Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/102—Mutagenizing nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology

Definitions

• the present invention relates to the field of genetic manipulation of plants and to that end makes use of a transposition system consisting of two elements, as well as a recombination system consisting of two elements, both active in the plant. Combining these two systems provides the possibility of obtaining deletion mutants or inversion mutants which cannot be obtained with either of the two systems alone.
• the present invention relates to a method for providing a deletion mutation or inversion mutation in a plant genome, wherein recombination in the plant genome is induced after transposition has taken place, so as to induce a deletion or inversion between the original and the new position of the transposon.
• the invention further relates to a method in which the DNA deleted by recombination is isolated.
• Organisms with a mutant phenotype often form the basis for the characterization and isolation of a gene or a set of genes.
• prokaryotes in particular frequent use is made of the induction of deletion mutants for research into the molecular structure of the genome, as well as for the characterization and isolation of genes which are being researched.
• the process of deletion induction is relatively simple because large numbers of specimens can be tested and the frequency at which homologous recombination occurs is relatively high. In eukaryotic cells, however, the frequency at which homologous recombination occurs is much lower and therefore it is less simple to induce deletion mutants in these cells at a high frequency. It is true it is possible to obtain mutants in prokaryotic and eukaryotic cells by chemical means, UV irradiaton, stress treatment, etc. These methods mainly yield point mutations and deletions/insertions of a few base pairs in the DNA of the treated cells. The mechanism by which these mutations are produced is often unclear and the location of the mutation produced in the genome cannot be traced, unless there is selection for a predetermined mutation.
• the location of a mutation can be determined when use is made of insertion mutagenesis. The point is that the mutated gene can then be isolated by making use of the known sequence of the mutagen used.
• transposons In prokaryotes, often use is made of transposons as an insertion mutagen.
• a transposon is a particular DNA fragment that is capable of changing its position in the genome of the host. This change in position can occur via a so-called conservative mechanism, whereby the gene excises from the original position and then reintegrates into the genome at a new location.
• transposons In prokaryotes, however, there are also transposons known which transpose via a replicative method. In this case, a complete copy of the transposon is left behind at the original position, while a new copy of the transposon inserts at another location in the genome. The reintegration of a transposon in or near a particular gene can then lead to the generation of a mutation in that the expression or the regulation of the gene or of several genes is disturbed.
• transposons are used to isolate genes by means of insertion mutagenesis, while in plant cells use is made inter alia of the transfer DNA (T-DNA) of • Agrobacterium tumefaciens as an insertion mutagen (Errampalli et al. 1991) . In principle, however, any DNA fragment capable of insertion into the genome of an organism can be used for this purpose.
• deletions after transposition because, on the one hand, transposition occurs in accordance with a different mechanism than replicative transposition and, accordingly, during normal transposition no copy of the transposon is left behind on the original location, and, on the other hand, the frequency of homologous recombination in animal cells and plant cells, compared with regard to bacteria, is so low that even if several copies of a transposon are present, deletion mutants can only be found under very stringent selection pressure.
• homologous recombination there are a number of site-specific recombination systems known which induce recombination at high frequencies in the prokaryote (Abremski et al.
• Another possibility of obtaining recombination in plants is the introduction of a heterologous recombination system into the plant. This has as an advantage in that the newly introduced recombination system can be regulated, in contrast to endogenous recombination systems.
• a site-specific recombination system is used, for instance, for the deletion of particular DNA segments which are important for the transformation process but thereafter no longer fulfill any essential function for the transformed organism ( Dale and Ow 1991; Russell et al. 1992) .
• the recombination sequences can be introduced into the genome simultaneously on one piece of DNA.
• the use of an inversion or deletion system makes it possible to influence the regulation of gene expression of genes that are introduced into the eukaryotic genome (Golic and Lindquist 1989; O'Gorman et al. 1991; Maeser and Kah ann 1991; Onouchi et al. 1991; Bayley et al. 1992) .
• the present invention further makes use of transposition in such a manner that a large number of deletions can be created in the eukaryotic genome.
• transposable elements in a large number of plant varieties transposable elements have been described and isolated, including the tobacco transposable element Tnt-1 (Grandbastien et al. 1989) and the Petunia hybrida element dTphl (Gerats et al. 1990) .
• Introduction of transposable elements, such as Spm/dSpm, Ac/Ds, Tam3/dTam3, into heterologous hosts has revealed that these transposable elements can also be active as a two-element system in a new host (Haring et al. 1991) .
• the Ac/Ds system in particular is active upon introduction in a large number of plants, such as tobacco (Nicotiana tabacum. , tomato .Lvcooersicon esculent.rim.
• the Ac element can excise from the original site of integration in the genome and subsequently reintegrate at a new position in the plant genome. It has f rther been demonstrated that in these plants transactivation of the non- autonomous Ds element can occur if Ac or the gene for the Ac transposase is active in the same cell (Lassner et al. 1989; Rommens et al. 1991) .
• the property of a transposon to reintegrate at a new position in the plant genome makes transposable elements suitable for the isolation of plant genes (Hille et al. 1989) .
• transposons such as Ac/Ds can be used in the plant for mutating (tagging) a particular gene.
• a transposon By the insertion of a transposon into a particular gene, a phenotype can arise, whereafter the transposon can be used as a tag in the isolation of this gene.
• This so-called transposon tagging strategy has been successivefully applied in the original hosts, such as . maius and £. mays, of transposable elements (Martin et al. 1985; Doring 1989) and is presently utilized in a number of laboratories for the isolation of plant genes from heterologous plant varieties whose gene product is not known (Haring et al. 1991) .
• the frequency at which a specific gene is eliminated by a transposon will be low.
• research is being done into the possibilities of optimizing transposon tagging.
• One possibility under consideration is for instance to uncouple the transposon and the transposase so as to enable regulation of excision and reintegration of the transposon.
• the transposable element has become non-autonomous (Ds) through a deletion in the area of the transposase gene.
• Ds non-autonomous
• Such a Ds element only needs the terminal repeats and parts of the subterminal sequences to be able to transpose efficiently, after transactivation by an introduced active transposase gene.
• the Ds element can now at the site of the deletion be equipped with random sequences without this adversely affecting the transposition process.
• transposons do not jump to entirely random positions in the genome. There seems to be a correlation between the distance of transposition and the frequency at which these events occur. Although hitherto very little research has been done into the integration pattern of transposons in plants, there nevertheless seems to be a preference for integration close to the original excision position (Dooner and Belachew 1989; Jones et al. 1990; Dooner et al. 1991; Osborne et al. 1991; Belzile and Yoder 1992) . This possible property of transposons such as Ac/Ds has as a consequence that it may be advantageous to start a tagging experiment from a position not far away from the locus of interest.
• transposition system in the plant can be used for the isolation of insertion mutants, this system cannot lead to an efficient isolation of deletion mutants.
• Small deletions or changes in the sequences located adjacent the transposon as a result of aberrant excision occur in a small percentage of the transposition events, but these events are not specific and therefore cannot be regulated (Dooner et al. " 1988) . Therefore, to enable induction of deletions into the plant genome, something will have to be added to the transposition system as such so as to initiate the generation of deletions after the transposition.
• the invention provides a method for providing a deletion or inversion mutation in a plant genome, comprising integrating into the plant genome recombinant DNA which comprises a transposable element as well as, both in and outside the transposable element, a recombination sequence, effecting transposition of the transposable element including the recombination sequence present therein and effecting recombination between the recombination sequence which has been left behind and the recombination sequence which has jumped, resulting in a deletion or an inversion of the DNA located between the two recombination sequences, depending on the relative orientation of the recombination sequences involved.
• the recombination sequences can each consist of a single recombination sequence or be linked in inverted repeat to a second specimen of the same recombination sequence. It is preferred that either the recombination sequence located in the transposable element or the recombination sequence located outside the transposable element, or both, are linked in inverted repeat to a second specimen of the recombination sequence. It is thereby ensured that a deletion can always be induced.
• the invention further provides a method for the purification of the deleted chromosomal DNA fragment.
• the chromosomal DNA is isolated from the parent plant from which the deletion mutant originates. Using the purified Cre protein a recombination reaction in vitro is performed on this DNA.
• the thus isolated circular DNA fragment is identical to the deleted DNA fragment in the deletion mutant and can subsequently be cloned using plasmid rescue (if a bacterial replication origin [ori] is present on the fragment removed by recombination) or using a second recombination reaction which introduces the DNA into a vector which contains the loxP sequence (e.g. cosmid, YAC, etc.).
• the transposable element is preferably a non-autonomous transposable element which does contain the cis elements required for transposition (terminal and subterminal sequences) but does not contain the trans elements required for transposition (transposase genes) .
• a non-autonomous transposable element which does contain the cis elements required for transposition (terminal and subterminal sequences) but does not contain the trans elements required for transposition (transposase genes) .
• an autonomous transposable element which also contains the trans elements required for transposition, this leads to complications and is therefore not preferred.
• the transposition of the non-autonomous transposable element with the recombination sequence present therein is preferably effected by introducing the trans elements required for transposition (transposase genes) into the plant. This can be done by means of a transient expression of transposase genes which have been introduced into the plant but have not been built into the genome, by retransformation or by crossing with a plant having the required transposase genes in its genome.
• the Ds element of Zea mays is used and as trans element for transposition the Ac transposase gene of Zea mays is used.
• the recombination between the recombination sequence which has been left behind and the recombination sequence which has jumped is preferably effected by introducing the trans elements required for recombination (recombination genes) into the plant.
• trans elements required for recombination recombination genes
• the loxP sequence of bacteriophage PI is used and as trans element for recombination the Cre recombinase gene of bacteriophage PI is used.
• different techniques can be used, such as direct transfer and transformation using Agrobacterium tumefaciens .
• the integration into the plant genome of the recombinant DNA which comprises a transposable element as well as, both in and outside the transposable element, a recombination sequence is effected using an Agrobacterium tumefaciens strain which contains a T-DNA construct, which T- DNA construct comprises the left-hand and right-hand ends of the T-DNA required for transfer to plants, with an insertion of the recombinant DNA mentioned located therebetween.
• the transposable element incorporates a bacterial replication origin; a bacterial marker gene, for instance a chloramphenicol resistance gene; and/or a marker gene that is active in plants, such as the ⁇ -glucuronidase gene (GUS) or the herbicide resistance gene bar, provided with transcription promoter and transcription terminator sequences active in plants; and that the recombinant DNA contains a marker gene that is active in plants, such as the hygromycin resistance gene Hptll, provided with transcription promoter and transcription terminator sequences which are active in plants, the transposable element having been inserted between the promoter and the marker gene; contains a marker gene that is active in plants, such as the tms2 gene from the octopin TL-DNA, provided with transcription promoter and transcription terminator sequences that are active in plants, which enables selection of plants in which a deletion has taken place; or contains a marker gene that is active in plants, such as the
• the invention extends to recombinant DNA comprising a transposable element as well as, both in and outside the transposable element, a recombination sequence, which recombinant DNA can be used in the above-mentioned method, as well as to a plant which contains an insertion of this recombinant DNA or, through a genetic manipulation by means of the method described, has been provided with a deletion or inversion mutation in the genome.
• recombinant DNA comprising a transposable element as well as, both in and outside the transposable element, a recombination sequence, which recombinant DNA can be used in the above-mentioned method, as well as to a plant which contains an insertion of this recombinant DNA or, through a genetic manipulation by means of the method described, has been provided with a deletion or inversion mutation in the genome.
• the invention relates to a method for the efficient induction of deletions and inversions in the plant genome.
• This method comprises introducing into the plant at least one non-autonomous transposable element equipped with a recombination site, simultaneously with a second recombination site which is located in the same piece of DNA.
• the method further comprises the introduction of the transposase gene into the same plant, whereafter transposition of the introduced non-autonomous transposable element can take place.
• the method further comprises the introduction of the recombinase gene into the same plant, whereafter recombination can take place between the recombination sequences present in the originally inserted DNA and the Ds element which has jumped, resulting in inversion/deletions of the intervening sequences.
• transposons in combination with a site- specific recombination system is unique and offers the possibility of using an efficient recombination system in the plant, with a view to obtaining a large number of independent deletion and inversion mutants.
• a transposition system or a recombination system in the plant this was not possible because the frequency at which inversion or deletion mutants are generated with these systems is very low.
• the use of these transposons does not enable the induction of homologous recombination after transposition and if a form of replicative transposition occurs nevertheless, the homologous recombination frequency in plants is too low to permit efficient recombination between the two transposon copies.
• the transposon is now introduced into the plant genome, together with a recombination sequence, and the t'ransposible element itself is also equipped with a recombination sequence, after transposition one of the recombination sequences will reintegrate with the transposon at a new position in the genome, while the second recombination sequence is neatly left behind right beside the original position ("empty donor site") of the transposon which has jumped.
• recombination can be induced between the original and the new position of the transposon by introducing into the cell the recombinase which acts on the relative recombination sequences.
• An advantage of this method is that the starting point of the thus obtained deletions/inversions in the plant genome is known, namely the recombination sequence in the DNA originally introduced into the plant.
• a further advantage is that the frequency of the site-specific recombination process induced by the recombinase is much higher than the freqency at which recombination occurs between two homologous sequences in the plant.
• transposon is capable of transposing to a large number of independent sites in the plant genome
• a large number of deletions and/or inversions can be obtained in this way, starting from one and the same original DNA insertion.
• This primary DNA insertion in the plant genome must consist of only two essential components. In the first place, this piece of DNA must contain a transposable element which is capable of excising and reintegrating at a new position in the plant genome.
• This transposable element then, must contain one of the recombination sequences of a recombination system that is capable of inducing recombination in the plant genome. This sequence must be inserted into the element in such a manner that this element is still capable of transposition.
• a second recombination sequence must be located, which does not jump along with the transposable element during the transposition process but is left right beside the original position ("empty donor site") of the jumped element. If two-element systems are used, in addition to this primary DNA construct, the genes that are involved in transposition and recombination must also be introduced into the plant.
• the Ac transposase is sufficient for this purpose. It also depends on the selected recombination system how many genes involved in the recombination process must be introduced.
• Cre/loxP system of bacteriophage PI the FLP recombination system of yeast and the Zygosaccharomvces recombination system, this concerns only one gene, viz., the Cre recombinase gene (Gre gene) , the FLP gene and the R gene, respectivel .
• the introduced genes for transposition and recombination should in any case contain a promoter that is active in the intended host.
• a strong promoter is preferred so as to obtain a highest possible frequency of transposition and recombination. It is also possible to use regulated or regulatable promoters to obtain a particular expression pattern of these genes.
• the introduced genes should preferably contain a 3' flanking region having therein a polyA addition signal that is functional in the intended host.
• Fig. 1 schematically represents a part of a plant genome with an insertion of recombinant DNA according to the invention, comprising T-DNA having therein a recombination sequence Lox and a non-autonomous transposable element Ds having therein a second specimen of the recombination sequence Lox (top) ; and schematically represents the situation resulting from a transposition induced with Ac transposase (middle) ; and schematically represents situations resulting from a deletion induced with Cre recombinase (bottom) ;
• Fig. 2 schematically represents a T-DNA construct which contains, between the left-hand and right-hand ends (LB and RB, respectively) of the T-DNA, an Ac transposase gene having a 3'-end of its own and the CaMV 35S promoter as well as the chloramphenicol resistance gene CAT (top) or the kanamycin resistance gene Nptll (bottom) , both provided with promoter and terminator sequences that are active in plants;
• Fig. 3 schematically represents a T-DNA construct which, between the left-hand and right-hand ends of the T-DNA, contains a Cre recombinase gene as well as the kanamycin resistance gene Nptll, both provided with promoter and terminator sequences which are active in plants; .
• Pig. 4 schematically represents a DNA construct which, between the terminal and subterminal sequences of the non-autonomous transposable element Ds, contains: a double loxP sequence, a bacterial replication origin (ori) , a bacterial chloramphenicol resistance gene (Cm) as well as the ⁇ - glucuronidase gene GUS (top) or the Basta R herbicide resistance gene bar (bottom) , both provided with promoter and terminator sequences that are active in plants; Fig.
• Fig. 5 represents a Ba HI fragment having therein the loxP sequence (top), a Hindlll fragment having therein a __ ⁇ _2t_I site and the loxP sequence (middle) , and a Hi&dlll fragment having therein two loxP sequences ordered in inverted repeat, separated by a NotI site (bottom) ;
• Fig. 6 schematically represents the part of the vector pMH2057 that contains the hygromycin resistance gene Hptll, provided with promoter and terminator sequences that are active in plants, and the tms2 gene from the octopin TL-DNA; Fig.
• FIG. 7 schematically represents a T-DNA construct that contains a loxP sequence and a kanamycin resistance gene Nptll adjacent the part of pMH2057 shown in Fig. 6, having therein an insertion - in the BamHI site located between the Hptll gene and the CaMV 35S promoter - of the DNA constructs shown in Fig. 4 with GUS gene (top) and bar gene (bottom), respectively;
• Fig. 8 schematically represents three strategies for the implementation of the method according to the invention
• Fig. 9 schematically represents a part of a plant genome carrying the traces of a method according to the invention by which a deletion has occurred of one of the two double loxP sequences and the DNA located between the non-staggered loxP site and the staggered loxP site
• Fig. 10 schematically represents a strategy for the use of positive selectable deletion marker genes
• Fig. 11 schematically represents a strategy for the implementation of a purification of the deleted chromosomal
• Fig. 12 schematically shows the construct pMV933 and pMH2713 as well as data of PCR experiments.
• transposition and recombination relate to the use of transposition and recombination and in particular the combination of these two systems in the plant.
• transposition system from maize, consisting of two elements (Ac and Ds) , as well as a site-specific recombination system from bacteriophage PI, consisting of two elements (34bp loxP sequences and the Cre- protein), in tomato.
• Transposable elements from maize, consisting of two elements (Ac and Ds) , as well as a site-specific recombination system from bacteriophage PI, consisting of two elements (34bp loxP sequences and the Cre- protein), in tomato.
• the R recombination system originating from the yeast plasmid pRSl and isolated from Z ⁇ gosaccharomvces rouxii has been studied in less detail, but the recombination process is very simple for all systems mentioned inasmuch as it consists of only two components, the recombinase (Cre protein, FLP protein, or R protein) and the recombination sequences (34 bp loxP sequences or FRT sequences, or SRI recombination sequences of 58 bp at most) .
• Recombination between two recombination sequences occurs when the Cre protein, the FLP protein, or the R protein is present and, depending on the relative position of the recombination sequences, results in a deletion of the intervening sequence (recombination sequences in direct repeat) or in an inversion of the intervening sequence (recombination sequences in inverted repeat) .
• the R site-specific recombination system works not only in yeast but also in plant cells (Onouchi et al. 1991) and the FLP site-specific recombination system also works in animal cells (O'Gorman et al. 1991), while the Cre/loxP recombination system functions not only in the prokaryote £.. coli and in vitro but also in yeast (Sauer 1987), animal cells (Sauer and Henderson 1989) and plant cells (Dale and Ow 1990; Odell et al. 1990) .
• Introduction of the loxP sequences and the gene that codes for the Cre recombinase was sufficient to demonstrate both inversion and deletion formation in tobacco cells (Dale and Ow 1990) .
• the choice of the host is strongly related to the choice of the transformation technique.
• the introduction of a deletion system as described here is interesting for all crops whose genomes are being studied and contain interesting genes which are eligible for isolation. In the area of application, this concerns ornamental and food crops in particular. Genes involved in the formation of the product of these crops, such as the flower, fruit, root, leaf, etc., are interesting genes to isolate. Further, the genes that play a role in the immune system of the plant are interesting genes that are eligible for isolation. It is therefore important that the system described here can be introduced into hosts such as ornamental and food crops. Also to be considered are hosts of non ⁇ commercial plant species such as wild varieties and ancestors of the present culture crops.
• the introduction of DNA into the plant genome can be realised in a number of manners.
• One possibility is the introduction of DNA directly into the plant cell, whereafter integration into the plant genome occurs in accordance with an unknown integration mechanism (Hain et al. 1985) .
• a second possibility is the introduction of foreign DNA into the plant cell using the basic bacterium Agrobacterium tumefaciens.
• T-DNA a specific piece of DNA
• Melchers and Hooykaas 1987 With respect to both transformation systems, it is known that the DNA integrates into the plant genome more or less at random. There does seem to be a slight preference for the integration of the T-DNA into DNA that is actively transcribed, although there are not yet sufficient data available for this .
• A., tumefaciens for the introduction of DNA into the plant genome is preferred to the use of direct DNA transfer because in this transformation method the integration of a specific piece of DNA occurs in a controlled manner, in contrast to the integration after direct DNA transfer.
• A. tumefaciens is incapable of transforming a particular plant, however, use can be made of other transformation techniques such as the direct DNA transfer.
• Direct introduction of DNA is realised inter alia by PEG/Ca transformation, electroporation, microinjection, laser techniques and via particle bombardment.
• the loxP sequence, present in Ds will also jump away from the loxP sequence which is present in the T-DNA.
• recombination on the loxP sequences can be induced by introduction of the Cre protein, resulting in deletions of different size starting from the T-DNA (see Fig. 1) .
• inversions or deletions are formed in the plant genome, it can be studied whether this results in a mutant phenotype.
• the combination of the Cre/loxP system and Ac/Ds transposition in tomato therefore gives the possibility of inducing mutations (deletions/inversions) in the plant genome at increased frequency.
• transgenic plants containing the "Ac transposase” gene plants with the Cre recombinase gene and plants with the Ds element and the loxP sequences are made.
• the Ac transposase is a gene originating from the Ac transposable element. It codes for the transposase, essential to the transposition process of Ac and Ds elements. Although this gene is expressed in monocotyls and dicotyls, the coding sequence for this protein (the transposase) can be regulated by different promoter (5*-end) and transcription terminator (3'-end) sequences. In this example, the choice opted for was to provide the gene with a strong constitutive plant promoter, namely the CaMV 35S promoter originating from the cauliflower mosaic virus genome (Odell et al. 1985) , while use is made of the transcription termination sequences of the transposase gene itself (see Fig. 2) .
• transposase gene is important to obtain transposition of the Ds element at a reasonable frequency.
• transposase gene provided with its natural promoter sequences.
• the first CaMV 35S transposase construct was made by first cloning a Hindlll/Smal fragment coming from pBI121 (Jefferson et al. 1987), with the CaMV 35S promoter thereon, into the £. coli vector pUC19 (Yanisch-Perron et al. 1985) .
• a Nael/EcoRI fragment (ca. 3.8 kbp) from Ac was cloned having located thereon the entire encoding sequence of the transposase and the 3'-end with the polyA addition signals. The entire insertion was subsequently transferred into another £.
• coli vector pSK- bluescript (Stratagene) as a Pstl/Clal fragment (pTT261) .
• CaMV 35S transposase construct was transferred as a Sacl/Sall fragment into a binary vector with a chloramphenicol restistance gene, as described by Haring et al. (1991; see Fig. 2) .
• the second CaMV 35S transposase construct was made by replacing the BamHI/Xhol fragment in the binary construct pTT230 (Rommens et al. 1991) with the BamHI/XhoI fragment from the pTT261 construct described hereinabove (see Fig. 2) .
• the Cre gene originating from bacteriophage PI is provided with prokaryotic transcription regulation sequences, and therefore here, too, the 5' end of this gene was replaced with the CaMV 35S promoter sequences, while the 3 '-end of the nopalin synthase gene, with a polyA addition signal therein, was used as transcription terminator sequence for this construct (see Fig. 3) .
• the construct used is a derivative of the construct pED32 which is described in detail by Dale and Ow (1990) .
• This CaMV 35S-Cre construct was set as a Xhol/Hindlll fragment into the Sall/Hindlll sites of the binary vector Bin 19 (Jefferson et al. 1978, Figure 3) .
• Ds element in this example use is made of an element consisting of the terminal inverted repeats and the subterminal sequences which are necessary for transposition.
• This Ds element is derived from the Ac element originating from the waxy-m7 allele of maize (Behrens et al . 1984) . It is possible to insert DNA between the sequences of the two Ds ends, which, during transposition subsequently jumps along with the transposable element to new locations in the genome.
• the Ds element is equipped not only with the sequences necessary for transposition but also with a detectable or selectable marker, a bacterial origin of replication (ori) and a synthetically prepared sequence consisting of the loxP sequence:
• ATAACTTCGTATAATGTATGCTATACGAAGTTAT SEQ ID NO:l and the recognition sequence (GCGGCCGC) for the restriction enzyme NotI.
• the inserted replication origin (ori) sequence and the NotI restriction site are for instance used to simplify the isolation of the elements from the plant genome before or after transposition, while the ori sequence can also be an important aid during the isolation of deleted chromosomal DNA segments using recombination reactions.
• the insertion of a marker gene into the Ds elements makes it possible to test plants in a simple manner for the presence of the transposable element.
• the Ds element described here has been demonstrated to be capable of excising and reintegrating when it has been transformed to the plant genome (Rommens et al. 1991) .
• the starting material for constructing these Ds elements was £• coli vector pACYC184 (Chang and Cohen 1978) .
• the Sphl/Nrul fragment of pACYC184 was replaced with a Sphl/Nrul fragment having located thereon the terminal ends of the Ac element (586 bp 5' end and 448 bp 3'-end), separated by a Bglll site, as described in Haring et al. 1989.
• the thus obtained Ds element (pACYC-Ds) is already provided with a bacterial replication origin with an antibiotic resistance for chloramphenicol.
• the selected marker gene and the loxP sequences can be introduced into the vector part of this construct, whereby the inserted sequences likewise come to lie between the ends of the Ds element (see Figure 4) .
• Figure 4 both possible orientations of the loxP fragment are schematically represented.
• the detectable marker ⁇ -glucuronidase (GUS) and the selectable marker against the herbicide Basta R the bar gene.
• both genes are regulated by the CaMV 35S promoter sequences and the GUS gene is provided with the nopalin synthase transcription terminator sequences, while the bar gene is provided with the transcription terminator sequences of transcript 7 of the octopin T-DNA ( Figure 4) .
• the CaMV 35S GUS construct has been described by
• the CaMV 35S bar construct has been described by De Block et al. (1987) and was inserted as a i ⁇ ndlll/Ec ⁇ RI fragment from pGSFR280 into the Hindlll and Asel sites of the pACYC-Ds construct.
• the synthetic loxP/Notl sequences were subsequently inserted into the Hindlll site of these constructs, preferably with the NotI site adjacent the marker gene and the loxP sequence directly adjacent the end of the Ds element (see Figure 4) .
• the sequences of two different loxP/Notl Hindlll fragments are specified in Figure 5. In the case of the insertions with the double loxP sequences with the NotI site in between, the orientation of the fragment is of course not important.
• ⁇ MH2057 was obtained by insertion of the Ss ⁇ CaMV 35S-HptII fragment from pTT218 as described by Haring et al. (1989) and the tms2 gene from the octopin TL-DNA (3490 bp Sphl/Xhol fragment) into the £. coli vector pUC19 (Yanisch-Perron et al. 1985, see Figure 6) .
• the promoter sequence for the Hptll gene again consists of sequences of the CaMV 35S promoter, while the gene contains the nopalin synthase 3'-end as transcription terminator.
• the insertion of the different Ds elements as a Bglll fragment into the BamHI site of the construct, between the promoter and the encoding sequence of a selectable marker, has as an advantage that hereby selection for excision of the Ds element from this construct can be effected. After excision of the Ds element from the T-DNA, the Hptll gene can be expressed and the cell has thus become hygromycin resistant . Insertion of the tms2 gene next to the Ds element provides the possibility of selecting for certain deletion events.
• the tms2 gene can be used as a negative selectable gene, which means that selection for the loss (by deletion) of this gene is possible. Although this is not necessary for the method described here, the presence of a negative selectable gene, such as the tms2 gene, or a positive selectable or detectable deletion marker, can substantially simplify the selection of plants in which deletions have occurred.
• the different thus obtained constructs can now finally be transferred into a binary vector already having located therein a selectable marker and loxP sequence.
• the selectable marker in this case the gene for kanamycin resistance (Nptll gene), is in this vector provided with the mannopin 5'- and 3'- regulatory sequences and is used for the selection of transgenic plants after transformation.
• the binary vector pCGN1548 used in this example has been described by McBride and Summerfelt (1990) .
• the synthetic BamHI fragment with the loxP sequence has been inserted (see Figure 5) .
• Adjacent thereto, the different Ds- containing constructs are inserted as a EBH.1 fragment.
• the constructs are then located within the "direct repeats" of the T-area, which is transferred to the plant cell by A. tumefaciens (see Figure 7) .
• T-DNA constructs as described above are transformed to - tabacum and £. esculentum via the "leaf disk” method (Fillatti et al. 1987) and to A- thaliana via the root transformation technique (Valvekens et al. 1988), in order to test the system in these different hosts.
• the primary transformants are examined for the number of T-DNA insertions (copy number) and also the location of the T-DNA insertion in the plant genome is determined in the case of transformation with the Ds/loxP construct.
• Another way of inducing transposition and recombination in the Ds/loxP plant is to use the possibility of expressing the transposase and recombinase transiently in protoplasts of the Ds/loxP-containing plants.
• this method it is not necessary that integration of the transposase and/or the recombinase gene occurs in the plant genome.
• Transient expression of the gene is sufficient to induce both transposition and recombination in the plant genome (see Figure 8) .
• the obtained deletion/inversion mutants (and the offspring of the following generation after self-pollination) can subsequently be analysed for the size of the deletion/inversion that has taken place and the occurrence of a phenotypical change, allowing subsequent characterization and optional isolation of the gene that is responsible for this mutation.
• a positive selectable marker can be used, as will be illustrated with reference to the construct shown in Figure 10.
• the underlying basis of the construct is that a promoter-less marker gene cannot be expressed until after the formation of a deletion, because only then a promoter for the gene is present.
• the system is comparable with the system that is used for the detection of transposition events using an excision marker which likewise cannot be expressed until the transposon between the promoter and the excision marker has disappeared through transposition.
• both systems are coupled, with one and the same promoter being used for the expression of the excision marker (after transposition) and the deletion marker (after occurrence of a chromosomal deletion) .
• Tobacco plants which contain the Ds/loxP described are provided with the recombinase protein Cre by means of retransformation of these plants with an Agrobacterium tumefaciens strain which contains the CaMV35S-Cre gene described in the T-area.
• Figure 12 summarizes the results of the PCR experiment in the plant. It is clear small PCR products can only be formed after the occurrence of a deletion in pMV933 and pMH2713 with, respectively, the primers pl84 + M3 and C5 + M3.
• deletion mutants can be studied at molecular level, by the isolation of the flanking sequences of the T-DNA segment left behind after the recombination event.
• This method can further lead to the isolation of mutants in which chromosome segments have been deleted or inverted.
• the organization of a chromosome may be changed, with possible consequences for the gene regulation of one or more plant genes.
• interchromosomal recombination can occur as well, with the result that the organization of the genome changes, which can lead to different phenotypes.
• inversion of a specific or random plant gene can be induced as well, with the result that the expression pattern of that gene is changed or even becomes regulatable.
• the DNA deleted in the deletion mutant is then isolated as a circular DNA molecule from the chromosomal DNA of the plant. Depending on the size of the isolated DNA and the presence of a bacterial origin of replication (ori) . this DNA can be- transformed and cloned directly or after a second recombination reaction. Small deletions (to some tens of kb) that contain an ori can be transformed directly to Escherichia coli. whereafter cloning is a fac .
• Retroviruses and retrotransposons the role of reverse transcription in shaping the eukaryotic genome. Cell 40, 481-482
• Tnt-1 a mobile retroviral like transposable element of tobacco isolated by plant cell genetics. Nature 337, 376-380. - Greenblatt, I. (1984) A chromosome replication pattern deduced from pericarp phenotypes resulting from movements of the transposable element Modulator in maize. Genetics 108, 471-485. - Hain, R., Stabel, P. Czernilofski, A. . Steinbiss, H.H., Herrera-Estrella, L. and Schell, J. (1985) Uptake, integration, expression and genetic transmission of a selectable chimeric gene in plant protoplasts. Mol. Gen. Genet. 199, 161-168. - Haring, M.A., Gao, J. , Volbeda, T., Rommens, C.M.T.,
• Tomato a crop species amenable to improvement by cellular and molecular methods. Euphytica 42, 1-23.
• SEQ ID NO:l SEQUENCE TYPE: nucleotide

Landscapes

• Genetics & Genomics (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Biomedical Technology (AREA)
• Organic Chemistry (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Molecular Biology (AREA)
• Plant Pathology (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Cell Biology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=19859745

Family Applications (1)

Country Status (4)

Families Citing this family (4)

Family Cites Families (2)

• 1991
  • 1991-09-25 NL NL9101620A patent/NL9101620A/nl not_active Application Discontinuation
• 1992
  • 1992-09-25 WO PCT/NL1992/000166 patent/WO1993006221A1/en not_active Application Discontinuation
  • 1992-09-25 AU AU26863/92A patent/AU2686392A/en not_active Abandoned
  • 1992-09-25 EP EP92920250A patent/EP0605557A1/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events