EP0143821A1 - Production of catechol 2,3-oxygenase by means of yeasts, plasmide for the implementation thereof and application - Google Patents

Abstract

The present invention relates to an expression block for catechol 2,3-oxygenase in yeast, characterized in that it comprises, according to the direction of reading and with the correct orientation, at least: a yeast promoter, the gene xylE, and a yeast terminator. By integrating the expression block into a plasmid and transforming a yeast, transformants capable of producing C 2.3-0 are obtained.

Description

Production of catechol 2,3-oxygenase by yeasts, plasmid for its implementation and application.

The present invention relates to the production of the enzyme catechol 2, 3-oxygenase (hereinafter called C 2,3-O) of Pseudomonas by a yeast such as Saccharomyces cerevisiae, as well as the applications which result therefrom, in particular the production of colored markers.

Colored markers have been used in genetics from the start of this science to easily track gene segregation in plants, animals and microorganisms. The molecular biology of bacteria has largely developed around the lactose system of Escherichia coli, using different chromogenic analogs of lactose (o-nitrophenyl-ß-D-galactoside yellow, 5-bromo, 4-chloro, 3-indolyl- ß-D-galactoside, named Xgal, blue). The use of these chromogenic substrates allows easy quantification of enzymatic activities in vitro. In vivo, the colored halo developed by the clones containing a β-galactosidase activity allows the extremely fast sorting of the positive or negative colonies as regards this characteristic. The system has also been adapted in numerous constructions, in particular for cloning pieces of DNA into the bacteriophage M13 or for studying the expression of genes.

However, there are few colored markers in the field of yeast genetics. Conventionally, the mutations (ade 1) and (ade 2) give the clones a red color. This feature has been widely exploited. On the other hand, if we consider the field of study using cloning and gene expression, no really practical marker has been developed so far. The previously described blue β-galactosidase / Xgal pair was introduced in yeasts (Rose et al., 1981). But this system suffers from the fact that, normally, the yeast does not have a permease for β-galactosides, forcing the experimenters to use large quantities (40 μg / ml) of Xgal substrate which is extremely expensive. In the field of transformation and labeling of strains, the demonstration of β-lactamase activity has been developed (Reipen et al., 1982), but the test is too complex to be used routinely.

A marker colored in yellow has recently been described in E. coli, phage M13 and gram-positive bacteria of the Bacillus type (Zukowski et al., 1983).

The present invention relates to the specific adaptation of this system using catechol 2,3-oxygenase encoded by the xylE gene, to yeast and the developments which are linked to it.

The xylE gene is normally carried by the TOL plasmid of some Pseudomonas species which degrade toluene (Franklin, 1981). This gene was cloned in E. coli (Franklin, 1981), in bacteriophage M13 and in Bacillus subtilis (Zukowski et al., 1983).

This gene codes for the enzyme catechol 2,3-oxygenase which oxidizes catechol to muconic semialdehyde 2-OH according to the reaction:

catechol semialdehyde 20H colorless muconic yellow As indicated above, the substrate (catechol) is colorless and the oxidation product is yellow.

Such a yellow labeling system, implementing the C 2,3-O encoded by the xylE gene, in yeast would offer the advantages requested for this type of test, in particular very low cost price, non destruction of the clones, reaction clear and fast, in addition it is not necessary to use a special medium.

In addition, the enzyme itself has been proposed for various industrial uses (French patent No. 82,01574 in the name of the Applicant) from bacterial cultures. Here too, yeast can be a very interesting organism for producing the enzyme in large quantities, given the industrial know-how concerning the production of this organism and the fact that it is recognized as non-pathogenic for humans and animals. .

The present invention relates to an expression block for catechol 2,3-oxygenase in yeast, characterized in that it comprises, according to the reading direction, and with the correct orientation, at least:

. a yeast promoter,. the xylE gene,. a yeast terminator.

The terminology "expression block" of catechol 2,3-oxygenase in yeast does not necessarily mean that the xylE gene is expressed. Indeed, as we will see below, it is possible to use this expression block as part of a colored marker, in this case we will use either the appearance of a coloration (expression of the C 2,3-O) or, on the contrary, disappearance of a coloration (blocking of the expression of C 2,3-O), in this case, although the "expression block" is present, C 2,3-O does not is not expressed because an exogenous DNA fragment is, for example, present within the xylE gene, in the second case we will use, however, the terms "expression block".

The reading direction used in this definition is that of the reading of the DNA of the expression block by the RNA polymerase; as for the correct orientation, it is understood in relation to the meaning defined above.

The yeast promoter is a DNA fragment generally originating from the yeast itself and which allows the specific start of the synthesis of mRNA.

In order to ensure the expression of catechol oxygenase, it is important that there is no other ATG initiator codon between this promoter and the ATG initiator codon of the xylE gene.

The yeast terminator is a DNA fragment which stops the synthesis and which ensures the correct modeling of the mRNA in order to obtain an important protein yield. Among the yeast promoters which can be used, mention should be made more particularly of the promoter of the URA ₃ ⁺ gene, but it is possible to use other promoters, in particular those of the genes coding for the enzymes of glycolysis (Dobson et al., 1982 ; Hitzeman et al., 1983). Among the yeast terminators which can be used, mention should be made more particularly of the terminator of the URA ₃ ⁺ gene, but it is of course possible to use other terminators of genes coding for proteins expressed by yeasts. The xylE gene has been described in various documents and its structure is known; however, as part of the pre sente invention means by "xylE gene" means not only the gene itself, but also its derivatives, the expression of which also leads to catechol 2,3-oxygenase activity. Thus, the structure of the "naked" xylE gene can be changed as to the precise nature of its proximal end. The number and sequence of base pairs present just before the ATG initiator codon may vary. In particular, the introduction of the base A at position -3, position 0 being the A of the ATG codon, may be of interest. Indeed, this characteristic is common to most yeast genes (Dobson et al., 1982). The modifications can be used in studies concerning the transcription and translation of genes (research) and in the optimization of gene expression in order to obtain better yields of enzyme (industry).

This "expression block" can be used in different ways, it can be integrated into an autonomous replication vector, or else it can be integrated into the chromosome of a yeast.

In the case of a vector with autonomous replication, it is necessary to provide an additional fragment ensuring self-replication in yeasts, in particular all or part of the plasmid 2 μ. The use of this DNA fragment has many advantages, in particular that of ensuring a high frequency of transformation and that of allowing a large number of copies per cell, therefore potentially a significant production of C 2,3-O.

But there are also other vectors with the same standalone replication property. For example, the use of "autonomous replication sequences" (Beggs, 1981) derived from yeast chromosomes or other eukaryotes, coupled or not with centromere sequences (Beggs, 1981), is possible. The use of "killer" DNA derivatives from Kluyveromyces lactis is also conceivable (De Louvencourt et al., 1982).

These variations allow the study and optimization of the essential parameters involved in the production of a protein by yeast, in particular the stability, the selective pressure, the media, the fermentation parameters and the nature of the basic strains.

The vector can, moreover, comprise other elements ensuring its good functioning in yeasts, but also its replication in bacteria.

Thus, it is possible to provide a replication system in bacteria such as E. coli or B. subtilis, as well as one or more selective markers such as resistance to certain antibiotics, ampicillin or tetracycline. This gives a versatile vector for yeast and prokaryotic cells.

In the case where it is desired to ensure integration of the expression block into the yeast chromosomes, a DNA exogenous to the expression block can recombine with its counterpart of the chromosome of the receiving yeast. It is thus possible to use an "expression block" complemented by a "carrier DNA" fragment. Thus, it will be demonstrated that the integration of the expression block is directed into the yeast chromosomes by the ends of the DNA sequences present in the fragment to be integrated. This type of results has been obtained for other systems (Orr-Weaver et al., 1981). It is thus possible to integrate the xylE sequence into any precise point of the 17 yeast chromosomes, provided that a corresponding DNA fragment is available. With the same technology, it is possible to integrate several copies of the expression block by repeating the experiment with different “carrier” DNA fragments. This will result in better expression of the xylE gene without appreciable instability.

The present invention also relates to the yeast strains transformed by the vectors described or comprising one or more "expression blocks" integrated into their chromosomes.

Among the strains which can be used, in particular with the elements of the URA3 ⁺ gene, mention should be made of Saccharomyces strains such as S. cerevisiae, S. uvarum, S. carlsbergensis, S. diastaticus, but also Schizosaccharomyces pombe (Chevallier et al., 1982).

The strains thus obtained can be used for the preparation of catechol oxygenase. Optimization of all the parameters described above must make it possible to achieve yields of enzyme compatible with commercial requirements. Yeast cells can be easily grown in large quantities on inexpensive substrates (musts, molasses). The cells are easily extractable from the medium by simple decantation. the enzyme can be extracted from cells by grinding the cells with known techniques.

The uses of catechol 2,3-oxygenase in chemical, food, agricultural and pharmaceutical processes ecological have been described in particular in French patent n ° 82 01 574. The essential specific points of yeast for this production remain the industrial know-how linked to yeasts and the non-pathogenicity of the strains. However, the present invention also allows the labeling of yeast strains by means of the change in coloration of the catechol in the presence of the C 2,3-O produced.

As will be demonstrated, the vaporization of a 0.5 M solution of catechol on colonies expressing the xylE gene results in the development of an intense yellow color on them.

This property can be used to detect yeast clones that have been transformed by the xylE gene. This technique can advantageously replace the β-lactamase test (Reipen, 1982) because of its much easier handling.

With the integration of xylE genes into the chromosomes of yeast, permanent labeling can be obtained. It is interesting to note that the dominant character, this marker can be used in industrial polyploid strains, or even those whose genetic structure is unknown. It is also important to note that the coloration is not lethal for the colonies and that these can normally be subcultured after the test. This type of marking of strains can be exploited in the context of mixed fermentation. One of the strains can thus be marked and easily followed in the complex population of fermentation tanks. This type of study will find a major application in the study of winemaking where the yeast population and its evolution is still very poor known. Its interest in population genetics at the research level is also evident.

The chromogenic properties of C 2,3-O may further find applications in the cloning and expression of genes other than the xylE gene.

Thus, one can cut the gene inside the coding sequence, after the ATG initiator codon. This provides a fragment which can be fused with any other gene. This fusion can also be carried out with the fragment containing a few base pairs before the initiating ATG. The creation of a hybrid protein with chromogenic properties can lead to a rapid and efficient method of measuring the production of the other part of the protein. Indeed, many molecules produced by genetic engineering are very difficult to measure (interferons, coagulation factors, antigenic molecules, etc.). The substitution of these costly and time-consuming tests by the simple colored or enzymatic test of the described enzyme can be a clear advantage in many cases. Another modification already proposed for viral and bacterial systems (French patent n ° 82 01 574) consists in introducing into the coding region of the xylE gene a small DNA fragment comprising a few cloning sites. The introduction of a new, fairly large fragment of DNA into these sites will destroy the xylE gene, resulting in the loss of the yellow marker. This system makes it possible to immediately recognize the recombinant molecules and avoids tedious research in yeast of particular DNA structures. In fact, one will preferably use in this case a plasmid comprising at least one unique restriction site located such that the insertion of a DNA fragment into this site inhibits the synthesis of C 2,3-O.

Finally, the demonstration of the fluorescent properties of C 2,3-O opens considerable prospects at the industrial level to automate the previous applications.

With appropriate optimization, cells with or without the xylE gene could be counted directly under the fluorescence microscope without having to wait for colony development. This can lead to a technique of "real time" analysis of complex fermentations, the observation of cells under a fluorescence microscope taking only a few minutes. For automated studies, the use of "cell counters" equipped for fluorescence (Falaiya et al., 1979) can allow extremely precise studies on large populations. In basic research, the study of the genetic phenomena linked to plasmids can be approached directly on the cells themselves and not on the clones derived from them, which until now was not achievable by known markers.

Of course, the present invention can be used for more basic research purposes or for educational purposes. Thus, this system can be used as a "probe" for termination and promotion functions. Or, if we couple the Mendelian red mutations (ade-) with the typically non-Mendelian segregation of the xylE system on a self-replicating vector, it is easy and spectacular to demonstrate the two types of segregation in the same experiment. Such a system also meets the specific requirements of education: simplicity, low cost, reproducibility, clarity.

In particular, the present invention also relates to the labeling of industrial strains. In fact, the yeast strains used in the context of recombinant DNA techniques are most of the time laboratory strains which are easily transformable by means of auxotrophies, for example for leucine. Industrial strains, in particular baker's or brewer's yeast strains, on the other hand, are very difficult to work because they have no auxotrophic character. In particular, the main character of auxotrophy for leucine necessary for the use of the plasmid pJDB207-xylE being absent, it is impossible to rely on this method to transform them. A system has been described by Jimenez et al. (1980), who uses the G418 antibiotic / G418 resistance pair to select transformation events with yeasts without auxotrophy. The method is however limited by the fact that yeasts not transformed by the plasmids can become naturally resistant to the antibiotic. A long analysis. and not very feasible on large series must follow each transformation experiment to differentiate these two types of colonies. Coupling the xylE expression block with the G418 resistance gene solves this problem immediately. Indeed, the transformed strains become yellow in contact with catechol, while the spontaneous resistant ones remain white.

This is why the present invention also relates to a block for the expression of catechol-2,3-oxygenase in a yeast as described above, characterized in that it comprises, as selection marker, the gene for resistance to a chemical compound. .

Among the genes for resistance to chemical compounds, mention should be made more particularly of the genes of resistance to antibiotics and in particular resistance to G418, that is to say the Neo gene.

This gene for resistance to a chemical compound is preferably under the promotion of a yeast promoter such as the promoter of the yeast PGK (phosphoglycerokinase) gene and terminated by a termination segment of the same PGK gene.

This type of expression block is more particularly usable in industrial yeasts, in particular the yeast strains for baking, brewing and wine making.

This improvement must make it possible to mark strains of industrial yeasts and thus to be able to monitor and control said fermentations.

Other characteristics and advantages of the present invention will appear in the examples below which refer, as necessary, to the appended figures in which: FIG. 1 diagrammatically shows a strategy for cloning the "naked" xylE gene; Figure 2 shows schematically the construction of an expression block; FIG. 3 diagrams the strategy for obtaining a self-replicating vector carrying the xylE gene; Figure 4 shows schematically the construction of a yeast containing an expression block integrated into the chromosome; FIG. 5 represents the assay of the activity of C 2,3-O in a crude yeast extract; FIG. 6 represents the kinetics of action of C 2,3-O produced by the yeast; FIG. 7 represents a comparison of the activities of the yeast C 2,3-O and of E. coli as a function of the pH; Figure 8 shows the preparation scheme for pTG840; Figure 9 shows the preparation scheme for pTG861.

EXAMPLE 1

Construction of the expression block necessary for the functioning of the gene in yeast a) Cloning of the "naked" xylE gene (FIG. 1)

The starting point of this construction is the phage M13mp9 (sold by the company NE Biolabs USA) in which the xylE gene is cloned in the form of a SalI / SalI fragment. These sites have been described in French Patent No. 82 01 574. As described in FIG. 1, this phage contains a unique PstI site located downstream of the coding sequence of the xylE gene. This site will be used as the end point of the "naked" gene. If we now consider the start of the gene, we must, as explained above, remove most of the DNA located upstream of the ATG initiator codon. To this end, the 4 HgiDI sites present on the structure are to be analyzed.

The first on the left (HgiDI (O)) is on the DNA of the phage itself. For an unknown reason, this site is not cut by the HgiDI enzyme under working conditions. The other 3 sites are located in the DNA sequences from Pseudomonas. The first, far upstream of the start of translation (ATG) is of no interest. The second (HgiDI (2)) is located just before the ATG of the xylE gene (in fact 4 base pairs upstream). It can therefore be used as the proximal end of the "naked" xylE gene because no ATG is present in these 4 base pairs. The last site (HgiDI (3)) is inside the gene and, if cut, will destroy the structure of the gene.

In order to produce an HgiDI (2) / PstI fragment containing the entire "naked" xylE gene, a partial digestion of 30 μg of the clone M13xylE described here is carried out (1 unit of enzyme per μg of DNA in 60 μl of buffer containing 5 μg / ml of ethidium bromide at 37 ° C for approximately 2 hours). The mixture obtained is extracted with phenol and then with a mixture of chloroform-isoamyl alcohol (24: 1) (so-called "Sevag" mixture), precipitated with alcohol and resuspended in an appropriate buffer.

A total digestion with the PstI enzyme is carried out on this solution. The digestion mixture is then analyzed by electrophoresis on 1% agarose gel and resolved into its different fragments, the size of these DNA fragments can always be explained by the double digestion described above. Among them, the 1.1 kilobase (kb) fragment, theoretically limited by the HgiDI (2) and PstI sites, is isolated from the gel using the technique of Girvitz (1980).

In order to obtain this fragment more easily and in large quantities, if necessary, it is cloned in the manner described below:

The plasmid pRG5 (Loison et al., 1981) is a derivative of PBR322 which contains an insertion of 2.5 kb in its HindIII site. This fragment allows the expression of the resistance to tetracycline carried by pBR322. pRG5 is cut with PstI and ClaI, then the large fragment thus generated is isolated as before from an agarose gel. This fragment is mixed with the "naked" xylE gene, the isolation of which has just been described, and the mixture is incubated overnight at 15 ° C. in the presence of phage T4 ligase. The mixture is used to transform a strain of E. coli using the calcium chloride technique (Maniatis et al., 1982). The bacterial population is spread on a medium containing tetracycline. The resistant tetracycline clones obtained were analyzed for their plasmid content and the plasmid pTG820 was extracted therefrom.

The fact that the ends generated by HgiDI and ClaI are complementary on the DNA allows the formation of the plasmid pTG820. If we cut it with the enzymes PstI and HgiIII, we release a 1.1 kb fragment containing the "naked" xylE gene containing 9 base pairs between the codon ATG initiator and the HindIII end. These 9 base pairs do not contain any ATG codons. b) Construction of the "expression block" (FIG. 2)

This structure must contain, as previously indicated, a yeast promoter upstream of the xylE gene and a terminator behind this gene.

The base plasmid in this construct is plasmid pTG802. It consists of a plasmid derived from pBR322 without a PstI site, and into the HindIII site from which the yeast URA3 gene was cloned. The only PstI site of pTG802 is located in the yeast DNA sequence, exactly 20 base pairs before the ATG initiator codon of the URA3 gene. This plasmid is cut with PstI and treated with the "Klenow" fragment of DNA polymerase I, which generates blunt ends at each end of the fragment.

The “naked” xylE gene is prepared as described in Example 1 by a PstI and HindIII digestion of pTG820. The 1.1 kb fragment is isolated from a gel, also treated with the "Klenow" fragment of polymerase I and coprecipitated with pTG802 treated as described above. The mixture is resuspended in the ad hoc buffer and ligated as described above. The transformation of E. coli and selection on medium containing ampicillin provides thousands of colonies.

The promoter of the URA3 gene functions in the bacterium E. coli. As the construction can lead to a fusion between the xylE gene and the promoter, bacterial clones producing catechol 2,3-oxygenase are sought among the colonies resistant to ampicillin.

To this end, a solution of catechol (0.5 M) is sprayed on the boxes and a few yellow clones appear. Plasmids from these clones are extracted and analyzed. It can be demonstrated that the orientation of the xylE gene is "correct" in these plasmids, relative to the yeast promoter.

The plasmid pTG821 thus obtained can release by a simple cut with HindIII a fragment of 2.2 kb which contains in order: the promoter of the yeast gene URA3, the gene xylE, and the yeast URA3 gene which has the functions of termination in its distal part.

This HindIII / HindIII fragment therefore groups together all of the functions necessary for the expression of the xylE gene in yeast and will be called "expression block" below.

EXAMPLE 2 Construction of a yeast strain carrying the expression block on an autonomous replicating plasmid (FIG. 3) The introduction of foreign DNA and the use of autonomous replicating plasmids in yeasts are known (Beggs, 1981 ), in particular using plasmids derived from the yeast "2 μm plasmid". The use of structures derived from the natural yeast plasmid, called "2 μm" has the advantages of ensuring a high transformation frequency and a large number of copies per cell. If the expression block is coupled with this type of plasmid, the large number of copies of the xylE gene may allow yeast produce a significant amount of catechol 2,3-oxygenase.

As a basic element in this construction, the plasmid pJDB207 (Beggs, 1981) is used. After cleavage with the enzyme HindIII, the large fragment is isolated and mixed with the expression block itself released from pTG821 by cleavage HindIII. The mixture is ligated and used to transform E. coli.

Clones resistant to ampicillin are obtained and among them many yellow clones appear in contact with catechol as described above.

One of them is cultivated and the plasmid which it contains is described in FIG. 3 (pJDB207-xylE).

This plasmid comprises: a selection marker for yeast (gene

LEU2), an autonomous replication system for yeast (2 μm), a selective marker for E. coli (Amp ^R or Tet ^R ), an autonomous replication system for E. coli

(oRi), the expression block xylE.

This plasmid pJDB207-xylE is used to transform a yeast strain (leu-). The cells which have received the plasmid are selected on a leucine-free medium.

Thousands of colonies are obtained in this way and almost all of them express the xylE gene by producing catechol 2,3-oxygenase. EXAMPLE 3 Construction of a yeast strain containing the expression block integrated into chromosome V (FIG. 4)

If the yeast is transformed with a DNA fragment carrying no autonomous replication system, the exogenous DNA can recombine with its homolog of the chromosome of the receiving yeast (Hinnen et al., 1978). This event is however very rare. It has been shown recently that linear and non-circular DNA as in the case of plasmids has the property of recombining much more frequently with the chromosome. On the other hand, during the transformation event, each cell "takes" a large number of DNA molecules from the medium (Beggs, 1981). These two elements made it possible to develop the strategy described below in order to integrate the expression block in the chromosome V of yeast.

30 μg of the plasmid pTG820 are treated with HindIII to release the expression block, then treated with the "Klenow" fragment of the polymerase I to avoid any reconstitution of the molecule. To this mixture we add

5 μg of plasmid pJDB207 intact. This mixture is used to transform a yeast (leu ₂ -), by selecting on medium without leucine, but containing uracil.

In fact, if the expression block integrates in place of the endogenous URA3 gene of the yeast, the latter will become auxotrophic for uracil and will need this compound in the culture medium to develop. The transformation results in thousands of clones. 200 of them are analyzed to see if they have become (ura-) for the reason described above. Subsequent genetic analyzes showed that for one of these strains it was well (ura-) as planned. However, a search for the catechol 2,3-oxygenase enzyme in this particular strain is negative.

A large number of strains (ura-) are then selected from the population obtained previously. To do this, a positive selection of the cells sought is used by spreading them on a medium containing uracil and 5-fluoro-orotate (10 ^-2 M). The colonies that grow on this medium are genetically (ura-) (this technique was transmitted by F. Lacroute in Strasbourg). In this way, a hundred strains (ura-) are isolated. Among those

4 produce a very small amount of catechol 2,3-oxygenase.

EXAMPLE 4

Color test on colonies and cells

The strain previously described in Example 2, which contains the xylE gene on an autonomous replicating plasmid, is analyzed with a view to in situ staining. First, a cell population of this strain is spread on a medium allowing the plasmid to be maintained, that is to say a medium devoid of leucine. After the colonies have grown (3 days at 28 ° C), the petri dishes are sprayed with a catechol solution (0.5 M in water).

After a few minutes at room temperature or at 28 ° C, the colonies become dark yellow.

The coloration persists on the colony even after several days at room temperature. No appreciable diffusion of the color appears. Low pH (around

5) the middle prevents browning of the Petri dish, what happens for pH close to 7.

In the same way, a mixed population containing cells containing the plasmid pJDB207-xylE and cells not containing it is spread out, after growth of the colonies, the same staining test (vaporization of catechol) is carried out, it is observed that the two kinds of colonies (with and without xylE gene) are very clearly differentiated by color.

It is known (Beggs, 1981) that the type of plasmid used is not stable in yeast under non-selective conditions, that is to say in the presence of leucine in the medium. The original strain containing the plasmid pJDB207-xylE is cultivated 3 days under non-selective conditions then spread on medium also non-selective. After the colonies have grown, the staining test is carried out. We can observe, despite the non-selectivity of the medium, a majority of yellow clones still containing the plasmid and white clones having lost it. In addition, a careful examination of the colonies reveals a heterogeneity in the intensity of the color. Some are light, others darker.

A rapid analysis of each of the color classes shows that the more intensely colored a colony is, the higher the percentage of cells (inside this colony) containing the plasmid.

EXAMPLE 5

In a second study, the yeast transformation technique must be considered precisely (Hinnen et al., 1978). The last step is to wrap the yeast protoplasts in a layer of agarose gel. These protoplasts regenerate into cells which give rise to very small clones included inside the agar. If catechol is sprayed on such dishes, it quickly diffuses into the agar layer and the small lenticular colonies turn yellow. The examination of such boxes under a binocular magnifier (magnification 100 times) allows a clear recognition of the yellow micro-colonies.

Finally, the same preparation can be examined using a fluorescence microscope. In this case the differentiation is even clearer because the clones expressing the xylE gene fluoresce clearly under ultraviolet radiation, while those which do not express it remain black and therefore invisible on the field of observation. Extremely effective research can thus be carried out on very underdeveloped colonies. You can also use a higher magnification (400 times) and observe that the cells themselves are fluorescent. Another interesting property of cells could be highlighted. Normal strains of yeast are only intoxicated by catechol in very large doses, greater than 10 mM; However, the strains described here, which express the xylE gene, show hypersensitivity to the substrate, no growth appearing beyond 1 mM. Thus, it is possible to couple a development test with the colored test, as is the case for the strains (ade-) previously mentioned.

EXAMPLE 6 The following tests are carried out with the strains described in Example 3 which contain the expression block of the xylE gene integrated into chromosome V. The essential difference with the strain containing this block on an autonomous replicating plasmid is that the gene is present here in a single copy, against 30 to 50 on the plasmid. We therefore expect an enzymatic activity per cell 30 to 50 times lower. The vaporization of catechol on this type of strains, containing only a single copy of the gene, does not make it possible to see a yellow coloration appear directly. This is undoubtedly due to the too weak enzymatic activity of the cells.

On the other hand, a treatment destroying cells thanks to the action (1 hour, 37 ° C, 1 mg / ml) of the enzyme

Zymolase 60 000 ^® (Miles Laboratory) followed by an in situ incubation of the colonies in an appropriate buffer (phosphate, pH 7, 0.1 M) containing 0.1 M of catechol makes it possible to reveal a yellow coloration of the colonies expressing this gene . In order to achieve greater expression, it is possible to envisage modifying the expression block which will no doubt allow the simple test to be carried out on intact colonies.

Another solution may be to search for mutants expressing xylE sufficiently by the simple search for yellow clones after mutagenesis.

Finally, an enrichment of this type of strains can be carried out using nystatin, as can be seen from the phenotype of sensitivity to catechol demonstrated in example 5.

EXAMPLE 7 In order to quantify the macroscopic phenomenon of coloring, biochemical tests were carried out.

About 3 g of cells cultured in medium without leucine are harvested, washed in 0.1 M phosphate buffer, pH 7, containing 10% acetone (Zukowski et al., 1983) and then ground using glass beads in this same buffer. After centrifugation (40,000 g, 30 minutes), the cell extract is tested for its catechol 2,3-oxygenase enzymatic activity under standard conditions (Zukowski et al., 1983). The results of this assay are given in FIG. 5 which gives the activity, a typical kinetics is presented by FIG. 6.

The calculation of the specific activity of the enzyme results in an activity of 25 mUnits / min / mg of proteins. This figure is extremely low compared to those obtained from other organisms: E.coli or B. subtilis. It is remarkable that so little activity leads to a macroscopic colony test so pronounced.

We then carry out a study of the kinetics of the enzyme from yeast as a function of pH to compare it with that from E. coli. The results (FIG. 7) show that the two enzymes behave identically, thereby indicating that the catechol 2,3-oxygenase produced by yeast has essentially the same properties as that produced by other organisms.

EXAMPLE 8

Construction of pTG840

The construction of the plasmid pTG840 is recalled in FIG. 8. The starting plasmid is the plasmid pTG902 obtained from pBR322 by deletion of the PstI and NdeI sites.

By digestion of pTG902 and of the plasmid carrying the ura3 gene (having no PstI site) with HindIII and ligation of the digestion product, the plasmid pTG803 is obtained.

The 2μ yeast plasmid is digested with

Avall and HindIII and the ends are made blunt by treatment with Klenow polymerase. This 2μ Avall / HindIII fragment is ligated with pTG803 digested with SmaI to provide the plasmid pTG807.

The ura3 gene and the origin of 2μ replication are released in the form of a single fragment by digestion of pTG807 with HindIII. This fragment is treated with the polymerase of

Klenow and cloned into the EcoRI site of pBR322 treated similarly to give pTG831.

The yeast phosphoglycerate kinase (PGK) gene is mutated so that the unique BglII site is introduced to the ATG to initiate translation of the PGK protein. The HindIII / SalI fragment (2.15 kb), comprising the promoter and the start of the coding region of the gene corresponding to the yeast phosphoglycerate kinase, was cloned into the same sites of the vector M13mp8. The creation of a BglII site at the level of the ATG initiator of phosphoglyceratekinase was carried out according to conventional techniques of in vitro mutagenesis (Gillam and Smith, 1979 gene 8, 99-106). To do this, a synthetic oligonucleotide, of sequence 5 'ATATAAAACAAGATCTTTATC 3', was used to modify the original sequence 5 'ATATAAAACAATGTCTTTATC 3'; the initiating ATG is thus rendered non-functional due to its replacement by the AGA sequence.

This thus modified gene is cloned into the plasmid pTG831 to give the plasmid pTG832.

The PGK terminator located in the EcoRI / HindIII fragment is cloned into the PvuII site of pTG832 after treatment of its ends with polymerase from

Klenow. The resulting plasmid, pTG833, is digested with BglII and recircularized to give the final expression vector pTG834. As indicated above, the unique BglII site in this vector can be used for the expression of heterologous gene in yeast.

It is in this BglII site that the BamHI / BglII fragment of the pNeo gene is ligated.

EXAMPLE 9

Construction of the plasmid pTG861 A HindIIl / HindIII fragment which combines all the expression functions of the xylE gene in yeast is taken from the plasmid pTG82l described in Example 1 of the patent and is introduced by digestion and ligation into the single site. HindIII from pTG840. The final plasmid pTG861 is thus obtained.

The different elements of this plasmid are listed in the table below.

EXAMPLE 10

Two industrially cultivated strains are used which do not carry auxotrophy. One is used in a brewery, the other in a bakery. These strains were transformed with the plasmid pTG861 according to the method described by Hinnen et al. (1978) with a few modifications: after the process as described by these authors, the protoplasts are incubated for 5 hours at 30 ° C. in the complete medium containing sorbitol (IM).

After this expression time, they are mixed with 10 ml of complete medium at 45 ° C. containing sorbitol (IM), 3% agar. 10 ml of the same medium containing 600 μg / ml of G418 for brewer's yeast and 2 mg / ml of G418 for baker's yeast are poured onto the first layer after an incubation of 6 to 15 hours at 30 ° C.

This manipulation is done in parallel with or without pTG86l DNA.

Yeast clones resistant to G418 are thus obtained, essentially on dishes corresponding to the series with DNA. The frequencies are however very low (from 1 to 1OO clones per box).

The colonies obtained are subcultured on fresh medium with antibiotic and without sorbitol, then brought into contact with catechol according to the technique described in Example 4 of the patent. We then find that a large fraction of the clones from the series with DNA become yellow while all the clones of the series without DNA remain white. The presence or absence of pTG861 in the yellow and white clones respectively was verified by the presence of β-lactamase in the strains (Chevallier et al. 1979). Another advantage of the method is linked to the instability of the plasmid (see example 4). The clones obtained with the brewery and bakery strains are cultured without antibiotics and then subcloned. The subclone populations are analyzed using the same rapid catechol method. It is then very easy to see the appearance of clones devoid of plasmid. This application of the invention can be very useful, on the one hand for analyzing industrial fermentations carried out with such strains, on the other hand for easily searching for strains devoid of plasmid in cotransformation manipulations (Rothstein, 1983).

References Beggs J. (1981) in Genetic Engineering, vol. 2, P.175-203; Ed. R. Williamson - Academic Press.

Chevallier MR, Lacroute JF (1982), The Embo Jl 1, 3, p.375-377. De Louvencourt L., Wesolowski M., Fukuhara H., Heslot H. (1982) in The proceeding of the XI ^th International Conference on Yeast Genetics and Molecular Biology, p.48.

Dobson M.J., Tuite M.F., Roberts N.A., Kingsman A.J. and Kingsman S.M. (1982), Nucl. Acids Res. 10, 8, p.2634. Falaiya A., Sagin S. (1979) Jl of Bacteriology 140, 3, p.1043-1049.

Franklin F.L.H., Bagdasarian M.M., Bagdasarian M., Timmis K.N. (1981), Proc. Nat. Acad. Sci. U.S.A. 78, p.7458-7462.

Girvitz S.C., Bochetti S., Rainbow A.J., Graham F.L. (1980), Anal. Biochem. 106, p.492.

Hinnen A., Hicks J.B., Finck G.R. (1978), Proc. Natl. Acad. Sci. U.S.A., 75, pp. 1929-1933.

Hitzeman R.A., Leung D.W., Perry L.J., Kohr W.J., Levine H.L. Goeddel D.V. (1983) Science 219, P.621. Loison G., Jund R. (1981) Gene 15, p.127-137.

Maniatis T., Fritsch EE, Sambook J. (1982); In the Molecular Cloning; A laboratory Manual; Gold Spring Harbor Laboratory Ed. NYUSA Orr-Weaver TL, Szostak JW, Rothstein RJ (1981) Proc. Natl. Acad. Sci. USA 78, 10, p.6354-6358.

Reipen G., Ehrart E., Breunig K.D., Hollenberg C.P. (1982) Current Genetics 6, p.189-193. Rose M., Casadaban M., Botstein D. (1981) Proc. Natl. Acad. Sci. U.S.A., 78, pp. 2460-2464.

Zukowski MM, Gaffney D. Speck D., Kruffmann M., Findeli A., Wisecup A., Lecocq JP (1983) Proc. Natl. Acad. Sci. USA 80, p.1101-1105.

BIBLIOGRAPHY

BECK E., LUDWIG G., AUERSWALD E.A., REIM B. and SCHALLER H. (1982) Gene 19, 327-336.

BOLIVAR F., RODRXGEZ R.L., GREENE P.J., BETLACH M.C., HEYNECHER H.L. and BOYER H.W. (1977) Gene 2, 95-113.

CHEVALLIER M.R. and AIGLE M. (1979) FEBS Letter 108, 179-180.

JIMENEZ A. and DAVIES J. (1980) Nature 287, 869-871.

ROTHSTEIN R.J. (1983) in Methods in enzymology, vol. 101. Wu, Grossman and Moldavian Editors, Academic Press (N.Y.) 202-211.

Claims

1. - Block for the expression of catechol 2,3-oxygenase in a yeast, characterized in that it comprises, according to the direction of reading and with the correct orientation, at least:

. a yeast promoter,

. the xylE gene, and

. a yeast terminator.

2. - Expression block according to claim 1, characterized in that the promoter and the terminator are the promoter and the terminator of the URA3 ⁺ gene in

Saccharomyces cerevisiae.

3. - Expression block according to one of claims 1 and 2, characterized in that the xylE gene is inserted into the PstI site of the URA3 gene.

4. - Expression block according to one of claims 1 to 3, characterized in that it is limited by two HindIII sites.

5. - expression block of catechol-2,3-oxγgenase in yeast according to one of claims 1 to 4, characterized in that it comprises as selection marker the gene for resistance to a chemical compound.

6. - expression block according to claim 5, characterized in that the gene for resistance to a chemical compound is a gene for resistance to an antibiotic.

7. - An expression block according to claim 6, characterized in that the antibiotic resistance gene is the G418 resistance gene.

8. - Expression block according to one of claims 5 to 7, characterized in that the gene is under the promotion of a yeast promoter and is terminated by a yeast terminator.

9. - expression block according to claim 8, characterized in that the yeast promoter and terminator originate from the PGK gene.

10. - Plasmid characterized in that it comprises an expression block according to one of claims 1 to 9, and an autonomous replication system for yeast.

11. - Plasmid according to claim 10, characterized in that the autonomous replication system is that of the plasmid 2 μm of yeast.

12. - Plasmid according to one of claims 10 and II, characterized in that it further comprises a selection marker for yeast.

13. - Plasmid according to claim 12, characterized in that the selection marker is the LEU2 gene.

14. - Plasmid according to one of claims 10 to 13, characterized in that it further comprises an autonomous replication system for a bacterium.

15. - Plasmid according to claim 14, characterized in that the autonomous replication system in a bacterium is that of the plasmid pBR322.

16. - Plasmid according to one of claims 12 to

15, characterized in that it comprises a selective marker for a bacterium.

17. - Plasmid according to claim 16, characterized in that the selective marker for a bacterium is a gene for resistance to an antibiotic.

18. - Plasmid according to one of claims 12 to 17, characterized in that it comprises at least:

. the promoter of the URA3 gene,. the xylE gene,. the terminator of the URA3 gene,

. the origin of replication of pBR322,. the ampicillin resistance gene,. the LEU2 gene,. all or part of the 2 μm plasmid.

19. - Plasmid according to one of claims 12 to 18, characterized in that it comprises at least one unique restriction site located so that the insertion of a DNA fragment in this site inhibits the synthesis of catechol oxygenase.

20. - Plasmid according to claim 19, characterized in that this unique restriction site is located in the xylE gene.

21. - Plasmid according to one of claims 19 and 20, characterized in that it comprises in the unique restriction site DNA coding for a protein.

22. - Yeast strain transformed with a plasmid according to one of claims 10 to 21.

23. - Yeast strain characterized in that it comprises an expression block according to one of claims 1 to 9 incorporated on its chromosome.

24. - Strain according to one of claims 22 and 23, characterized in that it is a strain of Saccharomyσes or Schizosaccharomyces.

25. - strain according to claim 24, characterized in that it is a strain of Saccharomyces cerevisiae.

26. - Strain according to one of claims 22 and 23, characterized in that it is a baker's yeast or a brewer's yeast.

27. - Catechol 2,3-oxygenase obtained by fermentation of a strain according to one of claims 22 to 26.

28. Application of the expression blocks according to one of claims 1 to 9 and the plasmids according to one of claims 10 to 21 as colored markers in yeasts by integration of the expression blocks on the chromosomes of said yeasts. or by transformation of said yeasts with the plasmids and detection of the catechol 2,3-oxygenase produced.

29. - Application according to claim 28, characterized in that the labeled yeast strain is a yeast strain used in winemaking.

30. - Application according to one of claims 28 and 29, characterized in that the detection is carried out by measuring the fluorescence of the strains producing catechol 2,3-oxygenase.

31. - Application according to one of claims 28 and 29, characterized in that the detection is carried out by spraying the strains with catechol and observation of a yellow coloration for the strains producing catechol oxygenase.