CA2005053A1

CA2005053A1 - Tnf polypeptides

Info

Publication number: CA2005053A1
Application number: CA 2005053
Authority: CA
Inventors: Lothar Daum; Thomas Doerper; Heinz Hillen; Achim Moeller; Klaus Schollmeier; Nigel Walker; Gerhard Keilhauer
Original assignee: BASF SE
Current assignee: BASF SE
Priority date: 1988-12-23
Filing date: 1989-12-11
Publication date: 1990-06-23
Also published as: EP0423252A1; DE3843534A1; WO1990007579A1

Abstract

- 25 - O.Z. 0050/40432 Abstract of the disclosure:

TNF polypeptides which differ from natural TNF by the replacement and/or deletion of amino acids are described.
The novel polypeptides are suitable for controlling diseases.

Description

2C~
l O.Z. 0050/40432 Novel TNF polypeptide~

The present invention relate~ to novel peptides derived from tumor necrosis factor (TNF), the preparation thereof and the use thereof as drugs.

Carswell et al. (Proc. Natl. Acad. Sci. USA 72 (1975) 3666) reported that the serum of endotoxin-treated animals which had previously been infected with the Calmette-Guerin strain of Mycobacteria (BCG) brought about hemorrhagic necrosis in various mouse tumors. This activity wa~ ascribed to tumor necrosis factor. TNF also has a cytostatic or cytotoxic effect on a large number of transformed cell line~ in vitro, whereas normal human and animal cell lines are unaffected (Lymphokine Reports Vol.

2, pp 235-275, Academic Press, New York, 1981). Recently, the biochemical characterization and the gene for human TNF have been described (Nature 312 (1984) 724, J. Biol.
Chem. 260 (1985) 2345, Nucl. Acids Res. 13 (1985) 6361).

It i~ possible to deduce from this data the following protein structure for mature human TNF:

V~ r~pn~r~L~n~v~Du~RL~ uu~

ValGlu~rgA~nG~euValVaL~093oluGly~n~r~leT ffl br GlnVa~PheLy~y~ yq~ lL~ee~ DIle Sed~IleAlaV~Li7~yrG~huLy3V~L~ leLy~Pro Cy~DnAnI~uThxP~uGlyA~$au~Ly~nI~rprpo~Ila~u GlyGayValPhPr-lnT~l uLy ~ yAg~hy~o~brALX~uIluA~IsPnl4p Tp1e~P~aGlu~ nVal~heGlyIleIleAk~eu The TNF genes of cattle, rabbit~ and mice have also been described (Cold Spring Harbor Symp . Quant . Biol. 51 (1986) 597).

3.~

- 2 - o.Z. 0050/40432 Besides its cytotoxic properties, TNF is one of the main substances involved in inflammatory reactions (Pharmac.
Res. 5 (1988) 129). Animal models have shown that TNF is invol~ed in septic shock (Science 229 (1985) 869) and graft-versus-host disease (J. Exp. Med. 166 (1987) 1280).

We have now found that certain polypeptides derived from TNF have more beneficial properties.

The present invention relates to TNF polypeptides of the formula ValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAla AsnProGlnAlaGluGlyGlnLeuGlnTrpLeuA~nArgArgAlaAsnAlaLeu LeuAlaAsnGlyValGluLeuArgA~pAsnGlnLeuValValProSerGluGly LeuTyrLeuIleTyrSerGlnValLeuPheLysGlyGlnGlyCy~ProSerThr HisValLeuLeuThrHisThrIleSerArgIleAlaValSerTyrGlnThrLys ValAsnLeuLeuSerAlaIleLysSerProCysGlnArgGluThrProGluGly AlaGluAlaLysProTrp~yrGluProIleTyrLeuGlyGlyValPheGlnLeu GluLysGlyAspArgLeuSerAlaGluIleAsnArgProAspTyrLeuAspPhe AlaGluSerGlyGlnValTyrPheGlyIleIleAlaLeu, wherein at least one amino acid in positions 9, 11, 15, 26, 35, 41, 44, 46, 52, 54, 56, 57, 61, 62, 78, 87, 95, 119, 121, 133, 136, 137, 138, 139, 140, 141, 142, 144, 150, 156 snd/or 157 has been replaced by another natural ~-amino acid, and from 1 to 7 N-terminal amino acids can be deleted, as well as the salts thereof with physiologi-cally tolerated acids.

The present invention particularly relates to TNF poly-peptides having at least one of the following modifica-tion~:

Position 9: Ser replaced by A
Position 11: Ly~ replaced by A
Position lS: HiC replaced by B or C

- 3 - O.Z. 0050/40432 Position 26. Leu replaced by C
Position 35: Ala replaced by C
Position 41: Val replaced by C
Position 44: Arg replaced by A
Position 46: Asn replaced by A
Position 52: Ser replaced by A
Po~ition 54: Gly replaced by C
Position 56: Tyr replaced by C
Position 57: Leu replaced by C
Position 61: Gln replaced by C
Position 62: Val replaced by A or C
Po3ition 78: His replaced by C or B
Position 87: Tyr replaced by C
Position 95: Ser replaced by C
Posi~ion 119: Tyr replaced by C or A
Position 121: Gly replaced by C
Position 133: Ser replaced by C
Position 136: Ile replaced by C
Position 137: Asn replaced by A
Position 138: Arg replaced by A, B or C
Position 139: Pro replaced by A, C or B
Position 140: Asp replaced by A or C
Position 141: Tyr replaced by A
Position 142: Leu replaced by C
Position 144: Phe replaced by C or A
Position 150: Val replaced by A or C
Position 156: Ala replaced b~ C
Position 157: Leu replaced by B, where A is an amino acid with a charged side-chain, B ic an amino acid with a polar uncharged side-chain and C i8 an amino acid with a hydrophobic 3ide-chain. Hence, A is Arg, His, Lys, Glu or Asp, B i~ Gln, Asn, Gly, Met, Cy8, Ser or Thr and C i8 Phe, Leu, Ile, Trp, Tyr, Pro, Val or Ala.

It i~ preferable for not more ~han 10 amino acid~ at or 3t i~

- 4 - O.Z. 0050/40432 after position 9 in the TNF molecule to have been deleted or modified.

Particularly suitable physiologically tolerated acid3 are: hydrochloric acid, citric acid, tartaric acid, lactic acid, phosphoric acid, methanesulfonic acid, acetic acid, formic acid, maleic acid, fumaric acid, malic acid, succinic acid, malonic acid, sulfuric acid, L-glutamic acid, L-aspartic acid, pyruvic acid, mucic acid, benzoic acid, glucuronic acid, oxalic acid, a~cor-bic acid and acetylglycine.

The novel polypeptides are prepared starting from thecDNA of human TNF, which i8 obtained aR described in Nature 312 (1984) 724 and incorporated into a plasmid.
This recombinant pla~mid, which c~rrie~ the genetic information for human TNF, serve~ aR starting point for the preparation of the novel TNF muteinC.

In order to introduce the intended modifications into the gene for human TNF, the TNF cDNA fragment is prepared pure by consecutive cleavage with re3triction enzymes and subsequent electrophoresis through an agarose gel. This fragment containing the TNF gene i~ incorporated into a polylinker of a bacteriophage vector (Gene l9, 269-276).

Finally, transformation of E.coli with this recombinant vector results in phage~ which carry the coding ~trand of the human TNF gene.

For the ~ite-Rpecific mutagenQsis of the TNF gene, oligodeoxynucleotides which are partially complementary to the TNF ~equence are ~ynthesized chemically. These oligonucleotides have an average length of 23 mucleo-tides. There is at the 5' end a region of about lOnucleotide~ which i5 perfectly complementary to the TNF-encoding strand. This i8 followed by a section of 3 - 5 - O.Z. 0050/40432 nucleotides which is not complementary and carries the desired modification of the TNF gene. This section is followed by a portion which is about 10 nucleotides long and once again is perfectly complementary to the TNF-encoding strand.

Deletions are generated by u~ing oligodeoxynucleotideswhich have exact complementarity in front of and behind the gene sequence to be deleted; this results in the formation of a heteroduplex in which the gene sequence to be deleted is in the form of a single strand.

The oligonucleotide~ constructed in thi3 way are hybri-dized with the recombinant TNF DNA. Subsequently a polymera~e and deoxynucleoside triphosphates are used to fill in the heteroduplex to give the complete double ~tranded DNA molecule, and covalent linkage i~ carried out with the enzyme T4 DNA ligase.

Thi~ DNA molecule is used to transform competent E.coli cellc, and the phages obtained in this way are examined by in situ plaque testing (Science 196 (1977) 180).

For this, the phage DNA which has been tran~ferred to nitroCellU108Q i8 probed with the radiolabeled oligo-nucleotide used for the mutagenesis.

Hybridization under highly stringent condition3 i8 used to identify those phage~ which carry the desired modific-ation in the TNF gene. The mutation i~ confirmed by DNAsequencing.

It is ~ubsequently po~ible to extract the mutated TNF
gene from the recombinant TNF vector by cleavage with restriction enzyme3 and to isolate it in pure form by gel electrophoresis. For expression of thi~ modified TNF gene in E.coli the TNF gene fragment must be provided with - 6 - o.Z. 0050/40432 prokaryotic signals such as promoters, terminators and ribosome-binding sites (Winnacker, Gene und Clone Verlag Chemie 1984, pages 192 et seq.). This TNF expression vector is subsequently used to transform an E.coli strain. The recombinant E .coli strain obtained in this way is used to produce a TNF m~ltein by culturing it in a suitable nutrient medium. The bacteria are then harvested and lysed. This results in a soluble mixture of E.coli proteins, from which the desired TNF mutein can be isolated in pure form by conventional methods of protein purification such as ammonium sulfate precipitation, ion exchange chromatography and rever~e phase chromatography.

Some of the novel muteins have good cytotoxic propertie~.
Some others of the muteins have high affinity for the cellular TNF receptor without, however, having cytotoxic activity. They are therefore TNF antagonists. They compete with natural TNF for binding to the cellular TNF
receptor and thus suppre~3 the TNF effect. The novel mutein~ are valuable drugs which can be employed for treating neoplastic disea~es and autoimmune diseases as well as for controlling and preventing infections, inflammation~ and transplant re~ection reactions. Simple experiments can be used to elucidate the mode of action of the individual muteins. The cytotoxicity of the mutein is determined by incubating a TNF-~ensitive cell line in the presence of the mutein. In a second experimental approach, the cell line i~ incubated with the relevant mutein in the presence of a lethal amount of TNF. It is possible in this way to detect the TNF-antagonistic effect. In addition, the affinity of the mutein for the cellular TNF receptor is determined in an in vitro binding experiment.

The followinq test systems were u~ed to characterize the agoni3tic and antagoni~tic effects of the novel muteins:

- 7 - o.z. 0050t40432 I. Cytotoxicity test on TNF-sensitive indicator cells, II. Cytotoxicity antagonism test on TNF-sensitive indica~or cells, III. Competitive receptor-binding test on indicator cells expressing TNF receptor.

I. Cytotoxicity test The agonistic effects of the novel muteins are assessed on the basis of their cytotoxic effect on TNF-sen~itive cells (e.g. L929, MCF-7, A204, U937).
The test with L929 and MCF-7 wa~ carxied out as follows:

1. 100 ~1 of culture medium containing 3 to 5 x 103 freshly trypsinized, exponentially growing, L929 cell~ (mouse) or MCF-7 cell~ (human) were pipetted into the wells of a 96-well flat-bottom culture plate. The plate was incubated at 37C
overnight. The air in the incubator was ~aturated with water vapor and contained 5~ CO2 by volume.

The L929 culture medium contained 500 ml of lx Earle'~ MEM (Boehringer Mannheim), 50 ml of heat-inactivated (56C, 30 min) fetal calf serum (FCS), 50 ml of L-glutamine (200 mN), 5 ml of lOOx non~e~sential amino acids, 3 ml of lM HEPES
buffer pH 7.2,and 50 ml of gentamicin (50 mg/ml).

The MCF-7 culture medium contained 500 ml of lx Dulbecco~3 MEN (Boehringer Mannheim), 100 ml of heat-inactivated (56C, 30 min) FCS, 5 ml of L-glutamine and 5 ml of lOOx non-essential amino acids.

2. Ths next day 100 ~1 of the mutein solution to be tested were added to the cell cultures and ~ub~ected to serial 2-fold dilution. In addition, ~ O O ~ 3 ~

- 8 - O-Z- 0050/4043~
some cell controls ~i.e. cell cultures not treated with mutein dilution) and some rhu-TNF
controls (i.e. cell cultures treated with recom-binant human TNF) were also made up. The culture plate was incubated at 37C in an atmosphere of air saturated with water vapor and containing 5 C0z by volume for 48 h.

3. The percentage of surviving cells in the cultures treated with mutein dilution was determine~ by staining with crystal violet. For this purpose, the liquid was xemoved from the wells of the te~t plate by tapping it. 50 ~1 of crystal violet solution were pipetted into each well.

The composition of the crystal violet solution wa~ a~ follow~:

3.75 g of crystal violet 1.75 g of NaCl 161.5 ml of ethanol 43.2 ml of 37~ formaldehyde water ad 500 ml The crystal violet solution was laft in the wells for 20 min and th~n likewi3e removed by tapping.
The plates were then washed 5 times by immer3ion in water in order to remove dye not bound to the cells. The dye bound to the cells was extracted Dy adding 100 ~1 of reagent ~olution ~50% etha-nol, 0.1~ glacial acetic acid, 49.9~ water~ ~o each well.

4. The plates were shaken for 5 min to obtain a solution of uniform color in each well. The surviving cell~ were determined by measuring the extinction at 540 nm of the colored solution in 6)~i.3 - 9 - O.Z. OOS0~40432 the individual wells.

5. Subsequently, by relating to the cell control, the 50% cytotoxicity value was defined, and the reciprocal of the samp.Le dilution which re~ulted S in 50% cytotoxicity was calculated a~ the cyto-toxic activity of the test sample.

II. Cytotoxicity antagonism test The antagonistic effect of the muteins was assessed on the basi of their property of antagonizing the cytotoxic effect of rhu-TNF on TNF-sen-~itive cells (e.g. L929, MCF-7, A204, U937). The cytotoxicity antagonism te~t with L929 and MCF-7 cells wa~
carried out as follows:
1. 100 ~1 of culture medium containing 3 to 5 x 103 fre~hly trypsinized, exponentially growing, L929 cell~ (mouse) or MCF-7 cells (human) were pipetted into the wells of a 96-well flat-bottom culture plate. The plate was incubated at 37C
overnight. The air in the incubator was saturated with water vapor and contained 5% CO2 by volume.

The L929 culture medium contained 500 ml of lx Earle's NEM (Boehringer Nannheim), 50 ml of heat-inactivated (56C, 30 min) FCS, 5 ml of L-gluta-mine (200 mM), 5 ml of lOOx non-essential amino acid~, 3 ml of lM HEPES buffer pH 7.2, and 500 ~1 of gentamicin (50 ms/ml).

The MCF-7 culture medium con~ained 500 ml of lx Dulbecco'~ MEM (Boehringer Mannheim), 100 ml of heat-inactivated (56C, 30 min) FCS, 5 ml of L-glutamine (200 mN) and 5 ml of lOOx non-e~sen-tial amino acids.

2. The next day 100 ~1 of the mutein solution to be X~ )t-~5~

- 10 -- O.Z. 0050/40432 tested were added to the cell cultures and subjected to serial 2-fold dilution. Then, 100 ~1 of a rhu-TNF dilution in culture medium, which dilution had an 80-100~ cytotoxic effect in the final concentration in the cell culture, were added to these cell cultures. In addition, some cell controls (i.e. cell cultures not treated with mutein solution or with rhu-TNF solution) and some rhu-TNF controls (= cell culture~
treated only with rhu-TNF solution) were also made up. The culture plate was then incubated at 37C in an atmosphere of air saturated with water vapor and containing 5~ CO2 ~y volume for 48 h.

3. The percentage of surviving cells in the culture~
treated with substance dilution wa3 determined by staining with crystal violet. For this purpose, the liquid was removed from the wells of the test plate by tapping it. 50 ~1 of crystal violet solution were pipetted into each well.

The crystal violet solution had the composition specified in I.3 The crystal violet solution was lsft in the well~
for 20 min and then likewise removed by tapping.
Tho plate~ were then washed 5 times by immer~ion in water in order to remova dye not bound to the cells. The dye bound to the cells was extracted by adding 100 ~1 of reagent ~olution (50% etha-nol, 0.1% glacial acetic acid, 49.9% water) to each well.

4. The plates were shakan for 5 min to obtain a solution of uni f orm color in each well. The surviving cell~ were detenmined by measuring the extinction at 540 nm of the colored solution in ~ O.z. 0050/40432 the individual wells.

5. Subsequently, by relating to the cell control and the rhu-TNF con~rol, the 50~ antagonism value wa~
defined, and the s~nple concentration which resulted in 50~ antagonism of rhu-TNF cytotox-icity at the rhu-TNF concentration used was calculated a9 antagonistic activity of the sample tested.

III. Competitive receptor-binding te~t Both the agonistic and antagonistic effect~ of muteins are conditional on the latter binding to the TNF receptor. Thi~ mean~ that muteins with an agonistic or antagonistic effect compete with rhu-TNF for binding to the TNF receptor on TNF-sensitive indicator cellR (e.g. U937). The competi-tive receptor-binding te~t was carried out as follow~:

1. 100 ~l of medium containing various concentra-tion~ of the mutein to be tested and of rhu-TNF
(= control) were pipetted into the reaction vessels. The medium compri~ed 500 ml of PBS
(Boehringer Mannheim), 10 ml of heat-inactivated (56nC, 30 min) FCS and 100 mg of sodium azide.

2. Sub~equently, lO0 ~l of medium containing 1 ng of l25I-labeled rhu-TNF (Bolton lactoperoxida~e method) were placed in the reaction vessel3 and mixed. The non-specific binding (NSB) was deter-mined by mixing in the reaction vessel the lZ5I-labeled rhu-TNF (1 ng of~25I-rhu-TNF in 100 ~l of medium) with a 200-fold excesR of unlabeled rhu-TNF (200 ng of rhu-TNF in 100 ~l of medium).

3. Then 100 ~l of medium containing 2 x 10~ U937 - 12 - O.Z. OOS0/40432 cells (human) were pipetted into the reaction ves els and mixed. The reaction vessels (test volume 300 ~1) were incubated at 0C for 90 min.
The reaction mixtures were remixed after 45 min.

S 4. After the incubation the cell~ were centrifuged at 1800 rpm and 4~C for 5 min, washed 3 times with medium and transferred quantitatively into counting vials, and the cell-bound radioactivity was determined in a Clini gamma counter 1272 (LKB Wallac).

5. After the measurements had been corrected for the non-~pecific binding, the 50~ competition value was defined by relating to the overall binding, and the ~ample concentration which led to 50~
competition ofl25I-rhu-TNF binding at thel25I-rhu-TNF concentration used was calculated as the competitive activity of the sample tested.

Example a. Preparation of a vector which carries the cDNA of human TNF.

~he ~tarting material wa~ the 578 bp-long TNF cDNA
fragment which codes for amino acids 8 to ~57 (AvaI-HindIII fragment).

Th~ subfragment of TNF cDNA wa~ linked to a chemical synthesized adaptor which codes for amino acids 1 to 7 and incorporated into a suitable vector.

The adaptor used was a double-stranded DNA molecule of the following sequence:

CGATACTACTATG(N)s TA~GATGATAC(~)sGGCT, ~3~

- 13 - O.Z. 0050/40432 where x is O or a number which is divisible by 3 from 3 to 21, N is A, G, C or T and S M is the nucleotide complementary to each N.

It was possible, by varying the adaptors, to influence the sequence at the 5~ end of the TNF cDNA and thus to modify, after gene expression had taken place, the amino terminus of the TNF protein.

When GTCAGATCATCTTCTCGAACC was employed for N21, the result was the cDNA for the complete mature form of human TNF (1-157), with a methionine being incorporated in front of amino acid 1.

When x equal~ 0 the resulting adaptor linked to the TNF
cDNA codes for a TNF protein in which the first 7 amino acids at the amino terminus are deleted. It was addition-ally possible, by varying N, to generate all deletions between 1 and 7 amino acids at the amino terminus of TNF.

The adaptor~ were prepared by completely automated chemical synthesis (A~plied Biosy3tQms 380A) and purified by preparative polyacrylamide gel electrophore~is.

The vector u~ed wa~ a 4.3 kb-long DNA molecule obtained from pBR322 by cleavage with ClaI and HindIII.

0.2 pmol of the 587 bp-long TNF fragment was linked with 0.5 pmol of the appropriate adaptor and U.1 pmol of the vector using the enzyme T4 DNA ligase. This DNA was used to transform the E.coli strain W3110 (ATCC 27325), and 2 clone with the appropriate DNA sequence was isolated.

B. Preparation of a single-stranded vector with the sequence encoding human TNF

- 14 - O.z. 0050/40432 The TNF cDNA vector described above was cleaved with a restriction enzymes EcoRI and HindIII. A O .6 kb TNF cDNA
fragment was obtained in pure form by gel electrophoresis and subsequence extraction from the gel. 100 mg of this S fragment were mixed with 1 ~g of the M13mp8 EcoRI-HindIII
vector fra~ment in 20 ~1 of 50 mM Tris.HCl (pH = 7.4), 10 mM MgCl2, 25 mM di~hiothreitol and 1 mM ATP in the pre-sence of 5 units of T4 DNA liqase and incubated at 14C
overnight.

This mixture was used to transform E.coli JM103 (obtain-able from Pharmacia). Several plaques were isolated from the culture plates by stabbing with a Pasteur pipette, and were examined for TNF cDNA insertion by DNA sequenc-ing. Tha recombinant phage with the ~oding strand of the TNF cDNA is called Ml3-TNF.

~. Preparation of vectors with a modified TNF sequence.

The M13-TNF described above was the starting molecule for the site-directed mutagenesi~ of the TNF gene. In order to introduce the intended modifications it was necessary to have oligodeoxynucleotides which are partially com-plementary to the TNF-encoding strand ("antisense oli~o-nucleotides"). These oligonucleotides have a length of from 15 to 30 nucleotide~; the oligonucleotides which were preferably used had a length of 23 nucleotide~. The first 10 of the nucleotide~ were perfectly complementary to the TNF-encoding strand, and the~e were followed by a non-complementary region which carried the intended modification in the TNF gene, and thi~ wa~ followed by another perfectly complementary region of 10 nucleotide~.
The antisense oligonucleotide for replacing serine by aspartic acid as amino acid No. 9 was pCAGGCTTGTCGTCCGGG&TTCGA.

- 15 - O.Z. 0050/40~32 The antisense oligonucleotide for deleting aspartic acid as amino acid no. 140 was pAGTCGAGATAGGGCCGATTG .

The oligonucleotides used f ~r the mutagenesis are de-tailed in Tab. l.

Table l:
No. Sequence 5' - 3' G C T G G T T A T C TTT C A G C T C C A C G

A GT A G A T G A G G A T C A G G C C C T C T

17 G G G A G T A GATAGCG T A ~ A G G C C C

26 G G C A GG&GCTCTGGATGGCAGA G

., . ~

- 16 - O.Z. 0050/40432 C C C C T C C C A G ~ A C G A T G G G C T C A

38 GATAG ~r CGGGGAGA T T G A T CTCA

C G A G A T A G T C G T C C C G A T T G A T C

AATG

Theqe oligonucleotide~ wera synthesized by conventional method3. In order to be used for the mutagenesi~, 10 pmol of ~he oligonucleotides were pho~phorylated in 10 ~1 of SO~Tris.HCl(p~=7.5),0.1~EDT~,lO~MgCl2,10 mN dithiothreitol, 0.1 mM ATP in the prasence of 5 units - 17 - O.z. 0050/40432 of T4 polynucleotide kinase at 37C for 30 min.
In order to be used as probe (see below), 2 pmol of the synthetic oligonucleotide were phosphorylated as stated above apart from the use of 1 ~M ~-32P-ATP in place of 0.1 mM ATP.

The specific activity was in the region of 5X106 cpm per pmol of oligonucl~otide.

Hybridization of the oligonucleotides with the single-stranded DNA from M13-TNF produced, ater chain extension, a heteroduplex DNA in which one strand con-tained the mutated DNA.

For the partial heteroduplex formation, 300 ng of M13-TNF
DNA were heated with 1 pmol of the phosphorylated oligonucleotide in 20 ~1 of 10 mM Tris.HCl (pH = 7.5), 0.1 mN EDTA, 50 mM NaCl at 80C (2 min), 50C (5 min) and room temperature (5 min). The chain extension wa~ started by adding 30 ~1 of 50 mM Tri~.HCl ~pH=8.0), 0.1 mM EDTA, 12 mM MgCl2, 10 mM dithiothreitol, 0.7 mM ATP, 0.07 mM
dATP, 0.2 mM dGTP, dTTP, dCTP, 2 unit~ of E.coli polymer-ase I (large fragment) and 20 unit~ of T4 DNA ligase.

After 30 min at room temperature, the reaction mixture was incubated at 37C for 4 h and sub~equently at 4C
overnight. Aliguots were extracted with phenol, and the DNA was precipitated with ethanol and dissolved in 15 ~1 of water. The DNA in these aliquots was used to tran form E.coli JN 103.

Bacterial culture di~hes (15 cm diameter) which contained a few hundred recombinant phage plaques were examined by in ~itu plaque hybridization (Science 196 tl977) 180) for the mutated genotype, entailing hybridization of the appropriate radiolabelled oligonucleotide (the probe) and the nitrocellulose filter extracts of the phage plaques 3' ~
- 18 - O.Z. 0050/40432 tabout 106 cpm per filter). Hybridization was carried out at 50C overnight, 40~ formamide and 5xSSC (lxSSC = 0.1 M NaCl, 15 mM sodium citrate pH=7.2).

The filters were washed in 2xSSC, 0.02% sodium dodecyl sulfate at 45C, dried in air, placed on an X-ray film and exposed at -70C.

It was necessary to set the stringency of the hybridiza-tion individually for the particular oligonucleotide (by altering the SSC concentration when washing the filters);
each of the mutants had a different ability to hybridize with the oligonucleotide, depending on the number and nature of the replaced or deleted nucleotidec.

One phage hybridizing with the radiolabelled probe was removed from the bacterial culture plate by stabbing with a Pasteur pipette and wa~ used as inoculum for infection of E.coli JM 103.

The single-stranded DNA was prepared from the culture supernatant, and the double-stranded DNA wa~ prepared from the cell pellet.

The cingle-stranded DNA was sequenced by the dideoxy method (Proc.Natl.Acad.Sci., USA 74 (1977) 5463) in order to confirm the mutation. It was then possible to isolate the gene for the TNF mutein from the double-stranded DNA
by cleavage with the restriction enzyme~ ClaI and HindIII
and subsequent gel electrophoresis.

D. Production of the TNF muteins The gene, prepared in tha above examples, for a TNF
mutein waB linked at it~ 5' end (ClaI) to promoter ~equences ~uch as the lac promoter or trp promoter and ribosome-binding sites. The gena contained at its 3' end - 19 - o.Z. 0050/40432 (HindIII) a tr~nscription tenninator such as the trpA
terminator. These DNA sequence~ are all commercially available (pharmacia-LKs~ Freiburg).

The gene for the TNF mutein, which had been pro~ided with the necessary expression signals in this way, was incor-porated into a vector such a~ pBR322. This vector was used to transform the E.coli strain W3110, and the resulting clones were tested for TNF mutein production.
For this, the supernatant from the bacteria was diluted and then examined in a biological test. Position bac-terial clones are cultured in lO l of LB nutrient medium at 37C.

E. Purific~tion of the protein~

1 1 of broth from the fermentation of an E.coli strain producing a novel substance wa~ centrifuged at 3000xg for 30 min. The re~idue was taken up in 200 ml of 0.4 M
arginine hydrochloride, 20 mM sodium phosphate pH 8.5 and sonicated for 30 min. 6 ml of 2M NnCl2 were added to the suspension, which wa~ then centrifuged at 3000xg for 45 min. The supernatant was ad~usted to pH 8.9 with dilute NH3 solution, and ~olid ammonium sulfate was added to 60%
saturation.

The protein precipitate was su~pended in 0.2 M arginine hydrochloride pH 7.5 and dialyzed~again t 0.4 N arginine hydrochloride pH 7.5. A~ter 16 h, the ~olution was ad~usted to pH 8.S with dilute NH3 solution and diluted to 5 times the volume with water.

This solution was chromatographed on a ~R-Sepharose column (Pharmacia) equilibrated with 0.01 N arginine buffer pH 8.5. Elution was with 0.02 M sodium phosphate, 0.06 M NaCl. The eluate was diluted 2.5-fold and then chromatographed on a ~S-SepharosQ column tPharmacia) ~(3(~. bl 3~
- 20 -- O.Z. 0050/40432 equilibrated with 0.02 M sodium phosphate pH 8Ø The column was washed with equilibration buffer and then eluted with 0.05 M sodium phosphate, 0.1 ~ NaCl, 0.1 M
arginine pH 8.6 to give a protein pure by SDS polyacryl-S amide gel electrophoresis.

The following TNF proteins were prepared in this way by mutagenesi~ with the oligonucleotides listed in Table 1 in the specified sequence (the specified position~ are those in the TNF which have been modified):
Position 9: Ser replaced by Asp Position 11: Lys replaced by Glu Position 15: His replaced by Ser Position 15: Hi~ replaced by Val Po~ition 15: His replaced by Thr Position 15: His replaced by Gln Po3ition 24: Gly replaced by Glu Position 35: Ala replaced by Leu Position 41: Val replaced by Met Po~ition 44: Arg replaced by Ly~
Position 46: A~n replaced by Asp Position 52: Ser replaced by A~p Position 54: Gly replaced by Val Position 56: Tyr replaced by Phe Position 56: Tyr replaced by Ile Po~ition 56: Tyr replaced by Leu Position 57s Leu replaced by Ala Po~ition 61: Gln by Ile Position 62: Val replaced by Ile Position 62: Val replaced by Leu Po~ition 62: Val replaced by His Position 78: Hi3 replaced by Ser Po~ition 78: His replaced by Glu Po~ition 78: Hi~ replaced by Thr Position 78: His replaced by Val Po~ition 87: Tyr replaced by Phe Position 87: Tyr replaced by His ~ ( 3 ~ ~ ~, S ~
- 21 - O.Z. 0050/40432 Position 95: Ser replaced by Val Position 119: Tyr replaced by Phe Position 119: Tyr replaced by Arg Position 121: Gly replaced by Ala Position 121: Gly replaced by Val Position 133: Ser replaced by Val Position 136: Ile replaced by Val Position 137: Asn replaced by Asp Position 138~ Arg replaced by Asp Position 138: Arg replaced by Gly Position 138: Arg replaced by Leu Position 139: Pro replaced by Asp Position 139. Pro replaced by Ile Position 139: Pro replaced by Gly Position 140: Asp replaced by Pro Position 140: Asp replaced by Lys Po~ition 141: Tyr replaced by His Position 142: Leu replaced by Phe Position 144: Phe raplaced by Ala Position 144: Phe replaced by Glu Position 144: Phe replaced by His Position 144: Phe replaced by Arg Position 150: Val replaced by Leu Position 150: Val replaced by Ile Position 150: Val replaced by His Po~ition 156: Ala replaced by Val Position 157: Leu replaced by Gly.

Claims

1. A TNF polypeptide of the formula wherein at least one amino acid in positions 9, 11, 15, 26, 35, 41, 44, 46, 52, 54, 56, 57, 61, 62, 78, 87, 95, 119, 121, 133, 136, 137, 138, 139, 140, 141, 142, 144, 150, 156 and/or 157 has been replaced by another natural .alpha.-amino acid, and from 1 to 7 N-terminal amino acids can be deleted, as well as the salts thereof with physiologi-cally tolerated acids.

2. A TNF polypeptide as claimed in claim 1, in which there is at least one of the following modifications:

Position 9: Ser replaced by A
Position 11: Lys replaced by A
Position 15: His replaced by B or C
Position 26: Leu replaced by C
Position 35: Ala replaced by C
Position 41: Val replaced by C
Position 44: Arg replaced by A
Position 46: Asn replaced by A
Position 52: Ser replaced by A
Position 54: Gly replaced by C
Position 56: Tyr replaced by C
Position 57: Leu replaced by C
Position 61: Gln replaced by C

- 23 - O.Z. 0050/40432 Position 62: Val replaced by A or C
Position 78: His replaced by C or B
Position 87: Tyr replaced by C
Position 95: Ser replaced by C
Position 119: Tyr replaced by C or A
Position 121: Gly replaced by C
Position 133: Ser replaced by C
Position 136: Ile replaced by C;
Position 137: Asn replaced by A
Position 138: Arg replaced by A, B or C
Position 139: Pro replaced by A, C or B
Position 140: Asp replaced by A or C
Position 141: Tyr replaced by A
Position 142: Leu replaced by C
Position 144: Phe replaced by C or A
Position 150: Val replaced by A or C
Position 156: Ala replaced by C
Position 157: Leu replaced by B, where A is an amino acid with a charged side-chain, B is an amino acid with a polar uncharged side-chain and C is an amino acid with a hydrophobic side-chain.

3. DNA coding for a TNF polypeptide as claimed in claim 1.

4. A vector containing a DNA as claimed in claim 3.

5. A host organism containing a vector as claimed in claim 4.

6. A process for the preparation of a TNF polypeptide as claimed in claim 1, which comprises culturing a host organism as claimed in claim 5 and isolating the TNF
polypeptide therefrom.

7. A TNF polypeptide as claimed in claim 1 for use for - 24 - O.Z. 0050/40432 controlling diseases.

8. The use of a TNF polypeptide as claimed in claim 1 for controlling neoplastic diseases and autoimmune diseases as well as for controlling and preventing infections, inflammations and transplant rejection reactions.