EP0409923A1

EP0409923A1 - EXPRESSION OF THE i(PLASMODIUM) CIRCUMSPOROZOITE PROTEIN IN INSECT CELLS

Info

Publication number: EP0409923A1
Application number: EP90900688A
Authority: EP
Inventors: Alex Bollen; Pascal Gilles; Michel Heinderyckx; Paul Jacobs; Hanne Ranch Johansen; Marc Massaer; Martin Rosenberg
Original assignee: GlaxoSmithKline Biologicals SA; SmithKline Biological SA
Current assignee: GlaxoSmithKline Biologicals SA
Priority date: 1988-12-21
Filing date: 1989-12-13
Publication date: 1991-01-30
Also published as: WO1990007006A1; ZA899610B; EP0409923A4; KR910700352A; AU4803790A; NZ231795A; AU634512B2; CA2005512A1; PT92677A; DK187790D0; IL92782A0; JPH03504082A; DK187790A

Abstract

Des protéines du circumsporozoïte de Plasmodium sont exprimées dans des cellules de Lépidoptère transfectées et/ou dans des cellules de Drosophile transfectées.Plasmodium circumsporozoite proteins are expressed in transfected Lepidopteran cells and / or in transfected Drosophila cells.

Description

Title

10 EXPRESSION OF THE PLASMODIUM CIRCUMSPOROZOITE PROTEIN IN INSECT CELLS

Field of Invention

15

The present invention relates to expression of the Plasmodium Circumsporozoite protein in insect cells. More specifically, this invention relates to the production of such proteins in Drosophila and Lepidoptera

20 cells.

Background of the Invention

-> Human malaria is caused by a parasite of the genus Plasmodium. There are four species of Plasmodium known to infect man: P. falciparum, P. vivax, P. malariae, and P. ovale. The most severe forms of human malaria are caused by P. falciparum and P. vivax; P.

_3Q falciparum is the most prevalent.

The malarial parasite is transmitted by mosquitoes to man in the form of a sporozoite, which migrates to the liver, multiplies within hepatocytes and emerges to initiate a cyclical growth in erythrocytes.

-j. The merozoite-stage parasite, which is released at the en of each cycle, rapidly reinvades red blood cells. The merozoite and sporozoite stages are antigenically distinct, and generally, antibodies against one stage do not cross react with another.

It has been shown that mammals, including man, have been protected against Plasmodium challenge when vaccinated with irradiated sporozoites (Clyde et al. , Am J Trop Med Hyq, 24:397 (1975), Nussenzweig et al. , Phil Tran R Soc Lond B, 302:117-28 (1984)). This method, while effective, is limited due to the difficulty of cultivating sporozoites. The sporozoites express a species-specific surface protein, the circumsporozoite (CS) protein, which was first identified in P. berqhei, a parasite of rodents. Monoclonal antibodies to this protein completely protected mice from challenge with infected mosquitoes (Potocnjak et al. , J Exp Med, 151:1504-13 (1980)).

Dame et al. , (Science, 225:593-9 (1984), US Patent 4,707,357) disclose cloning of the P. falciparum CS protein in E. coli. This gene encodes a protein of 412 amino acids, which contains 41 tetrapeptide repeats (37 invariant and 4 variant tetrapeptide units) . Monoclonal antibodies against the CS protein were inhibited from binding to it in the presence of synthetic peptides, derived from the repeat region. Enea et al. , (Science, 225:628-9 (1984)) further characterized an immunodominant epitope of the repeat region to consist of:

(Pro-Asn-Ala-Asn) In addition, Arnot et al. , (Science, 230:815-18 (1985)) teach cloning and the sequence of the P. vivax CS protein. The general structure of this CS protein was found to be similar in gross structure to the P. falciparum and P. knowlesi (a simian malarial species) CS proteins. That is, they consist of an amino terminal signal sequence, a carboxy terminal anchor domain, and a large central repeat domain flanked on both sides by conserved sequences referred to as regions I and II. The repeat domain is the immunodominant region of the CS protein. The conserved regions (I and II) are found to be highly charged.

Subunit vaccines against the P. falciparum sporozoite have been directed towards the repeat region of the CS protein. Young et al. (Science, 228:958-62 (1985)) teach cloning and expression of tandem CS repeat units in E. coli. When introduced into mice, these molecules were highly immunogenic. Antibodies raised to the repeat units in mice recognized the CS protein on live sporozoites and blocked sporozoite invasion of human hepatoma cells in vitro.

In addition, Young et al. disclose very low expression of the mature (i.e., minus the signal sequence) P. falciparum CS protein in E. coli. Dame et al. (Science, 225:593-9 (1984)) disclose low level expression of the full length (P. falciparum CS protein in E. coli. Both of these references (i.e., Young et al. and Dame et al. ) do not disclose a method of producing P. falciparum CS protein in useful quantities. Dame et al. (US Patent 4,707,357), Ballou et al.

(Science, 228:996-9 (1985)), Zavala et al. (Science, 228:1436-40 (1985)), Mazier et al. (Science, 231:156-9 (1986)), and Nussenzweig et al. (PCT/WO86/05790) disclose the use of synthetic peptides as subunit vaccines based on epitopes identified in the repeat region. More recently, Vergara et al. (PCT/WO86/01721) and Bernardi et al. (UK 2,193,215A and UK 2,199,038A) disclose antigenic peptides comprising Regions I and/or II fused to tetrapeptide repeats of the CS protein. The development of these subunit vaccines, corresponding to synthetic or recombinant polypeptides of the. repeat region, has been hampered due to their limited protective immunity. Although subunit vaccines of P. falciparum CS protein repeats have successfully immunized mice from malaria, vaccines, thus far tested in humans have been insufficiently immunoprotective for widespread use (Ballou et al. , Lancet, 1:1277-81 (1987)). Eqan et al. (Science, 236:453 (1987)) report that in the murine malarial model (P. berqhei) , protective immunity elicited by subunit vaccines and by sporozoites appear to be fundamentally different. Subunit vaccines elicited a predominantly antibody mediated protection whereas irradiated sporozoites induced a prolonged, cell-mediated immunity.

Sadoff et al. (Science, 240:336-8 (1988)) teach expression of a protein comprising a full length P. berqhei CS protein in an avirulent strain of Salmonella typhimurium. This CS protein is expressed on the cell surface of S. typhimurium and induced an antigen-specific cell-mediated immunity. Sadoff et al. suggest that the CS protein contains a T cell epitope(s), which is capable of inducing protective cell-mediated immunity.

Good et al. , Proc Natl Acad Sci USA, 85: 1199-1203 (1988) disclose T cell domains for the P. falciparum CS protein. These sites were identified by synthesizing overlapping synthetic peptides spanning the entire CS protein. In all, three sites were located; all 3' to the CS repeat region.

Sinigaglia et al. , Nature, 336:778-780 (1988), disclose that some synthetic peptides corresponding to a region of the P. falciparum protein, 3' to the repeat region, can be recognized by T cells of different MHC class II molecules.

The production of an effective vaccine, however, depends on the ability to manufacture large quantities of antigen. Barr et al. (J Exp Med, 165:1160 (1987)) disclose expression of a recombinant . vivax CS protein in yeast. It contains the entire repeat domain plus 15 amino acids preceding the repeats and 48 amino acids following the repeats on the carboxy terminal side.

Valenzuela et al. , (US Patent 4,722,840)- and Rutgers et al. (Bio/Technology, 6_:1065-70 (1988)) teach various length P. falciparum CS repeats fused to the hepatitis B surface antigen. The fusions are expressed as viral particles in Saccharomyces cerevisiae.

De Wilde et al. , PCT/WO88/05817, disclose expression of the mature (i.e., minus the signal sequence) P. falciparum CS protein in S. cervisiae.

Smith et al. (Science, 224:397-9 (1984)) disclose expression of the P. knowlesi CS protein in a recombinant virus. Mammalian cells infected with the recombinant virus expressed a CS polypeptide that was recognized by a monoclonal antibody against the P. knowlesi CS protein.

In the baculovirus expression system, a strong, temporally-regulated promoter can be used to express very high levels of heterologous genes. Smith et al. (US Patent 4,745,051) and Matsuura et al. (J Gen Virol, 68: 1233-50 (1987)) disclose baculovirus vectors containing the polyhedrin gene promoter to express prokaryotic and eukaryotic genes.

Miller et al. (PCT/WO88/02030) teach a method for producing heterologous genes by employing a mixture of at least two genetically distinct baculoviruses. Cochran et al. (EP-A-228,036) disclose expression of vaccinia growth factor (VGF) in a recombinant baculovirus. In addition, Cochran et al. present a hypothetical list of proteins which may be expressed in a recombinant baculovirus, including the hepatitis B surface antigen and Plasmodium polypeptides.

In addition to the baculovirus expression system, Drosophila cells have also been reported to express foreign bacterial genes. H. Johansen et al . , 28th Annual Drosophila Conference, p. 41 (1987) is an abstract by the inventors of the present application which briefly states that E _ coli galK genes regulated by a Drosophila metallothionein promoter were expressed in Drosophila cell lines. In a later report, Johansen et al. , Genes & Dev,

3.:882-889 (1989) disclose expression of the human H-ras oncogene in Drosophila host cells.

A. Vanderstraten et al■ , Proceedings of the 7th International Conference on Invertebrate and Fish Tissue Culture, Abstract, University of Tokyo Press, Japan, (1987) and A. Vanderstraten et al. , in "Invertebrate and Fish Tissue Culture", Eds. Y. Kuroda et al. , Japan Scientific Societies Press, Tokyo, pp. 131-134, (1988) are also publications by the present inventors which discuss a hygromycin B selection system for use in expressing foreign genes in D. melanoqaster cells in culture. The abstract notes that the system was used to co-introduce and overexpress the E. coli galK gene and other genes of mammalian origin.

B.J. Bond et al■ , Mol Cell Biol, £(6):2080 (1986) disclose the structure of the Drosophila melanoqaster actin 5C gene. The report discusses the two transcription start sites of the actin 5C gene and fusions between the promoter sequences and bacterial chloramphenicol acetyltransferase gene inserted into D. melanoqaster host cells.

It is thus an object of this invention to express proteins in insect cells and to use these recombinant products as vaccinal and diagnostic agents.

Summary of Invention

In one aspect, the present invention is a

Plasmodium circumsporozoite gene expression unit which includes a DNA coding sequence for the desired protein and regulatory sequences necessary for transcription of the protein coding sequence and subsequent translation within an insect cell. In related aspects, this invention is a DNA vector or a recombinant baculovirus which comprises the gene expression unit of the present invention.

In yet, another related aspect, this invention is an insect cell transfected with the DNA vector or recombinant baculovirus of this invention.

In further related aspects, this invention is a Plasmodium circumsporozoite protein, or a derivative thereof produced by the transfected insect cells of this invention. The derivative encompasses any Plasmodium circumsporozoite protein such as deletions, additions, substitutions or rearrangement of amino acids or chemical modifications thereof which retain the ability to be recognized by antibodies raised to the wild-type Plasmodium circumsporozoite protein.

In another aspect, this invention is a vaccine for stimulating protection against malarial infection, which comprises an immunoprotective and non-toxic quantity^* of the Plasmodium circumsporozoite protein produced by this invention.

This invention further relates to a method for preparing the protein of the invention. This method comprises growing a host cell transfected with the gene expression unit of this invention in a suitable culture medium.

Detailed Description of the Invention

The present invention relates to expression of

Plasmodium proteins, and derivatives thereof, in insect cell cultures. The insect cells are transfected by using standard techniques to introduce foreign DNA into an insect host cell without adversely affecting the host cell. The recombinant host cells so constructed produce Plasmodium proteins which are completely free of 1 contaminating materials. They may be expressed intracellularly, or membrane-bound, or secreted into the cell culture medium. Upon secretion, the protein is available by purification using conventional techniques.

5 Intracellularly expressed protein may be extracted from the host cells using conventional techniques as well. The DNA coding sequence for the Plasmodium falciparum circumsporozoite protein is disclosed by Dame et al■ , Science, 225:593-9 (1984) as follows: 10 l 5' ATG ATGAGAAAAT TAGCTATTTT

24 ATCTGTTTCT TCCTTTTTAT TTGTTGAGGC CTTATTCCAG GAATACCAGT

74 -GCTATGGAAG TTCGTCAAAC ACAAGGGTTC TAAATGAATT AAATTATGAT 15

124 AATGCAGGCA CTAATTTATA TAATGAATTA GAAATGAATT ATTATGGGAA

174 ACAGGAAAAT TGGTATAGTC TTAAAAAAAA TAGTAGATCA CTTGGAGAAA

20 224 ATGATGATGG AAATAATAAT AATGGAGATA ATGGTCGTGA AGGTAAAGAT

274 GAAGATAAAA GAGATGGAAA TAACGAAGAC AACGAGAAAT TAAGGAAACC

324 AAAACATAAA AAATTAAAGC AACCAGGGGA TGGTAATCCT GATCCAAATG 25

374 CAAACCCAAA TGTAGATCCC AATGCCAACC CAAATGTAGA TCCAAATGCA

424 AACCCAAATG TAGATCCAAA TGCAAACCCA AATGCAAACC CAAATGCAAA

30. 474 CCCAAATGCA AACCCAAATG CAAACCCAAA TGCAAACCCA AATGCAAACC

524 CAAATGCAAA CCCAAATGCA AACCCCAATG CAAATCCTAA TGCAAATCC

574 AATGCAAACC CAAATGCAAA TCCTAATGCA AACCCAAATG CAAACCCAA 5

624 CGTAGATCCT AATGCAAATC CAAATGCAAA CCCAAATGCA AACCCAAAC 674 CAAACCCCAA TGCAAATCCT AATGCAAACC CCAATGCAAA TCCTAATGCA

724 AATCCTAATG CCAATCCAAA TGCAAATCCA AATGCAAACC CAAACGCAAA

774 CCCCAATGCA AATCCTAATG CCAATCCAAA TGCAAATCCA AATGCAAACC

824 CAAATGCAAA CCCAAATGCA AACCCCAATG CAAATCCTAA TAAAAACAAT

874 CAAGGTAATG GACAAGGTCA CAATATGCCA AATGACCCAA ACCGAAATGT

924 AGATGAAAAT GCTAATGCCA ACAATGCTGT AAAAAATAAT AATAACGAAG

974 AACCAAGTGA TAAGCACATA GAACAATATT TAAAGAAAAT AAAAAATTCT

1024 ATTTCAACTG AATGGTCCCC ATGTAGTGTA ACTTGTGGAA ATGGTATTCA

1074 AGTTAGAATA AAGCCTGGCT CTGCTAATAA ACCTAAAGAC GAATTAGATT

1124 ATGAAAATGA TATTGAAAAA AAAATTTGTA AAATGGAAAA ATGTTCCAGT

1172 GTGTTTAATG TCGTAAATAG TTCAATAGGA TTAATAATGG TATTATCCTT

1224 CTTGTTCCTT AATTAG 3'

Wherein the first ATG codes for a N-terminal methionine and the last codon, TAG, is a translation termination (i.e., stop) signal.

DNA molecules comprising the coding sequence of this invention can be derived from P. falciparum mRNA using known techniques, e.g. , making complementary or cDNAs from mRNA template or via the polymerase chain reaction (see, Mullis et al. , U.S. Patent 4,800,159). Alternatively, such coding sequence may be synthesized by standard DNA synthesis techniques. In addition, there are numerous recombinant host cells containing the P__;_ falciparum circumsporozoite DNA molecule, which are widely available.

The invention is not limited to the specifically disclosed sequence, but includes all CS protein DNA coding sequences, as described below. As used herein, the terms "CS protein", "circumsporozoite protein" or "CS polypeptide" includes both the full length circumsporozoite protein of P. falciparum, substantially as illustrated above, and all derivatives thereof. The term "derivative" encompasses any CS DNA coding sequence such as a truncated CS coding sequence or other derivatives which encode a protein that retains the ability to induce an immune response to the wild-type CS protein following internal administration to man. Such other derivatives can be prepared by the addition, deletion, substitution, or rearrangement of amino acids or by chemical modifications thereof.

The CS DNA coding sequence of the invention comprises the full length CS protein, or a CS protein derivative which retains substantially the entire conserved region^*I (bases 319-363) and conserved region II (bases 1030-1068) and at least one Asn-Ala-Asn-Pro tetrapeptide unit, as discussed more fully below.

As an example, the CS DNA coding sequence used in the instant invention is substantially the same (i.e., differs in no more than about 10 amino acids) as the DNA coding sequence encoded by the above illustrated sequence, or which is lacking all or part of the carboxy terminal anchor region (approximately amino acids 392-412), or lacking the signal peptide (approximately amino acids 1-18), or lacking both a signal peptide and an anchor region. Examples of preferred embodiments are,,given in Example 1.

The derivative of the invention can be a hybrid, that is, a fusion polypeptide containing additional DNA coding sequences which can carry one or more epitopes for other sporozoite immunogens, other Plasmodium immunogens, or other non-Plasmodium immunogens. Alternatively, the derivative of the invention can be fused to a carrier polypeptide which has immunostimulating properties, as in the case of an adjuvant, or which otherwise enhances the immune response to the CS polypeptide, or which is useful in expressing, purifying or formulating the CS polypeptide.

As an example, a desirable DNA coding sequence for the CS protein of this invention may be constructed by fusing the mature CS protein DNA coding sequence to a heterologous signal sequence, e.g., the sequence of tissue plasminogen activator (tPA) . Such signal sequence functions to direct secretion of the protein from the host cell. The signal sequence may also be derived from other available signal sequences, e.g., those derived from

Herpes Simplex virus gene HSV-I gD (Lasky et al. , Science, supra.).

The CS^* DNA coding sequence may also be followed by a polyadenylation (poly A) region, such as an SV40 early poly A region. The poly A region, which functions in the polyadenylation of RNA transcripts, appears to play a role in stabilizing transcription. A similar poly A region can be derived from a variety of genes in which it is naturally present. This region can also be modified to alter its sequence provided that polyadenylation and transcript stabilization functions are not adversely affected.

The recombinant DNA coding sequence of this invention may also carry a genetic selection marker. The selection marker can be any gene or genes which cause a readily detectable phenotypic change in a transfected host cell. Such phenotypic change can be, for example, drug resistance, such as the gene for hygromycin B resistance. Alternatively, a selection system using the drug methotrexate and prokaryotic dihydrofolate reductase

(DHFR) can be used with Drosophila cells. The endogenous eukaryotic DHFR of the cells is inhibited by methotrexate. Therefore by transfecting cells with a plasmid containing the prokaryotic DHFR, which is insensitive to methotrexate, and then selecting with methotrexate, only cells transfected with and expressing the prokaryotic DHFR will survive.

Furthermore, unlike the methotrexate selection of transformed mammalian and bacterial cells, methotrexate can be used in the Drosophila system to initially obtain high-copy number transfectants. Only the cells which have incorporated the protective prokaryotic DHFR gene will survive. Concomitantly, these cells have the gene expression unit of interest.

Also included in the recombinant molecule are regulatory regions necessary or desirable for transcription of the CS protein coding sequence and its subsequent translation and expression in the host cell. The regulatory region typically contains a promoter region which functions in the binding of RNA polymerase and in the initiation of.ENA transcription. The promoter region is typically found upstream from the CS protein coding sequence.

Promoters known to be useful in Drosophila cells include mammalian cell promoters as well as Drosophila promoters, the latter being preferred. Examples of useful Drosophila promoters include the Drosophila metallothionein promoter. (Lastowski-Perry et al. , J. Biol. Chem. , 260: 1527 (1985)). This inducible promoter directs high-level transcription of the gene in the presence of metals, e.g., CuSO.. Use of the Drosophila metallothionein promoter results in the expression system of the invention retaining full regulation even at very high copy number. This is in direct contrast to the use of the mammalian metallothionein promoter in mammalian cells in which the regulatory effect of the metal is diminished as copy number increases. In the Drosophila expression system, this retained inducibility effect increases expression of the gene product in the Drosophila cell at high copy number.

The Drosophila actin 5C gene promoter (B.J. Bond et al^, Mol. Cell. Biol., 6_: 2080 (1986)) is also a desirable promoter sequence. The actin 5C promoter is a constitutive promoter and does not require addition of metal. Therefore, it is better-suited for use in a large scale production system, like a perfusion system, than is the Drosophila metallothionein promoter. An additional advantage is that the absence of a high concentration of copper in the media maintains the cells in a healthier state for longer periods of time.

Examples of other known Drosophila promoters include, e.g., the inducible heatshock (Hsp70) and COPIA LTR promoters. The SV40 early promoter gives lower levels of expression than the Drosophila metallothionein • promoter. Promoters which are commonly employed in the cell expression vectors including, e.g., avian Rous sarcoma virus LTR and simian virus (SV40 early promoter) demonstrate poor function and expression in the Drosophila system.

Promoters for use in Lepidoptera cells include promoters from a baculovirus genome. The promoter for the polyhedrin gene is preferred because the polyhedrin protein is naturally over expressed relative to other baculovirus proteins. The preferred polyhedrin gene promoter is from the AcMNPV baculovirus. See, Summers et al. , U.S. Patent 4,745,051; Smith et al. , Proc Natl Acad Sci USA, 82:8404 (1985); and Cochran, EP-A-228,036.

Insect cells which can be used in the invention include Drosophila SI, S2, S3, KC-0 and D. hydei cells. See, for example, Schneider et al. , J Embryo1 Exp Morph, 27:353 (1972); Schultz et al. , Proc Natl Acad Sci USA, 183:9428 (1986); Sinclair et al. , Mol Cell Biol, 5_:3208 (1985) . A preferred Drosophila cell line for use in the practice of the invention is the S₂ line. S₂ cells (Schneider, J. Embryol. Exp. Morph. 27: 353 (1972)) are stable cell cultures of polyploid embryonic Drosophila cells. Use of the S₂ Drosophila cell has many^' advantages, including, but not limited to, its ability to grow to a high density at room temperature. Stable integration of the selection system has produced up to 1000 copies of the transfected gene expression unit into the cell chromosomes.

Other Drosophila cell culture systems may also be useful in the present invention. Some possibly useful cells are, for example, the KC-0 Drosophila Melanoqaster cell line which is a serum-free cell line (Schulz et al■ , Proc. Nat'l Acad. Sci. USA, 83_.: 9428 (1986)). Preliminary studies using the KC-0 line have suggested that transfection is more difficult than with S₂ cells. Another cell line which may be useful is a cell line from Drosophila hydei. Protein expression can be obtained using the hydei cell line; however, transfection into this cell line can result in the transfected DNA being expressed with very low efficiency (Sinclair et al. , Mol. Cell. Biol., 5_^: 3208 (1985)]. Other available Drosophila cell lines which may be used in this invention include s and S₃-

The Drosophila cells selected for use in the present invention can be cultured in a variety of suitable nutrient media, including, e.g., M₃ medium. The M_ medium consists of a formulation of balanced salts and essential amino acids at a pH of 6.6. Preparation of the media is substantial, as described by Lindquist, PIS (Drosophila Information- Services) , 58_^ 163 (1982). Other conventional media for growth of Drosophila cells may also be used. Useful Lepidoptera cells include cells from

Trichoplusia ni, Spodoptera fruqiperda, Heliothis- zea, 1 Autoqraphica californica, Rachiplusia ou, Galleria melonella, Manduca sexta or other cells which can be infected with baculoviruses. These include nuclear polyhedrosis viruses (NPV) , single nucleocapsid viruses 5 (SNPV) and multiple nucleocapsid viruses (MNPV) . The preferred baculoviruses are NPV or MNPV baculoviruses because these contain the polyhedrin gene promoter which is highly expressed in infected cells. Particularly exemplified hereinbelow is the MNPV virus from 10 Autoqraphica California (AcMNPV). However, other MNPV and NPV viruses can also be employed such as the silkworm virus, Bombyx mori. Lepidoptera cells are transfected with the recombinant baculovirus of the invention, according to standard transfection techniques. These 15 include but are not limited to, calcium phosphate precipitation, electroporation, and liposome-mediated transfer. Cells are cultured in^' accordance with standard cell culture techniques in a variety of nutrient media, including, for example, TCI00 (Gibco Europe; Gardiner et 20 al. , J Invert Path, 25:363 (1975)) supplemented with 10% fetal calf serum (FCS) and grown at 27° to 28°C for 18 to 24 hours. Excellent yields of recombinant virus-encoded products are achieved with infection of actively growing cultures at densities of 1 to 1.2 x 10

25 cells/ml. See, Miller et al. , in Setlow and Hollander (eds.), Genetic Engineering: Principles and Methods, Vol 8, pp. 277-98, Plenum Publishing Co., New York, 1986.

In an preferred embodiment of this invention, a CS protein is expressed in Lepidoptera cells to produce

30. immunogenic polypeptides. For expression of the CS protein in Lepidoptera cells, use of a baculovirus expression system is preferred. In such system, an expression cassette comprising the CS protein DNA coding sequence, operat-ively linked to a baculovirus promoter, 5 typically is placed into a shuttle vector. Such vector contains a sufficient amount of bacterial DNA to propagate the shuttle vector in E. coli or some other suitable prokaryotic host. Such shuttle vector also contains a sufficient amount of baculovirus DNA flanking the CS protein coding sequence so as to permit recombination between a wild-type baculovirus and the heterologous gene. The- recombinant vector is then cotransfected into Lepidoptera cells with DNA from a wild-type baculovirus. The recombinant baculoviruses arising from homologous recombination are then selected and plaque purified by standard techniques. See Summers et al. , TAES Bull (Texas Agricultural Experimental Station Bulletin) NR 1555, May, 1987.

Production in insect cells can also be accomplished by infecting insect larvae. For example, a CS protein can be produced in Heliothis virescens caterpillars by feeding the recombinant baculovirus of the invention along with traces of wild-type baculovirus and then extracting the CS protein from, the hemolymph after about two days. See, for example. Miller et al. , PCT/WO88/02030.

In another preferred embodiment, a CS protein is expressed in Drosophila host cells. For expression in Drosophila cells, use of a two-vector system is preferred. In such a system, a CS protein gene expression unit is typically found on an expression vector. This expression vector comprises a regulatory region which functions in Drosophila, e.g., metallothionein or actin SC ^' promoter, a gene expression unit and a polyadenylation region, e.g., SV40 poly A site. The second vector of the two-vector system comprises a selection marker gene expression unit, e.g., hygromycin B or DHFR. The vector, pCOHYGRO, as further described in Example 1, encodes the hygromycin B phosphotransferase gene, which when expressed confers hygromycin B resistance to the transfected host cells which are expressing said selectable marker gene. Another example is the dihydrofolate reductase (DHFR) gene,, which, when expressed, is useful as a selectable marker in the presence of methotrexate. These selectable markers along with the cotransfection of Drosophila cells is further described by Johansen et al■ , U.S. Patent Application Serial No. 07/047,736, filed May 8, 1987 (equivalent to EP-A-290,261) and is incorporated by reference herein. Drosophila S₂ cells are especially suited to high-yield production of protein in the method of the present invention. The cells can be maintained in suspension cultures at room temperature (24+l°C) . Culture medium is M₃ supplemented with between 5 and 10% (v/v) heat-inactivated fetal bovine serum (FBS) . In the preferred embodiment of the invention, the culture medium contains 5% FBS. After induction, the cells are cultured in serum-free media. When the pCOHYGRO vector system is used, the media is also supplemented with 300 μg/ml hygromycin B. In this media, the S₂ cells can be grown in suspension cultures, for example, in 250 ml to 2000 ml spinner flasks, with stirring at 50-60 rpm. Cell densities are typically maintained between 10 6 and 107 cells per ml. In one embodiment of this invention, the cells are grown prior to induction in 1500 ml spinner flasks in media containing 5% serum. Transcription and expression of the CS protein coding sequence in the above-described systems can be monitored. For example, Southern blot analysis can be used to determine copy number of the CS gene. Northern blot analysis provides information regarding the size of the transcribed gene sequence (see, e.g., Maniatis et al. , Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982)). The level of transcription can also be quantitated. Expression of the selected CS protein in the recombinant cells can be further verified through Western blot analysis.

The purification of the CS polypeptide from eel 1 culture is carried out by conventional protein isolation techniques, e.g., selective precipitation, absorption chromatography and affinity chromatography, including a monoclonal antibody affinity column, as described in Example 3.

The proteins produced by Drosophila cells, according to this invention, are completely free of mammalian, bacterial and protozoal contaminating materials and, more importantly, from other Plasmodium materials. The vaccine of the invention comprises an immunoprotective amount of P. falciparum CS protein, prepared by the method of this invention. The term "immunoprotective" refers to the amount necessary to elicit an immune response against a subsequent challenge such that disease is averted or mitigated. In an preferred embodiment, the vaccine of the invention comprises an aqueous solution of the insect derived CS protein which can ^'be used directly. Alternatively, the CS protein, with or without prior lyophilization, can be mixed or absorbed with any of the various known adjuvants. Such adjuvants include, but are not limited to, aluminum hydroxide, muramyl dipeptide and saponins such as Quil A. As a further exemplary alternative, the CS protein can be encapsulated within microparticles such as liposomes. In yet another exemplary alternative, the CS protein can be conjugated to an immunostimulating macromolecule, such as killed Bordetella or a tetanus toxoid.

Vaccine preparation is generally described in New Trends and Developments in Vaccines, Voller et al.

(eds.), University Park Press, Baltimore, Maryland, 1978. Encapsulation within liposomes is described by Fullerton, U.S. Patent 4,235,877. Conjugation of proteins to macromolecules is disclosed, for example, by Likhite, U.S. Patent 4,372,945 and Armor et al. , ^"U.S. Patent 4,474,757. Use of Quil A is disclosed by Dalsgaard et al. , Acta Vet Scand, 18:349 (1977). The examples which follow are illustrative but not limiting of the present invention. Restriction enzymes and other reagents were used substantially in accordance with the vendors' instructions.

Examples

Example 1. Vector Constructions

A) BACULOVIRUS VECTORS:

i) Full length P. falciparum CS protein

Plasmid WR201 is obtained from the Walter Reed Army Institute of Research. It contains a 2.3 kilobase, EcoRI fragment from phage λmPfl, which encodes the complete P. falciparum circumsporozoite protein of 412 amino acids, signal sequence inclusive. See Dame et al. , Science, 22j5:593-9 (1984). From WR201, a Stul - AsuII fragment is isolated which codes for amino acids 18 - 412 of the CS protein plus 3' untranslated DNA. To this CS gene fragment is ligated a HindiII - Stul synthetic oligomer: 5' 3 AGCTTACCATGATGAGAAAATTAGCTATTTTATCTGTTTCTTCCTTTTTATTTGTTGAG ATGGTACTACTCTTTTAATCGATAAAATAGACAAAGAAGGAAAAATAAACAACTC 3' 5 to recreate amino acids 1 - 17, but lacking the 5' untranslated DNA region. The new fragment (i.e. HindiII-Stul-AsuII) is treated with E. coli DNA polymerase I, Large Fragment (i.e. Klenow Fragment), and is ligated into a cloning site within a vector capable of replicating in E. coli. For example, the HindiII-Stul-AsulI fragment is inserted into blunt-ended Mlul - Bell sites of a typical shuttle vector, herein referred to as TigND, to create a plasmid herein referred to as pNIV2103. Plasmid TigND is a derivative of plasmid TND

(Connors et al. , DNA, 7:651-661 (1988) or U.S. Patent Application serial number 07/137,892, filed December 28, 1987) . Plasmid TigND differs from plasmid TND in that the Rous LTR is replaced by the mouse gamma 2B heavy chain immunoglobin enhancer sequence. Alternatively, the HindiII-Stul-AsuII CS gene fragment can be inserted into the HindiII - AceI sites of pUC19 or pBR322 or other standard cloning vectors. Plasmid pAcYMl is a baculovirus shuttle vector containing sequences from the AcMNPV genome which includes the polyhedrin gene promoter, but not the polyhedrin gene, and sequences from a high copy number bacterial plasmid, pUC8. See Matsuura et al. , J Gen Virol, 68: 1233-50 (1987). From pNIV2103, a 1261 base pair HindiII - Ddel fragment, coding for the full length CS protein, including 3' untranslated P. falciparum DNA from WR201, is treated with E. coli DNA polymerase I and isolated. The blunt-ended fragment is then ligated into a blunt-ended BamHl site of plasmid pAcYMl, to create a plasmid herein referred to as pNIV2H2.

ii) "Anchor-less" CS protein

To create a CS gene lacking the last 21 amino acids (i.e., at the carboxy terminus), the

HindiII-StuI-AsuII gene fragment of Example (i) is first cloned into the HindiII - Accl sites of M13mpl8, a standard vector used in subcloning, sequencing, and mύtagenesis. Then, using standard techniques of site-directed mutagenesis, the CS gene was mutagenized with the primer:

5" ACACTGGAGCACTTTCCAT 3" to introduce a HqiAI site at amino acid codon 390. The vector is digested with Fspl (5' to the Hindlll site) and HgiAI to yield a CS gene fragment encoding amino acids 1 - 390. This fragment and a synthetic adapter which codes for amino acid 391, a stop codon and a Bell site:

5' CCAGTTGATGATCATCTAGAGG 3' 3' ACGAGGTCAACTACTAGTAGATCTCC 5' is then ligated into the Mlul - Bell sites of plasmid TigND to generate plasmid pNIV2104.

From pNIV2104, a 1180 base pair HindiII - Bell blunt-ended fragment, coding for amino acids 1 - 391, is then ligated into a blunt-ended BamHl site of pAcYMl to create plasmid pNIV2105. This plasmid is essentially the same as pNIV2112 except that it codes for a CS protein lacking the carboxy terminus.

iii) "Signal and anchor-less" CS protein

From plasmid pNIV2105, a subsequent vector is constructed, pNIV2111, which is missing the first 17 codons (i.e. signal sequence) in addition to the last 21 codons of the CS protein gene. This vector is constructed by (1) deleting the Xhol - Stul fragment from pNIV2105, comprising the polyhedrin gene promoter through the CS signal sequence (amino acids 1 - 17), and (2) replacing this fragment with a synthetic linker:

5' GATCCACCATGG 3' 3' GTGGTACC 5' and an Xhol - BamHl fragment isolated from pAcYMl. The resulting vector, pNIV2111, encodes a CS protein from amino acids 18 to 391, which is lacking a signal and an anchor sequence.

B) DROSOPHILA VECTORS:

iv) pMTtPA

As the basic vector for gene expression in Drosophila, the tPA expression vector pMTtPA (also called pDMtPA) was used. This vector is a derivative of vector pMLl, a small pBR322 vector containing the beta-lactamase gene which has deleted the poison sequences [Mellon et e . , Cell, 27: 297 (1982)]. These sequences are inhibitory to amplification of the vector. This vector was digested with Sail and Aat2 which removes a small piece of pBR322, and the digested ends were filled in. The missing piece of pBR322 is then replaced with a cassette containing the Drosophila metallothionein promoter on an end-filled EcoRl-Stul fragment, followed by a filled-in Hindlll-Sacl fragment from pDSPI [D.S. Pfarr et al. , DNA, 4/6) : 461 (1985)] containing a tPA signal sequence, prepeptide and the entire coding region of tPA. The tPA gene on this fragment is followed by an SV40 early polyadenylation site.

v) pCOHYGRO A commercially available plasmid, pUC18

[Bethesda Research Laboratories, Gaithersburg, MD] containing a BamHl and Smal site was used. The 5' LTR from an integrated COPIA element (357 base pairs) was cloned into the BamHl site of vector pUC18, resulting in the vector designated pUCOPIA. COPIA is a representative member of the disperse middle repetition sequences found scattered through the Drosophila genome [Rubin et al. , in Cold Spring Harbor Symp. Quant. Biol., 45: 619 (1980)]. The vector pUCOPIA was cut at the Smal site and the E_;_ coli gene coding for hygromycin B phosphotransferase (hygromycin B cassette) was cloned into pUCOPIA using standard cloning techniques. The hygromycin B cassette was isolated oh a Hindlll-BamHI fragment of 1481 base ^" pairs from the vector DSP-hygro [Gertz et al. , Gene, 25: 179 (1983)]. The hygromycin B cassette contains the sequence coding for the hygromycin B phosphotransferase gene and the SV40 early poly A region. The HindiII and BamHl sites were filled in using T. DNA polymerase, and the hygromycin B cassette was ligated into the Smal site of the vector pUCOPIA producing vector pCOHYGRO. vi) pMTcsp391

To create a mature P. falciparum CS coding sequence lacking the last 21 amino acid codons, an EcoRI-AsuII fragment from plasmid WR201 (see Example (i)) was cloned into the EcoRI - AceI sites of Ml3mpl8, which was also cited in Example (i). Using standard site-directed mutagenesis techniques, the CS gene was mutagenized with the primer of Example (ii) to introduce a HgiAI site at amino acid codon 390. The vector was then digested with EcoRI and HgiAI to yield a CS gene fragment encoding amino acids 1 - 390. This fragment and a synthetic adapter which encodes for amino acid 391, a stop codon, a Bell site and an Xbal site:

5' CCAGTTGATGATCAT 3' 3' ACGAGGTCAACTACTAGTAGATC 5' was then ligated into the EcoRI - Xbal sites of plasmid PULB1221 (see, Pierard et al., DNA, 8:321-328 (1989)) to generate, plasmid plJLB1221CSPdel.

A BstXl - Xbal fragment encoding for amino acids 26 - 391 was isolated from plasmid pULB122lCSPdel. This fragment and a synthetic Bglll - BstXl adapter, which codes for serine and CS amino acids 19-25:

5' GATCTTTATTCCAGGAATACCAGTGCT 3' 3" AAATAAGGTCCTTATGGTC 5' was ligated into the Bglll - Xbal sites of vector having the Drosophila metallothionein promoter, a tPA signal sequence, and an SV40 early polyadenylation site such as the pMTtPA derived vector pgpl60Δ32 (Johansen et al. , U.S. Patent Application Serial No. 07/278,386, filed Dec. i, 1988.). The resultant vector, pMTcsp39l, encodes a mature CS protein missing a carboxy terminal anchor sequence (i.e., missing amino acids 392 - 412) and having an additional serine residue at the amino terminal end, vii) pMTcsp398

Another vector containing a modified P. falciparum CS coding sequence was constructed by digesting vector pMTcsp391 with the restriction endonucleases HgiAI and Xbal and subsequently replacing the HgiAI - Xbal fragment with a synthetic oligonucleotide adaptor of the sequence:

5' CCAGTGTGTTTAATGTCGTGAATTCTTGAT 3' 3' ACGAGGTCACACAAATTACAGCACTTAAGAACTAGATC 5"

The adaptor encodes for CS amino acids 390 - 398 plus a termination codon. This resultant vector, designated pMTcsp398, encodes a mature CS protein having an additional serine at the amino terminal end and which is also lacking carboxy terminal anchor codons 399-412, i.e., ser-CS₁₉_₃₉₈.

viii) pMTcsp412

A 1492 bp BstXl - EcoRV fragment encoding the P^ falciparum CS protein (amino acids 26 - 412) was isolated from plasmid WR201 (cited above) . This BstXl - EcoRV fragment and the same synthetic adaptor for vector construction (vi), was ligated into the Bglll - Sacl (blunt-ended) sites of vector pMTtPA (see construction (iv)). The final construct, pMTcsp412, encodes for a mature CS protein (amino acids 19 - 412) plus an additional serine at the amino terimus, i.e., ser-CS₁₉_₄₁₂.

Example 2. Expression In Insect Cells

A) SPODOPTERA FRUGIPERDA CELLS:

Spodoptera frugiperda 9 (Sf9) cells are available from the ATCC (Rockville, MD, USA). The Sf9 cells were cotransfected with one of the following recombinant vectors, plasmid pNIV2112, pNIV2105 or pNIV2111 and with wild-type AcMNPV DNA, at 50 μg and 1 μg respectively; substantially as described by Summers et al. , TAES Bull, NR 1555, May 1987, cited above. Resulting virus particles were obtained by collecting the supernatants. The virus-containing media was then used to infect Sf9 cells in a plaque assay. Subsequent infection of Sf9 cells with a plaque purified recombinant baculovirus resulted in cells expressing the CS protein instead of the polyhedrin protein.

The recombinant baculovirus infected cells derived from pNIV2112 were shown to express a CS protein intracellularly, at roughly 3 μg/ml of infected culture medium supernatant. Western blot analysis showed essentially one band at about 60 kilodaltons.

The recombinant baculovirus infected cells derived from^'pNIV2105 express an "anchor-less", i.e., lacking a carboxy terminal anchor, CS protein, at a level of approximately 1 μg/ml of a 7 day culture supernatant. Western blot analysis of proteins in the supernatant and in the cell extract showed two immunoreactive doublet bands at about 50 and 60 kilodaltons.

Cells infected with pNIV2lll express a CS protein intracellularly at a level of approximately 3 μg/ 1.5 x 10 cells, 3 days post infection. Western blot analysis of the proteins in the cell extract showed essentially 2 bands at approximately 50 kilodaltons.

B) DROSOPHILA CELLS:

The MTcsp vectors of Example 1 were each contransfected with pCOHYGRO into Drosophila S₂ cells in the ratio of MTcsp vector to pCOHYGRO of 20:1. Transfection was performed by conventional techniques using CaPO. precipitation. Polyclonal cell lines were generated after selection with hygromycin B for 2 weeks. Single clonal cell lines were generated by serially diluting the polyclonal cell line and plating one cell per well in 96 well dishes. The cell lines were grown up and the expression of CS protein was monitored after 6 days of induction with CuSO. of a culture with a cell density of 5x10 cells/ml.

Production of CS proteins was measured by ELISA or by conventional western blotting techniques using antibodies raised to the CS repeat regions, substantially as described by Gross et al. , U.S. Patent Application Serial No. 07/256,181, filed Oct. 11, 1988. Highest production levels achieved for a single clonal cell line was 9mg/L in 100 ml spinner flasks with an induction period of 6 days at a cell density of 5 x 10 cells/ml. One of skill in the art can express other

Plasmodium Circumsporozoite proteins and fragments thereof, described by the present invention, using substantially the same systems and procedures as exemplified above as well as by using similar systems and materials which are publicly available..

Example 3. Purification of the Recombinant Proteins

Expressed In Insect Cells

The recombinant CS proteins expressed in S. frugiperda cells were purified as follows: Sf9 infected cells were lysed by 3 freeze-thawing cycles in RIPA buffer (50 mM Tris-HCl pH 7.2, 0.15M NaCl, 1% Triton X-100, 0.1% . SDS, 1% Na deoxycholate) . The crude extract was centrifuged for 30 min at 13,000 rpm . The supernatant was incubated with DNAse for 30 min at 37°C, pH 7.5. The pH was adjusted to 5.5 and RNAse and MgSO. were added. After a further incubation of 30 mm at 37°C, the cell extract was made 1M in MgCl₂ and 1M in NaCl; the pH was then adjusted to 1.6 by addition of concentrated HC1 and the sample was incubated for 1 hr at 0 C, then centrifuged 30 min at 13,000 rpm. The supernatant was dialyzed against 20 mM ammonium carbonate pH 7.5 and applied onto an affinity column made of a monoclonal antibody recognizing the repeats of the CS protein (See Nardin et al. , J Exp Med, 156:20 (1982)). Elution was performed with 100 mM Na acetate at pH 4.0 in the presence of 500 mM NaCl.

This purification technique is also effective with recombinant CS proteins expressed in a Drosophila host.

Example 4. Vaccine Containing CS Protein

An illustrative vaccine of this invention is prepared as follows: The insect-derived recombinant CS protein of this invention is added with stirring to a final concentration of 10 - 2,000 μg/ml, preferably 600 - 1600 μg/ml, in a buffered saline solution (150 mM

NaCl, 10 mM sodium phosphate pH 6.8; sterilized by filtration) containing 1.0 mg Al 3+ (as aluminum hydroxide gel) per ml. The pH is maintained at pH 6.8 and the mixture is left overnight at about 4°C. Thimerosal is added to a final concentration of 0.0005%. The pH is checked and adjusted, if necessary, to pH 6.8.

Each vaccine dose contains 0.5 ml to 3.0 ml of the CS vaccine formulation, prepared as described above. As an example, the amount of polypeptide per dose is about l to about 2,000 μg. Preferably, each dose would contain approximately 800μg of polypeptide/ 0.5 ml.

The vaccine is preferably administered parenterally, e.g. , intramuscularly (im) or subcutaneously (sc), although other routes of administration may be used to elicit a protective response. The vaccine is administered in a one-dose or multiple-dose course, e.g. 2 to 4 supplementary doses. Preferably, a multiple-dose course is administered 1 - 6 weeks apart. Thereafter, vaccinees can be revaccinated as needed, e.g., annually. The above description and examples fully disclose the invention and the preferred embodiments thereof. The invention is not limited to the embodiments specifically disclosed, but rather encompasses all variations and modifications thereof which come within the scope of the following claims.

Claims

What is claimed is:

1. A Plasmodium CS protein gene expression unit comprising a DNA coding sequence for said protein and a regulatory element necessary for transcription of the coding sequence and translation within an insect cell.

2. The gene expression unit of claim 1 which codes for a P. falciparum CS protein.

3. The gene expression unit of claim 2 which codes for a protein lacking the carboxy terminal anchor sequence, or lacking a signal sequence, or lacking both a signal and an anchor sequence.

4. The gene expression unit of claim 3 in which the regulatory element functions in Drosophila cells.

5. The gene expression unit of claim 3 in which the regulatory element functions in Lepidoptera cells.

6. The gene expression unit of claim 4 wherein said regulatory element comprises an actin 5C promoter or a Drosophila metallothionein promoter.

7. The gene expression unit of claim 6 as present in pMTcsp391, pMTcsp398, or pMTcsp412.

8. The gene expression unit of claim 5 in which the regulatory element functions in Spodoptera frugiperda cells.

9. The gene expression unit of claim 8 wherein said regulatory element comprises the AcMNPV polyhedrin gene promoter.

10. A DNA vector comprising the gene expressio unit of claim 1.

11. A recombinant baculovirus comprising the gene expression unit of claim 1.

12. An insect cell transfected with the vector of claim 10.

13. The insect cell of claim 12 which is a Drosophila cell.

14. An insect cell transfected with the recombinant baculovirus of claim 11.

15. The insect cell of claim 14 which is a

Lepidoptera cell.

16. The insect cell of claim 15 which is S. frugiperda.

17. A P. falciparum CS protein produced in insect cells.

18. The protein of claim 17 which is the full length CS protein.

19. The protein of claim 17 which is lacking the ° carboxy terminal anchor region, or lacking a signal peptide, or lacking both a signal peptide and a carboxy terminal anchor region.

20. A protein produced in insect cells, which is encoded by the gene expression unit of claim 1.

21. A protein produced in insect cells, which is encoded by the gene expression unit of claim 3.

22. A vaccine for stimulating protection against malarial infection wherein such vaccine comprises an immunoprotective and non-toxic quantity of the protein encoded by the CS gene expression unit of claim 1.

23. A method for protecting humans against disease symptoms associated with malarial infections which comprises administering to humans a safe and effective amount of the vaccine of claim 22.

24. A method for production of a Plasmodium CS protein in insect cells comprising culturing in a suitable medium insect cells transfected with a Plasmodium CS protein gene expression unit, said cells being capable of expressing said protein.

25. The method of claim 24 wherein the insect cells are Drosophila cells.

26. The method of claim 25 wherein said cells are transfected with a first vector containing the coding sequence for hygromycin B phosphotransferase and a second vector containing the coding sequence for a Plasmodium CS protein gene expression unit.

27. The method of claim 26 wherein said first vector is pCOHYGRO.

28. The method of claim 26 wherein said second vector comprises the CS DNA coding sequence of pMTcsp391, pMTcsp398 or pMTcsp412.

29. The method of claim 25 wherein the Drosophila cells are D. melanoqaster S₂ cells.

30. The method of claim 29 wherein said S₂ cells are co-transfected with the vector pCOHYGRO and a vector comprising a CS gene expression unit as is present in pMTcsp391, pMTcsp398 or pMTcsp412.

31. The method of claim 24 wherein the insect cells are Lepidoptera cells.

32. The method of claim 31 wherein said cells are co-transfected with a first vector comprising baculovirus DNA and a second vector comprising plasmid DNA which contains the coding sequence for a Plasmodium CS gene expression unit.

33. The method of claim 31 wherein the Lepidoptera cells are S. frugiperda.

34. A vaccine for stimulating protection against malarial infection wherein such vaccine comprises an immunoprotective and non-toxic quantity of the CS protein produced by the method of claim 24.

35. The protein of claim 20 for use in the manufacture of a vaccine for stimulating protection against malarial infection.