EP0423252A1 - Tumour necrosis factor muteins - Google Patents

Tumour necrosis factor muteins

Info

Publication number
EP0423252A1
EP0423252A1 EP19900900837 EP90900837A EP0423252A1 EP 0423252 A1 EP0423252 A1 EP 0423252A1 EP 19900900837 EP19900900837 EP 19900900837 EP 90900837 A EP90900837 A EP 90900837A EP 0423252 A1 EP0423252 A1 EP 0423252A1
Authority
EP
European Patent Office
Prior art keywords
replaced
tnf
amino acid
val
tyr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP19900900837
Other languages
German (de)
French (fr)
Inventor
Lothar Daum
Thomas Doerper
Heinz Hillen
Achim Moeller
Klaus Schollmeier
Nigel Walker
Gerhard Keilhauer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP0423252A1 publication Critical patent/EP0423252A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/525—Tumour necrosis factor [TNF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the invention relates to new polypeptides derived from tumor necrosis factor (TNF), their production and their use as medicaments.
  • TNF tumor necrosis factor
  • TNF is one of the main participants in inflammatory reactions (Phar ac. Res. 5, 129, 1988). In the animal model, the involvement of TNF in septic shock (Science 229, 869, 1985) and graft versus host disease (J. Exp. Med. 166, 1280, 1987).
  • the invention relates to TNF polypeptides of the formula
  • At least one amino acid in positions 9, 11, 15, 26, 35, 41, 44, 46, 52, 54, 56, 57, 61, 62, 78, 87, 95, 119, 121, 133, 136, 137, 138, 139, 140, 141, 142, 144, 150, 156 and / or 157 is replaced by another natural a-amino acid and N-terminal 1 to 7 amino acids may be missing, as well as their salts with physiologically acceptable acids.
  • the invention relates to the TNF polypeptides in which at least one of the following changes is present:
  • A is an amino acid with a charged side chain
  • B is an amino acid with a polar uncharged side chain
  • C is an amino acid with a hydrophobic side chain.
  • A is Arg, His, Lys, G u or Asp
  • no more than 10 amino acids from position 9 are deleted or changed in the TNF molecule.
  • physiologically acceptable acids hydrochloric acid, citric acid, tartaric acid, lactic acid, phosphoric acid, methanesulfonic acid, acetic acid, formic acid, maleic acid, fumaric acid, malic acid, succinic acid, malonic acid, sulfuric acid, L-glutamic acid, L-aspartic acid, pyruvic acid, mucic acid, mucic acid , Glucuronic acid, oxalic acid, ascorbic acid, acetylglycine.
  • the cDNA of the human TNF is used, which is obtained according to Nature 312, 724, 1984 and incorporated into a plasmid.
  • This recombinant plasmid which contains the genetic information for carries human TNF, serves as the starting point for the production of the new TNF muteins.
  • the TNF cDNA fragment is produced purely by successive cleavage with restriction enzymes and subsequent electrophoresis using an agarose gel.
  • This fragment containing TNF gene is inserted into a polylinker of a bacteriophage vector (genes 19, 269-276).
  • oligodeoxynucleotides are chemically synthesized that are partially complementary to the TNF sequence. These oligonucleotides have an average length of 23 nucleotides. At the 5 'end is a region of about 10 nucleotides that is perfectly complementary to the TNF-coding strand. This is followed by a section of 3 nucleotides, which is not complementary and carries the desired change in the TNF gene. This section is followed by an approximately 10 nucleotide long part, which in turn is perfectly complementary to the TNF-coding strand.
  • Deletions are created using oligodeoxynucleotides that have complementarity just before and after the gene sequence to be deleted; this forms a heteroduplex in which the gene sequence to be deleted is single-stranded.
  • the oligonucleotides so constructed are hybridized with the recombinant TNF-DNA.
  • the heteroduplex is then filled up with a polymerase and deoxynucleoside triphosphates to form the complete double-stranded DNA molecule and covalently linked to the enzyme T4 DNA ligase.
  • Competent E. coli cells are transformed with this DNA molecule and the phages thus obtained are examined by in situ plaque testing (Science 196, 180, 1977).
  • the phage DNA transferred to nitrocellulose is tested with the aid of the oligonucleotide used for mutagenesis, which is radioactively labeled.
  • phages are identified by hybridization that carry the desired change in the TNF gene.
  • the mutation is confirmed by DNA sequencing.
  • the mutated TNF gene can then be extracted from the recombined TNF vector by cleavage with restriction enzymes and isolated in pure form by gel electrophoresis.
  • the TNF gene fragment must be provided with prokaryotic signals such as promoters, terminators, ribosomal binding sites (Winnacker, Gene and Clone, Verlag Chemie 1984, page 192ff).
  • An E. coli strain is then transformed with this TNF expression vector.
  • TNF mutein a TNF mutein by growing it in a suitable nutrient medium. The bacteria are then harvested and lysed. This gives a soluble mixture of E. coli proteins from which the desired TNF mutein can be isolated in pure form by known methods of protein purification, such as ammonium sulfate precipitation, ion exchange chromatography and reverse phase chromatography.
  • the new muteins show good cytotoxic properties. Another part of the muteins has a high affinity for the cellular TNF receptor without, however, having any cytotoxic activity. They therefore represent TNF antagonists. In competition with natural TNF, they bind to the cellular TNF receptor and thus suppress the TNF effect.
  • the new muteins have proven to be valuable medicaments which can be used for the treatment of neoplastic diseases and autoimmune diseases and for combating and preventing infections, inflammations and rejection reactions in transplants. Simple experiments can be used to determine the mode of action of the individual muteins. With a TNF-sensitive cell, the cytotoxicity of the mutein is determined by incubating the cell line in the presence of the mutein.
  • the cell line is incubated with the corresponding mutein in the presence of a lethal amount of TNF. This enables the TNF-antagonizing effect to be demonstrated.
  • the affinity of the mutein for the cellular TNF receptor is determined by an in vitro binding experiment.
  • the agonistic evaluation of the new muteins is based on their cytotoxic effects on TNF-sensitive cells (e.g. L929, MCF-7, A204, U937).
  • the L929 and MCF-7 test was performed as follows:
  • the L929 culture medium contained 500 ml MEM Earle Ix (Boehringer, Mannheim), 50 ml heat-inactivated (30 min, 56 ° C) fetal calf serum (FCS), 50 ml L-glutamine (200 mM), 5 ml 100x nonessential amino acids, 3 ml IM Hepes buffer pH 7.2 and 50 ml gentamycin (50 mg / ml).
  • the MCF-7 culture medium contained 500 ml MEM Dulbecco lx
  • mutein solution to be tested 100 ⁇ ⁇ of the mutein solution to be tested were added to the cell cultures and titrated twice in series.
  • some cell controls i.e. cell cultures not treated with mutein dilution
  • some rhu-TNF controls i.e. cell cultures treated with recombinant human TNF
  • the culture plate was incubated for 48 hours at 37 ° C. in an atmosphere of water vapor-saturated air with 5 vol.% CO2.
  • the percentage of surviving cells in the cultures treated with mutein dilution was determined by means of crystal violet staining.
  • the liquids were removed from the wells by knocking off the test plate. 50 ⁇ crystal violet solutions were pipetted into each well.
  • the crystal violet solution had the following composition:
  • the 50% cytotoxicity value was defined and the reciprocal of the sample dilution, which leads to 50% cytotoxicity, was determined as the cytotoxic activity of the examined sample.
  • the antagonistic evaluation of the muteins is based on their ability to compete for the cytotoxic effects of rhu-TNF on TNF-sensitive cells (e.g. L929, MCF-7, A204, U937).
  • TNF-sensitive cells e.g. L929, MCF-7, A204, U937.
  • the competition cytotoxicity test with L929 and MCF-7 cells was carried out as follows:
  • the L929 culture medium contained 500 ml of MEM Earle lx (Boehringer, Mannheim), 50 ml of FCS heat-inactivated at 56 ° C for 30 min, 5 ml of L-glutamine (200 M), 5 ml of 100x nonessential amino acids, 3 ml of IM Hepes buffer pH 7.2 and 500 ⁇ l Genta ycin (50 mg / ml).
  • the MCF-7 culture medium contained 500 ml MEM Dulbecco lx (Boehringer, Mannheim), 100 ml heat-inactivated (30 min, 56 ° C) FCS, 5 ml L-glutamine (200 mM) and 5 ml lOOx nonessential amino acids. 2. The next day, 100 ⁇ l of the mutein solution to be tested was added to the cell cultures and titrated twice in series. 100 .mu.l of a rhu-TNF dilution in culture medium, which has an 80-100% cytotoxic effect in the final concentration in the cell culture, were then added to these cell cultures.
  • the percentage of surviving cells in the solution-treated cultures was determined by crystal violet staining.
  • the liquids were removed from the wells by knocking off the test plate. 50 ⁇ l of crystal violet solutions were pipetted into each well.
  • the crystal violet solution had the composition given in II.3.
  • the crystal violet solution remained in the wells for 20 min and was then also knocked off.
  • the plates were then washed 5 times each by immersion in water in order to remove the dye which was not bound to the zeolite.
  • the cell-bound dye was extracted from the cells by adding 100 ul reagent solution (50% ethanol, 0.1% glacial acetic acid, 49.9% water) to each well.
  • the 50% competition value was defined based on the total binding and the sample concentration which, at the l25j-rhu-TNF concentration presented, leads to 50% competition of the l25j-rhu-TNF binding , determined as the competitive activity of the sample examined.
  • the starting material was the 578 bp TNF cDNA fragment which codes for amino acids 8 to 157 (Aval-Hind3 fragment).
  • This TNF cDNA subfrag ent was linked to a chemically synthesized adapter, which codes for amino acids 1 to 7, and incorporated into a suitable vector.
  • M are the complementary nucleotides to N.
  • the sequence at the 5 'end of the TNF cDNA could be influenced by varying the adapters and the amino terminus of the TNF protein could thus be changed after gene expression had taken place.
  • an adapter was obtained which, after being linked to the TNF cDNA, coded for a TNF protein in which the first 7 amino acids were deleted at the amino terminus. Furthermore, all deletions between 1 and 7 amino acids at the amino terminus of the TNF could be generated by variation of N.
  • the adapters were manufactured by fully automated chemical synthesis (Applied Biosystems 380A) and cleaned by preparative polyacrylic acid gel electrophoresis.
  • a 4.3 kb DNA molecule which was obtained from pBR322 by cleavage with Clal and Hind3, served as vector.
  • the TNF cDNA vector described above was cleaved with the restriction enzymes EcoRI and Hind3.
  • E. coli JM103 (available from Pharmacia) was transformed with this mixture. A number of plaques were isolated by punching out the culture plates and were examined for TNF cDNA insertion by DNA sequencing. The recombined phage with the coding strand of the TNF cDNA is called M13-TNF.
  • the M13-TNF described above was the starting molecule for the targeted mutagenesis of the TNF gene.
  • antisense oligonucleotides oligodeoxynucleotides which are partially complementary to the TNF-coding strand. These oligonucleotides are between 15 and 30 nucleotides in length; oligonucleotides with a length of
  • the first 10 nucleotides were perfectly complementary to the TNF-coding strand, followed by a non-complementary region which carried the intended change in the TNF gene, and then followed by a perfectly complementary region of 10 nucleotides.
  • the antisense oligonucleotide for the exchange of amino acid No. 9 serine for aspartic acid was
  • the antisense oligonucleotide for the deletion of amino acid No. 140 was aspartic acid
  • the specific activity was in the range of 5-106 cpm per pmole of oligonucleotide.
  • Hybridization of the oligonucleotides with the single-stranded DNA from M13-TNF gave a heteroduplex DNA after chain extension, in which one strand contained the mutated DNA.
  • the filters were washed at 45 ° C in 2 • SSC, 0.02% sodium dodecyl sulfate, air dried, applied to an X-ray film and exposed at -70 ° C.
  • each mutant varied in its ability to hybridize with the oligonucleotide depending on the number and type of nucleotides exchanged or deleted.
  • a phage hybridizing with the radioactively labeled sample was punched out of the bacterial culture plate and used as an inokulu to infect E. coli JM 103.
  • the single-stranded DNA was prepared from the culture supernatant, and the double-stranded DNA from the cell precipitate.
  • the single-stranded DNA was sequenced according to the dideoxy method (Proc.Natl.Acad.Sci., USA 74, 5463, 1977) to confirm the mutation. Then the gene for the TNF mutein could be isolated from the double-stranded DNA by cleavage with the restriction enzymes Clal and Hind3 and subsequent gel electrophoresis.
  • the gene for a TNF mutein produced in the above examples was linked at its 5 'end (Clal) to promoter sequences such as, for example, lac promoter or trp promoter and ribosomal binding sites.
  • promoter sequences such as, for example, lac promoter or trp promoter and ribosomal binding sites.
  • Hind3 the gene contained a transcription terminator such as the trpA terminator.
  • the gene for the TNF mutein thus provided with the necessary expression signals was converted into a vector such as e.g. pBR322 installed.
  • the E. coli strain W3110 was transformed with this vector and the clones obtained were tested for TNF mutein production.
  • the bacterial supernatant was examined in a biological test after dilution. Positive bacterial clones are grown at 37 ° C in 10 1 LB culture medium.
  • the protein precipitate was suspended in 0.2 M arginine hydrochloride pH 7.5 and dialyzed against 0.4 M arginine hydrochloride pH 7.5. After 16 h, the pH was adjusted to 8.5 with dilute NH 3 solution and diluted to 5 times the volume with water.
  • TNF proteins were thus produced by mutagenesis with the oligonucleotides listed in Table 1 in the order given (the positions indicate the position in the TNF which has been changed):

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Des polypeptides du facteur de nécrose de tumeurs se distinguent du facteur naturel de nécrose de tumeurs par le remplacement et/ou la délétion d'acides aminés. Ces nouveaux polypeptides sont utiles pour traiter des maladies.Tumor necrosis factor polypeptides are distinguished from the natural tumor necrosis factor by the replacement and / or deletion of amino acids. These new polypeptides are useful for treating diseases.

Description

TUMOR NEKROSE FAKTOR MUTEINE Beschreibung TUMOR NECROSE FACTOR MUTEINE Description
Die Erfindung betrifft neue, vom Tumor Nekrose Faktor (TNF) abgeleitete Polypeptide, deren Herstellung und deren Verwendung als Arzneimittel.The invention relates to new polypeptides derived from tumor necrosis factor (TNF), their production and their use as medicaments.
Von Carswell et a . (Proc. Nat . Acad. Sei. USA 72, 3666, 1975) wurde be¬ richtet, daß das Serum von Endotoxin-behandelten Tieren, die zuvor mit dem Mycobacterien-Stam Calmette-Guerin (BCG) infiziert worden waren, eine hämorrhagische Nekrose bei verschiedenen Tumoren in der Maus bewirkte. Diese Aktivität wurde dem Tumor Nekrose Faktor zugeschrieben. TNF zeigt auch eine zytostatische oder zytotoxische Wirkung gegenüber einer Vielzahl von transformierten Zellinien in vitro, während normale menschliche und tierische Zellinien davon nicht betroffen werden ( ymphokine Reports Vol. 2, pp 235-275, Academic Press, New York, 1981). Kürzlich wurde die biochemische Charakterisierung und das Gen für menschlichen TNF beschrie¬ ben (Nature 312, 724, 1984; 3. Biol. Chem. 260, 2345, 1985; Nucl. Acids Res. 13, 6361, 1985).By Carswell et a. (Proc. Nat. Acad. Sci. USA 72, 3666, 1975) it was reported that the serum of endotoxin-treated animals which had previously been infected with the Mycobacteria-Stam Calmette-Guerin (BCG) had hemorrhagic necrosis in various tumors in the mouse. This activity was attributed to the tumor necrosis factor. TNF also shows cytostatic or cytotoxic activity against a variety of transformed cell lines in vitro, whereas normal human and animal cell lines are not affected (ymphokine Reports Vol. 2, pp 235-275, Academic Press, New York, 1981). Biochemical characterization and the gene for human TNF have recently been described (Nature 312, 724, 1984; 3rd Biol. Chem. 260, 2345, 1985; Nucl. Acids Res. 13, 6361, 1985).
Aus diesen Daten läßt sich folgende Proteinstruktur für das reife humane TNF ableiten:The following protein structure for mature human TNF can be derived from these data:
ValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnProValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnPro
GlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGlyGlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGly
ValGlu euArgAspAsnGln euValValProSerGluGlyLeuTyrLeuIleTyrSerValGlu euArgAspAsnGln euValValProSerGluGlyLeuTyrLeuIleTyrSer
GlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlleGlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlle
SerArglleAlaValSerTyrGlnThrLysValAsnLeu euSerAlalle ysSerProSerArglleAlaValSerTyrGlnThrLysValAsnLeu euSerAlalle ysSerPro
CysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeuCysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeu
GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAspGlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAsp
TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeuTyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu
Weiterhin wurde das TNF-Gen von Rind, Kaninchen und Maus beschrieben (Cold Spring Harbor Symp. Quant. Biol. 51, 597, 1986).Furthermore, the TNF gene of cattle, rabbits and mice has been described (Cold Spring Harbor Symp. Quant. Biol. 51, 597, 1986).
Neben seinen zytotoxischen Eigenschaften ist TNF einer der Hauptbeteilig¬ ten an entzündlichen Reaktionen (Phar ac. Res. 5, 129, 1988). Im Tier¬ modell konnte die Beteiligung von TNF beim septischen Schock (Science 229, 869, 1985) und der Graft versus Host Disease (J. Exp. Med. 166, 1280, 1987) gezeigt werden.In addition to its cytotoxic properties, TNF is one of the main participants in inflammatory reactions (Phar ac. Res. 5, 129, 1988). In the animal model, the involvement of TNF in septic shock (Science 229, 869, 1985) and graft versus host disease (J. Exp. Med. 166, 1280, 1987).
Es wurde nun gefunden, daß bestimmte Polypeptide, die sich vom TNF ableiten, günstigere Eigenschaften besitzen.It has now been found that certain polypeptides derived from the TNF have more favorable properties.
Gegenstand der Erfindung sind TNF-Polypeptide der FormelThe invention relates to TNF polypeptides of the formula
ValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnProValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnPro
GlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGlyGlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGly
ValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSerValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSer
GlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlleGlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlle
SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerProSerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro
CysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeuCysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeu
GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAspGlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAsp
TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu,TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu,
worin jedoch mindestens eine Aminosäure in den Positionen 9, 11, 15, 26, 35, 41, 44, 46, 52, 54, 56, 57, 61, 62, 78, 87, 95, 119, 121, 133, 136, 137, 138, 139, 140, 141, 142, 144, 150, 156 und/oder 157 durch eine andere natürliche a-Aminosäure ersetzt ist und N-terminal 1 bis 7 Aminosäuren fehlen können, sowie deren Salze mit physiologisch verträglichen Säuren.where, however, at least one amino acid in positions 9, 11, 15, 26, 35, 41, 44, 46, 52, 54, 56, 57, 61, 62, 78, 87, 95, 119, 121, 133, 136, 137, 138, 139, 140, 141, 142, 144, 150, 156 and / or 157 is replaced by another natural a-amino acid and N-terminal 1 to 7 amino acids may be missing, as well as their salts with physiologically acceptable acids.
Insbesondere sind Gegenstand der Erfindung die TNF-Polypeptide, in denen mindestens eine der folgenden Veränderungen vorliegt:In particular, the invention relates to the TNF polypeptides in which at least one of the following changes is present:
Leu ersetzt durch C Leu replaced by C
Gin ersetzt durch CGin replaced by C
Val ersetzt durch A oder CVal replaced by A or C
His ersetzt durch C oder BHis replaced by C or B
Tyr ersetzt durch CTyr replaced by C
Ser ersetzt durch CSer replaced by C
Tyr ersetzt durch C oder ATyr replaced by C or A
Gly ersetzt durch CGly replaced by C
Ser ersetzt durch C Ile ersetzt durch CSer replaced by C Ile replaced by C
Asn ersetzt durch AAsn replaced by A
Arg ersetzt durch A, B oder CArg replaced by A, B or C.
Pro ersetzt durch A, C oder BPro replaced by A, C or B
Asp ersetzt durch A oder C Tyr ersetzt durch AAsp replaced by A or C Tyr replaced by A
Leu ersetzt durch CLeu replaced by C
Phe ersetzt durch C oder APhe replaced by C or A
Val ersetzt durch A oder CVal replaced by A or C
Ala ersetzt durch C Leu ersetzt durch B,Ala replaced by C Leu replaced by B,
worin A eine Aminosäure mit geladener Seitenkette, B eine Aminosäure mit polarer ungeladener Seitenkette und C eine Aminosäure mit hydrophober Seitenkette bedeuten. A ist also Arg, His, Lys, G u oder Asp; B Gin, Asn, Gly, Met, Cys, Ser oder Thr und C Phe, Leu, Ile, Trp, Tyr, Pro, Val oder Ala.wherein A is an amino acid with a charged side chain, B is an amino acid with a polar uncharged side chain and C is an amino acid with a hydrophobic side chain. So A is Arg, His, Lys, G u or Asp; B Gin, Asn, Gly, Met, Cys, Ser or Thr and C Phe, Leu, Ile, Trp, Tyr, Pro, Val or Ala.
Vorzugsweise sind in dem TNF-Molekül nicht mehr als 10 Aminosäuren ab Position 9 deletiert oder verändert.Preferably, no more than 10 amino acids from position 9 are deleted or changed in the TNF molecule.
Als physiologisch verträgliche Säuren sind insbesondere zu nennen: Salzsäure, Zitronensäure, Weinsäure, Milchsäure, Phosphorsäure, Methansulfonsäure, Essigsäure, Ameisensäure, Maleinsäure, Fumarsäure, Äpfelsäure, Bernsteinsäure, Malonsäure, Schwefelsäure, L-Glutaminsäure, L-Asparaginsäure, Brenztraubensäure, Schleimsäure, Benzoesäure, Glucuronsäure, Oxalsäure, Ascorbinsäure, Acetylglycin.In particular, the following can be mentioned as physiologically acceptable acids: hydrochloric acid, citric acid, tartaric acid, lactic acid, phosphoric acid, methanesulfonic acid, acetic acid, formic acid, maleic acid, fumaric acid, malic acid, succinic acid, malonic acid, sulfuric acid, L-glutamic acid, L-aspartic acid, pyruvic acid, mucic acid, mucic acid , Glucuronic acid, oxalic acid, ascorbic acid, acetylglycine.
Zur Herstellung der neuen Polypeptide geht man von der cDNA des humanen TNFs aus, die man gemäß Nature 312, 724, 1984 erhält und in ein Plasmid einbaut. Dieses rekombinante Plasmid, das die genetische Information für humanes TNF trägt, dient als Ausgangspunkt für die Herstellung der neuen TNF-Muteine.For the production of the new polypeptides, the cDNA of the human TNF is used, which is obtained according to Nature 312, 724, 1984 and incorporated into a plasmid. This recombinant plasmid, which contains the genetic information for carries human TNF, serves as the starting point for the production of the new TNF muteins.
Um die beabsichtigten Veränderungen in das Gen für den humanen TNF gezielt einzuführen, wird das TNF-cDNA-Fragment durch aufeinanderfolgende Spaltung mit Restriktionsenzymen und anschl eßende Elektrophorese durch ein Agarosegel rein hergestellt. Dieses TNF-Gen enthaltende Fragment wird in einen Polylinker eines Bakteriophagenvektors eingebaut (Gene 19,269-276).In order to introduce the intended changes into the gene for the human TNF in a targeted manner, the TNF cDNA fragment is produced purely by successive cleavage with restriction enzymes and subsequent electrophoresis using an agarose gel. This fragment containing TNF gene is inserted into a polylinker of a bacteriophage vector (genes 19, 269-276).
Durch Transformation von E.coli mit diesem rekombinanten Vektor werden schließlich Phagen erhalten, die den codierenden Strang des humanen TNF-Gens tragen.By transforming E. coli with this recombinant vector, phages are finally obtained which carry the coding strand of the human TNF gene.
Zur gezielten Mutagenese des TNF-Gens werden Oligodesoxynukleotide chemisch synthetisiert, die partiell komplementär zur TNF-Sequenz sind. Diese Oligonukleotide besitzen eine durchschnittliche Länge von 23 Nukleotiden. Am 5'-Ende ist ein Bereich von etwa 10 Nukleotiden, der perfekt komplementär zum TNF-codierenden Strang ist. Anschließend folgt ein Abschnitt von 3 Nukleotiden, der nicht komplementär ist und die gewünschte Veränderung des TNF-Gens trägt. An diesen Abschnitt schließt sich ein etwa 10 Nukleotide langer Teil an, der wiederum perfekt komplementär zum TNF-codierenden Strang ist.For targeted mutagenesis of the TNF gene, oligodeoxynucleotides are chemically synthesized that are partially complementary to the TNF sequence. These oligonucleotides have an average length of 23 nucleotides. At the 5 'end is a region of about 10 nucleotides that is perfectly complementary to the TNF-coding strand. This is followed by a section of 3 nucleotides, which is not complementary and carries the desired change in the TNF gene. This section is followed by an approximately 10 nucleotide long part, which in turn is perfectly complementary to the TNF-coding strand.
Deletionen werden erzeugt, indem man Oligodesoxynukleotide verwendet, die genau vor und hinter der zu deletierenden Gensequenz Ko plementarität besitzen; dadurch wird ein Heteroduplex gebildet, in dem die zu deletierende Gensequenz einzelsträngig vorliegt.Deletions are created using oligodeoxynucleotides that have complementarity just before and after the gene sequence to be deleted; this forms a heteroduplex in which the gene sequence to be deleted is single-stranded.
Die so konstruierten Oligonukleotide werden mit der rekombinanten TNF-DNA hybridisiert. Anschließend wird mit einer Polymerase und Desoxynukleosid- triphosphaten der Heteroduplex zum vollständigen doppelsträngigen DNA-Molekül aufgefüllt und mit dem Enzym T4 DNA-Ligase kovalent verknüpft.The oligonucleotides so constructed are hybridized with the recombinant TNF-DNA. The heteroduplex is then filled up with a polymerase and deoxynucleoside triphosphates to form the complete double-stranded DNA molecule and covalently linked to the enzyme T4 DNA ligase.
Mit diesem DNA-Molekül werden kompetente E.coli Zellen transformiert und die so erhaltenen Phagen werden durch in situ Plaque-Testung untersucht (Science 196,180, 1977).Competent E. coli cells are transformed with this DNA molecule and the phages thus obtained are examined by in situ plaque testing (Science 196, 180, 1977).
Dazu wird die auf Nitrocellulose überführte Phagen-DNA mit Hilfe des zur Mutagenese verwendeten Oligonukleotids, das radioaktiv markiert ist, durchgetestet.For this purpose, the phage DNA transferred to nitrocellulose is tested with the aid of the oligonucleotide used for mutagenesis, which is radioactively labeled.
Unter hochstringeπten Bedingungen werden diejenigen Phagen durch Hybridisierung identifiziert, die die gewünschte Veränderung im TNF-Gen tragen. Die Bestätigung der Mutation erfolgt durch DNA-Sequenzierung. Anschließend kann das mutierte TNF-Gen mittels Spaltung mit Restriktions¬ enzymen aus dem rekombinierten TNF-Vektor herausgelöst und mittels Gelelektrophorese in reiner Form isoliert werden. Zur Expression dieses veränderten TNF-Gens in E.coli muß das TNF-Genfrag ent mit prokaryonti- sehen Signalen wie Promotoren, Terminatoren, ribosomalen Bindungsstellen versehen werden (Winnacker, Gene und Clone, Verlag Chemie 1984, Seite 192ff). Anschließend wird mit diesem TNF-Expressionsvektor ein E.coli- Stamm transformiert. Der so erhaltene rekombinante E.coli-Stamm wird zur Produktion eines TNF-Muteins verwendet, indem man ihn in einem geeigneten Nährmedium züchtet. Danach werden die Bakterien geerntet und lysiert. So erhält man ein lösliches Gemisch aus E.coli-Proteinen, aus dem das gewünschte TNF-Mutein durch bekannte Methoden der Proteinreinigung wie Am oniumsulfatpräzipitation, Ionenaustauschchromatographie und Umkehr¬ phasenchromatographie in reiner Form isoliert werden kann.Under highly stringent conditions, those phages are identified by hybridization that carry the desired change in the TNF gene. The mutation is confirmed by DNA sequencing. The mutated TNF gene can then be extracted from the recombined TNF vector by cleavage with restriction enzymes and isolated in pure form by gel electrophoresis. To express this modified TNF gene in E. coli, the TNF gene fragment must be provided with prokaryotic signals such as promoters, terminators, ribosomal binding sites (Winnacker, Gene and Clone, Verlag Chemie 1984, page 192ff). An E. coli strain is then transformed with this TNF expression vector. The recombinant E. coli strain thus obtained is used to produce a TNF mutein by growing it in a suitable nutrient medium. The bacteria are then harvested and lysed. This gives a soluble mixture of E. coli proteins from which the desired TNF mutein can be isolated in pure form by known methods of protein purification, such as ammonium sulfate precipitation, ion exchange chromatography and reverse phase chromatography.
Die neuen Muteine zeigen zum Teil gute zytotoxische Eigenschaften. Ein anderer Teil der Muteine besitzt eine hohe Affinität für den zellulären TNF-Rezeptor, ohne jedoch eine zytotoxische Aktivität zu besitzen. Sie stellen also TNF-Antagonisten dar. Sie binden in Konkurrenz zu natürlichem TNF an den zellulären TNF-Rezeptor und unterdrücken so .die TNF-Wirkung. Die neuen Muteine erweisen sich als wertvolle Arzneimittel, die zur Be¬ handlung von neoplastischen Erkrankungen und Autoimmunerkrankungen sowie zur Bekämpfung und Prophylaxe von Infektionen, Entzündungen und Abstoßungsreaktionen bei Transplantationen eingesetzt werden können. Durch einfache Experimente kann geklärt werden, welche Wirkungsweise die einzelnen Muteine besitzen. Mit einer TNF-sensitiven Zelle wird die Zytotoxizität des Muteins durch Inkubation der Zellinie in Gegenwart des Muteins bestimmt. In einem zweiten Versuchsansatz inkubiert man die Zellinie mit dem entsprechenden Mutein in Gegenwart einer letal wirkenden TNF-Menge. Dadurch kann die TNF-antagonisierende Wirkung nachgewiesen werden. Außerdem wird durch ein in vitro Bindungsexperiment die Affinität des Muteins zum zellulären TNF-Rezeptor bestimmt.Some of the new muteins show good cytotoxic properties. Another part of the muteins has a high affinity for the cellular TNF receptor without, however, having any cytotoxic activity. They therefore represent TNF antagonists. In competition with natural TNF, they bind to the cellular TNF receptor and thus suppress the TNF effect. The new muteins have proven to be valuable medicaments which can be used for the treatment of neoplastic diseases and autoimmune diseases and for combating and preventing infections, inflammations and rejection reactions in transplants. Simple experiments can be used to determine the mode of action of the individual muteins. With a TNF-sensitive cell, the cytotoxicity of the mutein is determined by incubating the cell line in the presence of the mutein. In a second experiment, the cell line is incubated with the corresponding mutein in the presence of a lethal amount of TNF. This enables the TNF-antagonizing effect to be demonstrated. In addition, the affinity of the mutein for the cellular TNF receptor is determined by an in vitro binding experiment.
Die biologische Charakterisierung der neuen Muteine auf ihre agonistische oder antagonistische Wirkung erfolgte in folgenden Testsystemen:The biological characterization of the new muteins for their agonistic or antagonistic effects was carried out in the following test systems:
I. Zytotoxizitätstest auf TNF-sensitiven Indikatorzellen,I. cytotoxicity test on TNF-sensitive indicator cells,
II. Kompetition-Zytotoxizitätstest auf TNF-sensitiven Indikatorzellen,II. Competition cytotoxicity test on TNF-sensitive indicator cells,
III. Kompetition-Rezeptorbindungstest auf TNF-Rezeptor exprimierenden Indikatorzellen. I. ZytotoxizitätstestIII. Competition receptor binding test on TNF receptor expressing indicator cells. I. Cytotoxicity test
Die agonistische Bewertung der neuen Muteine basiert auf deren zytotoxischer Wirkung auf TNF-sensitiven Zellen (z.B. L929, MCF-7, A204, U937). Der Test mit L929 und MCF-7 wurde wie folgt durchgeführt:The agonistic evaluation of the new muteins is based on their cytotoxic effects on TNF-sensitive cells (e.g. L929, MCF-7, A204, U937). The L929 and MCF-7 test was performed as follows:
1. 100 μ\ Kulturmedium mit 3 bis 5 x 103 frisch trypsinierten, sich im exponentiellen Wachstum befindenden L929-Zellen (Maus) bzw. MCF-7-Zellen (Mensch) wurden in die Vertiefungen einer 96-Loch-Flachboden-Kulturplatte pipettiert. Die Platte wurde über Nacht bei 37°C im Brutschrank inkubiert. Die mit Wasserdampf gesättigte Luft im Brutschrank enthielt 5 Vol% C02.1. 100 μ \ culture medium with 3 to 5 × 103 freshly trypsinized, exponentially growing L929 cells (mouse) or MCF-7 cells (human) were pipetted into the wells of a 96-well flat-bottom culture plate. The plate was incubated overnight at 37 ° C in the incubator. The air saturated with water vapor in the incubator contained 5 vol% CO 2 .
Das L929-Kulturmedium enthielt 500 ml MEM Earle Ix (Boehringer, Mannheim), 50 ml hitzeinaktiviertes (30 min, 56°C) foetales Kälberserum (FCS), 50 ml L-Glutamin (200 mM), 5 ml lOOx nichtessentielle Aminosäuren, 3 ml IM Hepes-Puffer pH 7,2 und 50 ml Gentamycin (50 mg/ml).The L929 culture medium contained 500 ml MEM Earle Ix (Boehringer, Mannheim), 50 ml heat-inactivated (30 min, 56 ° C) fetal calf serum (FCS), 50 ml L-glutamine (200 mM), 5 ml 100x nonessential amino acids, 3 ml IM Hepes buffer pH 7.2 and 50 ml gentamycin (50 mg / ml).
Das MCF-7-Kulturmedium enthielt 500 ml MEM Dulbecco lxThe MCF-7 culture medium contained 500 ml MEM Dulbecco lx
(Boehringer, Mannheim), 100 ml hitzeinaktiviertes (30 min, 56°C) FCS, 5 ml L-Glutamin und 5 ml lOOx nichtessentielle Aminosäuren.(Boehringer, Mannheim), 100 ml heat-inactivated (30 min, 56 ° C) FCS, 5 ml L-glutamine and 5 ml 100x nonessential amino acids.
2. Am folgenden Tag wurden 100 μ\ der zu prüfenden Mutein-Lösung zu den Zellkulturen gegeben und seriell 2-fach titriert. Zusätzlich wurden einige Zellkontrollen (d.h. nicht mit Mutein-Verdünnung behandelte Zellkulturen) und einige rhu-TNF-Kontrollen (d.h. mit rekombinanten humanen TNF behandelte Zellkulturen) mit angelegt. Die Kulturplatte wurde 48 h bei 37°C in einer Atmosphäre aus wasserdampf-gesättigter Luft mit 5 Vol.% CO2 inkubiert.2. The following day, 100 μ \ of the mutein solution to be tested were added to the cell cultures and titrated twice in series. In addition, some cell controls (i.e. cell cultures not treated with mutein dilution) and some rhu-TNF controls (i.e. cell cultures treated with recombinant human TNF) were included. The culture plate was incubated for 48 hours at 37 ° C. in an atmosphere of water vapor-saturated air with 5 vol.% CO2.
3. Der Prozentsatz überlebender Zellen in den mit Mutein-Verdünnung behandelten Kulturen wurde mittels der Kristallviolettfärbung bestimmt. Dazu wurden die Flüssigkeiten aus den Vertiefungen durch Abschlagen der Testplatte entfernt. In jede Vertiefung wurden 50 μϊ Kristallviolettlösungen pipettiert.3. The percentage of surviving cells in the cultures treated with mutein dilution was determined by means of crystal violet staining. The liquids were removed from the wells by knocking off the test plate. 50 μϊ crystal violet solutions were pipetted into each well.
Die Kristallviolettlösung hatte folgende Zusammensetzung:The crystal violet solution had the following composition:
3,75 g Kristallvϊolett3.75 g crystal violet
1,75 g NaCl 161,5 ml Ethanol 43,2 ml 37 % Formaldehyd ad 500 ml Wasser Die Kristallviolettlösung blieb 20 min in den Vertiefungen und wurde dann ebenfalls abgeschlagen. Anschließend wurden die Platten jeweils 5 mal durch Eintauchen in Wasser gewaschen, um den nicht zellgebundenen Farbstoff zu entfernen. Der zellge- bundene Farbstoff wurde durch Zugabe von 100 μl Reagenzlösung1.75 g NaCl 161.5 ml ethanol 43.2 ml 37% formaldehyde ad 500 ml water The crystal violet solution remained in the wells for 20 min and was then also knocked off. The plates were then washed 5 times each by immersion in water to remove the non-cell-bound dye. The cell-bound dye was removed by adding 100 μl of reagent solution
(50 % Ethanol, 0,1 % Eisessig, 49,9 % Wasser) in jede Vertiefung aus den Zellen extrahiert.(50% ethanol, 0.1% glacial acetic acid, 49.9% water) in each well extracted from the cells.
4. Durch Schütteln der Platten für 5 min erhielt man in jeder Vertiefung eine gleichmäßig gefärbte Lösung. Zur Bestimmung der überlebenden Zellen wurde die Extinktion der Färbelösung in den einzelnen Vertiefungen bei 540 nm gemessen.4. Shaking the plates for 5 minutes gave a uniformly colored solution in each well. To determine the surviving cells, the absorbance of the staining solution in the individual wells was measured at 540 nm.
5. Danach wurde, bezogen auf die Zellkontrolle, der 50 % Zytotoxi- zitätswert definiert und der Kehrwert der Probenverdünnung, die zu 50 % Zytotoxizität führt, als zytotoxische Aktivität der untersuchten Probe ermittelt.5. Then, based on the cell control, the 50% cytotoxicity value was defined and the reciprocal of the sample dilution, which leads to 50% cytotoxicity, was determined as the cytotoxic activity of the examined sample.
Kompetition-ZytotoxizitätstestCompetition cytotoxicity test
Die antagonistische Bewertung der Muteine basiert auf deren Eigenschaft, die zytotoxische Wirkung von rhu-TNF auf TNF-sensitiven Zellen (z.B. L929, MCF-7, A204, U937) zu kompetitieren. Der Kompetition-Zytotoxitätstest mit L929 und MCF-7-Zellen wurde wie folgt durchgeführt:The antagonistic evaluation of the muteins is based on their ability to compete for the cytotoxic effects of rhu-TNF on TNF-sensitive cells (e.g. L929, MCF-7, A204, U937). The competition cytotoxicity test with L929 and MCF-7 cells was carried out as follows:
1. 100 μ\ Kulturmedium mit 3 bis 5 x 103 frisch trypsinierten, sich im exponentiellem Wachstum befindenden L929-Zellen (Maus) bzw. MCF-7-Zellen (Mensch) wurden in die Vertiefungen einer 96-Loch-Flachboden-Kulturplatte pipettiert. Die Platte wurde über Nacht bei 37°C im Brutschrank inkubiert. Die mit Wasserdampf gesättigte Luft im Brutschrank enthielt 5 Vol% C02.1. 100 μ \ culture medium with 3 to 5 x 103 freshly trypsinized, exponentially growing L929 cells (mouse) or MCF-7 cells (human) were pipetted into the wells of a 96-well flat-bottom culture plate. The plate was incubated overnight at 37 ° C in the incubator. The air saturated with water vapor in the incubator contained 5 vol% CO 2 .
Das L929-Kulturmedium enthielt 500 ml MEM Earle lx (Boehringer, Mannheim), 50 ml für 30 min bei 56°C hitzeinaktiviertes FCS, 5 ml L-Glutamin (200 M), 5 ml lOOx nichtessentielle Aminosäuren, 3 ml IM Hepes-Puffer pH 7,2 und 500 μl Genta ycin (50 mg/ml).The L929 culture medium contained 500 ml of MEM Earle lx (Boehringer, Mannheim), 50 ml of FCS heat-inactivated at 56 ° C for 30 min, 5 ml of L-glutamine (200 M), 5 ml of 100x nonessential amino acids, 3 ml of IM Hepes buffer pH 7.2 and 500 µl Genta ycin (50 mg / ml).
Das MCF-7-Kulturmedium enthielt 500 ml MEM Dulbecco lx (Boehringer, Mannheim), 100 ml hitzeinaktiviertes (30 min, 56°C) FCS, 5 ml L-Glutamin (200 mM) und 5 ml lOOx nichtessentielle Aminosäuren. 2. Am nächsten Tag wurden 100 μl der zu prüfenden Mutein-Lösung zu den Zellkulturen zugegeben und seriell 2-fach titriert. Zu diesen Zellkulturen wurden dann 100 μl einer rhu-TNF-Verdünnung in Kulturmedium, die in der Endkonzentration in der Zellkultur eine 80-100 % zytotoxische Wirkung hat, zugegeben. Zudem wurden einige ZelIkontrollen (d.h. nicht mit Mutein-Lösung und nicht mit rhu-TNF-Lösung behandelte Zellkulturen) und einige rhu-TNF-Kontrollen (=nur mit rhu-TNF-Lösung behandelte Zellkulturen) mit angelegt. Die Kulturplatte wurde dann 48 h bei 37°C in einer Atmosphäre aus asserdampf-gesättigter Luft mit 5 Vol.% CO2 inkubiert.The MCF-7 culture medium contained 500 ml MEM Dulbecco lx (Boehringer, Mannheim), 100 ml heat-inactivated (30 min, 56 ° C) FCS, 5 ml L-glutamine (200 mM) and 5 ml lOOx nonessential amino acids. 2. The next day, 100 μl of the mutein solution to be tested was added to the cell cultures and titrated twice in series. 100 .mu.l of a rhu-TNF dilution in culture medium, which has an 80-100% cytotoxic effect in the final concentration in the cell culture, were then added to these cell cultures. In addition, some cell controls (ie cell cultures not treated with mutein solution and not with rhu-TNF solution) and some rhu-TNF controls (= cell cultures treated only with rhu-TNF solution) were also created. The culture plate was then incubated for 48 hours at 37 ° C. in an atmosphere of air saturated with water vapor with 5 vol.% CO2.
3. Der Prozentsatz überlebender Zellen in den mit Substanzlösung behandelten Kulturen wurde mittels der Kristallviolettfärbung bestimmt. Dazu wurden die Flüssigkeiten aus den Vertiefungen durch Abschlagen der Testplatte entfernt. In jede Vertiefung wurden 50 μl Kristallviolettlösungen pipettiert.3. The percentage of surviving cells in the solution-treated cultures was determined by crystal violet staining. The liquids were removed from the wells by knocking off the test plate. 50 μl of crystal violet solutions were pipetted into each well.
Die Kristallviolettlösung hatte die in II.3 angegebene Zusammensetzung.The crystal violet solution had the composition given in II.3.
Die Kristallviolettlösung blieb 20 min in den Vertiefungen und wurde dann ebenfalls abgeschlagen. Anschließend wurden die Platten jeweils 5 mal durch Eintauchen in Wasser gewaschen, um den nicht ze11gebundenen Farbstoff zu entfernen. Der zellgebundene Farbstoff wurde durch Zugabe von 100 μl Reagenzlösung (50 % Ethanol, 0, 1 % Eisessig, 49,9 % Wasser) in jede Vertiefung aus den Zellen extrahiert.The crystal violet solution remained in the wells for 20 min and was then also knocked off. The plates were then washed 5 times each by immersion in water in order to remove the dye which was not bound to the zeolite. The cell-bound dye was extracted from the cells by adding 100 ul reagent solution (50% ethanol, 0.1% glacial acetic acid, 49.9% water) to each well.
4. Durch Schütteln der Platten für 5 min erhielt man in jeder4. By shaking the plates for 5 min each was obtained
Vertiefung eine gleichmäßig gefärbte Lösung. Zur Bestimmung der überlebenden Zellen wurde die Extinktion der Färbelösung in den einzelnen Vertiefungen bei 540 nm gemessen.Deepen an evenly colored solution. To determine the surviving cells, the absorbance of the staining solution in the individual wells was measured at 540 nm.
5. Danach wurde, bezogen auf die Zellkontrolle und die rhu-TNF-Kontrolle der 50 % Kompetitionswert definiert und die Probenkonzentration, die bei der vorgelegten rhu-TNF-Konzen- tration zu 50 % Kompetition der rhu-TNF-Zytotoxität führt, als antagonistische Aktivität der untersuchten Probe ermittelt.5. Then, based on the cell control and the rhu-TNF control, the 50% competition value was defined and the sample concentration, which leads to 50% competition of the rhu-TNF cytotoxicity at the rhu-TNF concentration presented, as antagonistic Activity of the examined sample determined.
III.Ko petition-RezeptorbindungstestIII.Co petition receptor binding test
Sowohl die agonistische als auch die antagonistische Wirkung von Muteinen setzt voraus, daß letztere an den TNF-Rezeptor binden. Das bedeutet, daß Muteine mit agonistischer bzw. antagonistischer Wirkung und rhu-TNF um die Bindung am TNF-Rezeptor auf TNF-sensitiven Indikatorzellen (z.B. U937) konkurrieren. Der Kompetition-Rezeptor- bindungstest wurde wie folgt durchgeführt:Both the agonistic and the antagonistic effects of muteins require that the latter bind to the TNF receptor. The means that muteins with agonistic or antagonistic activity and rhu-TNF compete for binding to the TNF receptor on TNF-sensitive indicator cells (eg U937). The competition receptor binding test was carried out as follows:
1. 100 μl Medium mit verschiedenen Konzentrationen des zu prüfenden Muteins sowie des rhu-TNF (=Kontrolle) wurden in die Reaktions¬ gefäße pipettiert. Das Medium enthielt 500 ml PBS (Boehringer, Mannheim), 10 ml hitzeinaktiviertes (30 min, 56°C) FCS und 100 mg Natriumazid.1. 100 μl of medium with different concentrations of the mutein to be tested and of the rhu-TNF (= control) were pipetted into the reaction vessels. The medium contained 500 ml PBS (Boehringer, Mannheim), 10 ml heat-inactivated (30 min, 56 ° C) FCS and 100 mg sodium azide.
2. Anschließend wurden 100 μl Medium mit 1 ng l25 od-markiertem rhu-TNF (Lactoperoxidase-Methode nach Bolton) in die Reaktions¬ gefäße gegeben und gemischt. Zur Bestimmung der unspezifischen Bindung (NSB) wurde in den Reaktionsgefäßen das l25jod-markierte rhu-TNF (1 ng l25j-rhu-TNF in 100 μl Medium) mit dem 200-fachen Überschuß an nicht radioaktiv markiertem rhu-TNF (200 ng rhu-TNF in 100 μl Medium) gemischt.2. 100 .mu.l of medium with 1 ng l25 od-labeled rhu-TNF (lactoperoxidase method according to Bolton) were then added to the reaction vessels and mixed. To determine the non-specific binding (NSB), the l25 iodine-labeled rhu-TNF (1 ng l25j- r hu-TNF in 100 μl medium) was mixed with the 200-fold excess of non-radioactively labeled rhu-TNF (200 ng rhu -TNF mixed in 100 μl medium).
3. Dann wurden 100 μl Medium mit 2 x 106 u937-Zel.len (Mensch) in die Reaktionsgefäße pipettiert und gemischt. Die Reaktionsgefäße (Testvolumen 300 μl) wurden 90 min bei 0°C inkubiert. Nach 45 min wurden die Reaktionsansätze nochmals durchmischt.3. Then 100 μl medium with 2 x 106 u937 cells (human) were pipetted into the reaction vessels and mixed. The reaction vessels (test volume 300 μl) were incubated at 0 ° C. for 90 min. After 45 minutes, the reaction batches were mixed again.
4. Nach der Inkubationszeit wurden die Zellen 5 min bei 1800 rpm und 4°C zentrifugiert, 3 mal mit Medium gewaschen, quantitativ in Zählröhrchen überführt und die zellgebundene Radioaktivität in einem Clini Garrrma Counter 1272 (LKB Wallac) bestimmt.4. After the incubation time, the cells were centrifuged for 5 min at 1800 rpm and 4 ° C., washed 3 times with medium, transferred quantitatively into counting tubes and the cell-bound radioactivity was determined in a Clini Garrrma Counter 1272 (LKB Wallac).
5. Nach Korrektur der Meßwerte um die unspezifische Bindung wurde, bezogen auf die Gesamtbindung, der 50 % Kompetitionswert definiert und die Probenkonzentration, die bei der vorgelegten l25j-rhu-TNF-Konzentration zu 50 % Kompetition der l25j-rhu-TNF-Bindung führt, als kompetitive Aktivität der untersuchten Probe ermittelt.5. After the measurement values had been corrected for the non-specific binding, the 50% competition value was defined based on the total binding and the sample concentration which, at the l25j-rhu-TNF concentration presented, leads to 50% competition of the l25j-rhu-TNF binding , determined as the competitive activity of the sample examined.
Beispielexample
A. Herstellung eines Vektors, der die cDNA des humanen TNFs trägt.A. Preparation of a vector carrying the human TNF's cDNA.
Ausgangsmaterial war das 578 bp lange TNF-cDNA-Fragment, das für die Aminosäuren 8 bis 157 codiert (Aval-Hind3-Fragment) . Dieses TNF-cDNA-Teilfrag ent wurde mit einem chemisch synthetisierten Adaptor, der für die Aminosäuren 1 bis 7 codiert, verknüpft und in einen geeigneten Vektor eingebaut.The starting material was the 578 bp TNF cDNA fragment which codes for amino acids 8 to 157 (Aval-Hind3 fragment). This TNF cDNA subfrag ent was linked to a chemically synthesized adapter, which codes for amino acids 1 to 7, and incorporated into a suitable vector.
Als Adaptor diente ein doppelstrangiges DNA-Molekül folgender Sequenz:A double-stranded DNA molecule of the following sequence served as the adapter:
CGATACTACTATG(N)χ TATGATGATAC(M)XGGCT,CGATACTACTATG (N) χ TATGATGATAC (M) X GGCT,
worinwherein
x 0 oder eine durch 3 teilbare Zahl von 3 bis 21,x 0 or a number divisible by 3 from 3 to 21,
N A, G, C oder T undN A, G, C or T and
M das jeweils komplementäre Nukleotid zu N sind.M are the complementary nucleotides to N.
Durch Variation der Adaptoren konnte die Sequenz am 5'-Ende der TNF-cDNA beeinflußt und somit nach erfolgter Genexpression der Amino- terminus des TNF-Proteins verändert werden.The sequence at the 5 'end of the TNF cDNA could be influenced by varying the adapters and the amino terminus of the TNF protein could thus be changed after gene expression had taken place.
Wurde für 21 GTCAGATCATCTTCTCGAACC eingesetzt, so erhielt man die cDNA für die gesamte reife Form des humanen TNF (1-157), wobei vor der Aminosäure 1 ein Methionin eingebaut ist.If GTCAGATCATCTTCTCGAACC was used for 21, the cDNA for the entire mature form of human TNF (1-157) was obtained, with a methionine being built in before amino acid 1.
Für x gleich 0 erhielt man einen Adaptor, der nach Verknüpfung mit der TNF-cDNA für ein TNF-Proteϊn codierte, bei dem die ersten 7 Amino¬ säuren am Aminoterminus deletiert sind. Weiterhin konnten durch Variation von N alle Deletionen zwischen 1 und 7 Aminosäuren am Amino- terminus des TNF erzeugt werden.For x equal to 0, an adapter was obtained which, after being linked to the TNF cDNA, coded for a TNF protein in which the first 7 amino acids were deleted at the amino terminus. Furthermore, all deletions between 1 and 7 amino acids at the amino terminus of the TNF could be generated by variation of N.
Die Adaptoren wurden durch vollautomatische chemische Synthese (Applied Biosystems 380A) hergestellt und durch präparative Polyacryl- a id-Gelelektrophorese gereinigt.The adapters were manufactured by fully automated chemical synthesis (Applied Biosystems 380A) and cleaned by preparative polyacrylic acid gel electrophoresis.
Als Vektor diente ein 4,3 kb langes DNA-Molekül, das aus pBR322 durch Spaltung mit Clal und Hind3 erhalten wurde.A 4.3 kb DNA molecule, which was obtained from pBR322 by cleavage with Clal and Hind3, served as vector.
0,2 pMol des 587 bp langen TNF-Fragmentes wurden mit 0,5 pMol des entsprechenden Adaptors und 0,1 pMol des Vektors mit Hilfe des Enzyms T4-DNA Ligase verknüpft. Mit dieser DNA wurden der E.coli-Stamm W3110 (ATCC 27325) transformiert und ein Klon mit der entsprechenden DNA- Sequenz isoliert. B. Herstellung eines Einzelstrangvektors mit der codierenden Sequenz des humanen TNF0.2 pmole of the 587 bp TNF fragment was linked to 0.5 pmole of the corresponding adapter and 0.1 pmole of the vector using the enzyme T4-DNA ligase. The E. coli strain W3110 (ATCC 27325) was transformed with this DNA and a clone with the corresponding DNA sequence was isolated. B. Production of a single-strand vector with the coding sequence of the human TNF
Der oben beschriebene TNF-cDNA-Vektor wurde mit den Restriktionsenzy- men EcoRl und Hind3 gespalten. Man erhielt das 0,6 kb große TNF-cDNA- Fragment durch Gelelektrophorese und anschließende Extraktion aus dem Gel in reiner Form. 100 ng dieses Fragments wurden mit 1 μg des Ml3mp8-EcoRl-Hind3-Vektorfragments in 20 μl 50mM TrisHCl (pH=7,4), lOmM MgCl2 25mM Dithiothreitol und 1 mM ATP in Gegenwart von 5 Einhei- ten T4-DNA-Ligase gemischt und über Nacht bei 14°C inkubiert.The TNF cDNA vector described above was cleaved with the restriction enzymes EcoRI and Hind3. The 0.6 kb TNF cDNA fragment was obtained in pure form by gel electrophoresis and subsequent extraction from the gel. 100 ng of this fragment were mixed with 1 μg of the Ml3mp8-EcoRI-Hind3 vector fragment in 20 μl 50mM TrisHCl (pH = 7.4), 10MM MgCl 2 25mM dithiothreitol and 1 mM ATP in the presence of 5 units of T4-DNA ligase mixed and incubated overnight at 14 ° C.
Mit diesem Gemisch wurde E.coli JM103 (erhältlich von der Firma Pharmacia) transformiert. Man isolierte durch Ausstanzen aus den Kulturplatten mehrere Plaques, die durch DNA-Sequenzierung auf TNF-cDNA-Insertion untersucht wurden. Der rekombinierte Phage mit dem codierenden Strang der TNF-cDNA wird M13-TNF genannt.E. coli JM103 (available from Pharmacia) was transformed with this mixture. A number of plaques were isolated by punching out the culture plates and were examined for TNF cDNA insertion by DNA sequencing. The recombined phage with the coding strand of the TNF cDNA is called M13-TNF.
C. Herstellung von Vektoren mit veränderter TNF-SequenzC. Generation of Vectors with Altered TNF Sequence
Der oben beschriebene M13-TNF war das Ausgangsmolekül für die gezielte Mutagenese des TNF-Gens. Um die beabsichtigten Veränderungen einzu¬ führen, benötigte man Oligodesoxynukleotide, die partiell komplementär zum TNF-codierenden Strang sind ("antisense Oligonukleotide"). Diese Oligonukleotide besitzen eine Länge zwischen 15 und 30 Nukleotiden; bevorzugt verwendet wurden Oligonukleotide mit einer Länge vonThe M13-TNF described above was the starting molecule for the targeted mutagenesis of the TNF gene. In order to introduce the intended changes, one needed oligodeoxynucleotides which are partially complementary to the TNF-coding strand ("antisense oligonucleotides"). These oligonucleotides are between 15 and 30 nucleotides in length; oligonucleotides with a length of
23 Nukleotiden. Dabei waren die ersten 10 Nukleotide perfekt komple¬ mentär zum TNF-codierenden Strang, dann folgte ein nicht-komplementä¬ rer Bereich, der die beabsichtigte Veränderung im TNF-Gen trug, und anschließend folgte wieder ein perfekt komplementärer Bereich von 10 Nukleotiden. Das antisense Oligonukleotid für den Austausch der Aminosäure Nr. 9 Serin gegen Asparaginsäure war23 nucleotides. The first 10 nucleotides were perfectly complementary to the TNF-coding strand, followed by a non-complementary region which carried the intended change in the TNF gene, and then followed by a perfectly complementary region of 10 nucleotides. The antisense oligonucleotide for the exchange of amino acid No. 9 serine for aspartic acid was
pCAGGCTTGTCGTCCGGGGTTCGA.pCAGGCTTGTCGTCCGGGGTTCGA.
Das antisense Oligonukleotid für die Deletion der Aminosäure Nr 140 Asparaginsäure warThe antisense oligonucleotide for the deletion of amino acid No. 140 was aspartic acid
pAGTCGAGATAGGGCCGATTG.pAGTCGAGATAGGGCCGATTG.
Die für die Mutagenese verwendeten Oligonukleotide sind in Tab. 1 aufgeführt. Tabelle 1The oligonucleotides used for the mutagenesis are listed in Table 1. Table 1
Nr. Sequenz 5' - 3'Sequence 5 '- 3'
1 C A G G C T T G T C G T C C G G G G T T C G A1 C A G G C T T G T C G T C C G G G G T T C G A
2 G G G C T A C A G G C T C G T C A C T C G G G2 G G G C T A C A G G C T C G T C A C T C G G G
3 T T G C T A C A A C A G A G G C T A C A G G C3 T T G C T A C A A C A G A G G C T A C A G G C
4 T T G C T A C A A C A A C G G C T A C A G G C4 T T G C T A C A A C A A C G G C T A C A G G C
5 T T G C T A C A A C G G T G G C T A C A G G C 6 T T G C T A C A A C C T G G G C T A C A G G C5 T T G C T A C A A C G G T G G C T A C A G G C 6 T T G C T A C A A C C T G G G C T A C A G G C
7 A C T G G A G C T G T T C C T C A G C T T G A7 A C T G G A G C T G T T C C T C A G C T T G A
8 T G G C C A G G A G G A G A T T G G C C C G G8 T G G C C A G G A G G A G A T T G G C C C G G
9 C T C T C A G C T C C A T G C C A T T G G C C 10 G C T G G T T A T C T T T C A G C T C C A C G 11 C C A C C A G C T G G T C A T C T C T C A G C9 C T C T C A G C T C C A T G C C A T T G G C C 10 G C T G G T T A T C T T T C A G C T C C A C G 11 C C A C C A G C T G G T C A T C T C T C A G C
12 A C A G G C C C T C G T C T G G C A C C A C C12 A C A G G C C C T C G T C T G G C A C C A C C
13 T G A G G T A C A C A A C C T C T G A T G G C13 T G A G G T A C A C A A C C T C T G A T G G C
14 A G T A G A T G A G G A A C A G G C C C T C T14 A G T A G A T G A G G A A C A G G C C C T C T
15 A G T A G A T G A G G A T C A G G C C C T C T 16 A G T A G A T G A G G A G C A G G C C C T C T15 A G T A G A T G A G G A T C A G G C C C T C T 16 A G T A G A T G A G G A G C A G G C C C T C T
17 G G G A G T A G A T A G C G T A C A G G C C C17 G G G A G T A G A T A G C G T A C A G G C C C
18 T G A A G A G G A C G A T G G A G T A G A T G18 T G A A G A G G A C G A T G G A G T A G A T G
19 C C T T G A A G A G G A T C T G G G A G T A G19 C C T T G A A G A G G A T C T G G G A G T A G
20 C C T T G A A G A G G A G C T G G G A G T A G 21 G G C T G A T G G T A G A G G T G A G G A G C20 C C T T G A A G A G G A G C T G G G A G T A G 21 G G C T G A T G G T A G A G G T G A G G A G C
22 G G C T G A T G G T T T C G G T G A G G A G C22 G G C T G A T G G T T T C G G T G A G G A G C
23 G G C T G A T G G T G G T G G T G A G G A G C23 G G C T G A T G G T G G T G G T G A G G A G C
24 G G C T G A T G G T A A C G G T G A G G A G C24 G G C T G A T G G T A A C G G T G A G G A G C
25 C C T T G G T C T G G A A G G A G A C G G C G 26 G G C A G G G G C T C T G G A T G G C A G A G25 C C T T G G T C T G G A A G G A G A C G G C G 26 G G C A G G G G C T C T G G A T G G C A G A G
27 G G C A G G G G C T G T T G A T G G C A G A G27 G G C A G G G G C T G T T G A T G G C A G A G
28 C C C C T C C C A G G A A G A T G G G C T C A28 C C C C T C C C A G G A A G A T G G G C T C A
29 C C C C T C C C A G A C G G A T G G G C T C A29 C C C C T C C C A G A C G G A T G G G C T C A
30 C C C C T C C C A G A A C G A T G G G C T C A 31 G G A A G A C C C C A G C C A G A T A G A T G30 C C C C T C C C A G A A C G A T G G G C T C A 31 G G A A G A C C C C A G C C A G A T A G A T G
32 G G A A G A C C C C A A C C A G A T A G A T G32 G G A A G A C C C C A A C C A G A T A G A T G
33 T G A T C T C A G C A A C G A G T C G G T C A33 T G A T C T C A G C A A C G A G T C G G T C A
34 C G G G C C G A T T A A C C T C A G C G C T G34 C G G G C C G A T T A A C C T C A G C G C T G
35 A G T C G G G C C G G T C G A T C T C A G C G 36 G A T A G T C G G G G T C A T T G A T C T C A35 A G T C G G G C C G G T C G A T C T C A G C G 36 G A T A G T C G G G G T C A T T G A T C T C A
37 G A T A G T C G G G A C C A T T G A T C T C A37 G A T A G T C G G G A C C A T T G A T C T C A
38 G A T A G T C G G G G A G A T T G A T C T C A38 G A T A G T C G G G G A G A T T G A T C T C A
39 G A T A G T C G G G G A G A T T G A T C T C A39 G A T A G T C G G G G A G A T T G A T C T C A
40 C G A G A T A G T C G T C C C G A T T G A T C Tabelle 1 (Fortsetzung)40 CGAGATAGTCGTCCCGATTGA TC Table 1 (continued)
A A T G AATG
Diese Oligonukleotide wurden mittels konventioneller Methoden synthetisiert. Zum Gebrauch bei der Mutagenese wurden lOpMol des Oligonukleotids 30 min bei 37°C in 10 μl 50 mM TrisHCl (pH=7,5), 0,1 M EDTA, 10 mM MgCl 10 mM Dithiothreitol, 0,1 mM ATP in Gegenwart von 5 Einheiten T4 Polynukleotid-Kinase phosphoryliert.These oligonucleotides were synthesized using conventional methods. For use in mutagenesis, 10 mol of the oligonucleotide were dissolved in 10 μl of 50 mM TrisHCl (pH = 7.5), 0.1 M EDTA, 10 mM MgCl 10 mM dithiothreitol, 0.1 mM ATP in the presence of 5 units of T4 polynucleotide kinase phosphorylated.
Zum Gebrauch als Probe (s. unten) wurden 2 pMol des synthetischen Oligonukleotids wie oben angegeben phosphoryliert, nur daß anstatt 0, 1 mM ATP 1 μM γ-32 p-ATP verwendet wurde.For use as a sample (see below), 2 pmol of the synthetic oligonucleotide was phosphorylated as indicated above, except that 1 μM γ-32 p-ATP was used instead of 0.1 mM ATP.
Die spezifische Aktivität lag im Bereich von 5-106 cpm pro pMol Oligonukleotid.The specific activity was in the range of 5-106 cpm per pmole of oligonucleotide.
Die Hybridisierung der Oligonukleotide mit der einzelsträngigen DNA von M13-TNF ergab nach Kettenverlängerung eine Heteroduplex-DNA, bei der ein Strang die mutierte DNA beinhaltete.Hybridization of the oligonucleotides with the single-stranded DNA from M13-TNF gave a heteroduplex DNA after chain extension, in which one strand contained the mutated DNA.
Zur partiellen Heteroduplexbildung wurden 300 ng M13-TNF DNA mit 1 pMol des phosphorylierten Oligonukleotids in 20 μl 10 mM TrisHCl (pH=7,5), 0,1 mM EDTA, 50 mMol NaCl auf 80°C (2 min), 50°C (5 min) und Raumtemperatur (5 min) erwärmt. Die KettenVerlängerung wurde durch Zugabe von 30 μl 50 mM TrisHCl (pH=8,0), 0,1 M EDTA, 12 M MgCl2, 10 mM Dithiothreitol, 0,7 M ATP, 0,07 mM dATP, 0,2 mM an dGTP, dTTP, dCTP, 2 Einheiten E.coli Polymerase I (großes Fragment) und 20 Einhei¬ ten T4 DNA-Ligase gestartet. Nach 30 min bei Raumtemperatur wurde das Reaktionsgemisch 4 h bei 37°C inkubiert und anschließend bei 4°C über Nacht inkubiert. Aliquots wurden mit Phenol extrahiert, die DNA mit Ethanol ausgefällt und in 15 μl Wasser gelöst. Die DNA dieser Aliquots wurde zur Transformation von E.coli JM 103 benutzt.For partial heteroduplex formation, 300 ng M13-TNF DNA with 1 pmol of the phosphorylated oligonucleotide in 20 μl 10 mM TrisHCl (pH = 7.5), 0.1 mM EDTA, 50 mmol NaCl at 80 ° C. (2 min), 50 ° C (5 min) and room temperature (5 min) warmed. The chain extension was carried out by adding 30 ul 50 mM TrisHCl (pH = 8.0), 0.1 M EDTA, 12 M MgCl 2 , 10 mM dithiothreitol, 0.7 M ATP, 0.07 mM dATP, 0.2 mM started on dGTP, dTTP, dCTP, 2 units of E. coli polymerase I (large fragment) and 20 units of T4 DNA ligase. After 30 min at room temperature, the reaction mixture was incubated for 4 h at 37 ° C and then incubated at 4 ° C overnight. Aliquots were extracted with phenol, the DNA precipitated with ethanol and dissolved in 15 μl of water. The DNA of these aliquots was used to transform E.coli JM 103.
Bakterienkulturschalen (15 cm Durchmesser), die einige Hundert rekombinante Phagen-Plaques enthalten, wurden durch in situ Plaque- Hybridisierung (Science 196, 180, 1977) auf den mutierten Genotyp hin untersucht, indem man das entsprechende radioaktiv markierte Oligo¬ nukleotid (die Probe) und Nitrocellulosefilterabzüge der Phagen- Plaques hybridisierte (etwa 106 cpm pro Filter). Die Hybridisierung geschah über Nacht bei 50°C, 40% Formamid und 5 • SSC (1 • SSC = 0,1 H NaCl, 15 mM Natriumeitrat pH=7,2).Bacterial culture dishes (15 cm in diameter) containing a few hundred recombinant phage plaques were examined for the mutated genotype by in situ plaque hybridization (Science 196, 180, 1977) by the corresponding radioactively labeled oligonucleotide (the sample ) and hybridized nitrocellulose filter prints of the phage plaques (about 106 cpm per filter). Hybridization occurred overnight at 50 ° C, 40% formamide and 5 • SSC (1 • SSC = 0.1 H NaCl, 15 mM sodium citrate pH = 7.2).
Die Filter wurden bei 45°C in 2 • SSC, 0,02% Natriumdodecylsulfat gewaschen, an der Luft getrocknet, auf einen Röntgenfilm aufgebracht und bei -70°C exponiert.The filters were washed at 45 ° C in 2 • SSC, 0.02% sodium dodecyl sulfate, air dried, applied to an X-ray film and exposed at -70 ° C.
Es war notwendig, die Stringenz der Hybridisierung durch Veränderung der SSC-Konzentration beim Waschen der Filter) für das entsprechende Oligonukleotid individuell einzustellen; jede Mutante variierte je nach Anzahl und Art der ausgetauschten oder deletierten Nukleotide in ihrer Fähigkeit, mit dem Oligonukleotid zu hybridisieren.It was necessary to individually adjust the stringency of the hybridization by changing the SSC concentration when washing the filter) for the corresponding oligonucleotide; each mutant varied in its ability to hybridize with the oligonucleotide depending on the number and type of nucleotides exchanged or deleted.
Ein mit der radioaktiv markierten Probe hybridisierender Phage wurde aus der Bakterienkulturplatte ausgestanzt und als Inokulu zur Infektion von E.coli JM 103 verwendet.A phage hybridizing with the radioactively labeled sample was punched out of the bacterial culture plate and used as an inokulu to infect E. coli JM 103.
Aus dem Kulturüberstand wurde die einzelsträngige DNA, aus dem Zellniederschlag die doppelsträngige DNA präpariert.The single-stranded DNA was prepared from the culture supernatant, and the double-stranded DNA from the cell precipitate.
Die einzelsträngige DNA wurde nach der Didesoxymethode (Proc.Natl.Acad.Sci., USA 74, 5463, 1977) sequenziert, um die Mutation zu bestätigen. Dann konnte aus der doppelsträngigen DNA durch Spaltung mit den Restriktionsenzymen Clal und Hind3 und anschließende Gelelektrophorese das Gen für das TNF-Mutein isoliert werden.The single-stranded DNA was sequenced according to the dideoxy method (Proc.Natl.Acad.Sci., USA 74, 5463, 1977) to confirm the mutation. Then the gene for the TNF mutein could be isolated from the double-stranded DNA by cleavage with the restriction enzymes Clal and Hind3 and subsequent gel electrophoresis.
Produktion der TNF-MuteineProduction of the TNF muteins
Das in den obigen Beispielen hergestellte Gen für ein TNF-Mutein wurde an seinem 5'-Ende (Clal) mit Promotorsequenzen, wie z.B. lac-Promotor oder trp-Promotor und ribosomalen Bindungsstellen verknüpft. An seinem 3'-Ende (Hind3) enthielt das Gen einen Transkriptionsterminator, wie den trpA-Terminator. Diese DNA-Sequenzen sind alle kommerziell erhältlich (Pharmacia-LKB, Freiburg).The gene for a TNF mutein produced in the above examples was linked at its 5 'end (Clal) to promoter sequences such as, for example, lac promoter or trp promoter and ribosomal binding sites. At its 3 'end (Hind3) the gene contained a transcription terminator such as the trpA terminator. These DNA sequences are all commercially available (Pharmacia-LKB, Freiburg).
Das so mit den nötigen Expressionssignalen versehene Gen für das TNF- Mutein wurde in einen Vektor wie z.B. pBR322 eingebaut. Mit diesem Vektor wurde der E.coli Stamm W3110 transformiert und die erhaltenen Klone auf TNF-Mutein-Produktion getestet. Dazu wurde der Bakterien- überstand nach Verdünnung in einem biologischen Test untersucht. Positive Bakterienklone werden bei 37°C in 10 1 LB-Nährmedium gezüchtet.The gene for the TNF mutein thus provided with the necessary expression signals was converted into a vector such as e.g. pBR322 installed. The E. coli strain W3110 was transformed with this vector and the clones obtained were tested for TNF mutein production. For this purpose the bacterial supernatant was examined in a biological test after dilution. Positive bacterial clones are grown at 37 ° C in 10 1 LB culture medium.
Reinigung der ProteinePurification of the proteins
1 1 Fermentationsbrühe eines eine neue Substanz produzierenden E.coli- Stamms wurden 30 min bei 3000 g zentrifugiert. Der Rückstand wurde in 200 ml 0,4 M Argininhydrochlorid, 20 mM Natriumphosphat pH 8,5 aufge¬ nommen und 30 min mit Ultraschall behandelt. Die Suspension wurde mit 6 ml 2M MnCl2 versetzt und 45 min bei 3000 g zentrifugiert. Der überstand wurde mit verdünnter NH3-Lösung auf pH 8,9 gebracht und mit festem Ammoniumsulfat auf 60 % Sättigung eingestellt.1 1 fermentation broth of a E. coli strain producing a new substance was centrifuged at 3000 g for 30 min. The residue was taken up in 200 ml of 0.4 M arginine hydrochloride, 20 mM sodium phosphate pH 8.5 and treated with ultrasound for 30 min. 6 ml of 2M MnCl2 were added to the suspension and centrifuged at 3000 g for 45 min. The supernatant was brought to pH 8.9 with dilute NH 3 solution and adjusted to 60% saturation with solid ammonium sulfate.
Das Proteinpräzipitat wurde in 0,2 M Argininhydrochlorid pH 7,5 suspendiert und gegen 0,4 M Argininhydrochlorid pH 7,5 dialysiert. Nach 16 h wurde mit verdünnter NH3~Lösung auf pH 8,5 eingestellt und auf das 5fache Volumen mit Wasser verdünnt.The protein precipitate was suspended in 0.2 M arginine hydrochloride pH 7.5 and dialyzed against 0.4 M arginine hydrochloride pH 7.5. After 16 h, the pH was adjusted to 8.5 with dilute NH 3 solution and diluted to 5 times the volume with water.
Diese Lösung wurde über eine mit 0,01 M Argininpuffer pH 8,5 äquilibrierte βR-Sepharose-Säule (Pharmacia) Chromatographiert. Die . Elution erfolgte mit 0,02 M Na-Phosphat, 0,06 M NaCl. Das Eluat wurde nach dem Verdünnen auf das 2,5fache über eine mit 0,02 M Na-Phosphat pH 8,0 äquilibrierte ®S-Sepharose-Säule (Pharmacia) Chromatographiert. Nach Waschen der Säule mit Äquilibrierungspuffer erhielt man durch Elution mit 0,05 M Na-Phosphat, 0, 1 M NaCl, 0,1 M Arginin pH 8,6 SDS-Polyacrylamidgel-elektrophoretisch reines Protein.This solution was chromatographed on a β R-Sepharose column (Pharmacia) equilibrated with 0.01 M arginine buffer pH 8.5. The . Elution was carried out with 0.02 M Na phosphate, 0.06 M NaCl. After dilution to 2.5-fold, the eluate was chromatographed on a ®S-Sepharose column (Pharmacia) equilibrated with 0.02 M Na phosphate pH 8.0. After washing the column with equilibration buffer, pure protein was obtained by elution with 0.05 M Na phosphate, 0.1 M NaCl, 0.1 M arginine pH 8.6, SDS polyacrylamide gel.
So wurden durch Mutagenese mit den in Tabelle 1 aufgeführten Oligonukleotiden in der angegebenen Reihenfolge folgende TNF-Proteine hergestellt (Die Positionen geben die Stellung im TNF an, die verändert ist):The following TNF proteins were thus produced by mutagenesis with the oligonucleotides listed in Table 1 in the order given (the positions indicate the position in the TNF which has been changed):
Ser ersetzt durch AspSer replaced by Asp
Lys ersetzt durch GluLys replaced by Glu
His ersetzt durch SerHis replaced by Ser
His ersetzt durch ValHis replaced by Val
His ersetzt durch Thr His ersetzt durch Gin Position 24 Gly ersetzt durch GluHis replaced by Thr His replaced by gin Position 24 Gly replaced by Glu
Position 35 Ala ersetzt durch LeuPosition 35 Ala replaced by Leu
Position 41 Val ersetzt durch MetPosition 41 Val replaced by Met
Position 44 Arg ersetzt durch LysPosition 44 Arg replaced by Lys
Position 46 Asn ersetzt durch AspPosition 46 Asn replaced by Asp
Position 52 Ser ersetzt durch AspPosition 52 Ser replaced by Asp
Position 54 Gly ersetzt durch ValPosition 54 Gly replaced by Val
Position 56 Tyr ersetzt durch PhePosition 56 Tyr replaced by Phe
Position 56 Tyr ersetzt durch IlePosition 56 Tyr replaced by Ile
Position 56 Tyr ersetzt druch LeuPosition 56 Tyr replaced by Leu
Position 57 Leu ersetzt durch AlaPosition 57 Leu replaced by Ala
Position 61 Gin ersetzt durch IlePosition 61 gin replaced by ile
Position 62 Val ersetzt durch IlePosition 62 Val replaced by Ile
Position 62 Val ersetzt durch LeuPosition 62 Val replaced by Leu
Position 62 Val ersetzt druch HisPosition 62 Val is replaced by His
Position 78 His ersetzt durch SerPosition 78 His replaced by Ser
Position 78 His ersetzt durch GluPosition 78 His replaced by Glu
Position 78 His ersetzt druch ThrPosition 78 His replaced by Thr
Position 78 His ersetzt druch ValPosition 78 His is replaced by Val
Position 87 Tyr ersetzt durch PhePosition 87 Tyr replaced by Phe
Position 87 T r ersetzt durch HisPosition 87 T r replaced by His
Position 95 Ser ersetzt durch ValPosition 95 Ser replaced by Val
Position 119 T r ersetzt durch PhePosition 119 T r replaced by Phe
Position 119 Tyr ersetzt durch ArgPosition 119 Tyr replaced by Arg
Position 121 Gly ersetzt durch AlaPosition 121 Gly replaced by Ala
Position 121 Gly ersetzt durch ValPosition 121 Gly replaced by Val
Position 133 Ser ersetzt durch ValPosition 133 Ser replaced by Val
Position 136 Ile ersetzt durch ValPosition 136 Ile replaced by Val
Position 137 Asn ersetzt durch AspPosition 137 Asn replaced by Asp
Position 138 Arg ersetzt durch AspPosition 138 Arg replaced by Asp
Position 138 Arg ersetzt durch GlyPosition 138 Arg replaced by Gly
Position 138 Arg ersetzt durch LeuPosition 138 Arg replaced by Leu
Position 139 Pro ersetzt durch AspPosition 139 Pro replaced by Asp
Position 139 Pro ersetzt durch IlePosition 139 Pro replaced by Ile
Position 139 Pro ersetzt durch GlyPosition 139 Pro replaced by Gly
Position 140 Asp ersetzt durch ProPosition 140 Asp replaced by Pro
Position 140 Asp ersetzt durch LysPosition 140 Asp replaced by Lys
Position 141 Tyr ersetzt durch HisPosition 141 Tyr replaced by His
Position 142 Leu ersetzt durch PhePosition 142 Leu replaced by Phe
Position 144 Phe ersetzt durch AlaPosition 144 Phe replaced by Ala
Position 144 Phe ersetzt durch GluPosition 144 Phe replaced by Glu
Position 144 Phe ersetzt durch HisPosition 144 Phe replaced by His
Position 144 Phe ersetzt durch ArgPosition 144 Phe replaced by Arg
Position 150 Val ersetzt durch Leu Position 150 Val ersetzt durch IlePosition 150 Val replaced by Leu Position 150 Val replaced by Ile
Position 150 Val ersetzt durch HisPosition 150 Val replaced by His
Position 156 Ala ersetzt durch ValPosition 156 Ala replaced by Val
Position 157 Leu ersetzt durch Gly. Position 157 Leu replaced by Gly.

Claims

PatentansprücheClaims
1. TNF-Polypeptide der Formel1. TNF polypeptides of the formula
ValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnProValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnPro
GlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGlyGlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGly
ValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSerValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSer
GlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlleGlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlle
SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerProSerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro
CysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeuCysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeu
GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAspGlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAsp
TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu,TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu,
worin jedoch mindestens eine Aminosäure in den Positionen 9, 11, 15, 26, 35, 41, 44, 46, 52, 54, 56, 57, 61, 62, 78, 87, 95, 119, 121, 133, 136, 137, 138, 139, 140, 141, 142, 144, 150, 156 und/oder 157 durch eine andere natürliche α-Aminosäure ersetzt ist und N-terminal 1 bis 7 Aminosäuren fehlen können, sowie deren Salze mit physiologisch verträglichen Säuren.where, however, at least one amino acid in positions 9, 11, 15, 26, 35, 41, 44, 46, 52, 54, 56, 57, 61, 62, 78, 87, 95, 119, 121, 133, 136, 137, 138, 139, 140, 141, 142, 144, 150, 156 and / or 157 is replaced by another natural α-amino acid and N-terminal 1 to 7 amino acids may be missing, as well as their salts with physiologically compatible acids.
TNF-Polypeptide gemäß Anspruch 1, in denen mindestens eine der folgenden Veränderungen vorliegt:TNF polypeptides according to claim 1, in which at least one of the following changes is present:
Gin ersetzt durch C Gin replaced by C
Val ersetzt durch A oder CVal replaced by A or C
His ersetzt durch C oder BHis replaced by C or B
Tyr ersetzt durch CTyr replaced by C
Ser ersetzt durch CSer replaced by C
Tyr ersetzt durch C oder ATyr replaced by C or A
Gly ersetzt durch CGly replaced by C
Ser ersetzt durch CSer replaced by C
Ile ersetzt durch C 10 Asn ersetzt durch AIle replaced by C 10 Asn replaced by A
Arg ersetzt durch A, B oder CArg replaced by A, B or C.
Pro ersetzt durch A, C oder BPro replaced by A, C or B
Asp ersetzt durch A oder CAsp replaced by A or C
Tyr ersetzt durch A 15 Leu ersetzt durch CTyr replaced by A 15 Leu replaced by C
Phe ersetzt durch C oder APhe replaced by C or A
Val ersetzt durch A oder CVal replaced by A or C
Ala ersetzt durch C Leu ersetzt durch B, 20 worin A eine Aminosäure mit geladener Seitenkette, B eine Aminosäure mit polarer ungeladener Seitenkette und C eine Aminosäure mit hydrophober Seitenkette bedeuten.Ala replaced by C Leu replaced by B, 20 wherein A is an amino acid with a charged side chain, B is an amino acid with a polar uncharged side chain and C is an amino acid with a hydrophobic side chain.
253. DNA codierend für ein TNF-Polypeptid gemäß Anspruch 1.253. DNA coding for a TNF polypeptide according to claim 1.
4. Vektor enthaltend eine DNA gemäß Anspruch 3.4. Vector containing a DNA according to claim 3.
5. Wirtsorganismus enthaltend einen Vektor gemäß Anspruch 4. 305. Host organism containing a vector according to claim 4. 30
6. Verfahren zur Herstellung eines TNF-Polypeptids gemäß Anspruch 1, dadurch gekennzeichnet, daß man einen Wirtsorganismus nach Anspruch 5 züchtet und das TNF-Polypeptid daraus isoliert.6. A method for producing a TNF polypeptide according to claim 1, characterized in that one cultivates a host organism according to claim 5 and the TNF polypeptide is isolated therefrom.
357. TNF-Polypeptide gemäß Anspruch 1 zur Verwendung bei der Bekämpfung von Krankheiten.357. TNF polypeptides according to claim 1 for use in combating diseases.
8. Verwendung der TNF-Polypeptide gemäß Anspruch 1 zur Bekämpfung von neoplastischen Erkrankungen und Autoimmunerkrankungen sowie zur Be- 40 kämpfung und Prophylaxe von Infektionen, Entzündungen und Abstoßungs¬ reaktionen bei Transplantationen. 8. Use of the TNF polypeptides according to claim 1 for combating neoplastic diseases and autoimmune diseases and for combating and prophylaxis of infections, inflammation and rejection reactions in transplantations.
EP19900900837 1988-12-23 1989-12-19 Tumour necrosis factor muteins Withdrawn EP0423252A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19883843534 DE3843534A1 (en) 1988-12-23 1988-12-23 NEW TNF POLYPEPTIDES
DE3843534 1988-12-23

Publications (1)

Publication Number Publication Date
EP0423252A1 true EP0423252A1 (en) 1991-04-24

Family

ID=6370045

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19900900837 Withdrawn EP0423252A1 (en) 1988-12-23 1989-12-19 Tumour necrosis factor muteins

Country Status (4)

Country Link
EP (1) EP0423252A1 (en)
CA (1) CA2005053A1 (en)
DE (1) DE3843534A1 (en)
WO (1) WO1990007579A1 (en)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2055168A1 (en) * 1990-11-21 1992-05-22 Walter Fiers Tnf-muteins
WO1993018148A2 (en) * 1992-03-12 1993-09-16 Wisnieski Bernadine J Tumor necrosis factor with modified channel activity
KR970005042B1 (en) * 1993-02-09 1997-04-11 한일합성섬유공업 주식회사 Tumor necrosis factor-alpha muteine
CA2119089A1 (en) * 1993-03-29 1994-09-30 David Banner Tumor necrosis factor muteins
BR9811462A (en) * 1997-04-15 2000-09-12 Ferring Farma Lab Modified tfalfa molecules, dna encoding such modified tfalfa molecules and vaccines that comprise such modified tfalfa and dna.
US7244823B2 (en) 2000-03-02 2007-07-17 Xencor TNF-alpha variants proteins for the treatment of TNF-alpha related disorders
CA2401683A1 (en) * 2000-03-02 2001-09-07 Xencor Design and discovery of protein based tnf-.alpha. variants for the treatment of tnf-.alpha. related disorders
US7101974B2 (en) 2000-03-02 2006-09-05 Xencor TNF-αvariants
US7446174B2 (en) 2001-03-02 2008-11-04 Xencor, Inc. Protein based TNF-α variants for the treatment of TNF-α related disorders
US7687461B2 (en) 2000-03-02 2010-03-30 Xencor, Inc. Treatment of TNF-α related disorders with TNF-α variant proteins
US7056695B2 (en) 2000-03-02 2006-06-06 Xencor TNF-α variants
US7662367B2 (en) 2000-03-02 2010-02-16 Xencor, Inc. Pharmaceutical compositions for the treatment of TNF-α related disorders
DE10101319A1 (en) * 2001-01-09 2002-07-18 Schering Ag Morphometric tissue or cell preparation
GB201510758D0 (en) 2015-06-18 2015-08-05 Ucb Biopharma Sprl Novel TNFa structure for use in therapy
GB201621907D0 (en) 2016-12-21 2017-02-01 Ucb Biopharma Sprl And Sanofi Antibody epitope

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0155549B1 (en) * 1984-03-06 1991-03-20 Dainippon Pharmaceutical Co., Ltd. Dna encoding human tumor necrosis factor and human tumor necrosis factor polypeptide
GR851626B (en) * 1984-07-05 1985-11-26 Genentech Inc
EP0200748B1 (en) * 1984-10-15 1991-02-06 Cetus Corporation Human tumor necrosis factor
DE3750915T2 (en) * 1986-02-04 1995-08-24 Den Ichi Mizuno DNA encoding antitumor polypeptides, the polypeptides and antitumor agents containing these polypeptides.
DE3750056T2 (en) * 1986-06-20 1995-04-06 Dainippon Pharmaceutical Co Human TNF polypeptide mutants and DNA coding for these mutants.
AU1346488A (en) * 1987-02-26 1988-09-26 Cetus Corporation Arginine-depleted human tumor necrosis factor

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9007579A1 *

Also Published As

Publication number Publication date
DE3843534A1 (en) 1990-07-12
WO1990007579A1 (en) 1990-07-12
CA2005053A1 (en) 1990-06-23

Similar Documents

Publication Publication Date Title
DE3789859T2 (en) Forms of colony stimulation factor 1.
DE69233351T2 (en) Multimers of soluble forms of TNF receptors, process for their preparation and pharmaceutical compositions containing them
DE3852255T3 (en) Tumor necrosis factor-inhibiting protein and its purification
DE69131044T2 (en) INTERLEUKIN-I ANTAGONIST AND ITS USE
DE3689845T2 (en) RECOMBINANT FIBROBLAST GROWTH FACTOR.
DE69129990T3 (en) MODIFIED HUMAN TUMOR NECROSIS FACTOR ALPHA RECEPTOR
DE3689391T2 (en) RECOMBINANT COLONY-STIMULATING FACTOR-1.
DE69733204T3 (en) NOVEL VEGF-SIMILAR FACTORS
EP0423252A1 (en) Tumour necrosis factor muteins
DE69433648T2 (en) HUMAN CHEMOKIN POLYPEPTIDE
DE3382575T2 (en) DNA SEQUENCES, RECOMBINANT DNA MOLECULES AND METHOD FOR THE PRODUCTION OF PIG GROWTH HORMONE-LIKE POLYPEPTIDES.
DE4014750A1 (en) MUTEINE OF THE GRANULOCYTE-STIMULATING FACTOR (G-CSF)
DE3125706A1 (en) INTERFERON AND THEIR PRODUCTION
DD154022A5 (en) PROCESS FOR PREPARING HUMAN PRE GROWTH HORMONE
DE69924009T2 (en) METHOD FOR INCREASING THE BIOLOGICAL ACTIVITY OF LIGANDS
DE68911461T2 (en) Derivatives of basic human / bovine fibroblast growth factor.
DE68923107T2 (en) DNA sequences, recombinant DNA molecules and methods for the production of lipocortin III, IV, V, and VI.
CH675731A5 (en)
DE69131421T2 (en) DNA ENCODING THE RECEPTOR OF THE GRANULOCYTE COLONY-STIMULATING FACTOR
DE69626387T2 (en) ANTAGONISTS OF HUMANEM INTERLEUKIN-6, WHICH ARE UNABLE TO BIND WITH GP 130 AND THEIR USE IN THE PRODUCTION OF PHARMACEUTICAL COMPOSITIONS
WO1990006943A2 (en) Novel tnf peptides
DE3884853T2 (en) Angiogenin inhibitors.
DE3881123T2 (en) Cloning of DNA encoding an antibacterial polypeptide precursor and expression of the precursor.
DD294500A5 (en) METHOD FOR PRODUCING A LARGE NUMBER OF PEPTIDE ANALOGS
DE69022165T2 (en) Cloning plasmid vector, primer vector thereof and cDNA library production method.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19910212

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE ES FR GB IT LI NL SE

17Q First examination report despatched

Effective date: 19931210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 19940318