EP0481065A1 - Process for nucleic acid hybridization and amplification. - Google Patents

Process for nucleic acid hybridization and amplification.

Info

Publication number
EP0481065A1
EP0481065A1 EP91910088A EP91910088A EP0481065A1 EP 0481065 A1 EP0481065 A1 EP 0481065A1 EP 91910088 A EP91910088 A EP 91910088A EP 91910088 A EP91910088 A EP 91910088A EP 0481065 A1 EP0481065 A1 EP 0481065A1
Authority
EP
European Patent Office
Prior art keywords
dna
reca
protein
strand
stranded
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP91910088A
Other languages
German (de)
French (fr)
Other versions
EP0481065B1 (en
Inventor
David A Zarling
Elissa P Sena
Christopher J Green
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Daikin Industries Ltd
Original Assignee
SRI International Inc
Stanford Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SRI International Inc, Stanford Research Institute filed Critical SRI International Inc
Publication of EP0481065A1 publication Critical patent/EP0481065A1/en
Application granted granted Critical
Publication of EP0481065B1 publication Critical patent/EP0481065B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Definitions

  • the present invention relates to methods for using RecA protein(s) to catalyze DNA synthesis, repair and amplification reactions.
  • RecA+ protein (wild type) is a 38,000 dalton protein found in the bacterium Escherichia coli , which is important for homologous DNA recombination. Most information about its biochemistry and enzymology comes from studies on puri ⁇ fied RecA+ protein. Numerous in vitro studies have shown that RecA+ protein is intimately involved in the pairing reaction between homologous DNA sequences that ultimately leads to homologous recombination events (see Cox et. al. for a recent review of RecA+ protein properties) . It is this pairing reaction that makes RecA+ protein highly use ⁇ ful for DNA diagnostics and therapeutics applications.
  • RecA+ protein catalyzes strand exchange between a number of substrates, the most relevant for DNA probe applications being single- and double-stran ⁇ ded DNAs.
  • Single-stranded DNA probe
  • probe interacts with the homologous portion of the double-stranded ("native") target sequences, initially by forming a recombination intermedi ⁇ ate containing hybridized, partially joined molecules. This is followed by branch migration, and forming of fully hybrid molecules between the original single- and double- stranded DNAs, depending upon the extent of their homology.
  • This reaction results in a product that is a hybrid between probe and target.
  • Such hybrids can be easily detected using, for example, radio-labeled, enzyme-labeled, chemilu- minescently-labeled, phosphorescently-labeled or fluores- cently-labeled probes.
  • RecA-i- protein is particularly well suited for many DNA probe applications because the double- stranded target DNA does not need to be denatured (e.g., by heating) before hybridization.
  • RecA+ protein is useful in facilitating the initiation and completion of DNA chain elongation at DNA sequences that are either damaged or difficult to denature.
  • the method involves complexing a primer complementary to a 5' end region of the first strand and a primer complementary to a 5' end region of the second strand with RecA protein in the presence of ATP- -S.
  • the complexed primers are then reacted in a mix- ture also containing the target sequence, all four dNTPs, RecA protein and DNA polymerase.
  • the reaction is conducted below the temperature required for thermal dissociation of the two target strands and continued until a desired degree of amplification of the target sequence is achieved.
  • the method of the present invention is particularly useful when the target DNA has inhibitory secondary struc ⁇ ture or otherwise amplification resistant regions.
  • One embodiment of the present method includes that the two primers are complementary to the same DNA sequence.
  • Another embodiment includes the use of primers containing terminal 5' sequences which are non-complementary to the DNA target sequence. These non-complementary sequences may include sequences coding for restriction endonuclease recognition sites, capture sequences, reporter sequences, RecA protein loading sequences, Z-DNA sequences or double- stranded tails.
  • An important advantage of the invention is use of the method for the synthesis/amplification of physically or chemically damaged DNA substrates.
  • a preferred embodiment of the invention includes that the RecA protein is the protein product of the recA-803 gene.
  • the method of the present invention can also be used to achieve synthesis or amplification of DNA by conducting the DNA synthesis reactions at a constant temperature above about 50°C and below the temperature required for thermal dissociation of the target strands and their respective primers.
  • useful forms of the RecA pro ⁇ tein and DNA polymerase can be obtained from Thermus aguaticus .
  • the present invention further includes the cloning and identification of the coding sequences for the RecA protein of Thermus aguaticus .
  • the RecA coated primers of the present invention also serve as useful probes in hybridization-based diagnostic systems because of their enhanced ability to locate and pair with complementary sequences and sequences in regions of normally inhibitory secondary structure.
  • Figure 1 shows the results of the electrophoretic separation of DNA binding reactions comparing the activi ⁇ ties of RecA+ and recA-803 proteins.
  • Figure 2A shows the results of ATP hydrolysis reac ⁇ tions comparing the ATPase activity of RecA+ and recA-803 proteins.
  • Figure 2B shows the results of strand-transfer reactions comparing the activities of RecA+ and recA-803 proteins.
  • Figures 3, 4A and 4B show the results of RecA+ pro ⁇ tein/-double-stranded DNA binding assays.
  • Figure 5 illustrates the effects of RecA ⁇ protein and single-strand binding protein on bulk DNA synthesis from single-stranded DNA templates.
  • Figure 6 illustrates the effect of recA-803 protein on bulk DNA synthesis from double-stranded linear templates.
  • Figure 7 shows the results demonstrating the RecA+ protein enhancement of DNA synthesis from native lambda DNA templates.
  • Figure 8 shows the results demonstrating that the enhancement of DNA synthesis by RecA+ protein does not depend on the presence of single-strand binding protein.
  • Figure 9 shows the results demonstrating the depen ⁇ dence of RecA+ protein catalyzed DNA synthesis on the presence of specific primers.
  • Figures 10 and 11 show results demonstrating RecA+ protein catalyzed single temperature DNA amplification reactions.
  • Figure 12 shows results demonstrating that RecA+ enhances product specificity in single temperature amplifi- cation reactions.
  • Figure 13 shows the partial sequence of the RecA gene of Aquas pir ilium magnet ot act icum.
  • One focus of the present invention is to provide superior RecA+ protein catalysts to facilitate DNA hybrid ⁇ ization and DNA synthesis reactions.
  • recA-S03 pro ⁇ tein to be a valuable candidate for such a catalyst.
  • the recA-803 mutant gene has been cloned and sequenced, and the protein product over-expressed and purified (Madiraju et. al.) .
  • This new recA mutant protein more efficiently forms more stable recombination intermediates between target and probe DNAs than wild-type RecA+ protein as judged by nitro ⁇ cellulose filter binding assays (Madiraju et. al.).
  • mutant recA-803 protein catalyzes the pairing reaction with faster kinetics and to a greater final yield than is usu ⁇ ally achieved by the wild-type RecA+ enzyme.
  • Large quantities of mutant recA-803 protein have been isolated from E. coli containing a plasmid (Dr. A. John Clark, Dept. Mol. Biology (UC Berkeley) that over-expresses the gene; approximately 40% of the total protein in the bacterial cell is mutant recA-803 protein.
  • Example 1 presents gel retardation assay data to examine the relative DNA binding efficiencies of RecA+ and recA-803 proteins.
  • RecA+ or recA-803 protein is reacted with the double-stranded linearized DNA of phiX174 under conditions allowing formation of protein/DNA com- plexes.
  • the reactions were split into two samples; half of each sample was treated with a detergent, such as SDS, to destroy the protein/DNA complexes.
  • the treated and untreated samples were run side-by-side on 0.7% agarose gels (see Materials and Methods) .
  • a basis of the gel retardation assay is that DNA/protein complexes migrate much more slowly through the matrix of a gel.
  • Example 2 presents data showing that recA-803 protein is also a superior catalyst in comparison to RecA+ protein, in hydrolysis of ATP and in producing significantly greater amounts of DNA strand transfer products.
  • the recA-803 pro ⁇ tein exhibits significantly more DNA dependent ATPase acti- vity than the RecA+ protein ( Figure 2A) .
  • Example 2B single-stranded phiX-174 virion circular DNA was preincuba- ted with recA-803 or RecA+ protein proteins for 10 minutes at 37°C to form a Radding-type filament (Radding) . The double-stranded target was then added and the strands were transferred with ATPS as a ⁇ ofactor.
  • recA-803 catalyzes a significantly greater amount of strand-transfer product in comparison to RecA+ protein.
  • the strand-transfer products appear as a discrete band indicated by the arrow in Figure 2B.
  • Comparison of lanes 3 and 6 (RecA+ protein) to lane 8 (recA-803 protein) illustrates recA-803 protein's increased efficiency in generating DNA strand transfer products. From this and similar experiments the recA-803 protein appears to produce about 5-7 fold more Form II strand-transfer products than RecA+ protein.
  • recA-803 protein a superior catalyst for DNA synthesis, hybridization, diagnostics and therapeu- tics applications. These desirable properties make recA- 803 protein an ideal catalyst to provide rapid and effi ⁇ cient assays for hybridizing DNA probe sequences with native double-stranded DNA targets in solution.
  • assays can make use of any separation system (Collins et. al. , Rigas et. al., Leahy et.
  • functions of RecA+ protein most likely include facilitating DNA polymerization or recombination through (i) regions of complex or unusual secondary structure, or (ii) chemically or physically damaged DNA sequences.
  • RecA Protein's Enhanced Binding to Damaged DNA or DNA having the Z Conformation E. coli RecA+ protein is a major participant in the recognition and subsequent repair of damaged DNA double- helices.
  • Certain physical and chemical agents, such as UV light (Lu et. al.) and psoralen (Shi et. al.), which can adduct and/distort pyrimidine bases in double-stranded DNA conformation, are known to increase RecA+ protein binding. RecA+ protein recognition of purine-adducted double-helical DNA has not been examined previously.
  • N-acetoxy-N-2- acetylaminofluorene is a potent mutagen and model chemical carcinogen that covalently binds deoxygua- nine residues yielding adducts primarily at the C-8 position (Kriek) .
  • This modification causes extensive topological changes and unwinding of the DNA helix by inducing the rotation of the deoxyguanine base from the anti to the syn conformation (Fuchs et. al. , 1976) .
  • Energy minimization studies suggest that this rotation may be accompanied by insertion of the heterocyclic adduct into the helix interior causing a bend in the helical axis
  • Example 3 describes the results of RecA+ protein/dou- ble-stranded DNA binding assays.
  • Blaho et. al. have previ ⁇ ously shown that RecA+ protein preferentially binds to bro- minated or methylated linear synthetic Z-DNA compared with the B-DNA polymers.
  • the results of Example 3, presented in Figure 3, illustrate a preferential binding to the bromina- ted substrate, consistent with the results of Blaho et. al.
  • the results in Figure 3 show that RecA+ binding to the duplex synthetic DNA at neutral pH with ATP S as a co- factor is enhanced by purine adduction with N-AcO-AAF.
  • N-AcO-AAF adducts in the duplex DNA increased RecA+ protein binding to the DNA duplex. Binding was proportional to the degree of N-AcO-AAF adduction in the range of 5-20% N-AcO-AAF adduction.
  • Example 4 clearly illustrate RecA+ protein apparent sequence-specificity in preferential binding affinities to the double-stranded oligo-[d(C-A)*d(G-T) ] relative to the duplexes generated from oligo-[d(br 5 C-G) ] or oligo-[d(C-G) ] .
  • RecA+ protein shows sequence ( Figures 4A and 4B) and conformation ( Figure 3) specific binding preferences for these DNA duplexes.
  • RecA protein accordingly, has valuable diagnostic and therapeutic applications. If the target DNA has been damaged or has unusual secondary structure, traditional methods of DNA hybridization and/or synthesis may be ineffectual.
  • the results of the experiments presented in Examples 3 and 4 illustrate the value of using RecA pro ⁇ tein's ability to promote binding to complex DNA and complementary base pairing.
  • RecA protein catalyzed DNA amplifi- cation involves incubating DNA target sequences and DNA primers complementary to the target sequence with RecA+ protein or recA-803 protein in the presence of ATP or ATP S at 37°C. These conditions permit RecA-protein-catalyzed Radding-type D-loops or joint molecules between the primers and the tar ⁇ get DNA. These stable RecA-catalyzed joint molecules are elongated with the Klenow fra ment of DNA polymerase I.
  • Example 5 describes the enhancing effect of RecA+ pro ⁇ tein on DNA synthesis directed from a single-stranded template.
  • the data presented in Figure 5 shows the enhancement of single-stranded DNA synthesis by RecA+ and E. coli single-strand binding (SSB) proteins; the two pro ⁇ teins appear to have a synergistic effect.
  • Synthesis on phiX-174 single-stranded circular DNA templates was enhanced by coating the primers with RecA+, thus generating a Radding-type filament.
  • Inclusion of E . coli SSB protein in the reaction also enhanced single-stranded DNA directed DNA synthesis as measured by incorporation of [ 3 H]dGTP into high-molecular-weight (cold TCA insoluble) DNA.
  • RecA protein The effect of RecA protein on DNA synthesis from a double-stranded DNA (dsDNA) template was also examined (Example 6) .
  • the data presented in Figure 6 shows recA-803 protein-enhanced DNA synthesis from a double-stranded template using 18-mer primers.
  • the primers were reacted with recA-803 protein (3 ⁇ ) for 5 minutes at 37°C to form filaments before addition of the dsDNA.
  • Klenow large fragment of E. coli DNA polymerase I was added.
  • RecA-803 protein signifi- cantly enhanced DNA synthesis as judged by increased incor ⁇ poration of [ ⁇ - 35 S]dATP into high-molecular-weight DNA.
  • Examples 5 and 6 show that the rates and extent of DNA synthesis can be significantly enhanced by primers coated with RecA+ or recA-803.
  • Example 7 demonstrates that RecA protein is able to enhance DNA synthesis from native lambda viral DNA tem ⁇ plates.
  • the reactions were assembled at room temperature without the primers.
  • RecA+ protein was incubated with the two 25-mer single-stranded primers (PCR01 and PCR02, Table 1).
  • ATP-y-S and SSB protein were added to the reaction, followed by the native ⁇ DNA template. Reactions were incubated in a 37°C heat block and equilibrated at 37°C for 3 minutes prior to the addi ⁇ tion of Klenow DNA polymerase.
  • Example 7 presents data showing that the ability of RecA protein to enhance DNA synthesis on dsDNA templates is not dependent on the presence of SSB protein.
  • the data presented in Figure 8 shows DNA synthesis in the absence of SSB protein (lane 1) and further demonstrates RecA+ pro ⁇ tein's ability to enhance DNA synthesis in short term reac ⁇ tions (8 successive additions of polymerase every 10 mi ⁇ nutes for 80 minutes) .
  • the primer dependent nature of the RecA protein cata ⁇ lyzed DNA synthesis is described in Example 8.
  • the data presented in Figure 9 shows enhanced native DNA synthesis in polymerase reactions with exonuclease free (US Biochemi- cals) double mutants of the Klenow large fragment of E. coli DNA polymerase I only in the presence of RecA+ protein and primers.
  • a 500-bp DNA template was enzymatically synthesized (Amplitaq R kit, Perkin-Elmer-Cetus) using PCROl and PCR02 primer pairs (Table 1) .
  • This double-stranded product was used as a simple 500-bp template with 40-mer primers PCROl and PCR02 (Table 1) for DNA synthesis reactions.
  • the reac ⁇ tions were incubated for 17.5 hours at 37°C using exonucle- ase-free double mutants of the Klenow large fragment of E . coli DNA polymerase I.
  • the data presented in Figure 10 (Example 9) (lane 4) shows a band of newly synthesized DNA products with an electrophoretic mobility and molecular weight matching the 500-bp native ⁇ DNA template.
  • the method of the present invention permits the syn ⁇ thesis and amplification of native duplex, i.e. non- denatured, target DNA sequences, in solution, using RecA- catalyzed target hybridization with homologous oligonucleo- tide primer sequences.
  • This hybridization reaction posi ⁇ tions the primers for subsequent extension by DNA polymera- ses.
  • the reaction is a two-step process and requires opti ⁇ mization of both steps of the reaction: (i) the primer hybridization; and, (ii) the primer extension.
  • Target DNA sequences can be obtained by a variety of methods and from many sources, for example: (i) the original target DNA sequence may be synthesized from a single-strand nucleic acid template, such as single-strand DNA or an RNA molecule, by standard procedures (Maniatis et al.); and, (ii) the original target sequence may be ex ⁇ tracted from a cell or tissue source.
  • the target DNA se ⁇ quence can also be present in a homogeneous mixture, i.e.. predominantly composed of target sequences, or a heteroge ⁇ neous mixture, i.e., other sequences are present.
  • a primer complementary to the target se ⁇ quence is reacted with the target DNA sequence under conditions which allow the RecA protein to catalyze the formation of joint-molecules between the primer and the target DNA.
  • This reaction is carried out with native DNA substrates, i.e., the DNA strands are not heat-denatured.
  • the multi-stranded structures, whose formation are cata- lyzed by RecA protein, are elongated using the Klenow fragment of DNA polymerase I in the presence of nucleotide triphosphates. RecA protein topologically prepares the hybrid DNA for DNA polymerase elongation.
  • free primers complementary to the existing target DNA strands can either bind to an original strand or to the new strand. Once hybridized these complexes are then elongated using DNA polymerase as described above. The process is repeated and the target sequence is synthesized, thus amplified, many times. After a few rounds of amplification, the native target sequence can be detected using a labeled single- stranded DNA probe driven by mass action hybridization and/or by RecA protein/probe complexes in hybridization reactions catalyzed by the RecA protein.
  • the reaction can be allowed to proceed for many rounds, providing an amplified product which can be visualized, for example, by electrophoretically resolving the separated reaction components on an agarose gel, followed by staining the separated DNA in the gel with ethidium bromide.
  • RecA+ and recA-803 proteins in DNA amplification and DNA synthetic reactions is that these proteins strongly facilitate efficient hybridization of the single-stranded DNA primer to target DNA sequences. Fur ⁇ ther, these proteins prepare the DNA primer-native-target complex topologically for extension. Because of the topo- logical effects of RecA protein, cellular DNA polymerases, such as Klenow fragment of E. coli DNA polymerase I, can elongate the primer as the template strand is unwound. This reaction is simpler than amplification reactions which require heating to provide single strand templates and cooling to allow hybridization of the primers.
  • RecA enhanced DNA syntheses are to amplify normal, light-damaged, or chemical ⁇ ly-damaged DNA sequences using RecA-catalysis to properly position primers on their homologous targets for subsequent extension by DNA polymerases.
  • Another advantage of the use of RecA protein-catalyzed DNA synthesis is the elimination of the requirement for multiple cycles of high-temperature thermal denaturation and renaturation (Saiki et al.).
  • a second important application, as discussed above, is the ability of RecA protein to topologically prepare DNA for DNA synthesis; in particular, DNA having conformations or secondary structures which are difficult to synthesize or amplify by traditional methods, such as heat denatur- ation.
  • RecA protein-catalyzed reactions takes advantage of the ability of the RecA pro ⁇ tein/DNA primer complexes to efficiently find complementary sequences.
  • the protein/primer complexes can, for example, be used as probes in diagnostic assays which depend on the identification of sequences in a sample based on their complementarity to the primer.
  • the bound complex can then be stabilized and identified by a variety of methods, such as by antibodies directed against the recA-803 protein.
  • RecA protein refers to a family of RecA-like proteins all having essentially the same functions, particularly: (i) the protein's ability to properly position primers on their homologous targets for subsequent extension by DNA polymerases; (ii) the ability of RecA protein to topologically prepare DNA for DNA synthesis; and, (iii) the ability of RecA protein/DNA primer complexes to efficiently find and bind to complemen ⁇ tary sequences.
  • the best characterized RecA protein is from E. coli ; in addition to the wild-type protein a number of mutant recA proteins have been identified (eg. recA-803) . Further, many organisms have such RecA-like proteins (see below) .
  • RecA protein catalyzed DNA synthesis is use in enhancing DNA polymerase amplification reactions at a constant elevated temperature using a heat- stable DNA polymerase.
  • Heat-stable DNA polymerases have been isolated from a variety of sources, including: Thermus aguaticus (U.S. Biochemicals) , Bacillus ⁇ tearo- ther ophilus, Sulpholuhus , or Pyrodictium . Generally the activities of these enzymes are heat-stable up to about 95°C. A system such as this may allow amplification of DNA sequences having strong inhibitory structures or DNA se ⁇ quences known to produce artifacts (McConlogue et al; Shuldiner et al.). E.
  • coli RecA protein has a half-life of minutes at 52°C and, accordingly, is too heat-sensitive for use at elevated temperatures; accordingly, a heat-stable RecA protein is required.
  • a heat-stable RecA protein needs to retain its activity over essentially the same tempera ⁇ ture range as the DNA polymerase with which it is being used (eg. up to about 95°C) .
  • the RecA protein from Thermus aguaticus has been identified and the gene encoding it cloned.
  • Southern blot analysis of Thermus aguaticus genomic DNA was performed using the Aguaspir lium magnetotacticum RecA gene as a probe (Example 10) .
  • the Aquaspirillum magnetotacticum gene is unusually G-C rich and is likely a better match for the T . aguaticus RecA gene than the E. coli RecA gene.
  • Single DNA bands were identified, by hybridization with the probe, in each of the following digests: 12-15 kb, BamHI; 5 kb, Hindlll; and 1.5 kb, Sstl.
  • T. aguaticus RecA genomic DNA was purified from T. aguaticus, cut with the restriction endonuclease BamHI (Maniatis et al.), and then cloned into the EMBL Lambda cloning system (Promega) .
  • the large -Ba ⁇ I fragment (15kb) containing the T. aguaticus RecA gene from T. aguaticus was isolated from a phage DNA-containing clone which strongly hybridized to the probe under stringent conditions of hybridization washing.
  • the gene is being subcloned into M13 vectors for complete sequencing.
  • the gene is also being subcloned into ProtocloneTM lambda gtll vectors (Promega) for expression and identification of the RecA protein.
  • T. aguaticus RecA protein The ability of the T. aguaticus RecA protein to improve the length of the target and the final yield of the products in DNA amplification reactions is tested as described above for RecA proteins.
  • tem ⁇ plates having significant secondary structures are used as targets, such as human tRNA genes and the cluster of 21 tRNA genes found in a 2.5-kbp fragment of DNA from Bacillus subtili ⁇ (Green et al.).
  • Synthetic polymers including poly-[d(C-G) ] and poly- [d(br 5 C-G)], were synthesized enzymatically with DNA poly ⁇ merase from poly-[d(I-C) ] templates (Pharmacia) and charac- terized as described previously (Zarling et. al., 1984a; 1984b; Zarling et al. 1990).
  • Poly-[d(C-A)»d(G-T) ] was pur ⁇ chased from Pharmacia-P.L.
  • Polynucleotides were sonicated to an average size of 550 base pairs (bp) as determined by agarose gel electrophoresis to generate oligonucleotides.
  • Primers were either purchased (eg. , the primers in Table 1 are obtained from Cetus Perkin-El er) or prepared using commercially available automated oligonucleotide synthesizers. Alternatvely, custom designed synthetic primers may be purchased, for example, from Synthetic Genetics (San Diego, CA) .
  • This example describes the results of ATPase and strand-transfer reactions comparing the activities of RecA+ and recA-803 proteins.
  • BSA bovine serum albumin
  • the reactions were incubated at 37°C for 30 minutes in 0.6 ml microcentrifuge tubes. The reactions were terminat ⁇ ed by chilling to 0°C followed by the addition of 12 ⁇ l of 25 mM EDTA containing 3 mM each of unlabelled ATP, ADP and AMP as carrier. A 10 ⁇ l aliquot of each reaction was then spotted onto plastic-backed TLC sheets of PEI-cellulose F (Pharmacia) and the TLC sheets developed in a solvent containing 0.5 M LiCl and 0.25 M formic acid. Radioactive products were visualized by autoradiography. The areas corresponding to the liberated inorganic phosphate were scraped off of the TLC sheets and counted in a scintilla ⁇ tion counter.
  • Example 3 Increased Binding of RecA+ Protein to oligo-rdfbr 5 C-G) 1 and to N-acetoxy-N-2-acetylaminofluorene Modified DNA
  • This example describes the results of RecA+ protein/- double-stranded DNA binding assays which indicate the increased ability of the RecA+ protein to bind to light- damaged DNA, chemically-damaged DNA or DNA having the Z-conformation.
  • the DNA substrates used in the binding assays were end-labelled using adenosine [y-P 32 ] triphosphate (New England Nuclear) by the method of Silberklang et. al.
  • the reactions were initiated by the addition of the RecA+ protein at 37°C and incubated for the time periods specified in Figure 3.
  • Figure 3 illustrates the results of the DNA binding assay ' s.
  • the symbols in Figure 3 represent the following DNA substrates: open squares, oligo-[d(br 5 C-G) ] ; closed squares, N-AcO-AAF adducted oligo-[d(br 5 C-G) ] ; open triangles, oligo[d(C-G) ] ; closed triangles, N-AcO-AAF adducted oligo[d(C-G) ] .
  • Figure 3 shows the increased binding of RecA+ protein to chemically modified (N-AcO-AAF adducted) DNA relative to unmodified DNA; further, the figure illustrates the in ⁇ creased binding of RecA+ protein to oligo-[d(br 5 C-G) ] , having a Z-DNA conformation, relative to oligo[d(C-G) ] , having a B-DNA conformation.
  • This example describes the results of DNA binding assays which demonstrate the preferential binding of RecA+ prptein to certain double-stranded DNAs containing alterna ⁇ ting sequences of purines and pyrimidines [e.g., (PuPyPuPyPuPyPuPy) .
  • the DNA binding reactions had a total volume of 50 ⁇ l and contained the following components: 0.35 ⁇ M RecA+ pro- tein; 0.7 ⁇ M DNA (molecules) substrate; TEA buffer (see above) ; and 20 ⁇ M ATP-p-S.
  • the reactions were carried at 20°C and terminated by filtration of the protein/DNA com ⁇ plexes on nitrocellulose filters (described in Example 3) at the time points illustrated in Figure 4A.
  • the DNA binding reactions had a total volume of 50 ⁇ l and contained the following components: 0 to 5.0 ⁇ M RecA+ protein; 1.0 ⁇ M DNA substrate (molecules); TEA buffer (see above) ; and 20 ⁇ M ATP-p-S.
  • the reactions were carried at 20°C for 20 minutes and terminated by filtration of the pro ⁇ tein/DNA complexes on nitrocellulose filters (described in Example 3) .
  • Figures 4A and 4B clearly illustrate the binding pre ⁇ ference of RecA+ protein to the following sequences of alternating purines and pyrimidines, in decreasing order of preference: double stranded oligo-[d(C-A)»[d(G-T) ] , having the right-handed B-conformation; oligo-[d(br 5 C-G) ] , having the left-handed Z-conformation; and, oligo-[d(C-G) ] having the right-handed B-conformation.
  • This example describes the results demonstrating an enhancing effect of RecA+ protein on bulk DNA synthesis from a single-stranded template.
  • the 24-mer primer [d(AGCGGATAACAATTTCACACAGGA) ] was coated with RecA+ and protein using ATP-y-S .
  • the coated primer was added to M13mpl8 single-stranded DNA in a reaction mixture containing rATP; the RATP regenerating system PEP/PK (Boehringer Mannheim) ; dNTPs and [ 3 H]dGTP (New England Nuclear) ; E . coli single-strand binding (SSB) pro- tein (U.S. Biochemical Corporation).
  • the total reaction volume was 26.25 ⁇ l. These conditions were varied by the presence or absence of RecA+ protein and SSB protein (see Figure 5) . After 4 minutes at 37°C, 0.5 units of the Klenow large fragment of DNA polymerase I (New England Biolabs) was added.
  • Reactions were incubated at 37°C and sampled at 5 minute intervals for 15 minutes. Reaction samples were collected by cold 5% Trichloroacetic acid precipitation of the 3 H-labeled DNA and filtration on glass filters (Schleicher and Schuell, Inc.). The amount of [ 3 H]dGTP incorporated into newly synthesized high-molecular-weight DNA was determined by counting the glass filters in a toluene-based scintillation mix using a Packard P2000 liquid scintillation counter. The results of the reactions are presented in Figure 5.
  • the components of the reactions were as follows: open circles, DNA polymerase I; closed circles, DNA polymerase I and SSB protein; open squares, DNA polymerase I and RecA+ protein; and, the closed squares, DNA polymerase I, RecA+ protein, and SSB protein.
  • This example describes the results demonstrating the enhancement of bulk DNA synthesis by RecA+-803 protein.
  • the double-stranded linear template for these reac ⁇ tions was plasmid pJC801-886, containing the coding se- quences for the E. coli RecA gene, cut with restriction endonuclease Sail resulting in an 8 kilobase (kb) linear fragment.
  • primer A [d(ATGCGACCCTTGTGTATC) ] ; and, primer B [d(GTGGTGGGTAGCAAACC) ] .
  • the primers were coated with RecA+ protein (3.0 ⁇ M) , in 30 mM Tris-acetate, 60 mM sodium acetate, 10 mM Mg acetate, further containing the PEP/PK (Boehringher Mannheim) rATP regenerating system, for 5 minutes at 37°C.
  • the DNA synthesis reactions were performed in a total reaction volume of 32 ⁇ l.
  • Five units of Klenow DNA polymerase I were added. Reactions were incubated at 37°C for 30 minutes and sampled at the time points indicated in Figure 6. Reaction samples were collected by cold 5% Trichloroacetic acid precipita- tion of the 35 S-labeled DNA and filtration on glass filters (Schleicher and Schuell, Inc.). The amount of [ 35 S]dATP incorporated into newly synthesized high-molecular-weight DNA was determined by counting the glass filters in a toluene-based scintillation mix using a Packard P2000 liquid scintillation counter.
  • Lambda DNA Templates This example describes the results demonstrating the RecA+ protein enhancement of DNA synthesis from native lambda DNA templates using 25-mer primers.
  • the primer sequences (Cetus-Perkin Elmer, Norwalk, CT) were derived from the lambda viral DNA sequence.
  • the lamb ⁇ da viral genome is approximately 48.5 kb.
  • the DNA segment targeted by the primers is 500 base pair (bp) , including the primer sequences, which is about 1% of the total lambda genome.
  • RecA+ protein was bound to the single-stranded DNA primers under the following conditions: 0.66 ⁇ M RecA+ pro ⁇ tein was incubated with 1 ⁇ M final concentration of each primer (2 ⁇ M total) . The reaction mixture was incubated for 10 minutes at 22°C. RecA+ protein was effectively bound to the single-stranded primers under these conditions as evidenced by gel retardation of the primer/RecA+ protein complexes.
  • 1 ⁇ M final concentration ATP-y-S and 0.094 mM final concentration of SSB protein was added to the reaction, followed by the addition of 0.5 ⁇ g lambda viral genomic DNA (New England Biolabs) .
  • Figure 7 shows that lambda DNA synthesis was enhanced by the inclusion of RecA+ protein.
  • the enhancement is in ⁇ dicated by an increased concentration of DNA products in the lanes containing RecA+ protein; as evidenced by en- hanced ethidium bromide staining.
  • reaction conditions were as described in section A above.
  • the reaction mixtures were equilibrated at 37°C for 3 minutes.
  • DNA synthesis reactions were initiated by the addition of 1 unit Klenow DNA polymerase I (Klenow) .
  • the reactions were maintained at 37°C.
  • Klenow Klenow DNA polymerase I
  • the reactions were supplemented with 1 unit of Klenow at 10 minute intervals over the 80 minute course of the reaction.
  • Each reaction received 8 units of Klenow including the initial addition of 1 unit.
  • the following specific reaction conditions were used to test the effect of E . coli single-strand binding (SSB) protein on DNA synthesis in the presence of RecA+ protein.
  • the first reaction (lane 1, Figure 8) contained no SSB pro ⁇ tein.
  • the second reaction (lane 2, Figure 8) contained 0.094 ⁇ M SSB protein added to the reaction after the addi ⁇ tion of the RecA+ protein primer.
  • the third reaction was a control reaction which contained neither RecA+ protein nor SSB protein (lane 3, Figure 8). All the reactions contained 1 mM ATP-/-S and were incubated at 37 °C for 80 minutes.
  • Lane 8 The results of the above reactions are shown in Figure 8.
  • the samples loaded in each lane were described above.
  • Lane 4 contained a standard 1 kb molecular weight ladder (BRL) .
  • BTL 1 kb molecular weight ladder
  • the appearance of large molecular weight products in lanes 1 and 2 clearly demonstrates that the DNA synthe ⁇ sis reaction is not dependent on the presence of SSB pro ⁇ tein.
  • Lane 3 does, however, indicate the reliance of the reaction on the presence of RecA+ protein.
  • Example 8 RecA+ protein Enhances Primer Dependent DNA Synthesis at 37°C This example describes the results illustrating the dependence of the DNA synthesis reactions on the presence of both RecA+ protein and the lambda-specific primers.
  • the reaction conditions were essentially as described in Example 7A with the following exceptions.
  • the first reaction contained RecA+ protein, but the primers were omitted (lane 1, Figure 9) .
  • the second reaction contained primers but no RecA+ protein (lane 2, Figure 9) .
  • the third reaction contained both RecA-i- protein and the primers (lane 3, Figure 9) .
  • the reaction mixtures were equilibrated at 37°C for 3 minutes. DNA synthesis reactions were initiated by the addition of 1 unit of exonuclease-free E. coli DNA polymer ⁇ ase I (a double mutant of the large Klenow fragment, the enzyme is available from U.S. Biochemicals) . The reactions were maintained at 37°C.
  • reaction Following the initial addition of polymerase, the reactions were each supplemented with additional units of Klenow at ten minute intervals. Reactions were incubated at 37°C for a total of 72 hours. The 28 ⁇ l samples were treated with proteinase K, as above, before being loaded for electrophoretic separation.
  • Example 9 RecA+ Facilitated DNA Amplification at 37°C
  • the results in this example illustrate the enhancement of DNA synthesis from a 500 bp lambda target sequence by RecA+ protein.
  • the reaction conditions were essentially as described in Example 7A with the following exceptions. All the reac- tions contained 0.5 ⁇ g of a 500 bp template, corresponding to nucleotides 7131-7630 of the lambda genome which had been purified from the product of a J. aguaticus DNA poly ⁇ merase I-catalyzed thermal amplification using lambda DNA template (Mullis) , replacing the native lambda genomic DNA.
  • the first two reactions contained no RecA+ protein (lanes 2 and 3, Figure 10).
  • the third reaction contained 0.66 ⁇ M final concentration RecA+ protein and no SSB protein (lane 4, Figure 10) .
  • the fourth reaction contained 0.66 ⁇ M final concentration RecA+ protein and 0.094 ⁇ M final concentration SSB protein (lane 5, Figure 10).
  • reaction mixtures were equilibrated at 37°C for 3 minutes.
  • DNA synthesis reactions were initiated by the addition of 1 unit of exonuclease-free E. coli DNA poly ⁇ merase I (U.S. Biochemicals) .
  • the reactions were main ⁇ tained at 37°C.
  • the reactions were supplemented with 1 unit of Klenow each 10 minutes for an additional 70 minutes.
  • the time course of the reaction was 17.5 hours.
  • Samples were trea ⁇ ted with proteinase K, as above, before being loaded for electrophoretic separation.
  • the concentrations of these components in the reaction mix were as follows: 0.66 ⁇ M RecA+ protein; 0.094 ⁇ M SSB protein; 1 ⁇ M ATP--S; 2 ⁇ M 40-mer primers; 2 ⁇ M 25-mer primers; 0.5 ⁇ g 500 bp template; 1 unit/additions of 8 units total exonuclease-free DNA polymerase I.
  • the reaction numbers correspond to the lane numbers shown in Figure 11.
  • All the reactions contained 0.5 ⁇ g of a 500 bp template, corresponding to nucleotides 7131-7630 of the lambda genome which had been purified from the product of a T. aguaticus DNA polymerase I-catalyzed thermal amplification using lambda DNA template (Mullis) , replacing the native lambda genomic DNA.
  • aguaticus DNA polymerase I-catalyzed thermal amplification using lambda DNA template (Mullis) replacing the native lambda genomic DNA.
  • reaction 1 contained ATP-p-S and lacked RecA+ and SSB pro ⁇ tein (lanes 1, Figure 12) ;
  • reaction 2 contained ATP- -S and SSB protein and lacked RecA+ protein (lane 2 , Figure 12);
  • reaction 3 contained ATP-y-S and RecA+ and lacked SSB pro ⁇ tein (lane 3, Figure 12); and, reaction 4 contained all of the reaction components (lane 4, Figure 12).
  • PCR03A nucleotides 7351 through 7390 of the native lambda genome
  • PCR03A is a 40-mer corresponding to an internal DNA sequence of the 500 base pair lambda template used in the above amplification reaction. The membrane was then autoradiographed.
  • This example describes the identification of the T. aguaticus RecA gene by Southern hybridization analysis and the subsequent cloning of the gene.
  • Genomic DNA was purified from T. aguaticus and was digested with the following restriction enzymes: BamHI, Hindlll, and Sstl. The digested DNA was loaded onto a 0.8% agarose gel, electrophoresed, and the DNA fragments transferred to a nitrocellulose membrane (Maniatis et al.) .
  • the RecA gene from Aguaspirillum magneto ⁇ tacticum which has a 61.6% homology to the RecA gene of E. coli (A. Berson, M. Peters, and N. Waleh, all of SRI International, personal communication) was used; A. magne ⁇ totacticum has codon usage similar to T. aguaticus .
  • the probe consisted of the sequence shown in Figure 13 plus an additional 800 bases of uncharacterized genomic A. magneto ⁇ tacticum DNA. The probe was radioactively labeled using nick-translation (Bethesda Research Laboratories) .
  • Southern hybridization was performed using standard tech ⁇ niques (Maniatis et al. , 1987) at 42°C in 20% f ⁇ rmamide. The hybrids were washed under stringent conditions at 55°C in 0.1 x SSC and 0.1% SDS. The autoradiogram showed only a single band for each restriction digest. The DNA bands that hybridized to the probe were 12-15 kb, 5 kb and 1.5 kb for the Bam HI, Hind III, and Sst I digests, respectively. To clone this RecA gene, the above-described -BamHI T. aguaticus genomic DNA was cloned into the EMBL Lambda cloning system (Promega) .
  • the resulting phage vectors were plated and plaques generated.
  • the phage DNA was trans ⁇ ferred to nitrocellulose filters (plaque lifting, Maniatis et al.).
  • the Aguaspirillum magnetotac ⁇ ticum recA gene ( Figure 13) was used as a probe for the Thermus aguaticus recA gene.
  • the nitrocellose filters were hybridized with the labeled probe. From a phage DNA- containing clone which strongly hybridized to the probe under stringent conditions of hybridization washing, a large -BamHI fragment (15kb) containing the T. aguaticus RecA gene was isolated.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Treatments For Attaching Organic Compounds To Fibrous Goods (AREA)
  • Yarns And Mechanical Finishing Of Yarns Or Ropes (AREA)
  • Inorganic Fibers (AREA)
  • Woven Fabrics (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention se rapporte à un procédé pour effectuer l'amplification, facilitée par une protéine RecA, d'une séquence cible d'ADN bicaténaire possédant des premier et second brins complémentaires, chaque brin comportant des extrémités 5' et 3'. Ce procédé consiste à complexer une amorce complémentaire d'une région terminale 5' du premier brin, et une amorce complémentaire d'une région terminale 5' du second brin avec la protéine RecA et en présence d'ATP-gamma-S. Les amorces complexées sont amenées à réagir dans un mélange contenant aussi la séquence cible, les quatre dNTP, la protéine RecA et la polymérase d'ADN. La réaction se fait à une température inférieure à celle requise pour la dissociation thermique des deux brins cibles, et se poursuit jusqu'à ce qu'un degré d'amplification souhaité de la séquence cible soit atteint. La présente invention comprend en outre le clonage et l'identification des séquences codant pour la protéine RecA de Thermus aquaticus.The present invention relates to a method for performing RecA protein-mediated amplification of a double-stranded DNA target sequence having complementary first and second strands, each strand having 5' and 3' ends. This method consists in complexing a primer complementary to a 5' terminal region of the first strand, and a primer complementary to a 5' terminal region of the second strand with the RecA protein and in the presence of ATP-gamma-S. The complexed primers are reacted in a mixture also containing the target sequence, the four dNTPs, the RecA protein and the DNA polymerase. The reaction proceeds at a temperature below that required for thermal dissociation of the two target strands, and continues until a desired degree of amplification of the target sequence is achieved. The present invention further includes the cloning and identification of RecA protein coding sequences from Thermus aquaticus.

Description

PROCESS FOR NUCLEIC ACID HYBRIDIZATION AND AMPLIFICATION
Field of the Invention
The present invention relates to methods for using RecA protein(s) to catalyze DNA synthesis, repair and amplification reactions.
References
Blaho, J. A., et al., J. Biol. Chem. , 262. p. 6082, (1987). Cheng, S., et al., J. Biol. Chem. 263, p. 15110 (1988). Collins, M. , et. al. , in: "DNA Probes - Applications in Genetic and Infectious Disease and Cancer," (L.S. Lerman, Ed.), Cold Spring Harbor Laboratory, p. 137- 141 (1986) . Cox, M. M. , et al., Ann. Rev. Bioche . 56., p. 229 (1987). Fuchs, R. P. P., et. al., Biochem. _!_! , p. 2659 (1972). Fuchs, R. P. P., et al., Biochem., 1Σ5, p. 3347, (1976). Green, C.J., et al., B S Nucl. Acids Res. II, p. 5763-5774 (1983) . Hingerty, B. E., et al., J. of Biomolecular Structure and
Dynamics, 4., p. 365, (1986) . Krie , E. , Cancer Res., 22., p. 2042, (1972). Leahy, M. C. , et al., J. Biol. Chem., 261f p. 6954-6960 (1986) . Lu, C, et al., Proc. Natl. Acad. Sci., USA, JL3, p. 619,
(1986) . McConlogue, L. , et al. Nucleic Acids Res. Ij5, p. 9869
(1988) . Madiraju, M* V. V. s., et. al., Proc. Natl. Acad. Sci. (USA) 85., p. 6592 (1988) . Maniatis, T. , et. al.. Molecular Cloning: A laboratory Manual. Cold Spring Harbor Lab., Cold Spring Harbor, NY (1982) . Mullis, K. B., et al., U. S. Patent No. 4,683,195 (1987). Mullis, K. B., U. S. Patent No. 4,683,202 (1987). Radding, C. M. , Ann. Rev. Genet. .16, p. 405 (1982). Rigas, B., et al. , Proc. Natl. Acad. Sci. USA, £33., P« 9591-9595 (1986) . Sage, E. et al., Proc. Natl. Acad. Sci., USA, 77., p. 4597, (1980). Sage, E. , et al.. Nucleic Acid Res., 9., p. 1241, (1981). Santella, R. M. , et al.. Nucleic Acid Res., 9., p. 5459, (1981a) . Santella, R. M. , et al., Proc. Natl. Acad. Sci., USA, 78., p. 1451, (1981b) . Saiki, R. K. , et al. , Science 239, p. 487 (1988) . Shi, Y-B., et al.. Nucleic Acid Res., 16., p. 8945, (1988). Silberklang, M. , et. al.. Methods in Enzy ol. 59., p. 58 (1979) .
Shuldiner, A. R. , et al.. Nucleic Acid Res. 1/7, P* 4409
(1989) .
Wells, R. D., et al., Biol. Chem., 257. p. 10166, (1982). Zarling, D. A., et. al., J. Molec. Biol. 176. p. 369 (1984a) .
Zarling, D. A., et. al., J. Biolmol. Struct. Dyna . 1 , p.
1081 (1984b) . Zarling, D.A., et al., J. Molec. Biol. 211, p. 147 (1990). Background of the Invention
RecA+ protein (wild type) is a 38,000 dalton protein found in the bacterium Escherichia coli , which is important for homologous DNA recombination. Most information about its biochemistry and enzymology comes from studies on puri¬ fied RecA+ protein. Numerous in vitro studies have shown that RecA+ protein is intimately involved in the pairing reaction between homologous DNA sequences that ultimately leads to homologous recombination events (see Cox et. al. for a recent review of RecA+ protein properties) . It is this pairing reaction that makes RecA+ protein highly use¬ ful for DNA diagnostics and therapeutics applications.
In the presence of ATP, RecA+ protein catalyzes strand exchange between a number of substrates, the most relevant for DNA probe applications being single- and double-stran¬ ded DNAs. Single-stranded DNA (probe) interacts with the homologous portion of the double-stranded ("native") target sequences, initially by forming a recombination intermedi¬ ate containing hybridized, partially joined molecules. This is followed by branch migration, and forming of fully hybrid molecules between the original single- and double- stranded DNAs, depending upon the extent of their homology. This reaction results in a product that is a hybrid between probe and target. Such hybrids can be easily detected using, for example, radio-labeled, enzyme-labeled, chemilu- minescently-labeled, phosphorescently-labeled or fluores- cently-labeled probes.
The present application demonstrates the feasibility of using RecA+ protein to facilitate and improve the effi- ciency of hybridization reactions involving single-stranded primer and complementary native double-stranded target se¬ quences. In particular, RecA-i- protein is particularly well suited for many DNA probe applications because the double- stranded target DNA does not need to be denatured (e.g., by heating) before hybridization. Further, RecA+ protein is useful in facilitating the initiation and completion of DNA chain elongation at DNA sequences that are either damaged or difficult to denature.
summary of the Invention
It is one object of the present invention to provide a method of achieving RecA protein facilitated amplifica¬ tion of a double-stranded DNA target sequence having first and second complementary circular or linear strands, each linear strand with 5' and 3' ends. The method involves complexing a primer complementary to a 5' end region of the first strand and a primer complementary to a 5' end region of the second strand with RecA protein in the presence of ATP- -S. The complexed primers are then reacted in a mix- ture also containing the target sequence, all four dNTPs, RecA protein and DNA polymerase. The reaction is conducted below the temperature required for thermal dissociation of the two target strands and continued until a desired degree of amplification of the target sequence is achieved. The method of the present invention is particularly useful when the target DNA has inhibitory secondary struc¬ ture or otherwise amplification resistant regions.
During the course of the DNA synthesis reaction fur¬ ther additions of DNA polymerase, RecA protein, and/or ATP- y-S may be made.
One embodiment of the present method includes that the two primers are complementary to the same DNA sequence. Another embodiment includes the use of primers containing terminal 5' sequences which are non-complementary to the DNA target sequence. These non-complementary sequences may include sequences coding for restriction endonuclease recognition sites, capture sequences, reporter sequences, RecA protein loading sequences, Z-DNA sequences or double- stranded tails. An important advantage of the invention is use of the method for the synthesis/amplification of physically or chemically damaged DNA substrates.
A preferred embodiment of the invention includes that the RecA protein is the protein product of the recA-803 gene.
The method of the present invention can also be used to achieve synthesis or amplification of DNA by conducting the DNA synthesis reactions at a constant temperature above about 50°C and below the temperature required for thermal dissociation of the target strands and their respective primers. In this embodiment useful forms of the RecA pro¬ tein and DNA polymerase can be obtained from Thermus aguaticus . The present invention further includes the cloning and identification of the coding sequences for the RecA protein of Thermus aguaticus .
The RecA coated primers of the present invention also serve as useful probes in hybridization-based diagnostic systems because of their enhanced ability to locate and pair with complementary sequences and sequences in regions of normally inhibitory secondary structure.
Brief Description of the Drawings Figure 1 shows the results of the electrophoretic separation of DNA binding reactions comparing the activi¬ ties of RecA+ and recA-803 proteins.
Figure 2A shows the results of ATP hydrolysis reac¬ tions comparing the ATPase activity of RecA+ and recA-803 proteins. Figure 2B shows the results of strand-transfer reactions comparing the activities of RecA+ and recA-803 proteins.
Figures 3, 4A and 4B show the results of RecA+ pro¬ tein/-double-stranded DNA binding assays. Figure 5 illustrates the effects of RecA÷ protein and single-strand binding protein on bulk DNA synthesis from single-stranded DNA templates.
Figure 6 illustrates the effect of recA-803 protein on bulk DNA synthesis from double-stranded linear templates.
Figure 7 shows the results demonstrating the RecA+ protein enhancement of DNA synthesis from native lambda DNA templates.
Figure 8 shows the results demonstrating that the enhancement of DNA synthesis by RecA+ protein does not depend on the presence of single-strand binding protein.
Figure 9 shows the results demonstrating the depen¬ dence of RecA+ protein catalyzed DNA synthesis on the presence of specific primers. Figures 10 and 11 show results demonstrating RecA+ protein catalyzed single temperature DNA amplification reactions.
Figure 12 shows results demonstrating that RecA+ enhances product specificity in single temperature amplifi- cation reactions.
Figure 13 shows the partial sequence of the RecA gene of Aquas pir ilium magnet ot act icum.
Detailed Description of the Invention I. Comparison of the DNA Binding and DNA Strand-transfer Activities of RecA+ and RecA-803 Protein
One focus of the present invention is to provide superior RecA+ protein catalysts to facilitate DNA hybrid¬ ization and DNA synthesis reactions. Experiments performed in support of the present invention suggested recA-S03 pro¬ tein to be a valuable candidate for such a catalyst. The recA-803 mutant gene has been cloned and sequenced, and the protein product over-expressed and purified (Madiraju et. al.) . This new recA mutant protein more efficiently forms more stable recombination intermediates between target and probe DNAs than wild-type RecA+ protein as judged by nitro¬ cellulose filter binding assays (Madiraju et. al.). This observation suggests that the DNA pairing efficiency of the recA-803 protein, as measured by a nitrocellulose filter binding assay, is significantly greater than that of the wild-type RecA+ protein. Under certain conditions, the mutant recA protein catalyzes the pairing reaction with faster kinetics and to a greater final yield than is usu¬ ally achieved by the wild-type RecA+ enzyme. Large quantities of mutant recA-803 protein have been isolated from E. coli containing a plasmid (Dr. A. John Clark, Dept. Mol. Biology (UC Berkeley) that over-expresses the gene; approximately 40% of the total protein in the bacterial cell is mutant recA-803 protein. Example 1 (Figure 1) presents gel retardation assay data to examine the relative DNA binding efficiencies of RecA+ and recA-803 proteins. RecA+ or recA-803 protein is reacted with the double-stranded linearized DNA of phiX174 under conditions allowing formation of protein/DNA com- plexes. The reactions were split into two samples; half of each sample was treated with a detergent, such as SDS, to destroy the protein/DNA complexes. The treated and untreated samples were run side-by-side on 0.7% agarose gels (see Materials and Methods) . A basis of the gel retardation assay is that DNA/protein complexes migrate much more slowly through the matrix of a gel. Figure 1, lanes 7 and 8, illustrate untreated and treated samples, respectively. Corn-parison of lanes 3 (RecA+ protein) and 7 (recA-803 protein) clearly illustrates that, in compari- son to RecA+ protein, recA-803 protein binds much more efficiently to double-stranded linear phiX-174 DNA; similar experiments with double-stranded plasmid or viral DNAs gave identical results.
Example 2 presents data showing that recA-803 protein is also a superior catalyst in comparison to RecA+ protein, in hydrolysis of ATP and in producing significantly greater amounts of DNA strand transfer products. In the experiment described in Example 2A, it is clear that the recA-803 pro¬ tein exhibits significantly more DNA dependent ATPase acti- vity than the RecA+ protein (Figure 2A) . In Example 2B single-stranded phiX-174 virion circular DNA was preincuba- ted with recA-803 or RecA+ protein proteins for 10 minutes at 37°C to form a Radding-type filament (Radding) . The double-stranded target was then added and the strands were transferred with ATPS as a σofactor. These results demon¬ strate that recA-803 catalyzes a significantly greater amount of strand-transfer product in comparison to RecA+ protein. The strand-transfer products appear as a discrete band indicated by the arrow in Figure 2B. Comparison of lanes 3 and 6 (RecA+ protein) to lane 8 (recA-803 protein) illustrates recA-803 protein's increased efficiency in generating DNA strand transfer products. From this and similar experiments the recA-803 protein appears to produce about 5-7 fold more Form II strand-transfer products than RecA+ protein.
The properties of increased ability to bind DNA and increased efficiency in the catalysis of the strand- transfer reaction make recA-803 protein a superior catalyst for DNA synthesis, hybridization, diagnostics and therapeu- tics applications. These desirable properties make recA- 803 protein an ideal catalyst to provide rapid and effi¬ cient assays for hybridizing DNA probe sequences with native double-stranded DNA targets in solution. Such assays can make use of any separation system (Collins et. al. , Rigas et. al., Leahy et. al.) that differentiates between non-hybridized probe (which remains single-strand¬ ed) and hybridized probe target complex (which is partially duplex or multi-stranded, i.e., containing double-stranded regions with portions of single-stranded probe attached) . The use of RecA protein catalyzed enhanced hybridiza¬ tion with homologous sequences in DNA diagnostics elimi¬ nates all the necessary laborious steps involved in the usual denaturation of the target DNA and overcomes the serious limitations posed by "snap-back" and other repeti¬ tive sequences, which appear unamenable to denaturation and, therefore, detection. In nature, functions of RecA+ protein most likely include facilitating DNA polymerization or recombination through (i) regions of complex or unusual secondary structure, or (ii) chemically or physically damaged DNA sequences.
II. RecA Protein's Enhanced Binding to Damaged DNA or DNA having the Z Conformation E. coli RecA+ protein is a major participant in the recognition and subsequent repair of damaged DNA double- helices. Certain physical and chemical agents, such as UV light (Lu et. al.) and psoralen (Shi et. al.), which can adduct and/distort pyrimidine bases in double-stranded DNA conformation, are known to increase RecA+ protein binding. RecA+ protein recognition of purine-adducted double-helical DNA has not been examined previously. N-acetoxy-N-2- acetylaminofluorene (N-AcO-AAF) is a potent mutagen and model chemical carcinogen that covalently binds deoxygua- nine residues yielding adducts primarily at the C-8 position (Kriek) . This modification causes extensive topological changes and unwinding of the DNA helix by inducing the rotation of the deoxyguanine base from the anti to the syn conformation (Fuchs et. al. , 1976) . Energy minimization studies suggest that this rotation may be accompanied by insertion of the heterocyclic adduct into the helix interior causing a bend in the helical axis
(Hingerty et. al.). Furthermore, covalent modification with N-AcO-AAF induces a B - Z transition in duplex DNA of certain alternating purine-pyrimidine or other sequences (Sage et. al., 1980, 1981; Santella et. al., 1981a, 1981b; and Wells et. al.).
Example 3 describes the results of RecA+ protein/dou- ble-stranded DNA binding assays. Blaho et. al. have previ¬ ously shown that RecA+ protein preferentially binds to bro- minated or methylated linear synthetic Z-DNA compared with the B-DNA polymers. The results of Example 3, presented in Figure 3, illustrate a preferential binding to the bromina- ted substrate, consistent with the results of Blaho et. al. Further, the results in Figure 3 show that RecA+ binding to the duplex synthetic DNA at neutral pH with ATP S as a co- factor is enhanced by purine adduction with N-AcO-AAF. In these and other similar experiments, increased N-AcO-AAF adducts in the duplex DNA increased RecA+ protein binding to the DNA duplex. Binding was proportional to the degree of N-AcO-AAF adduction in the range of 5-20% N-AcO-AAF adduction.
The results in Example 4 (Figures 4A and 4B) clearly illustrate RecA+ protein apparent sequence-specificity in preferential binding affinities to the double-stranded oligo-[d(C-A)*d(G-T) ] relative to the duplexes generated from oligo-[d(br5C-G) ] or oligo-[d(C-G) ] . RecA+ protein shows sequence (Figures 4A and 4B) and conformation (Figure 3) specific binding preferences for these DNA duplexes.
RecA protein, accordingly, has valuable diagnostic and therapeutic applications. If the target DNA has been damaged or has unusual secondary structure, traditional methods of DNA hybridization and/or synthesis may be ineffectual. The results of the experiments presented in Examples 3 and 4 illustrate the value of using RecA pro¬ tein's ability to promote binding to complex DNA and complementary base pairing. III. Enhancement of In Vitro DNA Synthesis by RecA- and recA-803
Prior art DNA amplification methods are all based on a three-step process involving DNA template denaturation, primer hybridization, and primer extension by DNA polymer¬ ase (Mullis, and Mullis et al.); the present invention provides unique and valuable alternatives, utilizing RecA protein catalysis.
One new method of RecA protein catalyzed DNA amplifi- cation involves incubating DNA target sequences and DNA primers complementary to the target sequence with RecA+ protein or recA-803 protein in the presence of ATP or ATP S at 37°C. These conditions permit RecA-protein-catalyzed Radding-type D-loops or joint molecules between the primers and the tar¬ get DNA. These stable RecA-catalyzed joint molecules are elongated with the Klenow fra ment of DNA polymerase I.
Example 5 describes the enhancing effect of RecA+ pro¬ tein on DNA synthesis directed from a single-stranded template. The data presented in Figure 5 shows the enhancement of single-stranded DNA synthesis by RecA+ and E. coli single-strand binding (SSB) proteins; the two pro¬ teins appear to have a synergistic effect. Synthesis on phiX-174 single-stranded circular DNA templates was enhanced by coating the primers with RecA+, thus generating a Radding-type filament. Inclusion of E . coli SSB protein in the reaction also enhanced single-stranded DNA directed DNA synthesis as measured by incorporation of [3H]dGTP into high-molecular-weight (cold TCA insoluble) DNA. The effect of RecA protein on DNA synthesis from a double-stranded DNA (dsDNA) template was also examined (Example 6) . The data presented in Figure 6 shows recA-803 protein-enhanced DNA synthesis from a double-stranded template using 18-mer primers. The primers were reacted with recA-803 protein (3 μΑ) for 5 minutes at 37°C to form filaments before addition of the dsDNA. Following an additional 5-minute incubation, Klenow large fragment of E. coli DNA polymerase I was added. RecA-803 protein signifi- cantly enhanced DNA synthesis as judged by increased incor¬ poration of [σ-35S]dATP into high-molecular-weight DNA.
Examples 5 and 6 show that the rates and extent of DNA synthesis can be significantly enhanced by primers coated with RecA+ or recA-803. Example 7 demonstrates that RecA protein is able to enhance DNA synthesis from native lambda viral DNA tem¬ plates. In Example 7 the reactions were assembled at room temperature without the primers. RecA+ protein was incubated with the two 25-mer single-stranded primers (PCR01 and PCR02, Table 1). Next, ATP-y-S and SSB protein were added to the reaction, followed by the native λ DNA template. Reactions were incubated in a 37°C heat block and equilibrated at 37°C for 3 minutes prior to the addi¬ tion of Klenow DNA polymerase. Following the initiation of the reaction by the first addition of Klenow, subsequently, at ten-minute intervals over the 80 minute time course, an additional 1.0 unit of fresh Klenow polymerase was added. Reactions were sampled and the amount of newly synthesized DNA was measured. The data presented in Figure 7 shows that native λ DNA synthesis is enhanced by including RecA+ pro¬ tein and ATP^S in long-term (72-hour) reactions catalyzed by Klenow DNA polymerase at a single temperature, 37°C. The enhancement of DNA synthesis is evidenced by enhanced ethidium bromide binding and staining of DNA products separated by electrophoresis on 0.7% agarose gels.
Example 7 presents data showing that the ability of RecA protein to enhance DNA synthesis on dsDNA templates is not dependent on the presence of SSB protein. The data presented in Figure 8 shows DNA synthesis in the absence of SSB protein (lane 1) and further demonstrates RecA+ pro¬ tein's ability to enhance DNA synthesis in short term reac¬ tions (8 successive additions of polymerase every 10 mi¬ nutes for 80 minutes) . The primer dependent nature of the RecA protein cata¬ lyzed DNA synthesis is described in Example 8. The data presented in Figure 9 shows enhanced native DNA synthesis in polymerase reactions with exonuclease free (US Biochemi- cals) double mutants of the Klenow large fragment of E. coli DNA polymerase I only in the presence of RecA+ protein and primers.
A 500-bp DNA template was enzymatically synthesized (AmplitaqR kit, Perkin-Elmer-Cetus) using PCROl and PCR02 primer pairs (Table 1) . This double-stranded product was used as a simple 500-bp template with 40-mer primers PCROl and PCR02 (Table 1) for DNA synthesis reactions. The reac¬ tions were incubated for 17.5 hours at 37°C using exonucle- ase-free double mutants of the Klenow large fragment of E . coli DNA polymerase I. The data presented in Figure 10 (Example 9) (lane 4) shows a band of newly synthesized DNA products with an electrophoretic mobility and molecular weight matching the 500-bp native λ DNA template. The syn¬ thesis of these DNA products was absolutely dependent on the addition of RecA+ protein to the reaction. Under the same conditions, reactions supplemented with both RecA+ protein and SSB proteins produced other lower-molecular- weight products (lane 5) . This result suggested that the DNA synthesis product is more heterogeneous when SSB pro¬ tein is present; that is, the protein is having a negative effect in terms of specificity although bulk DNA synthesis may be improved in the presence of SSB protein.
In another experiment, 500-bp DNA products were syn¬ thesized from 500-bp λ DNA templates with the 25-mer primer pairs (Example 9). Table 2, presented in Example 9, summa- rizes a number of reaction conditions under which the RecA+ protein's ability to catalyze DNA synthesis has been tested. The results of the reactions are presented in Figure 11. In general, the enhancing effects of RecA pro- tein depend on the RecA protein concentration, the pro¬ tein/DNA ratio, the time of incubation, and the presence of the specific primer pairs at the appropriate concentrations (lane 7) .
Hybridization of a radiolabeled probe, specific for the 500 base pair λ template, to products of a Klenow single-temperature DNA amplification reaction catalyzed by RecA+ shows that RecA+ enhances true product synthesis (Example 9C) . The data shown in Figure 12 demonstrates that significant amplification of the 500 base pair tem- plate occurred only in the reaction which contained RecA+ and TP S and lacked SSB protein (Lane 3) .
The method of the present invention permits the syn¬ thesis and amplification of native duplex, i.e. non- denatured, target DNA sequences, in solution, using RecA- catalyzed target hybridization with homologous oligonucleo- tide primer sequences. This hybridization reaction posi¬ tions the primers for subsequent extension by DNA polymera- ses. The reaction is a two-step process and requires opti¬ mization of both steps of the reaction: (i) the primer hybridization; and, (ii) the primer extension.
Target DNA sequences can be obtained by a variety of methods and from many sources, for example: (i) the original target DNA sequence may be synthesized from a single-strand nucleic acid template, such as single-strand DNA or an RNA molecule, by standard procedures (Maniatis et al.); and, (ii) the original target sequence may be ex¬ tracted from a cell or tissue source. The target DNA se¬ quence can also be present in a homogeneous mixture, i.e.. predominantly composed of target sequences, or a heteroge¬ neous mixture, i.e., other sequences are present.
Initially, a primer complementary to the target se¬ quence is reacted with the target DNA sequence under conditions which allow the RecA protein to catalyze the formation of joint-molecules between the primer and the target DNA. This reaction is carried out with native DNA substrates, i.e., the DNA strands are not heat-denatured. The multi-stranded structures, whose formation are cata- lyzed by RecA protein, are elongated using the Klenow fragment of DNA polymerase I in the presence of nucleotide triphosphates. RecA protein topologically prepares the hybrid DNA for DNA polymerase elongation.
In subsequent rounds of amplification, free primers complementary to the existing target DNA strands can either bind to an original strand or to the new strand. Once hybridized these complexes are then elongated using DNA polymerase as described above. The process is repeated and the target sequence is synthesized, thus amplified, many times. After a few rounds of amplification, the native target sequence can be detected using a labeled single- stranded DNA probe driven by mass action hybridization and/or by RecA protein/probe complexes in hybridization reactions catalyzed by the RecA protein. Alternatively, the reaction can be allowed to proceed for many rounds, providing an amplified product which can be visualized, for example, by electrophoretically resolving the separated reaction components on an agarose gel, followed by staining the separated DNA in the gel with ethidium bromide. The advantage of using RecA+ and recA-803 proteins in DNA amplification and DNA synthetic reactions is that these proteins strongly facilitate efficient hybridization of the single-stranded DNA primer to target DNA sequences. Fur¬ ther, these proteins prepare the DNA primer-native-target complex topologically for extension. Because of the topo- logical effects of RecA protein, cellular DNA polymerases, such as Klenow fragment of E. coli DNA polymerase I, can elongate the primer as the template strand is unwound. This reaction is simpler than amplification reactions which require heating to provide single strand templates and cooling to allow hybridization of the primers.
Accordingly, one major use of these RecA enhanced DNA syntheses is to amplify normal, light-damaged, or chemical¬ ly-damaged DNA sequences using RecA-catalysis to properly position primers on their homologous targets for subsequent extension by DNA polymerases. Another advantage of the use of RecA protein-catalyzed DNA synthesis is the elimination of the requirement for multiple cycles of high-temperature thermal denaturation and renaturation (Saiki et al.). A second important application, as discussed above, is the ability of RecA protein to topologically prepare DNA for DNA synthesis; in particular, DNA having conformations or secondary structures which are difficult to synthesize or amplify by traditional methods, such as heat denatur- ation.
A third important use of these RecA protein-catalyzed reactions takes advantage of the ability of the RecA pro¬ tein/DNA primer complexes to efficiently find complementary sequences. The protein/primer complexes can, for example, be used as probes in diagnostic assays which depend on the identification of sequences in a sample based on their complementarity to the primer. The bound complex can then be stabilized and identified by a variety of methods, such as by antibodies directed against the recA-803 protein.
IV. Other Useful Proteins having the Activities of RecA Protein
In the present invention RecA protein refers to a family of RecA-like proteins all having essentially the same functions, particularly: (i) the protein's ability to properly position primers on their homologous targets for subsequent extension by DNA polymerases; (ii) the ability of RecA protein to topologically prepare DNA for DNA synthesis; and, (iii) the ability of RecA protein/DNA primer complexes to efficiently find and bind to complemen¬ tary sequences. The best characterized RecA protein is from E. coli ; in addition to the wild-type protein a number of mutant recA proteins have been identified (eg. recA-803) . Further, many organisms have such RecA-like proteins (see below) .
Another application of RecA protein catalyzed DNA synthesis is use in enhancing DNA polymerase amplification reactions at a constant elevated temperature using a heat- stable DNA polymerase. Heat-stable DNA polymerases have been isolated from a variety of sources, including: Thermus aguaticus (U.S. Biochemicals) , Bacillus εtearo- ther ophilus, Sulpholuhus , or Pyrodictium . Generally the activities of these enzymes are heat-stable up to about 95°C. A system such as this may allow amplification of DNA sequences having strong inhibitory structures or DNA se¬ quences known to produce artifacts (McConlogue et al; Shuldiner et al.). E. coli RecA protein has a half-life of minutes at 52°C and, accordingly, is too heat-sensitive for use at elevated temperatures; accordingly, a heat-stable RecA protein is required. A heat-stable RecA protein needs to retain its activity over essentially the same tempera¬ ture range as the DNA polymerase with which it is being used (eg. up to about 95°C) .
In experiments performed in support of the present invention, the RecA protein from Thermus aguaticus has been identified and the gene encoding it cloned. Southern blot analysis of Thermus aguaticus genomic DNA was performed using the Aguaspir lium magnetotacticum RecA gene as a probe (Example 10) . The Aquaspirillum magnetotacticum gene is unusually G-C rich and is likely a better match for the T . aguaticus RecA gene than the E. coli RecA gene. Single DNA bands were identified, by hybridization with the probe, in each of the following digests: 12-15 kb, BamHI; 5 kb, Hindlll; and 1.5 kb, Sstl.
To clone the T. aguaticus RecA gene, genomic DNA was purified from T. aguaticus, cut with the restriction endonuclease BamHI (Maniatis et al.), and then cloned into the EMBL Lambda cloning system (Promega) . The large -Ba ϊI fragment (15kb) containing the T. aguaticus RecA gene from T. aguaticus was isolated from a phage DNA-containing clone which strongly hybridized to the probe under stringent conditions of hybridization washing. The gene is being subcloned into M13 vectors for complete sequencing. The gene is also being subcloned into Protoclone™ lambda gtll vectors (Promega) for expression and identification of the RecA protein.
The ability of the T. aguaticus RecA protein to improve the length of the target and the final yield of the products in DNA amplification reactions is tested as described above for RecA proteins. In particular, tem¬ plates having significant secondary structures are used as targets, such as human tRNA genes and the cluster of 21 tRNA genes found in a 2.5-kbp fragment of DNA from Bacillus subtiliε (Green et al.).
The following examples illustrate, but in no way are intended to limit, the present invention.
Materials and Methods
DNAs and Enzymes
Synthetic polymers, including poly-[d(C-G) ] and poly- [d(br5C-G)], were synthesized enzymatically with DNA poly¬ merase from poly-[d(I-C) ] templates (Pharmacia) and charac- terized as described previously (Zarling et. al., 1984a; 1984b; Zarling et al. 1990). Poly-[d(C-A)»d(G-T) ] was pur¬ chased from Pharmacia-P.L. Polynucleotides were sonicated to an average size of 550 base pairs (bp) as determined by agarose gel electrophoresis to generate oligonucleotides. Polynucleotide end-labeling was as described by Silberklang et. al. Restriction endonucleases were obtained from a va¬ riety of commercial sources (eg., New England Biolabs, and Boehringer Mannheim. Purified wild-type RecA+ protein and restriction endo¬ nucleases were purchased from Pharmacia. RecA+ protein was stored at -70°C in 20 mM Tris-HCl (pH=7.5) , 0.1 mM EDTA, 0.1 mM dithiothreitol (DTT) , in a final concentration of 50% (v/v) glycerol. M13mpl8 DNA and ATP-/-S were obtained from Boehringer Mannheim.
Agarose Gel Electrophoresis of Protein-DNA Complexes
Reactions were terminated by the addition of TBE buffer (90 mM Tris-HCl, 90 mM boric acid, 2.8 mM EDTA, pH=8) containing 0.25% bromphenol blue and 0.25% xylene cyanol all in 50% glycerol (v/v) .
All samples were analyzed on 0.7% agarose gels rou¬ tinely run in 1 X Tris-borate-EDTA buffer (Maniatis et. al.). When the samples were protein/DNA complexes, agarose gels were electrophoresed at 4°C for approximately 2-3 hours at 90 volts. DNA bands were visualized by staining the gel in 4 μg/ml ethidium bromide, destaining the gel in distilled water, and then photographing the gel using an ultra-violet light source.
Source of the DNA Primers •
Primers were either purchased (eg. , the primers in Table 1 are obtained from Cetus Perkin-El er) or prepared using commercially available automated oligonucleotide synthesizers. Alternatvely, custom designed synthetic primers may be purchased, for example, from Synthetic Genetics (San Diego, CA) .
Example 1
Comparison of RecA-803 and RecA+ wild-type proteins Binding
Efficiencies to DNA substrates This example describes the results of DNA binding reactions comparing the activities of RecA+ and recA-803 proteins.
Reactions were assembled in a volume of 0.01 ml con¬ taining: 10 mM Tris acetate buffer (pH =7.5 at 37°C) ; 2 mM magnesium acetate; 1 mM dithiothreitol; 50 mM sodium acetate; 5% glycerol (added as 10X buffer); 1.6 mM ATP- -S; 0.05 μg phiX174 as circular virion DNA; and either 34.3 //M (Figure 1, lanes 2, 5, and 6) or 17.1 M (Figure 1, lanes 3, 4, 7 and 8) of RecA+ or recA-803 proteins. The reaction mixtures were equilibrated for 10 minutes at 37°C. The concentration of magnesium was then increased to a final concentration of 12 mM by addition of 0.2 M magnesium acetate. 0.4 μg of Xhol digested phiX174 linear double- stranded DNA (form II DNA) and an appropriate volume of 10X buffer was then added to the mixture resulting in a final reaction volume of 20 μl . After 30 minutes of incubation at 37°C, all reactions were divided into 2 equal aliquots of which one was treated with proteinase K (10 mg/ml) for 15 minutes at 37°C (lanes 2, 4, 6, and 8). The untreated samples corresponding to lanes 1 and 2 of Figure 1 are not shown.
Comparison of lanes 3 and 7 (Figure 1) clearly demon¬ strates that at equal protein concentrations RecA+ protein binds less double-stranded target DNA than recA-803 pro¬ tein. Example 2
Comparison of the ATPase Activities of RecA+ and RecA-803 and Their Abilities to Catalyze strand-transfer Reactions
This example describes the results of ATPase and strand-transfer reactions comparing the activities of RecA+ and recA-803 proteins.
A. ATPase Activity Reactions
The ATPase activities of equal concentrations of RecA+ and recA-803 were compared. Reactions were carried out in a total volume of 18 μl of buffer containing 35 mM Tris-HCl (pH=7.5), 6.7 mM MgCl2, 2 mM dithiothrietol, 100 //g/ml bovine serum albumin (BSA) , 1.4 mM ATP, 0.002 μM. [ γ--~l?]-ATP. To these reaction mixtures RecA or RecA803 protein was added in the presence or absence of 50 single-stranded phiX174 phage DNA.
The reactions were incubated at 37°C for 30 minutes in 0.6 ml microcentrifuge tubes. The reactions were terminat¬ ed by chilling to 0°C followed by the addition of 12 μl of 25 mM EDTA containing 3 mM each of unlabelled ATP, ADP and AMP as carrier. A 10 μl aliquot of each reaction was then spotted onto plastic-backed TLC sheets of PEI-cellulose F (Pharmacia) and the TLC sheets developed in a solvent containing 0.5 M LiCl and 0.25 M formic acid. Radioactive products were visualized by autoradiography. The areas corresponding to the liberated inorganic phosphate were scraped off of the TLC sheets and counted in a scintilla¬ tion counter. The percent of hydrolysis was calculated by dividing the cpm of the product by the total cpm of the 10 μl sample. Figure 2A shows the results of the above reactions. Neither recA-803 (open diamonds) nor RecA+ (closed squares) have significant ATPase activity in the absence of DNA. However, RecA-803 protein (closed diamonds) , in the presence of DNA, has superior ATPase activity when compared with RecA+ protein (open squares) .
B. Strand-transfer Reactions Reactions were assembled in a volume of 0.01 ml as in Example 1 with the following exceptions: 0.3 μg phiX174 single-stranded circular virion DNA was used instead of 0.05 μg; and, 34.3 μM. of RecA+ or recA-803 proteins were used in all reactions. After 30 minutes of incubation at 37°C, the reactions were divided in half and SDS was added to a final concen¬ tration of 0.5% to one-half of each sample. Gel loading dye (50% glycerol, 50% TEB, 0.25% bromphenol blue, 0.25% xylene cyanol; Maniatis et al.) was added to all the samples. The samples were electrophoresed for 3 hours at 7.6 V/cm in a standard 0.7% agarose gel, prepared as described above. DNA bands were visualized by staining with ethidium bromide.
The reactions in lanes 3, 4, 5, and 6 (Figure 2B) contained RecA+ protein, whereas lanes 7 and 8 (Figure 2B) contained recA-803 protein. Lanes 1 and 2 contained no RecA+ protein. Lanes 3, 6, and 8, were samples treated with SDS. The two bright bands in lane 1 correspond to the substrates of the reaction. Complete strand-transfer results in the formation of double-stranded nicked circular DNA (Form II) ; strand-transfer products are indicated by the arrow in Figure 2B.
Example 3 Increased Binding of RecA+ Protein to oligo-rdfbr5C-G) 1 and to N-acetoxy-N-2-acetylaminofluorene Modified DNA This example describes the results of RecA+ protein/- double-stranded DNA binding assays which indicate the increased ability of the RecA+ protein to bind to light- damaged DNA, chemically-damaged DNA or DNA having the Z-conformation.
A. Preparation of Adducted DNA N-acetoxy-N-2-acetylaminofluorene (obtained from Dr. Frederick Beland, National Center for Toxicological Research, Jefferson, Arizona) was stored at -20°C. Adduc¬ tion reactions were performed in a total reaction volume of 50 μl and contained the following reagents: 2.5 μg of DNA (either oligo-'[d(br5C-G) ] or oligo-[d(C-G) ]) ; 0 to 200 mM N-acetoxy-N-2-acetylamino-fluorene (N-AcO-AAF) ; 50 mM NaCl; and, 5 mM Tris-HCl, pH=7.5. The reactions were performed for 10 minutes at 25°C in the dark. Unbound N- AcO-AAF was removed by extraction with 20 volumes of ice- cold anhydrous diethyl ether. The adducted DNA was then ethanol precipitated and extensively dialyzed against 10 mM Tris-HCl, 1 mM EDTA, pH=7.5. The extent of modification of each reaction was determined from the A305/A260 ratio as described by Fuchs et. al. (1972) , using an extinction coefficient of e= 18,000 for N-Aco-AAF. DNA having 5-20% adduction of N-AcO-AAF was used in subsequent reactions.
B. RecA+ protein Binding Assays
The DNA substrates used in the binding assays were end-labelled using adenosine [y-P32] triphosphate (New England Nuclear) by the method of Silberklang et. al. The binding reactions had a total volume of 50 μl and contained the following: 0.57 μM of oligo-[d(br5C-G) ] or oligo-[d(C- G) ] ; 0.33 μM RecA+ protein; TEA buffer (25 mM triethanol- amine, pH=7.5, 1.0 mM dithiothreitol, and 5.0 mM MgCl2) ; and 20 μM ATP-y-S. The reactions were initiated by the addition of the RecA+ protein at 37°C and incubated for the time periods specified in Figure 3.
All reactions were terminated by filtration on nitro¬ cellulose membrane filters (Millipore, Millititer™- STHA09610) , which were pre-wetted with double distilled water and primed with TEA buffer prior to sample filtra¬ tion. Filters were washed 6 times with TEA buffer, dried under a heat lamp, and immersed in Aquasol-2 (DuPont, New England Nuclear) . The radioactivity retained on each filter was measured using a liquid scintillation counter (Hewlett Packard Model 2000CA) . Under these conditions the retention of protein-bound-DNA by the nitrocellulose was approximately 50% efficient.
Figure 3 illustrates the results of the DNA binding assay's. The symbols in Figure 3 represent the following DNA substrates: open squares, oligo-[d(br5C-G) ] ; closed squares, N-AcO-AAF adducted oligo-[d(br5C-G) ] ; open triangles, oligo[d(C-G) ] ; closed triangles, N-AcO-AAF adducted oligo[d(C-G) ] . Figure 3 shows the increased binding of RecA+ protein to chemically modified (N-AcO-AAF adducted) DNA relative to unmodified DNA; further, the figure illustrates the in¬ creased binding of RecA+ protein to oligo-[d(br5C-G) ] , having a Z-DNA conformation, relative to oligo[d(C-G) ] , having a B-DNA conformation.
Example 4
Preferential binding of RecA+ protein to double-stranded oligo-rdfC-A d(G-τn relative to either oligordfC-Gn or
oligo-rdfbr5C-G) 1
This example describes the results of DNA binding assays which demonstrate the preferential binding of RecA+ prptein to certain double-stranded DNAs containing alterna¬ ting sequences of purines and pyrimidines [e.g., (PuPyPuPyPuPyPuPy) .
A. Constant RecA+ Protein/DNA Concentration (Figure 4A)
The DNA binding reactions had a total volume of 50 μl and contained the following components: 0.35 μM RecA+ pro- tein; 0.7 μM DNA (molecules) substrate; TEA buffer (see above) ; and 20 μM ATP-p-S. The reactions were carried at 20°C and terminated by filtration of the protein/DNA com¬ plexes on nitrocellulose filters (described in Example 3) at the time points illustrated in Figure 4A. B. Constant DNA Concentration with Increasing RecA+ Protein Concentration
The DNA binding reactions had a total volume of 50 μl and contained the following components: 0 to 5.0 μM RecA+ protein; 1.0 μM DNA substrate (molecules); TEA buffer (see above) ; and 20 μM ATP-p-S. The reactions were carried at 20°C for 20 minutes and terminated by filtration of the pro¬ tein/DNA complexes on nitrocellulose filters (described in Example 3) .
The DNA substrates used in the above reactions were as follows for Figures 4A and 4B: open squares, oligo-[d(C- G) ] ; closed squares, oligo-[d(br5C-G) ] ; and, open triangles, oligo-[d(C-A)*d(G-T) ] .
Figures 4A and 4B clearly illustrate the binding pre¬ ference of RecA+ protein to the following sequences of alternating purines and pyrimidines, in decreasing order of preference: double stranded oligo-[d(C-A)»[d(G-T) ] , having the right-handed B-conformation; oligo-[d(br5C-G) ] , having the left-handed Z-conformation; and, oligo-[d(C-G) ] having the right-handed B-conformation.
Example 5 RecA+ Protein Enhancement of DNA Synthesis on Single— Stranded Circular DNA Templates
This example describes the results demonstrating an enhancing effect of RecA+ protein on bulk DNA synthesis from a single-stranded template.
The 24-mer primer [d(AGCGGATAACAATTTCACACAGGA) ] was coated with RecA+ and protein using ATP-y-S . The coated primer was added to M13mpl8 single-stranded DNA in a reaction mixture containing rATP; the RATP regenerating system PEP/PK (Boehringer Mannheim) ; dNTPs and [3H]dGTP (New England Nuclear) ; E . coli single-strand binding (SSB) pro- tein (U.S. Biochemical Corporation). The total reaction volume was 26.25 μl. These conditions were varied by the presence or absence of RecA+ protein and SSB protein (see Figure 5) . After 4 minutes at 37°C, 0.5 units of the Klenow large fragment of DNA polymerase I (New England Biolabs) was added.
Reactions were incubated at 37°C and sampled at 5 minute intervals for 15 minutes. Reaction samples were collected by cold 5% Trichloroacetic acid precipitation of the 3H-labeled DNA and filtration on glass filters (Schleicher and Schuell, Inc.). The amount of [3H]dGTP incorporated into newly synthesized high-molecular-weight DNA was determined by counting the glass filters in a toluene-based scintillation mix using a Packard P2000 liquid scintillation counter. The results of the reactions are presented in Figure 5. The components of the reactions were as follows: open circles, DNA polymerase I; closed circles, DNA polymerase I and SSB protein; open squares, DNA polymerase I and RecA+ protein; and, the closed squares, DNA polymerase I, RecA+ protein, and SSB protein.
The results illustrated in Figure 5 show that the addition of RecA+ protein in the absence of SSB protein improves bulk DNA synthesis. Further, there appears to be a synergistic effect of SSB protein and RecA+ protein on
DNA synthesis from a single-stranded circular template.
Example 6 RecA-803 Protein Enhanced DNA Synthesis on Linear Double -Stranded DNA Templates
This example describes the results demonstrating the enhancement of bulk DNA synthesis by RecA+-803 protein.
The double-stranded linear template for these reac¬ tions was plasmid pJC801-886, containing the coding se- quences for the E. coli RecA gene, cut with restriction endonuclease Sail resulting in an 8 kilobase (kb) linear fragment.
The following -RecA gene-specific primers were used: primer A [d(ATGCGACCCTTGTGTATC) ] ; and, primer B [d(GTGGTGGGTAGCAAACC) ] . The primers were coated with RecA+ protein (3.0 μM) , in 30 mM Tris-acetate, 60 mM sodium acetate, 10 mM Mg acetate, further containing the PEP/PK (Boehringher Mannheim) rATP regenerating system, for 5 minutes at 37°C. The DNA synthesis reactions were performed in a total reaction volume of 32 μl. The reactions contained 0.5μg pJC801-886, 0.6 μM each of primers A and B, 30 mM Tris-ace¬ tate, pH=8.3, 60 mM Na acetate, 10 mM Mg acetate, the ATP regenerating system described in Example 5, dNTPs, and [σ- 35S]dATP. Five units of Klenow DNA polymerase I were added. Reactions were incubated at 37°C for 30 minutes and sampled at the time points indicated in Figure 6. Reaction samples were collected by cold 5% Trichloroacetic acid precipita- tion of the 35S-labeled DNA and filtration on glass filters (Schleicher and Schuell, Inc.). The amount of [35S]dATP incorporated into newly synthesized high-molecular-weight DNA was determined by counting the glass filters in a toluene-based scintillation mix using a Packard P2000 liquid scintillation counter.
The results illustrated in Figure 6 (open squares, in the absence of recA-803 protein; and closed squares, in the presence of recA-803 protein) clearly demonstrate the enhancement of bulk DNA synthesis from a linear double- stranded template in the presence of recA-803 protein.
Example 7 RecA+ Protein Enhanced DNA Synthesis on Native Linear
Lambda DNA Templates This example describes the results demonstrating the RecA+ protein enhancement of DNA synthesis from native lambda DNA templates using 25-mer primers.
A. Preparation of RecA+ Protein/Primer Complexes The following primers were used for the DNA synthesis reactions:
Table 1
Primer or Probe Nucleotides λ DNA Seguence
1 PCR01-25 mer 7131-7155 (5' )GATGAGTTCGTGTCCGTACAACTGG(3' )
2 PRC02-25 mer 7606-7603 (5')GGTTATCGAAATCAGCCACAGCGC(3')
3 PRC01A-40 mer 7131-7170 (5' )GATGAGTTCGTGTCCGTACAACTGGCG-
TAATCATGGCCCT(3')
4 PRC02A-40 mer 7591-7630 (5' )GGTTATCGAAATCAGCCACCAGCGCCTC- CCGTTATTGCATT(3') The primer sequences (Cetus-Perkin Elmer, Norwalk, CT) were derived from the lambda viral DNA sequence. The lamb¬ da viral genome is approximately 48.5 kb. The DNA segment targeted by the primers is 500 base pair (bp) , including the primer sequences, which is about 1% of the total lambda genome.
RecA+ protein was bound to the single-stranded DNA primers under the following conditions: 0.66 μM RecA+ pro¬ tein was incubated with 1 μM final concentration of each primer (2 μM total) . The reaction mixture was incubated for 10 minutes at 22°C. RecA+ protein was effectively bound to the single-stranded primers under these conditions as evidenced by gel retardation of the primer/RecA+ protein complexes. After the 10 minute incubation, the RecA-primer mix¬ ture was added to the reaction mixture (10 mM Tris-HCl, pH=7.5; 50 mM NaCl; 10 mM MgCl2, 750 μM dNTPs final concen¬ tration, 10% DMSO final concentration) . Next, 1 μM final concentration ATP-y-S and 0.094 mM final concentration of SSB protein was added to the reaction, followed by the addition of 0.5 μg lambda viral genomic DNA (New England Biolabs) .
B. DNA Synthesis is Enhanced by the Presence of RecA+ Protein. The above reaction mixtures were equilibrated at 37°C for 3 minutes. DNA synthesis reactions were initiated by the addition of 1 unit Klenow DNA polymerase I (Klenow) . The reactions were maintained at 37°C. Following the ini¬ tial addition of Klenow, the reactions were supplemented with 1 unit of Klenow at 10 minute intervals seven times over the 80-minute course of the reaction.
The following specific reaction conditions were used to examine the effect of the addition of the RecA+ protein on the DNA synthesis reactions (Figure 7) : (a) lane 1, eight successive additions of 0.66 μM RecA+ protein and 0.094 mM SSB protein at 10 minute intervals; (b) lane 2, eight successive additions of 0.66 μM RecA+ protein, 0.094 mM SSB protein, and 1 mM ATP-^-S at 10 minute intervals; (c) lane 3, only the initial addition of RecA+ protein com¬ plexed to the primers followed by eight successive addi¬ tions of ATP-K-S and SSB protein; and, (d) lane 4, a control reaction from which RecA+ protein, SSB protein, and ATP-y-S were omitted. Lanes 5 and 6 contain lambda DNA (0.5μg) and a set of 1 kb DNA molecular weight markers (BRL) , respec¬ tively.
The products of the reactions were separated by elec¬ trophoresis in a 0.7% agarose gel and the DNA bands visua- * lized by staining with ethidium bromide. The results are illustrated in Figure 7.
Figure 7 shows that lambda DNA synthesis was enhanced by the inclusion of RecA+ protein. The enhancement is in¬ dicated by an increased concentration of DNA products in the lanes containing RecA+ protein; as evidenced by en- hanced ethidium bromide staining.
C. Enhancement of DNA Synthesis by RecA+ Protein is Independent of Single-Strand Binding Protein.
The reaction conditions were as described in section A above. The reaction mixtures were equilibrated at 37°C for 3 minutes. DNA synthesis reactions were initiated by the addition of 1 unit Klenow DNA polymerase I (Klenow) . The reactions were maintained at 37°C. Following the ini¬ tial addition of Klenow, the reactions were supplemented with 1 unit of Klenow at 10 minute intervals over the 80 minute course of the reaction. Each reaction received 8 units of Klenow including the initial addition of 1 unit.
The following specific reaction conditions were used to test the effect of E . coli single-strand binding (SSB) protein on DNA synthesis in the presence of RecA+ protein. The first reaction (lane 1, Figure 8) contained no SSB pro¬ tein. The second reaction (lane 2, Figure 8) contained 0.094 μM SSB protein added to the reaction after the addi¬ tion of the RecA+ protein primer. The third reaction was a control reaction which contained neither RecA+ protein nor SSB protein (lane 3, Figure 8). All the reactions contained 1 mM ATP-/-S and were incubated at 37 °C for 80 minutes.
At the end of 80 minutes 2.5 μl of Proteinase K (50 μg/μl) were added to the reactions and the mixtures held at 37°C for 15 minutes. The DNA molecules were then separated by agarose gel electrophoresis.
The results of the above reactions are shown in Figure 8. The samples loaded in each lane were described above. Lane 4 contained a standard 1 kb molecular weight ladder (BRL) . The appearance of large molecular weight products in lanes 1 and 2 clearly demonstrates that the DNA synthe¬ sis reaction is not dependent on the presence of SSB pro¬ tein. Lane 3 does, however, indicate the reliance of the reaction on the presence of RecA+ protein.
Example 8 RecA+ protein Enhances Primer Dependent DNA Synthesis at 37°C This example describes the results illustrating the dependence of the DNA synthesis reactions on the presence of both RecA+ protein and the lambda-specific primers.
The reaction conditions were essentially as described in Example 7A with the following exceptions. The first reaction contained RecA+ protein, but the primers were omitted (lane 1, Figure 9) . The second reaction contained primers but no RecA+ protein (lane 2, Figure 9) . The third reaction contained both RecA-i- protein and the primers (lane 3, Figure 9) . The reaction mixtures were equilibrated at 37°C for 3 minutes. DNA synthesis reactions were initiated by the addition of 1 unit of exonuclease-free E. coli DNA polymer¬ ase I (a double mutant of the large Klenow fragment, the enzyme is available from U.S. Biochemicals) . The reactions were maintained at 37°C. Following the initial addition of polymerase, the reactions were each supplemented with additional units of Klenow at ten minute intervals. Reactions were incubated at 37°C for a total of 72 hours. The 28μl samples were treated with proteinase K, as above, before being loaded for electrophoretic separation.
As can be seen from lane 3, Figure 9, DNA synthesis occurs only in the presence of RecA+ protein and the lambda-specific primers.
Example 9 RecA+ Facilitated DNA Amplification at 37°C The results in this example illustrate the enhancement of DNA synthesis from a 500 bp lambda target sequence by RecA+ protein.
A. The Effect of SSB protein
The reaction conditions were essentially as described in Example 7A with the following exceptions. All the reac- tions contained 0.5 μg of a 500 bp template, corresponding to nucleotides 7131-7630 of the lambda genome which had been purified from the product of a J. aguaticus DNA poly¬ merase I-catalyzed thermal amplification using lambda DNA template (Mullis) , replacing the native lambda genomic DNA. The first two reactions contained no RecA+ protein (lanes 2 and 3, Figure 10). The third reaction contained 0.66 μM final concentration RecA+ protein and no SSB protein (lane 4, Figure 10) . The fourth reaction contained 0.66 μM final concentration RecA+ protein and 0.094 μM final concentration SSB protein (lane 5, Figure 10).
The reaction mixtures were equilibrated at 37°C for 3 minutes. DNA synthesis reactions were initiated by the addition of 1 unit of exonuclease-free E. coli DNA poly¬ merase I (U.S. Biochemicals) . The reactions were main¬ tained at 37°C. Following the initial addition of polymer¬ ase, the reactions were supplemented with 1 unit of Klenow each 10 minutes for an additional 70 minutes. The time course of the reaction was 17.5 hours. Samples were trea¬ ted with proteinase K, as above, before being loaded for electrophoretic separation.
As can be seen from Figure 10, there is no DNA synthesis in the absence of RecA+ protein (lanes 2 and 3) . The 500 bp template was loaded in lane 1 as a standard. The synthesis performed in the presence of RecA+ protein (lane 4) shows a product band of comparable size to the 500 bp template. However, the synthesis performed in the presence of RecA+ protein and SSB protein appears to generate newly synthesized products smaller than the 500 bp template (lane 5) .
B. The Effects on DNA Synthesis of Each Component of the Reaction Mixture The reaction conditions were as described above in this example. The following chart summarizes the reaction conditions used.
The concentrations of these components in the reaction mix were as follows: 0.66 μM RecA+ protein; 0.094 μM SSB protein; 1 μM ATP--S; 2 μM 40-mer primers; 2 μM 25-mer primers; 0.5 μg 500 bp template; 1 unit/additions of 8 units total exonuclease-free DNA polymerase I. The reaction numbers correspond to the lane numbers shown in Figure 11.
As can be seen from the results displayed in Figure 11, DNA synthesis is most effectively enhanced under the reaction conditions given above for reaction 7; the presence of RecA+ protein and ATP-^-S. Reaction 8 contained the same components as reaction 7 with the exception that SSB protein was also included. Comparison of lanes 8 and 7 illustrates that the presence of SSB protein does not enhance the effects of RecA+ protein and ATP-p-S on DNA synthesis from a double-strand template.
C. RecA+ Enhances Specific Amplication In Single Temperature Reactions.
All the reactions contained 0.5 μg of a 500 bp template, corresponding to nucleotides 7131-7630 of the lambda genome which had been purified from the product of a T. aguaticus DNA polymerase I-catalyzed thermal amplification using lambda DNA template (Mullis) , replacing the native lambda genomic DNA. The reaction conditions were essentially as described in Example 7A with the following exceptions: reaction 1 contained ATP-p-S and lacked RecA+ and SSB pro¬ tein (lanes 1, Figure 12) ; reaction 2 contained ATP- -S and SSB protein and lacked RecA+ protein (lane 2 , Figure 12); reaction 3 contained ATP-y-S and RecA+ and lacked SSB pro¬ tein (lane 3, Figure 12); and, reaction 4 contained all of the reaction components (lane 4, Figure 12).
Single-temperature DNA synthesis reactions were performed essentially as described above in Example 7A. After 72 hours of incubation at 37°C, 16 μl aliquots from each reaction were treated with protinease K (100 μg/aliquot) for 15 minutes at 37°C and then loaded onto a 0.7% agarose gel. After electrophoretic seperation the DNA fragments were transferred by standard protocols (Maniatis et al.) onto hybridization transfer membrane (Hybond-N, Amersham) . The DNA was UV cross-linked (Stratalinker, Stratagene) to the membrane. The UV-treated transfer membrane was hybridized with 32p-end-labelled probe PCR03A: PCR03A (nucleotides 7351 through 7390 of the native lambda genome) is a 40-mer corresponding to an internal DNA sequence of the 500 base pair lambda template used in the above amplification reaction. The membrane was then autoradiographed.
Hybridization of specific radiolabeled probe to products of a Klenow single temperature RecA+ catalyzed amplifica¬ tion reaction shows that RecA+ enhanced true product synthesis. The autoradiograph (Figure 12) clearly demon- strates that significant amplification of 500 base pair product occurred only in the reaction which contained RecA+ and ATP-y-S and lacked SSB protein (Lane 3) . Example 10 Identification and Cloning of the Thermus aguaticus RecA Gene
This example describes the identification of the T. aguaticus RecA gene by Southern hybridization analysis and the subsequent cloning of the gene.
Genomic DNA was purified from T. aguaticus and was digested with the following restriction enzymes: BamHI, Hindlll, and Sstl. The digested DNA was loaded onto a 0.8% agarose gel, electrophoresed, and the DNA fragments transferred to a nitrocellulose membrane (Maniatis et al.) . As a probe, the RecA gene from Aguaspirillum magneto¬ tacticum, which has a 61.6% homology to the RecA gene of E. coli (A. Berson, M. Peters, and N. Waleh, all of SRI International, personal communication) was used; A. magne¬ totacticum has codon usage similar to T. aguaticus . The probe consisted of the sequence shown in Figure 13 plus an additional 800 bases of uncharacterized genomic A. magneto¬ tacticum DNA. The probe was radioactively labeled using nick-translation (Bethesda Research Laboratories) .
Southern hybridization was performed using standard tech¬ niques (Maniatis et al. , 1987) at 42°C in 20% fσrmamide. The hybrids were washed under stringent conditions at 55°C in 0.1 x SSC and 0.1% SDS. The autoradiogram showed only a single band for each restriction digest. The DNA bands that hybridized to the probe were 12-15 kb, 5 kb and 1.5 kb for the Bam HI, Hind III, and Sst I digests, respectively. To clone this RecA gene, the above-described -BamHI T. aguaticus genomic DNA was cloned into the EMBL Lambda cloning system (Promega) . The resulting phage vectors were plated and plaques generated. The phage DNA was trans¬ ferred to nitrocellulose filters (plaque lifting, Maniatis et al.). As described above the Aguaspirillum magnetotac¬ ticum recA gene (Figure 13) was used as a probe for the Thermus aguaticus recA gene. The nitrocellose filters were hybridized with the labeled probe. From a phage DNA- containing clone which strongly hybridized to the probe under stringent conditions of hybridization washing, a large -BamHI fragment (15kb) containing the T. aguaticus RecA gene was isolated.

Claims

IT IS CLAIMED:
1. A method of achieving amplification of a double- stranded DNA target sequence having first and second complementary strands, each strand with 5' and 3' ends, comprising:
(a) complexing a primer complementary to a 5' end region of the first strand and a primer complementary to a 5' end region of the second strand with RecA protein in the presence of ATP-K-S;
(b) reacting the complexed primers in a reaction mixture also containing the target sequence, all four dNTPs, RecA protein and DNA polymerase, said reacting performed below the temperature required for thermal dissociation of the two target strands and continued until a desired degree of amplification of the target sequence is achieved.
2. The method of claim 1, wherein the double-stranded target DNA has areas of inhibitory secondary structure.
3. The method of claim 1, wherein the double-stranded target DNA is prepared by taking a single-stranded DNA molecule and converting it to a double-stranded DNA molecule by:
(a) complexing a primer complementary to a 5' end region of the single-strand with RecA protein in the presence- of ATP-K-S;
(b) reacting the complexed primers in a reaction mixture also containing the single-stranded target sequence, all four dNTPs, and polymerase, to generate a complementary strand to the single-stranded target sequence.
4. The method of claim 3, wherein the single-stranded DNA has areas of inhibitory secondary structure.
5. The method of claim 3, where the single-stranded DNA molecule is a cDNA molecule.
6. The method of claim 1, where said reacting includes further addition of polymerase.
7. The method of claim 1, where said reacting includes further addition of RecA protein.
8. The method of claim 7, where said reacting includes further addition of ATP-K-S or a mixture of dATP and ATP-κ~ S.
9. The method of claim 1, wherein the two primers are complementary to the same DNA sequence.
10. The method of claim 1, wherein the primers include terminal 5' sequences which are non-complementary to the DNA target sequence.
11. The method of claim 10, where the non-complementary sequences include sequences coding for restriction endonu- clease recognition sites.
12. The method of claim 1, wherein the double-stranded target DNA has been physically or chemically damaged.
13. The method of claim 1, wherein the RecA protein is the protein product of the reσA-803 gene.
14. The method of claim 1, wherein the polymerase is the Klenow large fragment of E. coli DNA polymerase I and the reaction is carried out at 37°C.
15. A method of achieving synthesis and amplification of a double-stranded DNA target sequence having first and second complementary strands, each strand with 5' and 3' ends, comprising: (a) complexing a primer complementary to a 5' end region of the first strand and a primer complementary to a 5' end region of the second strand with heat-stable RecA protein in the presence of ATP-K-S;
(b) reacting the complexed primers in a reaction mixture also containing the target sequence, all four dNTPs, and a heat-stable polymerase, said reacting performed above about 50°C and below the temperature required for thermal dissoci¬ ation of. the target strands and their respective primers, and said reacting continued until a desired degree of amplification of the target sequence is achieved.
16. The method of claim 15, wherein the heat-stable RecA protein is the RecA protein of Thermus aguaticus .
17. _The method of claim 15, wherein the heat-stable DNA polymerase is DNA polymerase I of Thermus aguaticus .
18. The method of claim 17, wherein the heat-stable RecA protein is the RecA protein of Thermus aguaticus .
EP91910088A 1990-05-07 1991-04-17 Process for nucleic acid hybridization and amplification Expired - Lifetime EP0481065B1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US520321 1990-05-07
US07/520,321 US5223414A (en) 1990-05-07 1990-05-07 Process for nucleic acid hybridization and amplification
PCT/US1991/002626 WO1991017267A1 (en) 1990-05-07 1991-04-17 Process for nucleic acid hybridization and amplification

Publications (2)

Publication Number Publication Date
EP0481065A1 true EP0481065A1 (en) 1992-04-22
EP0481065B1 EP0481065B1 (en) 1996-10-16

Family

ID=24072098

Family Applications (1)

Application Number Title Priority Date Filing Date
EP91910088A Expired - Lifetime EP0481065B1 (en) 1990-05-07 1991-04-17 Process for nucleic acid hybridization and amplification

Country Status (6)

Country Link
US (1) US5223414A (en)
EP (1) EP0481065B1 (en)
JP (1) JP3010738B2 (en)
CA (1) CA2056983C (en)
DE (1) DE69122712T2 (en)
WO (1) WO1991017267A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994076A (en) * 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US6489455B2 (en) 1997-05-21 2002-12-03 Clontech Laboratories, Inc. Methods of assaying differential expression
WO2006081583A2 (en) * 2005-01-28 2006-08-03 Helicos Biosciences Corporation Methods and compositions for improving fidelity in a nucleic acid synthesis reaction

Families Citing this family (115)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK0612352T3 (en) * 1990-05-07 1997-06-30 Daikin Ind Ltd Diagnostic applications of double-D loop formation
US5510473A (en) * 1990-11-09 1996-04-23 The United States Of American As Represented By The Secretary Of Health And Human Services Cloning of the recA gene from thermus aquaticus YT-1
US5506098A (en) * 1991-09-04 1996-04-09 Daikin Industries, Ltd. In situ hybridization method
CA2131630A1 (en) * 1992-03-10 1993-09-30 Yury E. Khudyakov Exchangeable template reaction
CA2118513A1 (en) * 1992-04-24 1993-11-11 David A. Zarling In vivo homologous sequence targeting in eukaryotic cells
US20020108136A1 (en) * 1997-03-21 2002-08-08 Sri Transgenic animals produced by homologous sequence targeting
DE4216949C2 (en) * 1992-05-22 1997-07-24 Christoph Prof Dr Dr Cremer Non-enzymatic method for in situ hybridization on specific samples
US5674992A (en) * 1992-08-28 1997-10-07 Cornell Research Foundation, Inc. CDNA encoding a recA homolog in eukaryotes
US5491086A (en) * 1993-05-14 1996-02-13 Hoffmann-La Roche Inc. Purified thermostable nucleic acid polymerase and DNA coding sequences from pyrodictium species
US5965361A (en) * 1993-12-28 1999-10-12 Daikin Industries, Ltd. In-situ hybridization method using RecA protein and RecA protein having marker or ligand for use in said method
KR100230718B1 (en) * 1994-03-16 1999-11-15 다니엘 엘. 캐시앙, 헨리 엘. 노르호프 Isothermal strand displacement nucleic acid amplification
ATE272720T1 (en) 1996-08-29 2004-08-15 Napro Biotherapeutics Inc METHOD FOR FINDING, DETECTING, ENRICHMENT AND/OR ISOLATING TARGET NUCLEIC ACID SEQUENCES USING RECOMBINASE SIMILAR TO RECA
US5948653A (en) * 1997-03-21 1999-09-07 Pati; Sushma Sequence alterations using homologous recombination
EP1165760A2 (en) * 1999-03-12 2002-01-02 McGill University A method for increasing the processivity of a dna- or rna-dependent polymerase and compositions therefor
AU2001227679A1 (en) * 2000-02-25 2001-09-03 General Atomics Mutant nucleic binding enzymes and use thereof in diagnostic, detection and purification methods
US20020132350A1 (en) * 2000-09-14 2002-09-19 Pioneer Hi-Bred International, Inc. Targeted genetic manipulation using Mu bacteriophage cleaved donor complex
US20020132259A1 (en) * 2001-02-21 2002-09-19 Wagner Robert E. Mutation detection using MutS and RecA
EP1414840A4 (en) * 2001-03-27 2005-04-13 Univ Delaware Genomics applications for modified oligonucleotides
WO2002086167A1 (en) * 2001-04-20 2002-10-31 The Penn State Research Foundation Methods for nucleic acid manipulation
US7468244B2 (en) * 2001-09-27 2008-12-23 University Of Delaware Polymorphism detection and separation
US7297485B2 (en) * 2001-10-15 2007-11-20 Qiagen Gmbh Method for nucleic acid amplification that results in low amplification bias
US7244562B2 (en) * 2001-11-01 2007-07-17 Gene Check, Inc. RecA assisted detection of mutations, single nucleotide polymorphisms and specific sequences
EP1992706B1 (en) * 2002-02-21 2014-11-19 Alere San Diego, Inc. Recombinase polymerase amplification
US8030000B2 (en) 2002-02-21 2011-10-04 Alere San Diego, Inc. Recombinase polymerase amplification
US7399590B2 (en) 2002-02-21 2008-07-15 Asm Scientific, Inc. Recombinase polymerase amplification
JP4455335B2 (en) * 2002-09-17 2010-04-21 株式会社アイシン・コスモス研究所 Nucleic acid amplification method and single nucleotide polymorphism detection method
JP2004113108A (en) * 2002-09-26 2004-04-15 Aisin Seiki Co Ltd Method for collecting dna
AU2005218507A1 (en) * 2004-02-28 2005-09-15 Chang-Ning J. Wang Nucleic acid complexes
ES2718482T3 (en) 2004-06-01 2019-07-02 Alere San Diego Inc Recombinase polymerase amplification kit
JP2008501679A (en) 2004-06-02 2008-01-24 エーエスエム サイエンティフィック， インコーポレイテッド 2'-nitrobenzyl modified ribonucleotide
US7700281B2 (en) * 2004-06-30 2010-04-20 Usb Corporation Hot start nucleic acid amplification
JP4534138B2 (en) * 2004-12-21 2010-09-01 アイシン精機株式会社 Method for activating protein derived from extreme thermophile and its use in nucleic acid amplification reaction
ES2420831T3 (en) 2005-07-25 2013-08-27 Alere San Diego, Inc. Procedures for multiplexing the extension of recombinase polymerase
US20080220421A1 (en) * 2006-02-27 2008-09-11 Salinas Frank G Isothermal screening for nucleic acids associated with diseases and conditions of the gi tract
US20070202522A1 (en) * 2006-02-27 2007-08-30 Salinas Frank G Isothermal screening of tumor cell related nucleic acids
US20080003600A1 (en) * 2006-02-27 2008-01-03 Salinas Frank G Isothermal screening of breast cancer related nucleic acid
US20090061413A1 (en) * 2006-02-27 2009-03-05 Salinas Frank G Isothermal screening of hiv-1 related nucleic acids
CA2650993C (en) 2006-05-04 2015-06-16 Asm Scientific, Inc. Recombinase polymerase amplification
WO2009052214A2 (en) * 2007-10-15 2009-04-23 Complete Genomics, Inc. Sequence analysis using decorated nucleic acids
US8383345B2 (en) 2008-09-12 2013-02-26 University Of Washington Sequence tag directed subassembly of short sequencing reads into long sequencing reads
US9309566B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9334531B2 (en) 2010-12-17 2016-05-10 Life Technologies Corporation Nucleic acid amplification
US9309557B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
WO2010135310A1 (en) 2009-05-20 2010-11-25 Biosite Incorporated Dna glycosylase/lyase and ap endonuclease substrates
EP2438196B1 (en) 2009-06-05 2016-12-21 Alere San Diego, Inc. Recombinase polymerase amplification reagents and kits
US9074251B2 (en) 2011-02-10 2015-07-07 Illumina, Inc. Linking sequence reads using paired code tags
EP3147374B1 (en) 2010-12-17 2019-01-30 Life Technologies Corporation Methods for nucleic acid amplification
WO2012106546A2 (en) 2011-02-02 2012-08-09 University Of Washington Through Its Center For Commercialization Massively parallel continguity mapping
EP3978620A1 (en) 2011-04-07 2022-04-06 Abbott Diagnostics Scarborough, Inc. Monitoring recombinase polymerase amplification mixtures
EP3461910B1 (en) 2012-04-19 2020-08-26 Life Technologies Corporation Nucleic acid amplification
CN109486902B (en) 2012-04-19 2023-02-28 生命技术公司 Nucleic acid amplification
US9012022B2 (en) 2012-06-08 2015-04-21 Illumina, Inc. Polymer coatings
US8895249B2 (en) 2012-06-15 2014-11-25 Illumina, Inc. Kinetic exclusion amplification of nucleic acid libraries
EP3257952B1 (en) 2012-09-11 2020-02-12 Life Technologies Corporation Nucleic acid amplification
WO2014043143A1 (en) 2012-09-11 2014-03-20 Life Technologies Corporation Nucleic acid amplification
US9683230B2 (en) 2013-01-09 2017-06-20 Illumina Cambridge Limited Sample preparation on a solid support
US9512422B2 (en) 2013-02-26 2016-12-06 Illumina, Inc. Gel patterned surfaces
CA3160098A1 (en) 2013-03-11 2014-10-09 Cue Health Inc. Systems and methods for detection and quantification of analytes
US10545161B2 (en) 2013-03-11 2020-01-28 Cue Health Inc. Systems and methods for detection and quantification of analytes
US9623409B2 (en) 2013-03-11 2017-04-18 Cue Inc. Cartridges, kits, and methods for enhanced mixing for detection and quantification of analytes
WO2014142850A1 (en) 2013-03-13 2014-09-18 Illumina, Inc. Methods and compositions for nucleic acid sequencing
CA2931533C (en) * 2013-12-09 2023-08-08 Illumina, Inc. Methods and compositions for targeted nucleic acid sequencing
CA2932283A1 (en) 2013-12-20 2015-06-25 Illumina, Inc. Preserving genomic connectivity information in fragmented genomic dna samples
CN106103713B (en) 2014-02-03 2021-05-28 赛默飞世尔科技波罗的海封闭股份公司 Method for controlled DNA fragmentation
USD745423S1 (en) 2014-05-12 2015-12-15 Cue Inc. Automated analyzer test cartridge and sample collection device for analyte detection
CN106574305B (en) 2014-06-13 2021-03-02 生命技术公司 Multiplex nucleic acid amplification
EP3715468A1 (en) 2014-06-13 2020-09-30 Illumina Cambridge Limited Methods and compositions for preparing sequencing libraries
US10577603B2 (en) 2014-06-30 2020-03-03 Illumina, Inc. Methods and compositions using one-sided transposition
WO2016040602A1 (en) 2014-09-11 2016-03-17 Epicentre Technologies Corporation Reduced representation bisulfite sequencing using uracil n-glycosylase (ung) and endonuclease iv
CA2962941C (en) 2014-09-29 2022-06-14 Illumina Cambridge Limited Recombinase mutants
RU2736728C2 (en) 2014-10-17 2020-11-19 Иллумина Кембридж Лимитед Transposition with preservation of gene adhesion
CA2967525A1 (en) 2014-11-11 2016-05-19 Illumina Cambridge Ltd. Methods and arrays for producing and sequencing monoclonal clusters of nucleic acid
EP3234187B1 (en) 2014-12-15 2021-02-17 Illumina, Inc. Method for single molecular placement on a substrate
CN107849598B (en) 2015-05-29 2021-12-14 伊卢米纳剑桥有限公司 Enhanced utilization of surface primers in clusters
US10344336B2 (en) 2015-06-09 2019-07-09 Life Technologies Corporation Methods, systems, compositions, kits, apparatus and computer-readable media for molecular tagging
BR122020004273B1 (en) 2015-07-17 2022-11-29 Cue Health Inc SAMPLE ANALYSIS CARTRIDGE
EP3387147A1 (en) 2015-12-09 2018-10-17 Life Technologies Corporation Detection and quantification of nucleic acid molecules associated with a surface
WO2017121836A1 (en) 2016-01-15 2017-07-20 Thermo Fisher Scientific Baltics Uab Thermophilic dna polymerase mutants
ES2903045T3 (en) 2016-03-28 2022-03-30 Illumina Inc recombinase mutants
ES2861350T3 (en) 2016-03-28 2021-10-06 Illumina Inc Multi-plane microarrays
CA3016221C (en) 2016-04-07 2021-09-28 Illumina, Inc. Methods and systems for construction of normalized nucleic acid libraries
WO2017214561A1 (en) 2016-06-10 2017-12-14 Life Technologies Corporation Methods and compositions for nucleic acid amplification
WO2018018008A1 (en) 2016-07-22 2018-01-25 Oregon Health & Science University Single cell whole genome libraries and combinatorial indexing methods of making thereof
WO2018071522A1 (en) 2016-10-11 2018-04-19 Life Technologies Corporation Rapid amplification of nucleic acids
GB201704754D0 (en) 2017-01-05 2017-05-10 Illumina Inc Kinetic exclusion amplification of nucleic acid libraries
WO2018140540A1 (en) 2017-01-25 2018-08-02 Cue Health Inc. Systems and methods for enhanced detection and quantification of analytes
DK3615690T3 (en) 2017-04-23 2021-11-15 Illumina Cambridge Ltd COMPOSITIONS AND METHODS FOR IMPROVING SAMPLE IDENTIFICATION IN INDEXED NUCLEIC ACID LIBRARIES
EP3913053A1 (en) 2017-04-23 2021-11-24 Illumina Cambridge Limited Compositions and methods for improving sample identification in indexed nucleic acid libraries
ES2937929T3 (en) 2017-04-23 2023-04-03 Illumina Inc Compositions and methods to improve sample identification in indexed nucleic acid libraries
SG11201911730XA (en) 2017-06-07 2020-01-30 Univ Oregon Health & Science Single cell whole genome libraries for methylation sequencing
US11542540B2 (en) 2017-06-16 2023-01-03 Life Technologies Corporation Control nucleic acids, and compositions, kits, and uses thereof
WO2019002178A1 (en) 2017-06-26 2019-01-03 Thermo Fisher Scientific Baltics Uab Thermophilic dna polymerase mutants
EP3662482A1 (en) 2017-07-31 2020-06-10 Illumina Inc. Sequencing system with multiplexed biological sample aggregation
CN111566223B (en) 2017-11-07 2024-04-12 生命技术公司 Methods and compositions for manipulating nucleic acids
AU2019248635B2 (en) 2018-04-02 2022-01-27 Illumina, Inc. Compositions and methods for making controls for sequence-based genetic testing
CA3067435C (en) 2018-05-17 2023-09-12 Illumina, Inc. High-throughput single-cell sequencing with reduced amplification bias
MX2019015262A (en) 2018-06-04 2023-01-25 Illumina Inc High-throughput single-cell transcriptome libraries and methods of making and of using.
AU2019402925A1 (en) 2018-12-19 2021-01-14 Illumina, Inc. Methods for improving polynucleotide cluster clonality priority
JP2022522917A (en) 2019-03-01 2022-04-21 イルミナ インコーポレイテッド High-throughput single-nucleus and single-cell libraries, as well as manufacturing and usage
EP3963103B1 (en) 2019-05-03 2024-02-28 Life Technologies Corporation Methods and compositions for manipulating nucleic acids
US11905558B2 (en) 2019-08-21 2024-02-20 Life Technologies Corporation System and method for sequencing
MX2021011847A (en) 2019-12-19 2021-11-17 Illumina Inc High-throughput single-cell libraries and methods of making and of using.
BR112022019541A2 (en) 2020-03-30 2022-11-16 Illumina Inc METHODS AND COMPOSITIONS FOR PREPARING NUCLEIC ACID LIBRARIES
CN115916967A (en) 2020-05-12 2023-04-04 伊鲁米纳公司 Production of nucleic acids having modified bases using recombinant terminal deoxynucleotidyl transferases
WO2021252617A1 (en) 2020-06-09 2021-12-16 Illumina, Inc. Methods for increasing yield of sequencing libraries
JP2023532231A (en) 2020-06-30 2023-07-27 イルミナ インコーポレイテッド Sequencing by Catalytically Controlled Synthesis to Generate Unblemished DNA
US20220170093A1 (en) 2020-11-16 2022-06-02 Life Technologies Corporation System and method for sequencing
US20240117416A1 (en) 2021-01-29 2024-04-11 Illumina, Inc. Methods, compositions and kits to improve seeding efficiency of flow cells with polynucleotides
CN117222747A (en) 2021-03-22 2023-12-12 伊鲁米纳剑桥有限公司 Methods for improving clonality of nucleic acid clusters
WO2023196572A1 (en) 2022-04-07 2023-10-12 Illumina Singapore Pte. Ltd. Altered cytidine deaminases and methods of use
NL2033124B1 (en) 2022-09-23 2024-03-29 Rapidemic B V Methods and device for multiple-label nucleic acid amplification and detection
WO2024069581A1 (en) 2022-09-30 2024-04-04 Illumina Singapore Pte. Ltd. Helicase-cytidine deaminase complexes and methods of use
WO2024073043A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Methods of using cpg binding proteins in mapping modified cytosine nucleotides
WO2024073047A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Cytidine deaminases and methods of use in mapping modified cytosine nucleotides
US20240209419A1 (en) 2022-12-14 2024-06-27 Illumina, Inc. Systems and Methods for Capture and Enrichment of Clustered Beads on Flow Cell Substrates

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4713337A (en) * 1985-01-03 1987-12-15 Massachusetts Institute Of Technology Method for deletion of a gene from a bacteria
AU606043B2 (en) 1985-03-28 1991-01-31 F. Hoffmann-La Roche Ag Detection of viruses by amplification and hybridization
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4888274A (en) * 1985-09-18 1989-12-19 Yale University RecA nucleoprotein filament and methods
JPS63109800A (en) 1986-10-27 1988-05-14 Rikagaku Kenkyusho Determination of dna base sequence
EP0322311B1 (en) 1987-12-21 1994-03-23 Applied Biosystems, Inc. Method and kit for detecting a nucleic acid sequence

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9117267A1 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994076A (en) * 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US6489455B2 (en) 1997-05-21 2002-12-03 Clontech Laboratories, Inc. Methods of assaying differential expression
WO2006081583A2 (en) * 2005-01-28 2006-08-03 Helicos Biosciences Corporation Methods and compositions for improving fidelity in a nucleic acid synthesis reaction
WO2006081583A3 (en) * 2005-01-28 2006-10-19 Helicos Biosciences Corp Methods and compositions for improving fidelity in a nucleic acid synthesis reaction

Also Published As

Publication number Publication date
DE69122712D1 (en) 1996-11-21
JP3010738B2 (en) 2000-02-21
WO1991017267A1 (en) 1991-11-14
EP0481065B1 (en) 1996-10-16
CA2056983C (en) 2003-07-01
US5223414A (en) 1993-06-29
CA2056983A1 (en) 1991-11-08
DE69122712T2 (en) 1997-02-20
JPH04507198A (en) 1992-12-17

Similar Documents

Publication Publication Date Title
US5223414A (en) Process for nucleic acid hybridization and amplification
US6361940B1 (en) Compositions and methods for enhancing hybridization and priming specificity
Zoller et al. [32] Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors
JP2546576B2 (en) Nucleic acid sequence cloning method
JP2622327B2 (en) Nucleic acid sequence amplification means
EP0702728B1 (en) Magnetic cycle reaction
US6238866B1 (en) Detector for nucleic acid typing and methods of using the same
JP3514630B2 (en) Amplification and detection of nucleic acid sequences
EP0760002B1 (en) Detection of mutation by resolvase cleavage
EP1712618B1 (en) Method of amplifying nucleic acid and method of detecting mutated nucleic acid using the same
CN118291584A (en) Nuclease-based RNA depletion
CN110719957B (en) Methods and kits for targeted enrichment of nucleic acids
KR20010012175A (en) Two-step hybridization and capture of a polynucleotide
WO1993014217A1 (en) Use of predetermined nucleotides having altered base pairing characteristics in the amplification of nucleic acid molecules
WO1999036571A2 (en) Method for the detection or nucleic acid of nucleic acid sequences
JPH0467960B2 (en)
WO2009049630A1 (en) Isothermal amplification method for detection of nucleic acid mutation
EP0358737A4 (en) Genomic amplification with direct sequencing
JP2002514909A (en) Compositions and methods for enhancing hybridization specificity
EP0509089A1 (en) Compositions and methods for analyzing genomic variation
CN102424833A (en) Real-time PCR gene detection chip for multiple gene mutation sites and detection method thereof
CN111808977B (en) Design method and detection method of specific primers of resistance genes of rifampicin antibiotics caused by SNP
JPH0767646A (en) Method for amplifying nucleic acid sequence using specific rna sequence contained in sample as template
JP4453115B2 (en) Method for preparing labeled DNA
CN113454235A (en) Improved nucleic acid target enrichment and related methods

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19911129

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): DE FR GB IT NL

17Q First examination report despatched

Effective date: 19940405

GRAH Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOS IGRA

GRAH Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOS IGRA

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DAIKIN INDUSTRIES, LTD.

GRAH Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOS IGRA

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): DE FR GB IT NL

ET Fr: translation filed
REF Corresponds to:

Ref document number: 69122712

Country of ref document: DE

Date of ref document: 19961121

ITF It: translation for a ep patent filed
PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed
REG Reference to a national code

Ref country code: GB

Ref legal event code: IF02

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20080312

Year of fee payment: 18

Ref country code: DE

Payment date: 20080424

Year of fee payment: 18

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IT

Payment date: 20080428

Year of fee payment: 18

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20080415

Year of fee payment: 18

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20080423

Year of fee payment: 18

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 20090417

NLV4 Nl: lapsed or anulled due to non-payment of the annual fee

Effective date: 20091101

REG Reference to a national code

Ref country code: FR

Ref legal event code: ST

Effective date: 20091231

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20091103

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NL

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20091101

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20090417

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20091222

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20090417