |
Effective date: 19991216 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |