EP0409923A1 - EXPRESSION DE LA PROTEINE DU CIRCUMSPOROZOITE DE $i(PLASMODIUM) DANS DES CELLULES D'INSECTE - Google Patents

EXPRESSION DE LA PROTEINE DU CIRCUMSPOROZOITE DE $i(PLASMODIUM) DANS DES CELLULES D'INSECTE

Info

Publication number
EP0409923A1
EP0409923A1 EP90900688A EP90900688A EP0409923A1 EP 0409923 A1 EP0409923 A1 EP 0409923A1 EP 90900688 A EP90900688 A EP 90900688A EP 90900688 A EP90900688 A EP 90900688A EP 0409923 A1 EP0409923 A1 EP 0409923A1
Authority
EP
European Patent Office
Prior art keywords
protein
cells
gene expression
expression unit
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP90900688A
Other languages
German (de)
English (en)
Other versions
EP0409923A4 (en
Inventor
Alex Bollen
Pascal Gilles
Michel Heinderyckx
Paul Jacobs
Hanne Ranch Johansen
Marc Massaer
Martin Rosenberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GlaxoSmithKline Biologicals SA
Original Assignee
GlaxoSmithKline Biologicals SA
SmithKline Biological SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GlaxoSmithKline Biologicals SA, SmithKline Biological SA filed Critical GlaxoSmithKline Biologicals SA
Publication of EP0409923A1 publication Critical patent/EP0409923A1/fr
Publication of EP0409923A4 publication Critical patent/EP0409923A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445—Plasmodium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/866—Baculoviral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/06—Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to expression of the Plasmodium Circumsporozoite protein in insect cells. More specifically, this invention relates to the production of such proteins in Drosophila and Lepidoptera
  • -> Human malaria is caused by a parasite of the genus Plasmodium.
  • Plasmodium There are four species of Plasmodium known to infect man: P. falciparum, P. vivax, P. malariae, and P. ovale. The most severe forms of human malaria are caused by P. falciparum and P. vivax; P.
  • the malarial parasite is transmitted by mosquitoes to man in the form of a sporozoite, which migrates to the liver, multiplies within hepatocytes and emerges to initiate a cyclical growth in erythrocytes.
  • the merozoite-stage parasite which is released at the en of each cycle, rapidly reinvades red blood cells.
  • the merozoite and sporozoite stages are antigenically distinct, and generally, antibodies against one stage do not cross react with another.
  • Subunit vaccines against the P. falciparum sporozoite have been directed towards the repeat region of the CS protein. Young et al. (Science, 228:958-62 (1985)) teach cloning and expression of tandem CS repeat units in E. coli. When introduced into mice, these molecules were highly immunogenic. Antibodies raised to the repeat units in mice recognized the CS protein on live sporozoites and blocked sporozoite invasion of human hepatoma cells in vitro.
  • subunit vaccines corresponding to synthetic or recombinant polypeptides of the. repeat region
  • vaccines thus far tested in humans have been insufficiently immunoprotective for widespread use (Ballou et al. , Lancet, 1:1277-81 (1987)).
  • Eqan et al. (Science, 236:453 (1987)) report that in the murine malarial model (P. berqhei) , protective immunity elicited by subunit vaccines and by sporozoites appear to be fundamentally different.
  • Subunit vaccines elicited a predominantly antibody mediated protection whereas irradiated sporozoites induced a prolonged, cell-mediated immunity.
  • Sadoff et al. teach expression of a protein comprising a full length P. berqhei CS protein in an avirulent strain of Salmonella typhimurium. This CS protein is expressed on the cell surface of S. typhimurium and induced an antigen-specific cell-mediated immunity. Sadoff et al. suggest that the CS protein contains a T cell epitope(s), which is capable of inducing protective cell-mediated immunity.
  • T cell domains for the P. falciparum CS protein were identified by synthesizing overlapping synthetic peptides spanning the entire CS protein. In all, three sites were located; all 3' to the CS repeat region.
  • Valenzuela et al. (US Patent 4,722,840)- and Rutgers et al. (Bio/Technology, 6_:1065-70 (1988)) teach various length P. falciparum CS repeats fused to the hepatitis B surface antigen. The fusions are expressed as viral particles in Saccharomyces cerevisiae.
  • baculovirus expression system a strong, temporally-regulated promoter can be used to express very high levels of heterologous genes.
  • Smith et al. US Patent 4,745,051
  • Matsuura et al. J Gen Virol, 68: 1233-50 (1987) disclose baculovirus vectors containing the polyhedrin gene promoter to express prokaryotic and eukaryotic genes.
  • Miller et al. (PCT/WO88/02030) teach a method for producing heterologous genes by employing a mixture of at least two genetically distinct baculoviruses.
  • Cochran et al. (EP-A-228,036) disclose expression of vaccinia growth factor (VGF) in a recombinant baculovirus.
  • VVF vaccinia growth factor
  • Cochran et al. present a hypothetical list of proteins which may be expressed in a recombinant baculovirus, including the hepatitis B surface antigen and Plasmodium polypeptides.
  • the present invention is a
  • Plasmodium circumsporozoite gene expression unit which includes a DNA coding sequence for the desired protein and regulatory sequences necessary for transcription of the protein coding sequence and subsequent translation within an insect cell.
  • this invention is a DNA vector or a recombinant baculovirus which comprises the gene expression unit of the present invention.
  • this invention is an insect cell transfected with the DNA vector or recombinant baculovirus of this invention.
  • this invention is a Plasmodium circumsporozoite protein, or a derivative thereof produced by the transfected insect cells of this invention.
  • the derivative encompasses any Plasmodium circumsporozoite protein such as deletions, additions, substitutions or rearrangement of amino acids or chemical modifications thereof which retain the ability to be recognized by antibodies raised to the wild-type Plasmodium circumsporozoite protein.
  • this invention is a vaccine for stimulating protection against malarial infection, which comprises an immunoprotective and non-toxic quantity * of the Plasmodium circumsporozoite protein produced by this invention.
  • This invention further relates to a method for preparing the protein of the invention.
  • This method comprises growing a host cell transfected with the gene expression unit of this invention in a suitable culture medium.
  • the present invention relates to expression of
  • Plasmodium proteins, and derivatives thereof, in insect cell cultures are transfected by using standard techniques to introduce foreign DNA into an insect host cell without adversely affecting the host cell.
  • the recombinant host cells so constructed produce Plasmodium proteins which are completely free of 1 contaminating materials. They may be expressed intracellularly, or membrane-bound, or secreted into the cell culture medium. Upon secretion, the protein is available by purification using conventional techniques.
  • Intracellularly expressed protein may be extracted from the host cells using conventional techniques as well.
  • the DNA coding sequence for the Plasmodium falciparum circumsporozoite protein is disclosed by Dame et al ⁇ , Science, 225:593-9 (1984) as follows: 10 l 5' ATG ATGAGAAAAT TAGCTATTTT
  • AAAACATAAA AAATTAAAGC AACCAGGGGA TGGTAATCCT GATCCAAATG 25
  • the first ATG codes for a N-terminal methionine and the last codon, TAG, is a translation termination (i.e., stop) signal.
  • DNA molecules comprising the coding sequence of this invention can be derived from P. falciparum mRNA using known techniques, e.g. , making complementary or cDNAs from mRNA template or via the polymerase chain reaction (see, Mullis et al. , U.S. Patent 4,800,159). Alternatively, such coding sequence may be synthesized by standard DNA synthesis techniques. In addition, there are numerous recombinant host cells containing the P_ ; _ falciparum circumsporozoite DNA molecule, which are widely available.
  • the invention is not limited to the specifically disclosed sequence, but includes all CS protein DNA coding sequences, as described below.
  • CS protein includes both the full length circumsporozoite protein of P. falciparum, substantially as illustrated above, and all derivatives thereof.
  • derivative encompasses any CS DNA coding sequence such as a truncated CS coding sequence or other derivatives which encode a protein that retains the ability to induce an immune response to the wild-type CS protein following internal administration to man.
  • Such other derivatives can be prepared by the addition, deletion, substitution, or rearrangement of amino acids or by chemical modifications thereof.
  • the CS DNA coding sequence of the invention comprises the full length CS protein, or a CS protein derivative which retains substantially the entire conserved region * I (bases 319-363) and conserved region II (bases 1030-1068) and at least one Asn-Ala-Asn-Pro tetrapeptide unit, as discussed more fully below.
  • the CS DNA coding sequence used in the instant invention is substantially the same (i.e., differs in no more than about 10 amino acids) as the DNA coding sequence encoded by the above illustrated sequence, or which is lacking all or part of the carboxy terminal anchor region (approximately amino acids 392-412), or lacking the signal peptide (approximately amino acids 1-18), or lacking both a signal peptide and an anchor region.
  • Examples of preferred embodiments are,,given in Example 1.
  • the derivative of the invention can be a hybrid, that is, a fusion polypeptide containing additional DNA coding sequences which can carry one or more epitopes for other sporozoite immunogens, other Plasmodium immunogens, or other non-Plasmodium immunogens.
  • the derivative of the invention can be fused to a carrier polypeptide which has immunostimulating properties, as in the case of an adjuvant, or which otherwise enhances the immune response to the CS polypeptide, or which is useful in expressing, purifying or formulating the CS polypeptide.
  • a desirable DNA coding sequence for the CS protein of this invention may be constructed by fusing the mature CS protein DNA coding sequence to a heterologous signal sequence, e.g., the sequence of tissue plasminogen activator (tPA) .
  • a heterologous signal sequence e.g., the sequence of tissue plasminogen activator (tPA) .
  • tPA tissue plasminogen activator
  • Such signal sequence functions to direct secretion of the protein from the host cell.
  • the signal sequence may also be derived from other available signal sequences, e.g., those derived from
  • Herpes Simplex virus gene HSV-I gD (Lasky et al. , Science, supra.).
  • the CS * DNA coding sequence may also be followed by a polyadenylation (poly A) region, such as an SV40 early poly A region.
  • poly A region which functions in the polyadenylation of RNA transcripts, appears to play a role in stabilizing transcription.
  • a similar poly A region can be derived from a variety of genes in which it is naturally present. This region can also be modified to alter its sequence provided that polyadenylation and transcript stabilization functions are not adversely affected.
  • the recombinant DNA coding sequence of this invention may also carry a genetic selection marker.
  • the selection marker can be any gene or genes which cause a readily detectable phenotypic change in a transfected host cell.
  • phenotypic change can be, for example, drug resistance, such as the gene for hygromycin B resistance.
  • DHFR can be used with Drosophila cells.
  • the endogenous eukaryotic DHFR of the cells is inhibited by methotrexate. Therefore by transfecting cells with a plasmid containing the prokaryotic DHFR, which is insensitive to methotrexate, and then selecting with methotrexate, only cells transfected with and expressing the prokaryotic DHFR will survive.
  • methotrexate can be used in the Drosophila system to initially obtain high-copy number transfectants. Only the cells which have incorporated the protective prokaryotic DHFR gene will survive. Concomitantly, these cells have the gene expression unit of interest.
  • the regulatory region typically contains a promoter region which functions in the binding of RNA polymerase and in the initiation of.ENA transcription.
  • the promoter region is typically found upstream from the CS protein coding sequence.
  • Drosophila promoters include mammalian cell promoters as well as Drosophila promoters, the latter being preferred.
  • useful Drosophila promoters include the Drosophila metallothionein promoter. (Lastowski-Perry et al. , J. Biol. Chem. , 260: 1527 (1985)). This inducible promoter directs high-level transcription of the gene in the presence of metals, e.g., CuSO..
  • Use of the Drosophila metallothionein promoter results in the expression system of the invention retaining full regulation even at very high copy number.
  • the Drosophila actin 5C gene promoter (B.J. Bond et al ⁇ , Mol. Cell. Biol., 6_: 2080 (1986)) is also a desirable promoter sequence.
  • the actin 5C promoter is a constitutive promoter and does not require addition of metal. Therefore, it is better-suited for use in a large scale production system, like a perfusion system, than is the Drosophila metallothionein promoter.
  • An additional advantage is that the absence of a high concentration of copper in the media maintains the cells in a healthier state for longer periods of time.
  • Drosophila promoters examples include, e.g., the inducible heatshock (Hsp70) and COPIA LTR promoters.
  • Hsp70 inducible heatshock
  • COPIA LTR promoters COPIA LTR promoters.
  • the SV40 early promoter gives lower levels of expression than the Drosophila metallothionein • promoter.
  • Promoters which are commonly employed in the cell expression vectors including, e.g., avian Rous sarcoma virus LTR and simian virus (SV40 early promoter) demonstrate poor function and expression in the Drosophila system.
  • Promoters for use in Lepidoptera cells include promoters from a baculovirus genome.
  • the promoter for the polyhedrin gene is preferred because the polyhedrin protein is naturally over expressed relative to other baculovirus proteins.
  • the preferred polyhedrin gene promoter is from the AcMNPV baculovirus. See, Summers et al. , U.S. Patent 4,745,051; Smith et al. , Proc Natl Acad Sci USA, 82:8404 (1985); and Cochran, EP-A-228,036.
  • Insect cells which can be used in the invention include Drosophila SI, S2, S3, KC-0 and D. hydei cells. See, for example, Schneider et al. , J Embryo1 Exp Morph, 27:353 (1972); Schultz et al. , Proc Natl Acad Sci USA, 183:9428 (1986); Sinclair et al. , Mol Cell Biol, 5_:3208 (1985) .
  • a preferred Drosophila cell line for use in the practice of the invention is the S 2 line.
  • S 2 cells (Schneider, J. Embryol. Exp. Morph. 27: 353 (1972)) are stable cell cultures of polyploid embryonic Drosophila cells.
  • S 2 Drosophila cell has many ' advantages, including, but not limited to, its ability to grow to a high density at room temperature. Stable integration of the selection system has produced up to 1000 copies of the transfected gene expression unit into the cell chromosomes.
  • Drosophila cell culture systems may also be useful in the present invention.
  • Some possibly useful cells are, for example, the KC-0 Drosophila Melanoqaster cell line which is a serum-free cell line (Schulz et al ⁇ , Proc. Nat'l Acad. Sci. USA, 83 . : 9428 (1986)). Preliminary studies using the KC-0 line have suggested that transfection is more difficult than with S 2 cells.
  • Another cell line which may be useful is a cell line from Drosophila hydei. Protein expression can be obtained using the hydei cell line; however, transfection into this cell line can result in the transfected DNA being expressed with very low efficiency (Sinclair et al. , Mol. Cell. Biol., 5 ⁇ : 3208 (1985)].
  • Other available Drosophila cell lines which may be used in this invention include s and S 3 -
  • the Drosophila cells selected for use in the present invention can be cultured in a variety of suitable nutrient media, including, e.g., M 3 medium.
  • M 3 medium consists of a formulation of balanced salts and essential amino acids at a pH of 6.6. Preparation of the media is substantial, as described by Lindquist, PIS (Drosophila Information- Services) , 58 ⁇ 163 (1982). Other conventional media for growth of Drosophila cells may also be used.
  • Useful Lepidoptera cells include cells from
  • baculoviruses include nuclear polyhedrosis viruses (NPV) , single nucleocapsid viruses 5 (SNPV) and multiple nucleocapsid viruses (MNPV) .
  • NPV nuclear polyhedrosis viruses
  • SNPV single nucleocapsid viruses 5
  • MNPV multiple nucleocapsid viruses
  • the preferred baculoviruses are NPV or MNPV baculoviruses because these contain the polyhedrin gene promoter which is highly expressed in infected cells.
  • MNPV virus from 10 Autoqraphica California (AcMNPV).
  • AcMNPV Autoqraphica California
  • other MNPV and NPV viruses can also be employed such as the silkworm virus, Bombyx mori.
  • Lepidoptera cells are transfected with the recombinant baculovirus of the invention, according to standard transfection techniques. These 15 include but are not limited to, calcium phosphate precipitation, electroporation, and liposome-mediated transfer.
  • Cells are cultured in ' accordance with standard cell culture techniques in a variety of nutrient media, including, for example, TCI00 (Gibco Europe; Gardiner et 20 al.
  • a CS protein is expressed in Lepidoptera cells to produce
  • immunogenic polypeptides For expression of the CS protein in Lepidoptera cells, use of a baculovirus expression system is preferred.
  • an expression cassette comprising the CS protein DNA coding sequence, operat-ively linked to a baculovirus promoter, 5 typically is placed into a shuttle vector.
  • Such vector contains a sufficient amount of bacterial DNA to propagate the shuttle vector in E. coli or some other suitable prokaryotic host.
  • Such shuttle vector also contains a sufficient amount of baculovirus DNA flanking the CS protein coding sequence so as to permit recombination between a wild-type baculovirus and the heterologous gene.
  • The- recombinant vector is then cotransfected into Lepidoptera cells with DNA from a wild-type baculovirus.
  • the recombinant baculoviruses arising from homologous recombination are then selected and plaque purified by standard techniques. See Summers et al. , TAES Bull (Texas Agricultural Experimental Station Bulletin) NR 1555, May, 1987.
  • CS protein can be produced in Heliothis virescens caterpillars by feeding the recombinant baculovirus of the invention along with traces of wild-type baculovirus and then extracting the CS protein from, the hemolymph after about two days. See, for example. Miller et al. , PCT/WO88/02030.
  • a CS protein is expressed in Drosophila host cells.
  • Drosophila host cells use of a two-vector system is preferred.
  • a CS protein gene expression unit is typically found on an expression vector.
  • This expression vector comprises a regulatory region which functions in Drosophila, e.g., metallothionein or actin SC ' promoter, a gene expression unit and a polyadenylation region, e.g., SV40 poly A site.
  • the second vector of the two-vector system comprises a selection marker gene expression unit, e.g., hygromycin B or DHFR.
  • the vector, pCOHYGRO encodes the hygromycin B phosphotransferase gene, which when expressed confers hygromycin B resistance to the transfected host cells which are expressing said selectable marker gene.
  • Another example is the dihydrofolate reductase (DHFR) gene, which, when expressed, is useful as a selectable marker in the presence of methotrexate.
  • DHFR dihydrofolate reductase
  • Drosophila S 2 cells are especially suited to high-yield production of protein in the method of the present invention.
  • the cells can be maintained in suspension cultures at room temperature (24+l°C) .
  • Culture medium is M 3 supplemented with between 5 and 10% (v/v) heat-inactivated fetal bovine serum (FBS) .
  • FBS heat-inactivated fetal bovine serum
  • the culture medium contains 5% FBS.
  • the cells are cultured in serum-free media.
  • the media is also supplemented with 300 ⁇ g/ml hygromycin B.
  • the S 2 cells can be grown in suspension cultures, for example, in 250 ml to 2000 ml spinner flasks, with stirring at 50-60 rpm. Cell densities are typically maintained between 10 6 and 107 cells per ml. In one embodiment of this invention, the cells are grown prior to induction in 1500 ml spinner flasks in media containing 5% serum. Transcription and expression of the CS protein coding sequence in the above-described systems can be monitored. For example, Southern blot analysis can be used to determine copy number of the CS gene. Northern blot analysis provides information regarding the size of the transcribed gene sequence (see, e.g., Maniatis et al. , Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982)). The level of transcription can also be quantitated. Expression of the selected CS protein in the recombinant cells can be further verified through Western blot analysis.
  • the purification of the CS polypeptide from eel 1 culture is carried out by conventional protein isolation techniques, e.g., selective precipitation, absorption chromatography and affinity chromatography, including a monoclonal antibody affinity column, as described in Example 3.
  • the proteins produced by Drosophila cells are completely free of mammalian, bacterial and protozoal contaminating materials and, more importantly, from other Plasmodium materials.
  • the vaccine of the invention comprises an immunoprotective amount of P. falciparum CS protein, prepared by the method of this invention.
  • the term "immunoprotective" refers to the amount necessary to elicit an immune response against a subsequent challenge such that disease is averted or mitigated.
  • the vaccine of the invention comprises an aqueous solution of the insect derived CS protein which can ' be used directly.
  • the CS protein with or without prior lyophilization, can be mixed or absorbed with any of the various known adjuvants.
  • Such adjuvants include, but are not limited to, aluminum hydroxide, muramyl dipeptide and saponins such as Quil A.
  • the CS protein can be encapsulated within microparticles such as liposomes.
  • the CS protein can be conjugated to an immunostimulating macromolecule, such as killed Bordetella or a tetanus toxoid.
  • Vaccine preparation is generally described in New Trends and Developments in Vaccines, Voller et al.
  • Plasmid WR201 is obtained from the Walter Reed Army Institute of Research. It contains a 2.3 kilobase, EcoRI fragment from phage ⁇ mPfl, which encodes the complete P. falciparum circumsporozoite protein of 412 amino acids, signal sequence inclusive. See Dame et al. , Science, 22j5:593-9 (1984). From WR201, a Stul - AsuII fragment is isolated which codes for amino acids 18 - 412 of the CS protein plus 3' untranslated DNA.
  • a HindiII - Stul synthetic oligomer 5' 3 AGCTTACCATGATGAGAAAATTAGCTATTTTATCTGTTTCTTCCTTTTTATTTGTTGAG ATGGTACTACTCTTTTAATCGATAAAATAGACAAAGAAGGAAAAATAAACAACTC 3' 5 to recreate amino acids 1 - 17, but lacking the 5' untranslated DNA region.
  • the new fragment i.e. HindiII-Stul-AsuII
  • E. coli DNA polymerase I, Large Fragment i.e. Klenow Fragment
  • Klenow Fragment Large Fragment
  • Plasmid TigND is a derivative of plasmid TND
  • Plasmid TigND differs from plasmid TND in that the Rous LTR is replaced by the mouse gamma 2B heavy chain immunoglobin enhancer sequence.
  • the HindiII-Stul-AsuII CS gene fragment can be inserted into the HindiII - AceI sites of pUC19 or pBR322 or other standard cloning vectors.
  • Plasmid pAcYMl is a baculovirus shuttle vector containing sequences from the AcMNPV genome which includes the polyhedrin gene promoter, but not the polyhedrin gene, and sequences from a high copy number bacterial plasmid, pUC8. See Matsuura et al. , J Gen Virol, 68: 1233-50 (1987). From pNIV2103, a 1261 base pair HindiII - Ddel fragment, coding for the full length CS protein, including 3' untranslated P. falciparum DNA from WR201, is treated with E. coli DNA polymerase I and isolated. The blunt-ended fragment is then ligated into a blunt-ended BamHl site of plasmid pAcYMl, to create a plasmid herein referred to as pNIV2H2.
  • Example (i) is first cloned into the HindiII - Accl sites of M13mpl8, a standard vector used in subcloning, sequencing, and m ⁇ tagenesis. Then, using standard techniques of site-directed mutagenesis, the CS gene was mutagenized with the primer:
  • plasmid pNIV2105 From pNIV2104, a 1180 base pair HindiII - Bell blunt-ended fragment, coding for amino acids 1 - 391, is then ligated into a blunt-ended BamHl site of pAcYMl to create plasmid pNIV2105.
  • This plasmid is essentially the same as pNIV2112 except that it codes for a CS protein lacking the carboxy terminus.
  • pNIV2111 which is missing the first 17 codons (i.e. signal sequence) in addition to the last 21 codons of the CS protein gene.
  • This vector is constructed by (1) deleting the Xhol - Stul fragment from pNIV2105, comprising the polyhedrin gene promoter through the CS signal sequence (amino acids 1 - 17), and (2) replacing this fragment with a synthetic linker:
  • pNIV2111 encodes a CS protein from amino acids 18 to 391, which is lacking a signal and an anchor sequence.
  • the tPA expression vector pMTtPA (also called pDMtPA) was used.
  • This vector is a derivative of vector pMLl, a small pBR322 vector containing the beta-lactamase gene which has deleted the poison sequences [Mellon et e . , Cell, 27: 297 (1982)]. These sequences are inhibitory to amplification of the vector.
  • This vector was digested with Sail and Aat2 which removes a small piece of pBR322, and the digested ends were filled in.
  • the missing piece of pBR322 is then replaced with a cassette containing the Drosophila metallothionein promoter on an end-filled EcoRl-Stul fragment, followed by a filled-in Hindlll-Sacl fragment from pDSPI [D.S. Reifen et al. , DNA, 4/6) : 461 (1985)] containing a tPA signal sequence, prepeptide and the entire coding region of tPA.
  • the tPA gene on this fragment is followed by an SV40 early polyadenylation site.
  • COPIA is a representative member of the disperse middle repetition sequences found scattered through the Drosophila genome [Rubin et al. , in Cold Spring Harbor Symp. Quant. Biol., 45: 619 (1980)].
  • the vector pUCOPIA was cut at the Smal site and the E_;_ coli gene coding for hygromycin B phosphotransferase (hygromycin B cassette) was cloned into pUCOPIA using standard cloning techniques.
  • the hygromycin B cassette was isolated oh a Hindlll-BamHI fragment of 1481 base " pairs from the vector DSP-hygro [Gertz et al. , Gene, 25: 179 (1983)].
  • the hygromycin B cassette contains the sequence coding for the hygromycin B phosphotransferase gene and the SV40 early poly A region.
  • the HindiII and BamHl sites were filled in using T. DNA polymerase, and the hygromycin B cassette was ligated into the Smal site of the vector pUCOPIA producing vector pCOHYGRO.
  • a BstXl - Xbal fragment encoding for amino acids 26 - 391 was isolated from plasmid pULB122lCSPdel. This fragment and a synthetic Bglll - BstXl adapter, which codes for serine and CS amino acids 19-25:
  • AAATAAGGTCCTTATGGTC 5' was ligated into the Bglll - Xbal sites of vector having the Drosophila metallothionein promoter, a tPA signal sequence, and an SV40 early polyadenylation site such as the pMTtPA derived vector pgpl60 ⁇ 32 (Johansen et al. , U.S. Patent Application Serial No. 07/278,386, filed Dec. i, 1988.).
  • the resultant vector, pMTcsp39l encodes a mature CS protein missing a carboxy terminal anchor sequence (i.e., missing amino acids 392 - 412) and having an additional serine residue at the amino terminal end, vii) pMTcsp398
  • Another vector containing a modified P. falciparum CS coding sequence was constructed by digesting vector pMTcsp391 with the restriction endonucleases HgiAI and Xbal and subsequently replacing the HgiAI - Xbal fragment with a synthetic oligonucleotide adaptor of the sequence:
  • the adaptor encodes for CS amino acids 390 - 398 plus a termination codon.
  • This resultant vector designated pMTcsp398, encodes a mature CS protein having an additional serine at the amino terminal end and which is also lacking carboxy terminal anchor codons 399-412, i.e., ser-CS 19 _ 398 .
  • a 1492 bp BstXl - EcoRV fragment encoding the P ⁇ falciparum CS protein (amino acids 26 - 412) was isolated from plasmid WR201 (cited above) .
  • This BstXl - EcoRV fragment and the same synthetic adaptor for vector construction (vi) was ligated into the Bglll - Sacl (blunt-ended) sites of vector pMTtPA (see construction (iv)).
  • the final construct, pMTcsp412 encodes for a mature CS protein (amino acids 19 - 412) plus an additional serine at the amino terimus, i.e., ser-CS 19 _ 412 .
  • Spodoptera frugiperda 9 (Sf9) cells are available from the ATCC (Rockville, MD, USA).
  • the Sf9 cells were cotransfected with one of the following recombinant vectors, plasmid pNIV2112, pNIV2105 or pNIV2111 and with wild-type AcMNPV DNA, at 50 ⁇ g and 1 ⁇ g respectively; substantially as described by Summers et al. , TAES Bull, NR 1555, May 1987, cited above. Resulting virus particles were obtained by collecting the supernatants. The virus-containing media was then used to infect Sf9 cells in a plaque assay. Subsequent infection of Sf9 cells with a plaque purified recombinant baculovirus resulted in cells expressing the CS protein instead of the polyhedrin protein.
  • the recombinant baculovirus infected cells derived from pNIV2112 were shown to express a CS protein intracellularly, at roughly 3 ⁇ g/ml of infected culture medium supernatant.
  • Western blot analysis showed essentially one band at about 60 kilodaltons.
  • the recombinant baculovirus infected cells derived from ' pNIV2105 express an "anchor-less", i.e., lacking a carboxy terminal anchor, CS protein, at a level of approximately 1 ⁇ g/ml of a 7 day culture supernatant.
  • anchor-less i.e., lacking a carboxy terminal anchor, CS protein
  • Western blot analysis of proteins in the supernatant and in the cell extract showed two immunoreactive doublet bands at about 50 and 60 kilodaltons.
  • Cells infected with pNIV2lll express a CS protein intracellularly at a level of approximately 3 ⁇ g/ 1.5 x 10 cells, 3 days post infection.
  • Western blot analysis of the proteins in the cell extract showed essentially 2 bands at approximately 50 kilodaltons.
  • the MTcsp vectors of Example 1 were each contransfected with pCOHYGRO into Drosophila S 2 cells in the ratio of MTcsp vector to pCOHYGRO of 20:1. Transfection was performed by conventional techniques using CaPO. precipitation. Polyclonal cell lines were generated after selection with hygromycin B for 2 weeks. Single clonal cell lines were generated by serially diluting the polyclonal cell line and plating one cell per well in 96 well dishes. The cell lines were grown up and the expression of CS protein was monitored after 6 days of induction with CuSO. of a culture with a cell density of 5x10 cells/ml.
  • the recombinant CS proteins expressed in S. frugiperda cells were purified as follows: Sf9 infected cells were lysed by 3 freeze-thawing cycles in RIPA buffer (50 mM Tris-HCl pH 7.2, 0.15M NaCl, 1% Triton X-100, 0.1% . SDS, 1% Na deoxycholate) . The crude extract was centrifuged for 30 min at 13,000 rpm . The supernatant was incubated with DNAse for 30 min at 37°C, pH 7.5. The pH was adjusted to 5.5 and RNAse and MgSO. were added.
  • the cell extract was made 1M in MgCl 2 and 1M in NaCl; the pH was then adjusted to 1.6 by addition of concentrated HC1 and the sample was incubated for 1 hr at 0 C, then centrifuged 30 min at 13,000 rpm. The supernatant was dialyzed against 20 mM ammonium carbonate pH 7.5 and applied onto an affinity column made of a monoclonal antibody recognizing the repeats of the CS protein (See Nardin et al. , J Exp Med, 156:20 (1982)). Elution was performed with 100 mM Na acetate at pH 4.0 in the presence of 500 mM NaCl.
  • This purification technique is also effective with recombinant CS proteins expressed in a Drosophila host.
  • An illustrative vaccine of this invention is prepared as follows: The insect-derived recombinant CS protein of this invention is added with stirring to a final concentration of 10 - 2,000 ⁇ g/ml, preferably 600 - 1600 ⁇ g/ml, in a buffered saline solution (150 mM
  • Each vaccine dose contains 0.5 ml to 3.0 ml of the CS vaccine formulation, prepared as described above.
  • the amount of polypeptide per dose is about l to about 2,000 ⁇ g.
  • each dose would contain approximately 800 ⁇ g of polypeptide/ 0.5 ml.
  • the vaccine is preferably administered parenterally, e.g. , intramuscularly (im) or subcutaneously (sc), although other routes of administration may be used to elicit a protective response.
  • the vaccine is administered in a one-dose or multiple-dose course, e.g. 2 to 4 supplementary doses. Preferably, a multiple-dose course is administered 1 - 6 weeks apart. Thereafter, vaccinees can be revaccinated as needed, e.g., annually.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Des protéines du circumsporozoïte de Plasmodium sont exprimées dans des cellules de Lépidoptère transfectées et/ou dans des cellules de Drosophile transfectées.
EP19900900688 1988-12-21 1989-12-13 Expression of the i(plasmodium) circumsporozoite protein in insect cells Withdrawn EP0409923A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US28793488A 1988-12-21 1988-12-21
US287934 1999-04-07

Publications (2)

Publication Number Publication Date
EP0409923A1 true EP0409923A1 (fr) 1991-01-30
EP0409923A4 EP0409923A4 (en) 1993-01-20

Family

ID=23105005

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19900900688 Withdrawn EP0409923A4 (en) 1988-12-21 1989-12-13 Expression of the i(plasmodium) circumsporozoite protein in insect cells

Country Status (11)

Country Link
EP (1) EP0409923A4 (fr)
JP (1) JPH03504082A (fr)
KR (1) KR910700352A (fr)
AU (1) AU634512B2 (fr)
CA (1) CA2005512A1 (fr)
DK (1) DK187790D0 (fr)
IL (1) IL92782A0 (fr)
NZ (1) NZ231795A (fr)
PT (1) PT92677A (fr)
WO (1) WO1990007006A1 (fr)
ZA (1) ZA899610B (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2003794C (fr) * 1988-12-01 2000-02-08 Hanne R. Johansen Expression de proteines de vih dans des cellules de drosophiles
US9169304B2 (en) 2012-05-01 2015-10-27 Pfenex Inc. Process for purifying recombinant Plasmodium falciparum circumsporozoite protein

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0166410A2 (fr) * 1984-06-26 1986-01-02 THE UNITED STATES OF AMERICA as represented by the Secretary United States Department of Commerce Peptides à activité immunologique induisant l'immunisation contre la malaria et leur codage génétique
EP0278941A1 (fr) * 1987-01-30 1988-08-17 Smithkline Biologicals S.A. Expression de la protéine de circumsporozoite du P. falciparum dans la levure
EP0290261A1 (fr) * 1987-05-08 1988-11-09 Smithkline Beecham Corporation Expression de gènes étrangers dans les cellules de Drosophila

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4745051A (en) * 1983-05-27 1988-05-17 The Texas A&M University System Method for producing a recombinant baculovirus expression vector

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0166410A2 (fr) * 1984-06-26 1986-01-02 THE UNITED STATES OF AMERICA as represented by the Secretary United States Department of Commerce Peptides à activité immunologique induisant l'immunisation contre la malaria et leur codage génétique
EP0278941A1 (fr) * 1987-01-30 1988-08-17 Smithkline Biologicals S.A. Expression de la protéine de circumsporozoite du P. falciparum dans la levure
EP0290261A1 (fr) * 1987-05-08 1988-11-09 Smithkline Beecham Corporation Expression de gènes étrangers dans les cellules de Drosophila

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MOL. BIOL. MED., vol. 5, 1988, pages 185-196, Academic Press Ltd; F. DONTFRAID et al.: "Human and murine CD4 T cell epitopes map to the same region of the malaria circumsporozoite protein: limited immunogenicity of sporozoites and circumsporozoite protein" *
MOLECULAR AND CELLULAR BIOLOGY, vol. 6, no. 6, June 1986, pages 2080-2088; American Society for Microbiology, US; B.J. BOND et al.: "The Drosophilia melanogaster Actin 5C gene uses two transcription initiation sites and three polyadenylation sites to express multiple mRNA species" *
See also references of WO9007006A1 *

Also Published As

Publication number Publication date
WO1990007006A1 (fr) 1990-06-28
EP0409923A4 (en) 1993-01-20
IL92782A0 (en) 1990-09-17
DK187790A (da) 1990-08-06
AU634512B2 (en) 1993-02-25
NZ231795A (en) 1992-04-28
ZA899610B (en) 1990-11-28
KR910700352A (ko) 1991-03-14
AU4803790A (en) 1990-07-10
JPH03504082A (ja) 1991-09-12
DK187790D0 (da) 1990-08-06
CA2005512A1 (fr) 1990-06-21
PT92677A (pt) 1990-06-29

Similar Documents

Publication Publication Date Title
JP3183879B2 (ja) ポリペプチドおよびこれをコードするｄｎａ
AU627465B2 (en) Expression of retrovirus gag protein in eukaryotic cells
EP0340359B1 (fr) Vecteurs de transfert de Baculovirus
KR0166585B1 (ko) 앵커-결여 vzv 당단백질, 이를 제조하는 방법 및 이의 면역보호적 용도
AU647190B2 (en) Expression system
AU4314489A (en) Fusion protein of paramyxovirus, method of production using recombinant baculovirus expression vector, vaccine comprising such protein and use thereof
HU211673A9 (en) Coccidiosis vaccines
WO1992001057A1 (fr) Vaccin a base de glycoproteine de vhe-4 (virus d'herpes equin-4)
EP0759995A1 (fr) Glycoproteine hybride de hcmv et hsv
AU634512B2 (en) Expression of the plasmodium circumsporozoite protein in insect cells
KR20000065265A (ko) 말라리아 원충 msp-1의 c-말단 단편을 함유하는 재조합 단백질
EP0432168B1 (fr) Vaccin contre la coccidiose prepare par genie genetique
EP0278941A1 (fr) Expression de la protéine de circumsporozoite du P. falciparum dans la levure
Matsuoka et al. Induction of anti-malarial transmission blocking immunity with a recombinant ookinete surface antigen of Plasmodium berghei produced in silkworm larvae using the baculovirus expression vector system
EP0695358A1 (fr) Antigenes recombines du virus ourlien et leur utilisation dans les vaccins
US5733553A (en) Recombinant birth control vaccine
EP0514411B1 (fr) Polypeptiques et adn codant pour ces derniers, associes aux parasites de la malaria chez l' tre humain
WO1998014472A1 (fr) Proteines de fusion pfs28
US7737262B2 (en) Plasmodium falciparum polypeptides and methods of using same
Jacobs et al. Plasmodium falciparum: recombinant baculoviruses direct the expression of circumsporozoite proteins in Spodoptera frugiperda cell cultures
US5695957A (en) Polypeptides and DNA encoding same, associated with human malaria parasites
WO1991005049A1 (fr) Vaccin rebombinant de limitation des naissances

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19900810

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

A4 Supplementary search report drawn up and despatched

Effective date: 19921201

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

17Q First examination report despatched

Effective date: 19930210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19930821