WO1994029463A1 - Yeast promotor and use thereof - Google Patents

Yeast promotor and use thereof Download PDF

Info

Publication number
WO1994029463A1
WO1994029463A1 PCT/FR1994/000698 FR9400698W WO9429463A1 WO 1994029463 A1 WO1994029463 A1 WO 1994029463A1 FR 9400698 W FR9400698 W FR 9400698W WO 9429463 A1 WO9429463 A1 WO 9429463A1
Authority
WO
WIPO (PCT)
Prior art keywords
recombinant
dna
proteins
expression
genes
Prior art date
Application number
PCT/FR1994/000698
Other languages
French (fr)
Inventor
Monique Bolotin
Sandrine Menari
Original Assignee
Rhone-Poulenc Rorer S.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rhone-Poulenc Rorer S.A. filed Critical Rhone-Poulenc Rorer S.A.
Priority to JP7501423A priority Critical patent/JPH08511161A/en
Priority to EP94918915A priority patent/EP0703986A1/en
Publication of WO1994029463A1 publication Critical patent/WO1994029463A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/765—Serum albumin, e.g. HSA

Definitions

  • the present invention relates to the field of molecular biology. More particularly, it relates to a new DNA sequence exhibiting transcriptional promoter activity, expression vectors containing this sequence, and its use for the production of recombinant proteins, and for example heterologous proteins. The invention also relates to the recombinant cells containing this DNA sequence.
  • This situation can cause various drawbacks, and in particular limit the activity of the promoter due to the absence of certain elements of the transcriptional machinery (for example of trans-activators), present a certain toxicity for the host cell due to an absence of regulation, or affect the stability of the vector.
  • the Applicant has now identified, clone and sequence xa region of the genome of Kluyveromyces lactis exhibiting transcriptional promoter activity (see SEQ ID No. 1). More specifically, this region corresponds to the promoter of the gene for a protein involved in the transport of sugars. This region, or derivatives or fragments thereof, can be used very efficiently for the production of recombinant proteins in yeasts of the genus Kluyveromyces. It is understood that this sequence can also be used in other host organisms.
  • an advantage of the promoter activity obtained lies in its regulable nature. Therefore, according to the conditions of use (medium, strain), it is possible to control the activity of the promoter, and therefore to trigger or repress the expression of a recombinant gene.
  • An object of the present invention therefore resides in a DNA sequence comprising all or part of the sequence SEQ ID No. 1 or of its complementary strand, or of a derivative thereof, and having a transcriptional promoter activity.
  • the term “derivative” means any sequence obtained from the sequence SEQ ID No. 1 by modification (s) of genetic and / or chemical nature, retaining promoter activity.
  • modification of a genetic and / or chemical nature is meant any mutation, deletion, substitution, addition, and / or modification of one or more nucleotides. Such modifications can be carried out for different purposes, and in particular that of preparing portable promoters, or that of preparing promoters suitable for expression in a particular type of vector or host, that of reducing the size, of increasing transciption promoter activity, generate inducible promoters, improve the level of regulation, or to change the nature of regulation.
  • Such modifications can be made, for example, by in vitro mutagenesis, by the introduction of additional control elements or synthetic sequences, or by deletions or substitutions of the original control elements.
  • a derivative as defined above When a derivative as defined above is produced, its transcriptional promoter activity can be demonstrated in several ways, and in particular by placing under the control of the sequence studied, a reporter gene whose expression is detectable. Any other technique known to those skilled in the art can obviously be used for this purpose.
  • the sequence SEQ ID No. 1 was obtained from a fusion library between fragments of the genome of Klactis 2359/152 and the lacZ gene of Ec li according to the protocol described in the examples.
  • the invention also relates to a DNA fragment comprising all or part of the 3 kb BglII-BamHI fragment described in FIG. 3 and having a transcriptional promoter activity.
  • Another subject of the invention relates to a recombinant DNA comprising a DNA sequence as defined above.
  • This recombinant DNA can contain, for example, the promoter sequence SEQ ID No. 1 or a derivative thereof, into which a restriction site is inserted, facilitating the use of this sequence as a "portable" promoter.
  • this recombinant DNA also contains one or more structural genes. In particular, they may be genes coding for proteins of pharmaceutical or agrifood interest.
  • enzymes such as in particular superoxide dismutase, catalase, amylases, lipases, amidases, chymosin, etc.
  • blood derivatives such as serum albumin, alpha- or beta-globin, factor VIII, factor IX, von Willebrand factor, fibronectin, alpha-1 antitrypsin, etc.
  • insulin and its variants lymphokines (such as interleukins, interferons, colony stimulating factors [G-CSF, GM-CSF, M-CSF ...], TNF, TRF, etc.), growth factors (such as growth hormone, erythropoietin, FGF, EGF, PDGF, TGF, etc.), apolipoproteins, antigenic polypeptides for production of vaccines (hepatitis, cytomegalovirus, Eppstein-Barr, herpes, etc.), or even fusions of polypeptides such as in particular fusions comprising an active
  • the recombinant DNA also contains signals allowing the secretion of the expression product of said structural gene (s).
  • signals may correspond to the natural secretion signals of the protein in question, but they may be of a different origin.
  • secretion signals derived from yeast genes can be used, such as those of the killer toxin genes (Stark and Boyd, EMBO J. 5 (1986) 199i) or the alpha pheromone (Kurjan and Herskowitz, Cell 2 ⁇ (1982) 933; Brake et al., Yeast 4 (1988) S436).
  • the recombinant DNA is part of an expression plasmid, which can be autonomously replicating or integrative.
  • autonomously replicating vectors can be obtained using autonomous replicating sequences in the chosen host.
  • these may be origins of replication derived from plasmids (pKDl, 2 ⁇ , etc.), or else chromosomal sequences (ARS).
  • Integrative vectors can be obtained in particular by using sequences homologous to certain regions of the host genome, allowing, by homologous recombination, the integration of the vector.
  • Another subject of the invention relates to recombinant cells containing a DNA sequence as defined above.
  • the cells are chosen from yeasts, and even more preferably from yeasts of the genus Kluyveromyces. It is understood, however, that the invention covers all the recombinant cells in which the promoter regions of the invention are active, whether they are eukaryotic or prokaryotic cells.
  • the eukaryotic cells mention may be made of plant, animal cells, yeasts, or fungi.
  • yeasts mention may be made of yeasts of the genus Saccharomyces, Pichia, Schwanniomyces, or Hansenula.
  • animal cells mention may be made of COS, CHO, C127 cells, etc.
  • fungi capable of being used in the present invention, there may be mentioned more particularly Aspergillus ssp. or Trichoderma ssp.
  • bacteria such as Escherichia coli, or those belonging to the genera Corynebacterium, Bacillus or Streptomyces can be used.
  • promoter of the transcription of the sequences of the invention in these different hosts can be verified for example by introducing into the host cell considered a recombinant DNA comprising, under the control of the promoter sequence studied, a reporter gene, the expression can be highlighted in the host considered.
  • the recombinant cells of the invention can be obtained by any method which makes it possible to introduce foreign DNA into a cell. It may especially be transformation, electroporation, conjugation, fusion of protoplasts, or any other technique known to those skilled in the art. With regard to transformation, various protocols have been described in the prior art. In particular, it can be carried out by treating the whole cells in the presence of lithium acetate and of polyethylene glycol according to the technique described by Ito et al. (J. Bacteriol. 153 (1983) 163-168), or in the presence of ethylene glycol and dimethyl sulfoxide according to the technique of Durrens et al. (Curr. Genêt. Lj £ (1990) 7).
  • sequences of the invention can be used for the expression of genes coding for proteins of pharmaceutical or agrifood interest.
  • proteins of pharmaceutical or agrifood interest By way of example, mention may be made of the proteins listed above.
  • the present invention also makes it possible to carry out a method for producing recombinant proteins, according to which a recombinant cell as defined above is cultivated and the protein produced is recovered.
  • a recombinant cell as defined above is cultivated and the protein produced is recovered.
  • a particularly advantageous aspect of the invention lies in the possibility of regulating the activity of the promoters.
  • the Applicant has indeed shown that the promoter of the sequence SEQ ID No. 1 was repressed by glucose and active in the presence of lactose.
  • the promoter of the sequence SEQ ID No. 1 is 50 to 100 times more active in the presence of lactose than in the presence of glucose.
  • This result is interesting because it makes it possible to carry out a process for producing recombinant proteins in which the phases of cell growth and expression of the desired recombinant gene are separated.
  • glucose medium the recombinant cells divide up to a stationary phase. At this time, the concentration of glucose in the culture medium has dropped sharply, which allows the expression of the gene of interest to be depressed.
  • the method of the invention is applicable to the production of human serum albumin, or one of its molecular variants.
  • molecular variant of albumin is understood to mean the natural variants resulting from the polymorphism of albumin, truncated forms, or any hybrid protein based on albumin.
  • SEQ ID No. 1 Nucleotide sequence of the 1 kb fragment corresponding to the promoter of a sugar transporter gene from K. lactis.
  • Figure 1 Preparation of the Mini Mu MudIIZKl transposon.
  • Figure 2 Restriction map of the Mini Mu MudIIZKl transposon.
  • Figure 3 Restriction map of clone 2C5.
  • Figure 4 Restriction map of the 3 kb BglII-BamHI fragment carrying the sequence SEQ ID No. 1.
  • the pBR322 and pUC type plasmids are of commercial origin (Bethesda
  • the DNA fragments are separated according to their size by electrophoresis in agarose or acrylamide gels, extracted with phenol or with a phenol / chloroform mixture, precipitated with ethanol and then incubated in the presence of DNA.
  • phage T4 ligase (Boehringer) according to supplier's recommendations.
  • the filling of the protruding 5 ′ ends can be carried out by the Klenow fragment of the DNA Polymerase I of £. coli (Boehringer) according to the supplier's specifications. Destruction of the prominent 3 ′ ends can be carried out in the presence of phage T4 DNA Polymerase (Biolabs) used according to the manufacturer's recommendations. The destruction of the protruding 5 ′ ends can be carried out by gentle treatment with nuclease SI.
  • K. lactis The transformations of K. lactis are carried out by any technique known to a person skilled in the art, an example of which is given in the text. Unless otherwise indicated, the bacterial strains used are Ecoli DH1
  • the yeast strains used belong to budding yeasts and more particularly to yeasts of the genus Kluyveromyces.
  • the strains K. lactis 2359/152 and K. lactis SD6 were particularly used.
  • the yeast strains transformed by the plasmids are cultured in Erlenmeyer flasks or in pilot fermenters of 21 (SETRIC, France) at 28 ° C in rich medium (YPD: 1% yeast extract, 2% Bactopeptone, 2% glucose; or YPL: 1% yeast extract, 2% Bactopeptone, 2% lactose) with constant stirring.
  • YPD 1% yeast extract, 2% Bactopeptone, 2% glucose
  • YPL 1% yeast extract, 2% Bactopeptone, 2% lactose
  • sequence SEQ ID No. 1 was isolated from a fusion library between fragments of the genome of K lactis 2359/152 and the lacZ gene of Exoli. This example describes in (A) the preparation of the fusion library, and in (B) the selection and characterization of a clone of this library carrying the promoter sequence SEQ ID no.
  • the Mini Mu MudIIZKl was built from the Mini Mu Mud ⁇ ZZl described by Daignan-Fornier and Bolotin-Fukuhara (Gene £ 2 (1988) 45). It was obtained by replacing the origin of replication of the MudIIZZI mini transposon with an origin of functional replication in Kluyveromyces: the origin of replication of the plasmid pKDl (EP231,435).
  • A.1.1 Construction of a cassette carrying the origin of replication of the plasmid pKD1 (fragment SU).
  • the SU fragment (carrying the origin of replication of the plasmid pKD1) was put into the form of a NotI cassette.
  • a derivative of the plasmid pUCl ⁇ was constructed in which the external sites of the cloning multisite (Hindi ⁇ and EcoRI sites) were changed into NotI sites. This was done by digestion with the corresponding enzyme, action of the Klenow enzyme and ligation with a synthetic oligonucleotide corresponding to a NotI site [oligo d (AGCGGCCGCT); Biolabs].
  • the plasmid obtained is designated ⁇ GM67.
  • the SU fragment of 960 bp obtained by digestion with the enzyme Sau3A of the plasmid KEp6 was then inserted at the BamHI compatible site of the plasmid pGM67.
  • the plasmid thus obtained, designated pGM68 contains, in the form of a NotI cassette, the SU fragment.
  • the plasmid pGM15 carrying the mini Mu MudIIZZl was deleted from the 2 ⁇ regions by digestion using the enzyme Sali.
  • the unique SalI site thus obtained was then transformed into a NotI site by ligation of a synthetic oligonucleotide corresponding to a NotI site after the action of the Klenow enzyme.
  • the resulting plasmid is called pGM59.
  • the plasmid obtained designated pGM83, carries a mini Mu, called MudIIZKl, which is adapted to the yeast Kluyveromyces lactis, as well as a functional copy of the LEU2 gene from S. cerevisiae capable of complementing a leu2 mutation in Klactis
  • MudIIZKl is shown in Figure 2.
  • the strain JM109 :: (Mute) was transformed by the plasmid pGM83 containing the mini mu MudIIZKl in the presence of calcium chloride. After transformation, the transposition was induced by thermal shock according to the technique described by Castilho et al. (J. Bacteriol. 15S (1984) 488). The phage lysate obtained after induction is then used to superinfect the JM109 strain: :( Mucts).
  • the JM 109 "strain (Mutes) being recA, the linear DNA packaged by the phage cannot be closed to give a replicative plasmid.
  • the integrants [strain JM109 :: (Mutes)" (MudIIZKl)] are therefore selected as chloramphenicol clones resistant (Cm ⁇ ), sensitive ampicillin (AmpS).
  • the plasmid DNA of each pool produced in DH1 is extracted (Maniatis).
  • the fusion library is produced by extensive transposition of the Mini Mu MudIIZKl onto the plasmids forming the genomic DNA library of Klactis.
  • the mini-muductions were made according to the protocol described by Castilho et al. (J.
  • LBAC LBAC (LB medium (Gibco BRL) supplemented with 50 mg / 1 of ampicillin and 30 mg 1 of chloramphenicol), the marker Amp ⁇ being provided by the plasmid, and the marker Cm ⁇ by the mini-mu.
  • transpositions are made in series, and between 10,000 and 20,000 transductants are recovered per pool.
  • the DNA of the transductants is then extracted from a 100 ml preparation, purified by precipitation with polyethylene glycol (Maniatis et al, 1989) and resuspended in 100 ⁇ l of water. This
  • the fusion DNA prepared above was used to transform, by electroporation, a receptor strain of Klactis.
  • This receptor strain designated SD6
  • This last mutation prevents the strain from growing on a medium containing lactose as the only carbon source, but it can be complemented by overexpression of the lacZ ⁇ .coli gene coding for ⁇ -galactosidase (Chen et al., J. Basic Microbiol £ 2 (1988) 211). Therefore, the expression of a protein fused to ⁇ -galactosidase must allow the growth of the strain SD6 on lactose after transformation. This positive screen was used to rapidly select clones carrying strong promoters.
  • the strain SD6 (Chen et al., Mol. Gen. Genêt. 222 (1992) 97) was obtained by crossing the strain Klactis CXJ1-7A (a, lac4-8, ura3A, adel-1, Kl, K2, pKDl) (Chen and Fukuhara, Gene £ 2 (1988) 181) with the strain AWJ-137 (leu2, trpl, homothallic) (Kâmper et al, Curr. Genêt. 12 (1991) 109), and selection of spores having the ADE + genotype, uraA, leu2, lac4-8.
  • the strain CXJ1-7A As the spores obtained were not capable of regenerating after transformation by protoplasts, a back crossing was made with the strain CXJ1-7A. After mass sporulation, the spores of the selected genotype were tested by transformation with lithium chloride with the plasmid KEp6 according to a technique derived from that described by Ito et al. (J. Bacteriol. 153 (1983) 163) (the LiCl concentration is 20 mM, ie 10 times less than that used by Ito for S. cerevisiae). The strain CXJ1-7A served as a transformation control.
  • the strain SD6 selected on these criteria, transforms correctly: 1 to 3. 10 ⁇ transformants per ⁇ g of DNA; and the transformants have satisfactory stability: 30 to 40% of the colonies retain the [Ura + ] phenotype after 6 generations in a non-selective medium.
  • strain SD6 was transformed by electroporation according to Becker and
  • clone 2C5 was studied by restriction (see FIG. 3) and by analysis of the sequence of the junction between the Klactis protein and the ⁇ - galactosidase.
  • sequence of the junction starting from the lacZ end of the mini-m ⁇ (double-stranded sequence) was determined by sequencing, using the following oligonucleotide located at -59 nucleotides from the junction:
  • the different Kluyveromyces strains used were transformed by treating the whole cells in the presence of lithium acetate and polyethylene glycol, according to the technique described by Ito et al. (J. Bacteriol. 153 (1983)
  • a portable promoter is prepared by PCR, by insertion on the 3 kb BglII-BamHI fragment of a restriction site in position +1 relative to the ATG codon.
  • This site makes it possible to generate a fragment comprising the promoter region and to introduce any gene which it is desired to express downstream of the promoter thus obtained.
  • NAME RHONE-POULENC RORER S.A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

DNA sequences having transcriptional promotor activity, the expression vectors containing these sequences, and the use of these sequences for recombinant gene expression are disclosed.

Description

PROMOTEUR DE LEVURE ET SON UTILISATION YEAST PROMOTER AND ITS USE
La présente invention concerne le domaine de la biologie moléculaire. Plus particulièrement, elle concerne une nouvelle séquence d'ADN présentant une activité de promoteur transcriptionnel, des vecteurs d'expression contenant cette séquence, et son utilisation pour la production de protéines recombinantes, et par exemple de protéines hétérologues. L'invention concerne aussi les cellules recombinées contenant cette séquence d'ADN.The present invention relates to the field of molecular biology. More particularly, it relates to a new DNA sequence exhibiting transcriptional promoter activity, expression vectors containing this sequence, and its use for the production of recombinant proteins, and for example heterologous proteins. The invention also relates to the recombinant cells containing this DNA sequence.
Les progrès accomplis dans le domaine de la biologie moléculaire ont permis de modifier des microorganismes pour leur faire produire des protéines hétérologues. En particulier, de nombreuses études génétiques ont_-pbrté sur la bactérie Kcoli. Toutefois, l'application industrielle de ces nouveaux modes de production est encore limitée, en particulier par les problèmes d'efficacité d'expression des gènes dans ces microorganismes recombinés. Aussi, dans le but d'augmenter les performances de ces systèmes de production, des recherches ont été effectuées afin d'isoler des promoteurs forts, permettant d'obtenir des niveaux élevés d'expression de protéines hétérologues. Chez Exoli, on peut citer en particulier les promoteurs des opérons tryptophane et lactose.Advances in molecular biology have made it possible to modify microorganisms to make them produce heterologous proteins. In particular, numerous genetic studies have been carried out on the Kcoli bacteria. However, the industrial application of these new modes of production is still limited, in particular by the problems of efficiency of expression of genes in these recombinant microorganisms. Also, in order to increase the performance of these production systems, research has been carried out in order to isolate strong promoters, making it possible to obtain high levels of expression of heterologous proteins. In Exoli, mention may in particular be made of the promoters of the tryptophan and lactose operons.
Plus récemment, chez la levure S.cerevisiae, des études ont porté sur des promoteurs dérivés de gènes impliqués dans la glycolyse. On peut citer notamment les travaux sur le promoteur du gène de la 3-ρhosρhoglycérate kinase PGK (Dobson et al., Nucleic Acid Res. lβ, 1982, 2625; Hitzeman et al., Nucleic Acid Research 1982, 7791), sur celui du gène de la glyceraldéhyde-3-phosphate deshydrogénase GAPDH (Holland et al., J.Biol.Chem. 254, 1979, 9839; Musti et al., Gène 25, 1983, 133), sur celui du gène de l'alcool deshydrogénase 1 ADH1 (Bennentzen et al., J.Biol.Chem. 257, 1982, 3018; Denis et al., J.Biol.Chem. 25, 1983, 1165), sur celui du gène de l'enolase 1 ENO1 (Uemura et al., Gène 45, 1986, 65), sur celui du gène G ALI /G ALI 0 (Johnston et Davis, Mol. Cell. Biol. 4 (1984) 1440) ou sur celui du gène CYC1 (Guarente et Ptashne, PNAS 7g (1981) 2199).More recently, in the yeast S. cerevisiae, studies have focused on promoters derived from genes involved in glycolysis. Mention may in particular be made of the work on the promoter of the gene for 3-ρhosρhoglycerate kinase PGK (Dobson et al., Nucleic Acid Res. Lβ, 1982, 2625; Hitzeman et al., Nucleic Acid Research 1982, 7791) GAPDH glyceraldehyde-3-phosphate dehydrogenase gene (Holland et al., J. Biol. Chem. 254, 1979, 9839; Musti et al., Gene 25, 1983, 133), on that of the alcohol dehydrogenase gene 1 ADH1 (Boulezzen et al., J. Biol. Chem. 257, 1982, 3018; Denis et al., J. Biol. Chem. 25, 1983, 1165), on that of the enolase 1 gene ENO1 (Uemura et al., Gene 45, 1986, 65), that of the G ALI / G ALI 0 gene (Johnston and Davis, Mol. Cell. Biol. 4 (1984) 1440) or that of the CYC1 gene (Guarente and Ptashne, PNAS 7g (1981) 2199).
Récemment, des outils génétiques ont été développés afin de se servir de la levure Kluyveromyces comme cellule hôte pour la production de protéines recombinantes. La mise en évidence d'un plasmide de type 2-micron originaire de K. drosophilarum (plasmide pKDl - EP 241 43?) a permis d'établir un système hôte/vecteur très efficace pour la production de protéines recombinantes (EP 361 991). Cependant, les promoteurs utilisés dans ce système n'ont pas été optimisés jusqu'à présent. En particulier, il s'agit essentiellement de promoteurs hétérologues, c'est-à-dire provenant d'autres microorganismes, tel que notamment S.cerevisiae. Cette situation peut engendrer différents inconvénients, et notamment limiter l'activité du promoteur à cause de l'absence de certains éléments de la machinerie transcriptionnelle (par exemple de trans-activateurs), présenter une certaine toxicité pour la cellule hôte due à une absence de régulation, ou affecter la stabilité du vecteur.Recently, genetic tools have been developed to use the Kluyveromyces yeast as a host cell for the production of recombinant proteins. The demonstration of a 2-micron type plasmid originating from K. drosophilarum (plasmid pKDl - EP 241 43?) Has made it possible to establish a very efficient host / vector system for the production of recombinant proteins (EP 361 991) . However, the promoters used in this system have not been optimized until now. In particular, these are essentially heterologous promoters, that is to say from other microorganisms, such as in particular S. cerevisiae. This situation can cause various drawbacks, and in particular limit the activity of the promoter due to the absence of certain elements of the transcriptional machinery (for example of trans-activators), present a certain toxicity for the host cell due to an absence of regulation, or affect the stability of the vector.
Dans ces conditions, le manque de promoteurs homologues forts chez Kluyveromyces constitue un facteur limitant dans l'exploitation industrielle de ce système d'expression.Under these conditions, the lack of strong homologous promoters in Kluyveromyces constitutes a limiting factor in the industrial exploitation of this expression system.
La Demanderesse a maintenant identifié, clone et séquence xa région du génome de Kluyveromyces lactis présentant une activité de promoteur transcriptionnel (voir SEQ ID n° 1). Plus précisément, cette région correspond au promoteur du gène d'une protéine impliquée dans le transport de sucres. Cette région, ou des dérivés ou fragments de celle-ci, peut être utilisée de manière très performante pour la production de protéines recombinantes chez les levures du genre Kluyveromyces. Il est entendu que cette séquence peut également être utilisée dans d'autres organismes hôtes.The Applicant has now identified, clone and sequence xa region of the genome of Kluyveromyces lactis exhibiting transcriptional promoter activity (see SEQ ID No. 1). More specifically, this region corresponds to the promoter of the gene for a protein involved in the transport of sugars. This region, or derivatives or fragments thereof, can be used very efficiently for the production of recombinant proteins in yeasts of the genus Kluyveromyces. It is understood that this sequence can also be used in other host organisms.
De plus, un avantage de l'activité promotrice obtenue réside dans son caractère régulable. De ce fait, selon les conditions d'utilisation (milieu, souche), il est possible de contrôler l'activité du promoteur, et donc de déclencher ou de réprimer l'expression d'un gène recombiné.In addition, an advantage of the promoter activity obtained lies in its regulable nature. Therefore, according to the conditions of use (medium, strain), it is possible to control the activity of the promoter, and therefore to trigger or repress the expression of a recombinant gene.
Un objet de la présente invention réside donc dans une séquence d'ADN comprenant tout ou partie de la séquence SEQ ID n° 1 ou de son brin complémentaire, ou d'un dérivé de celles-ci, et possédant une activité de promoteur transcriptionnel.An object of the present invention therefore resides in a DNA sequence comprising all or part of the sequence SEQ ID No. 1 or of its complementary strand, or of a derivative thereof, and having a transcriptional promoter activity.
Au sens de la présente invention, on entend par dérivé, toute séquence obtenue à partir de la séquence SEQ ID n° 1 par modification (s) de nature génétique et/ou chimique, conservant une activité de promoteur. Par modification de nature génétique et/ou chimique, on entend toute mutation, délétion, substitution, addition, et/ou modification d'un ou plusieurs nucléotides. De telles modifications peuvent être effectuées dans différents buts, et notamment celui de préparer des promoteurs portables, ou celui de préparer des promoteurs adaptés à l'expression dans un type particulier de vecteur ou d'hôte, celui de réduire la taille, d'augmenter l'activité de promoteur de la transciption, de générer des promoteurs inductibles, d'améliorer le niveau de régulation, ou encore de changer la nature de la régulation. De telles modifications peuvent être effectuées par exemple par mutagénèse in vitro, par introduction d'éléments additionnels de contrôle ou de séquences synthétiques, ou par des délétions ou des substitutions des éléments originels de contrôle. Lorsqu'un dérivé tel que défini ci-dessus est réalisé, son activité de promoteur transcriptionnel peut être mise en évidence de plusieurs façons, et en particulier en plaçant sous le contrôle de la séquence étudiée, un gène reporteur dont l'expression est détectable. Toute autre technique connue de l'homme de l'art peut bien évidemment être utilisée à cet effet. La séquence SEQ ID n° 1 a été obtenue à partir d'une banque de fusion entre des fragments du génome de Klactis 2359/152 et le gène lacZ de E.c li selon le protocole décrit dans les exemples. Il est entendu que l'homme du métier peut isoler cette région par hybridation au moyen d'une sonde comprenant tout ou partie de la séquence SEQ ID n°l ou de son brin complémentaire. Les dérivés selon l'invention peuvent ensuite être préparés à partir de cette séquence, comme indiqué dans les exemples.Within the meaning of the present invention, the term “derivative” means any sequence obtained from the sequence SEQ ID No. 1 by modification (s) of genetic and / or chemical nature, retaining promoter activity. By modification of a genetic and / or chemical nature is meant any mutation, deletion, substitution, addition, and / or modification of one or more nucleotides. Such modifications can be carried out for different purposes, and in particular that of preparing portable promoters, or that of preparing promoters suitable for expression in a particular type of vector or host, that of reducing the size, of increasing transciption promoter activity, generate inducible promoters, improve the level of regulation, or to change the nature of regulation. Such modifications can be made, for example, by in vitro mutagenesis, by the introduction of additional control elements or synthetic sequences, or by deletions or substitutions of the original control elements. When a derivative as defined above is produced, its transcriptional promoter activity can be demonstrated in several ways, and in particular by placing under the control of the sequence studied, a reporter gene whose expression is detectable. Any other technique known to those skilled in the art can obviously be used for this purpose. The sequence SEQ ID No. 1 was obtained from a fusion library between fragments of the genome of Klactis 2359/152 and the lacZ gene of Ec li according to the protocol described in the examples. It is understood that a person skilled in the art can isolate this region by hybridization by means of a probe comprising all or part of the sequence SEQ ID No. 1 or of its complementary strand. The derivatives according to the invention can then be prepared from this sequence, as indicated in the examples.
L'invention concerne également un fragment d'ADN comprenant tout ou partie du fragment BglII-BamHI de 3 kb décrit sur la figure 3 et possédant une activité de promoteur transcriptionnel.The invention also relates to a DNA fragment comprising all or part of the 3 kb BglII-BamHI fragment described in FIG. 3 and having a transcriptional promoter activity.
Un autre objet de l'invention concerne un ADN recombinant comprenant une séquence d'ADN telle que définie ci-dessus.Another subject of the invention relates to a recombinant DNA comprising a DNA sequence as defined above.
Cet ADN recombinant peut contenir par exemple la séquence promotrice SEQ ID n° 1 ou un dérivé de celle-ci, dans laquelle est inséré un site de restriction, facilitant l'utilisation de cette séquence comme promoteur "portable". Préférentiellement, cet ADN recombinant contient en outre un ou plusieurs gènes de structure. En particulier, il peut s'agir de gènes codant pour des protéines d'intérêt pharmaceutique ou agroalimentaire. A titre d'exemple, on peut citer les enzymes (tels que notamment la superoxide dismutase, la catalase, les amylases, les lipases, les amidases, la chymosine, etc), les dérivés sanguins (tels que la sérum- albumine, l'alpha- ou la béta-globine, le facteur VIII, le facteur IX, le facteur de von Willebrand, la fibronectine, l'alpha- 1 antitrypsine, etc), l'insuline et ses variants, les lymphokines (telles que les interleukines, les interférons, les facteurs de stimulation des colonies [G-CSF, GM-CSF, M-CSF...], le TNF, le TRF, etc), les facteurs de croissance (tels que l'hormone de croissance, l'érythropoiétine, le FGF, l'EGF, le PDGF, le TGF, etc), les apolipoprotéines, des polypeptides antigéniques pour la réalisation de vaccins (hépatite, cytomégalovirus, Eppstein-Barr, herpès, etc), ou encore des fusions de polypeptides telles que notamment des fusions comportant une partie active fusionnée à une partie stabilisatrice (par exemple des fusions entre l'albumine ou des fragments d'albumine et le récepteur ou une partie d'un récepteur de virus [CD4, etc.]).This recombinant DNA can contain, for example, the promoter sequence SEQ ID No. 1 or a derivative thereof, into which a restriction site is inserted, facilitating the use of this sequence as a "portable" promoter. Preferably, this recombinant DNA also contains one or more structural genes. In particular, they may be genes coding for proteins of pharmaceutical or agrifood interest. By way of example, mention may be made of enzymes (such as in particular superoxide dismutase, catalase, amylases, lipases, amidases, chymosin, etc.), blood derivatives (such as serum albumin, alpha- or beta-globin, factor VIII, factor IX, von Willebrand factor, fibronectin, alpha-1 antitrypsin, etc.), insulin and its variants, lymphokines (such as interleukins, interferons, colony stimulating factors [G-CSF, GM-CSF, M-CSF ...], TNF, TRF, etc.), growth factors (such as growth hormone, erythropoietin, FGF, EGF, PDGF, TGF, etc.), apolipoproteins, antigenic polypeptides for production of vaccines (hepatitis, cytomegalovirus, Eppstein-Barr, herpes, etc.), or even fusions of polypeptides such as in particular fusions comprising an active part fused to a stabilizing part (for example fusions between albumin or fragments of albumin and the receptor or part of a virus receptor (CD4, etc.)).
Encore plus préférentiellement, l'ADN recombinant contient également des signaux permettant la sécrétion du produit d'expression du ou desdits gènes de structure. Ces signaux peuvent correspondre aux signaux naturels de sécrétion de la protéine considérée, mais ils peuvent être d'une origine différente. En particulier des signaux de sécrétion dérivés de gènes de levure peuvent être utilisés, tels que ceux des gènes de la toxine killer (Stark et Boyd, EMBO J. 5 (1986) 199i) ou de la phéromone alpha (Kurjan et Herskowitz, Cell 2Ω (1982) 933; Brake et al., Yeast 4 (1988) S436).Even more preferably, the recombinant DNA also contains signals allowing the secretion of the expression product of said structural gene (s). These signals may correspond to the natural secretion signals of the protein in question, but they may be of a different origin. In particular, secretion signals derived from yeast genes can be used, such as those of the killer toxin genes (Stark and Boyd, EMBO J. 5 (1986) 199i) or the alpha pheromone (Kurjan and Herskowitz, Cell 2Ω (1982) 933; Brake et al., Yeast 4 (1988) S436).
Dans un mode de réalisation particulier de l'invention, l'ADN recombinant fait partie d'un plasmide d'expression, qui peut être à réplication autonome ou intégratif.In a particular embodiment of the invention, the recombinant DNA is part of an expression plasmid, which can be autonomously replicating or integrative.
En particulier, des vecteurs à réplication autonome peuvent être obtenus en utilisant des séquences à réplication autonomes chez l'hôte choisi. Notamment, chez la levure, il peut s'agir d'origines de réplication dérivées de plasmides (pKDl, 2μ, etc), ou bien de séquences chromosomiques (ARS).In particular, autonomously replicating vectors can be obtained using autonomous replicating sequences in the chosen host. In particular, in yeast, these may be origins of replication derived from plasmids (pKDl, 2μ, etc.), or else chromosomal sequences (ARS).
Les vecteurs intégratifs peuvent être obtenus notamment en utilisant des séquences homologues à certaines régions du génome de l'hôte, permettant, par recombinaison homologue, l'intégration du vecteur.Integrative vectors can be obtained in particular by using sequences homologous to certain regions of the host genome, allowing, by homologous recombination, the integration of the vector.
Un autre objet de l'invention concerne les cellules recombinées contenant une séquence d'ADN telle que définie ci-avant.Another subject of the invention relates to recombinant cells containing a DNA sequence as defined above.
Avantageusement, les cellules sont choisies parmi les levures, et encore plus préférentiellement, parmi les levures du genre Kluyveromyces. Il est entendu cependant que l'invention couvre toutes les cellules recombinées dans lesquelles les régions promotrices de l'invention sont actives, qu'il s'agisse de cellules eucaryotes ou procaryotes. Ainsi, parmi les cellules eucaryotes, on peut citer les cellules végétales, animales, les levures, ou les champignons. En particulier, s'agissant de levures, on peut citer les levures du genre Saccharomyces , Pichia, Schwanniomyces, ou Hansenula. S'agissant de cellules animales, on peut citer les cellules COS, CHO, C127, etc. Parmi les champignons susceptibles d'être utilisés dans la présente invention, on peut citer plus particulièrement Aspergillus ssp. ou Trichoderma ssp. Comme hôtes procaryotes, on peut utiliser les bactéries telles que Escherichia coli, ou celles appartenant aux genres Corynebacterium, Bacillus ou Streptomyces.Advantageously, the cells are chosen from yeasts, and even more preferably from yeasts of the genus Kluyveromyces. It is understood, however, that the invention covers all the recombinant cells in which the promoter regions of the invention are active, whether they are eukaryotic or prokaryotic cells. Thus, among the eukaryotic cells, mention may be made of plant, animal cells, yeasts, or fungi. In particular, as regards yeasts, mention may be made of yeasts of the genus Saccharomyces, Pichia, Schwanniomyces, or Hansenula. As regards animal cells, mention may be made of COS, CHO, C127 cells, etc. Among the fungi capable of being used in the present invention, there may be mentioned more particularly Aspergillus ssp. or Trichoderma ssp. As prokaryotic hosts, bacteria such as Escherichia coli, or those belonging to the genera Corynebacterium, Bacillus or Streptomyces can be used.
L'activité de promoteur de la transcription des séquences de l'invention dans ces différents hôtes peut être vérifiée par exemple en introduisant dans la cellule hôte considérée un ADN recombinant comprenant, sous le contrôle de la séquence promotrice étudiée, un gène reporteur dont l'expression peut être mise en évidence dans l'hote considéré.The activity of promoter of the transcription of the sequences of the invention in these different hosts can be verified for example by introducing into the host cell considered a recombinant DNA comprising, under the control of the promoter sequence studied, a reporter gene, the expression can be highlighted in the host considered.
Les cellules recombinées de l'invention peuvent être obtenues par toute méthode permettant d'introduire un ADN étranger dans une cellule. Il peut s'agir notamment de transformation, électroporation, conjugaison, fusion de protoplastes, ou toute autre technique connue de l'homme de l'art. S'agissant de la transformation, différents protocoles ont été décrits dans l'art antérieur. En particulier, elle peut être réalisée en traitant les cellules entières en présence d'acétate de lithium et de polyéthylène glycol selon la technique décrite par Ito et al. (J. Bacteriol. 153 (1983) 163-168), ou en présence d'éthylène glycol et de diméthylsulfoxyde selon la technique de Durrens et al. (Curr. Genêt. lj£ (1990) 7). Un protocole alternatif a également été décrit dans la demande de brevet EP 361 991. S'agissant d'électroporation, elle peut être réalisée selon Becker et Guarentte (in : Methods in Enzymology Xoil94 (1991) 182). Un autre objet de l'invention concerne l'utilisation d'une séquence telle que précédemment définie pour l'expression de gènes recombinés. Les séquences d'ADN selon l'invention peuvent en effet permettre une production à des niveaux élevés de protéines recombinantes.The recombinant cells of the invention can be obtained by any method which makes it possible to introduce foreign DNA into a cell. It may especially be transformation, electroporation, conjugation, fusion of protoplasts, or any other technique known to those skilled in the art. With regard to transformation, various protocols have been described in the prior art. In particular, it can be carried out by treating the whole cells in the presence of lithium acetate and of polyethylene glycol according to the technique described by Ito et al. (J. Bacteriol. 153 (1983) 163-168), or in the presence of ethylene glycol and dimethyl sulfoxide according to the technique of Durrens et al. (Curr. Genêt. Lj £ (1990) 7). An alternative protocol has also been described in patent application EP 361 991. As regards electroporation, it can be carried out according to Becker and Guarentte (in: Methods in Enzymology Xoil94 (1991) 182). Another object of the invention relates to the use of a sequence as defined above for the expression of recombinant genes. The DNA sequences according to the invention can in fact allow production at high levels of recombinant proteins.
Avantageusement, les séquences de l'invention peuvent être utilisées pour l'expression de gènes codant pour des protéines d'intérêt pharmaceutique ou agroalimentaire. A titre d'exemple, on peut citer les protéines énumérées précédemment.Advantageously, the sequences of the invention can be used for the expression of genes coding for proteins of pharmaceutical or agrifood interest. By way of example, mention may be made of the proteins listed above.
La présente invention permet également la réalisation d'un procédé de production de protéines recombinantes, selon lequel on cultive une cellule recombinée telle que définie ci-avant et on récupère la protéine produite. A titre d'exemple de protéine, on peut citer les protéines énumérées précédemment.The present invention also makes it possible to carry out a method for producing recombinant proteins, according to which a recombinant cell as defined above is cultivated and the protein produced is recovered. By way of example of protein, mention may be made of the proteins listed above.
Par ailleurs, un aspect particulièrement avantageux de l'invention réside dans la possibilité de réguler l'activité des promoteurs. La demanderesse a en effet montré que le promoteur de la séquence SEQ ID n° 1 était réprimé par le glucose et actif en présence de lactose. Ainsi, dans la souche SD6 (Cf exemple I B.l.), le promoteur de la séquence SEQ ID n° 1 est 50 à 100 fois plus actifs en présence de lactose qu'en présence de glucose. Ce résultat est intéressant car il permet de réaliser un procédé de production de protéines recombinantes dans lequel les phases de croissance des cellules et d'expression du gène recombiné désiré sont séparées. Ainsi, en milieu glucose, les cellules recombinantes se divisent jusqu'à une phase stationnaire. A cet instant, la concentration en glucose du milieu de culture a fortement baissé, ce qui permet de déréprimer l'expression du gène d'intérêt.Furthermore, a particularly advantageous aspect of the invention lies in the possibility of regulating the activity of the promoters. The Applicant has indeed shown that the promoter of the sequence SEQ ID No. 1 was repressed by glucose and active in the presence of lactose. Thus, in strain SD6 (cf. example I B1), the promoter of the sequence SEQ ID No. 1 is 50 to 100 times more active in the presence of lactose than in the presence of glucose. This result is interesting because it makes it possible to carry out a process for producing recombinant proteins in which the phases of cell growth and expression of the desired recombinant gene are separated. Thus, in glucose medium, the recombinant cells divide up to a stationary phase. At this time, the concentration of glucose in the culture medium has dropped sharply, which allows the expression of the gene of interest to be depressed.
Préférentiellement, le procédé de l'invention est applicable à la production de sérum-albumine humaine, ou un de ses variants moléculaires. On entend par variant moléculaire de l'albumine, les variants naturels résultant du polymorphisme de l'albumine, les formes tronquées, ou toute protéine hybride à base d'albumine.Preferably, the method of the invention is applicable to the production of human serum albumin, or one of its molecular variants. The term “molecular variant of albumin” is understood to mean the natural variants resulting from the polymorphism of albumin, truncated forms, or any hybrid protein based on albumin.
D'autres avantages de la présente invention apparaîtront à la lecture des exemples qui suivent, qui doivent être considérés comme illustratif s et non limitatifs.Other advantages of the present invention will appear on reading the examples which follow, which should be considered as illustrative and not limiting.
L E G E N D E D E S F I G U R E SL E G E N D E D E S F I G U R E S
SEQ ID n° 1 : Séquence nucléotidique du fragment de 1 kb correspondant au promoteur d'un gène transporteur de sucre de K. lactis. Figure 1 : Préparation du transposon Mini Mu MudIIZKl. Figure 2 : Carte de restriction du transposon Mini Mu MudIIZKl. Figure 3 : Carte de restriction du clone 2C5. Figure 4: Carte de restriction du fragment BglII-BamHI de 3 kb portant la séquence SEQ ID n° 1.SEQ ID No. 1: Nucleotide sequence of the 1 kb fragment corresponding to the promoter of a sugar transporter gene from K. lactis. Figure 1: Preparation of the Mini Mu MudIIZKl transposon. Figure 2: Restriction map of the Mini Mu MudIIZKl transposon. Figure 3: Restriction map of clone 2C5. Figure 4: Restriction map of the 3 kb BglII-BamHI fragment carrying the sequence SEQ ID No. 1.
TECHNIQUES GENERALES DE CLONAGEGENERAL CLONING TECHNIQUES
Les méthodes classiquement utilisées en biologie moléculaire telles que les extractions préparatives d'ADN plasmidique, la centrifugation d'ADN plasmidique en gradient de chlorure de césium, l'électrophorèse sur gels d'agarose ou d'acrylamide, la purification de fragments d'ADN par électroélution, les extraction de protéines au phénol ou au phénol-chloroforme, la précipitation d'ADN en milieu salin par de l'éthanol ou de l'isopropanol, la transformation dans Escherichia coli etc, sont bien connues de l'homme de métier et sont abondament décrites dans la littérature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982; Ausubel F.M. et al. (eds), "CurrentClassically used methods in molecular biology such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in cesium chloride gradient, electrophoresis on agarose or acrylamide gels, purification of DNA fragments by electroelution, the extraction of proteins with phenol or phenol-chloroform, the precipitation of DNA in a saline medium with ethanol or isopropanol, the transformation in Escherichia coli, etc., are well known to the skilled person. and are extensively described in the literature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982; Ausubel FM et al. (eds), "Current
Protocols in Molecular Biology", John Wiley & Sons, New York, 1987].Protocols in Molecular Biology ", John Wiley & Sons, New York, 1987].
Les enzymes de restriction ont été fournies par New England BiolabsRestriction enzymes were supplied by New England Biolabs
(Biolabs), ou Pharmacia et sont utilisées selon les recommandations des fournisseurs. Les plasmides de type pBR322 et pUC sont d'origine commerciale (Bethesda(Biolabs), or Pharmacia and are used according to the recommendations of the suppliers. The pBR322 and pUC type plasmids are of commercial origin (Bethesda
Research Laboratories).Research Laboratories).
Pour les ligatures, les fragments d'ADN sont séparés selon leur taille par électrophorèse en gels d'agarose ou d'acrylamide, extraits au phénol ou par un mélange phénol/chloroforme, précipités à l'éthanol puis incubés en présence de l'ADN ligase du phage T4 (Boehringer) selon les recommandations du fournisseur.For the ligations, the DNA fragments are separated according to their size by electrophoresis in agarose or acrylamide gels, extracted with phenol or with a phenol / chloroform mixture, precipitated with ethanol and then incubated in the presence of DNA. phage T4 ligase (Boehringer) according to supplier's recommendations.
Le remplissage des extrémités 5' proéminentes peut être effectué par le fragment de Klenow de l'ADN Polymérase I d'£. coli (Boehringer) selon les spécifications du fournisseur. La destruction des extrémités 3' proéminentes peut être effectuée en présence de l'ADN Polymérase du phage T4 (Biolabs) utilisée selon les recommandations du fabricant. La destruction des extrémités 5' proéminentes peut être effectuée par un traitement ménagé par la nucléase SI.The filling of the protruding 5 ′ ends can be carried out by the Klenow fragment of the DNA Polymerase I of £. coli (Boehringer) according to the supplier's specifications. Destruction of the prominent 3 ′ ends can be carried out in the presence of phage T4 DNA Polymerase (Biolabs) used according to the manufacturer's recommendations. The destruction of the protruding 5 ′ ends can be carried out by gentle treatment with nuclease SI.
La mutagénèse dirigée in vitro par oligodéoxynucléotides synthétiques peut être effectuée selon la méthode développée par Taylor et al. [Nucleic Acids Res. 12Mutagenesis directed in vitro by synthetic oligodeoxynucleotides can be carried out according to the method developed by Taylor et al. [Nucleic Acids Res. 12
(1985) 8749-8764]. L'amplification enzymatique de fragments d'ADN par la technique dite de(1985) 8749-8764]. The enzymatic amplification of DNA fragments by the technique known as
PCR [Polymérase-catalyzed £hain Reaction, Saiki R.K. et al., Science 230 (1985)PCR [Polymerase-catalyzed £ hate Reaction, Saiki R.K. et al., Science 230 (1985)
1350-1354; Mullis K.B. et Faloona F.A., Meth. Enzym. 155 (1987) 335-350] peut être effectuée en utilisant un "DNA thermal cycler" (Perkin Elmer Cetus) selon les spécifications du fabricant. La vérification des séquences nucléotidiques peut être effectuée par la méthode développée par Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-1350-1354; Mullis K.B. and Faloona F.A., Meth. Enzym. 155 (1987) 335-350] can be performed using a "DNA thermal cycler" (Perkin Elmer Cetus) according to the manufacturer's specifications. Verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-
5467].5467].
Les transformations de K. lactis sont effectuées par toute technique connue de l'homme de l'art, et dont un exemple est donné dans le texte. Sauf indication contraire, les souches bactériennes utilisées sont Ecoli DH1The transformations of K. lactis are carried out by any technique known to a person skilled in the art, an example of which is given in the text. Unless otherwise indicated, the bacterial strains used are Ecoli DH1
(Hanahan D., J. Mol. Biol. 166 (1983) 557) ou Ecoli JM109:: (Muets) (Daignan- fornier et Bolotin-Fukuhara, Gène £2 (1988) 45).(Hanahan D., J. Mol. Biol. 166 (1983) 557) or Ecoli JM109 :: (Mutes) (Daignan-fornier and Bolotin-Fukuhara, Gene £ 2 (1988) 45).
Les souches de levures utilisées appartiennent aux levures bourgeonnantes et plus particulièrement aux levures du genre Kluyveromyces. Les souche K. lactis 2359/152 et K. lactis SD6 ont été particulièrement utilisées. Les souches de levures transformées par les plasmides sont cultivées en erlenmeyers ou en fermenteurs pilotes de 21 (SETRIC, France) à 28°C en milieu riche (YPD: 1 % extrait de levure, 2 % Bactopeptone, 2 % glucose; ou YPL: 1 % extrait de levure, 2 % Bactopeptone, 2 % lactose) sous agitation constante.The yeast strains used belong to budding yeasts and more particularly to yeasts of the genus Kluyveromyces. The strains K. lactis 2359/152 and K. lactis SD6 were particularly used. The yeast strains transformed by the plasmids are cultured in Erlenmeyer flasks or in pilot fermenters of 21 (SETRIC, France) at 28 ° C in rich medium (YPD: 1% yeast extract, 2% Bactopeptone, 2% glucose; or YPL: 1% yeast extract, 2% Bactopeptone, 2% lactose) with constant stirring.
E X E M P L E SE X E M P L E S
I - Isolement du fragment BglII-BamHI de 3 kb de K. lactis.I - Isolation of the 3 kb BglII-BamHI fragment of K. lactis.
La séquence SEQ ID n° 1 a été isolée à partir d'une banque de fusion entre des fragments du génome de K lactis 2359/152 et le gène lacZ de Exoli. Cet exemple décrit en (A) la préparation de la banque de fusion, et en (B) la sélection et la caractérisation d'un clone de cette banque portant la séquence promotrice SEQ ID n°The sequence SEQ ID No. 1 was isolated from a fusion library between fragments of the genome of K lactis 2359/152 and the lacZ gene of Exoli. This example describes in (A) the preparation of the fusion library, and in (B) the selection and characterization of a clone of this library carrying the promoter sequence SEQ ID no.
1 de K. lactis.1 by K. lactis.
AJ Préparation de la banque de fusionAJ Preparation of the fusion bank
A.l. Préparation du transposon Mini Mu MudIIZKl (figures 1 et 2).A.l. Preparation of the Mini Mu MudIIZKl transposon (Figures 1 and 2).
Le Mini Mu MudIIZKl a été construit à partir du Mini Mu MudϋZZl décrit par Daignan-Fornier et Bolotin-Fukuhara (Gène £2 (1988) 45). Il a été obtenu en substituant l'origine de réplication du mini transposon MudIIZZI par une origine de réplication fonctionnelle dans Kluyveromyces : l'origine de réplication du plasmide pKDl (EP231 435).The Mini Mu MudIIZKl was built from the Mini Mu MudϋZZl described by Daignan-Fornier and Bolotin-Fukuhara (Gene £ 2 (1988) 45). It was obtained by replacing the origin of replication of the MudIIZZI mini transposon with an origin of functional replication in Kluyveromyces: the origin of replication of the plasmid pKDl (EP231,435).
A.1.1. Construction d'une cassette portant l'origine de réplication du plasmide pKDl (fragment SU).A.1.1. Construction of a cassette carrying the origin of replication of the plasmid pKD1 (fragment SU).
Afin de faciliter les manipulations ultérieures, le fragment SU (portant l'origine de réplication du plasmide pKDl) a été mis sous forme d'une cassette Notl. Pour cela, un dérivé du plasmide pUClδ a été construit dans lequel les sites externes du multisite de clonage (sites Hindiπ et EcoRI) ont été changés en sites Notl. Cela a été fait par digestion avec l'enzyme correspondante, action de l'enzyme de Klenow et ligature avec un oligonucléotide synthétique correspondant à un site Notl [oligo d(AGCGGCCGCT); Biolabs]. Le plasmide obtenu est désigné ρGM67. Le fragment SU de 960 pb obtenu par digestion par l'enzyme Sau3A du plasmide KEp6 (Chen et al, Nucl. Acids Res. 114 (1986) 4471) a ensuite été inséré au site compatible BamHI du plasmide pGM67. Le plasmide ainsi obtenu désigné pGM68 contient, sous forme d'une cassette Notl, le fragment SU.In order to facilitate subsequent manipulations, the SU fragment (carrying the origin of replication of the plasmid pKD1) was put into the form of a NotI cassette. For this, a derivative of the plasmid pUClδ was constructed in which the external sites of the cloning multisite (Hindiπ and EcoRI sites) were changed into NotI sites. This was done by digestion with the corresponding enzyme, action of the Klenow enzyme and ligation with a synthetic oligonucleotide corresponding to a NotI site [oligo d (AGCGGCCGCT); Biolabs]. The plasmid obtained is designated ρGM67. The SU fragment of 960 bp obtained by digestion with the enzyme Sau3A of the plasmid KEp6 (Chen et al, Nucl. Acids Res. 114 (1986) 4471) was then inserted at the BamHI compatible site of the plasmid pGM67. The plasmid thus obtained, designated pGM68, contains, in the form of a NotI cassette, the SU fragment.
A.1.2. Suppression de l'origine de réplication 2μ du transposon MudIIZZl.A.1.2. Suppression of the origin of 2μ replication of the MudIIZZl transposon.
Le plasmide pGM15 portant le mini Mu MudIIZZl (Daignan-Fornier et Bolotin-Fukuhara précitée) a été délété des régions 2μ par digestion au moyen de l'enzyme Sali. Le site Sali unique ainsi obtenu a ensuite été transformé en site Notl par ligature d'un oligonucléotide synthétique correspondant à un site Notl après action de l'enzyme de Klenow. Le plasmide résultant est appelé pGM59.The plasmid pGM15 carrying the mini Mu MudIIZZl (Daignan-Fornier and Bolotin-Fukuhara above) was deleted from the 2 μ regions by digestion using the enzyme Sali. The unique SalI site thus obtained was then transformed into a NotI site by ligation of a synthetic oligonucleotide corresponding to a NotI site after the action of the Klenow enzyme. The resulting plasmid is called pGM59.
A.1.3. Insertion du fragment SUA.1.3. Insertion of the SU fragment
La cassette Notl portant l'origine de réplication du plasmide pKDl (fragmentThe Notl cassette carrying the origin of replication of the plasmid pKDl (fragment
SU), provenant du plasmide pUC18 modifié a ensuite été introduite au site Notl unique du plasmide pGM59.SU), coming from the modified pUC18 plasmid, was then introduced into the unique NotI site of the plasmid pGM59.
Le plasmide obtenu, désigné pGM83, porte un mini Mu, appelé MudIIZKl, qui est adapté à la levure Kluyveromyces lactis, ainsi qu'une copie fonctionnelle du gène LEU2 de S.cerevisiae capable de complémenter une mutation leu2 chez KlactisThe plasmid obtained, designated pGM83, carries a mini Mu, called MudIIZKl, which is adapted to the yeast Kluyveromyces lactis, as well as a functional copy of the LEU2 gene from S. cerevisiae capable of complementing a leu2 mutation in Klactis
(Kâmper et al, Curr. Genêt. 12 (1991) 109). La carte de restriction du mini-mu(Kâmper et al, Curr. Genêt. 12 (1991) 109). The restriction map of the mini-mu
MudIIZKl est représentée sur la figure 2.MudIIZKl is shown in Figure 2.
A.2. Introduction du Mini Mu MudIIZKl dans la souche Ecoli portant le Mu helper JM109::(Mucts) : Obtention de la souche JM109::(Mucts)::OvludHZKl).A.2. Introduction of the Mini Mu MudIIZKl into the Ecoli strain carrying the Mu helper JM109: :( Mucts): Obtaining the strain JM109: :( Mucts) :: OvludHZKl).
La souche JM109:: (Muets) a été transformée par le plasmide pGM83 contenant le mini mu MudIIZKl en présence de chlorure de calcium. Après transformation, la transposition a été induite par choc thermique selon la technique décrite par Castilho et al. (J. Bacteriol. 15S (1984) 488). Le lysat phagique obtenu après induction est ensuite utilisé pour surinfecter la souche JM109::(Mucts). La souche JM 109 "(Muets) étant recA, l'ADN linéaire encapsidé par le phage ne peut se refermer pour donner un plasmide réplicatif. Les intégrants [souche JM109:: (Muets) "(MudIIZKl)] sont donc sélectionnés comme clones chloramphénicol résistants (Cm^), ampicilline sensibles (AmpS).The strain JM109 :: (Mute) was transformed by the plasmid pGM83 containing the mini mu MudIIZKl in the presence of calcium chloride. After transformation, the transposition was induced by thermal shock according to the technique described by Castilho et al. (J. Bacteriol. 15S (1984) 488). The phage lysate obtained after induction is then used to superinfect the JM109 strain: :( Mucts). The JM 109 "strain (Mutes) being recA, the linear DNA packaged by the phage cannot be closed to give a replicative plasmid. The integrants [strain JM109 :: (Mutes)" (MudIIZKl)] are therefore selected as chloramphenicol clones resistant (Cm ^), sensitive ampicillin (AmpS).
A.3. Préparation de la banque génomique de Klactis dans Ecoli DH1 L'ADN de haut poids moléculaire a été préparé à partir de la souche Klactis 2359/152, et digéré partiellement par l'enzyme Sau3A. Les fragments d'une taille de 4 à 8 kb ont été récupérés sur gel d'agarose LMP ("Low Melting Point", SEAKEM) et clones dans le plasmide pBR322 linéarisé par BamHI et déphosphorylé par action de la phosphatase intestinale de veau (Biolabs). 35 pools de 1000 colonies dans Ecoli DH1 ont ainsi été réalisés. Les 1000 colonies de chaque pool sont ampicilline- résistantes et tétracycline-sensibles, ce qui montre qu'elles ont toutes inséré un fragment d'ADN génomique de Klactis dans pBR322.A.3. Preparation of the Klactis genomic library in Ecoli DH1 The high molecular weight DNA was prepared from the Klactis 2359/152 strain, and partially digested with the enzyme Sau3A. The fragments of a size of 4 to 8 kb were recovered on LMP agarose gel ("Low Melting Point", SEAKEM) and cloned in the plasmid pBR322 linearized with BamHI and dephosphorylated by the action of intestinal phosphatase of calf (Biolabs ). 35 pools of 1000 colonies in Ecoli DH1 were thus produced. The 1000 colonies in each pool are ampicillin-resistant and tetracycline-sensitive, which shows that they have all inserted a fragment of Klactis genomic DNA into pBR322.
A.4. Préparation de la banque de fusionA.4. Preparation of the fusion bank
A.4.1. Introduction de la banque génomique de Klactis dan! la soucheA.4.1. Introduction of the Klactis dan genomic bank! strain
JM109:: (Muets) :: (MudIIZKl).JM109 :: (Mutes) :: (MudIIZKl).
L'ADN plasmidique de chaque pool réalisé dans DH1 est extrait (Maniatis).The plasmid DNA of each pool produced in DH1 is extracted (Maniatis).
Cet ADN est ensuite utilisé pour transformer la souche JM109:: (Muets) :: (MudIIZKl) en présence de chlorure de calcium. Pour être représentatif des 1000 colonies contenues dans chaque pool de la banque génomique, plus de 3000 clones par pool ont été récupérés dans la souche JM109::(Mucts)::(MudIIZKl) permettant la transduction.This DNA is then used to transform the strain JM109 :: (Mutes) :: (MudIIZKl) in the presence of calcium chloride. To be representative of the 1000 colonies contained in each pool of the genomic library, more than 3000 clones per pool were recovered in the strain JM109: :( Mucts): :( MudIIZKl) allowing the transduction.
A.4.2. Transposition du Mini Mu MudIIZKlA.4.2. Transposition of the Mini Mu MudIIZKl
La banque de fusion est réalisée par transposition extensive du Mini Mu MudIIZKl sur les plasmides formant la banque d'ADN génomique de Klactis. Les mini-muductions ont été faites selon le protocole décrit par Castilho et al. (J.The fusion library is produced by extensive transposition of the Mini Mu MudIIZKl onto the plasmids forming the genomic DNA library of Klactis. The mini-muductions were made according to the protocol described by Castilho et al. (J.
Bacteriol. 158 (1984) 488) et les transductants ont été sélectionnés sur milieu sélectifBacteriol. 158 (1984) 488) and the transductants were selected on selective medium
LBAC (milieu LB (Gibco BRL) supplémenté avec 50 mg/1 d'ampicilline et 30 mg 1 de chloramphénicol), le marqueur Amp^ étant apporté par le plasmide, et le marqueur Cm^ par le mini-mu. Pour chaque pool, des transpositions sont faites en série, et entre 10 000 et 20 000 transductants sont récupérés par pool. L'ADN des transductants est ensuite extrait d'une préparation de 100 ml, purifié par précipitation au polyéthylène glycol (Maniatis et al, 1989) et resuspendu dans lOOμl d'eau. CetLBAC (LB medium (Gibco BRL) supplemented with 50 mg / 1 of ampicillin and 30 mg 1 of chloramphenicol), the marker Amp ^ being provided by the plasmid, and the marker Cm ^ by the mini-mu. For each pool, transpositions are made in series, and between 10,000 and 20,000 transductants are recovered per pool. The DNA of the transductants is then extracted from a 100 ml preparation, purified by precipitation with polyethylene glycol (Maniatis et al, 1989) and resuspended in 100 μl of water. This
ADN a ensuite été utilisé pour transformer Klactis et sélectionner des clones portant des promoteurs. B/ Isolement du fragment BglII-BamHI de KlactisDNA was then used to transform Klactis and select clones carrying promoters. B / Isolation of the BglII-BamHI fragment from Klactis
L'ADN de fusion préparé ci-dessus a été utilisé pour transformer, par électroporation, une souche réceptrice de Klactis. Cette souche réceptrice, désignée SD6, porte les mutations leu2 (correspondant au marqueur de sélection du mini-mu MudIIZKl) et lac4-8. Cette dernière mutation empêche la souche de pousser sur un milieu contenant du lactose comme seule source de carbone, mais elle peut être complémentée par la surexpression du gène lacZ άΕ.coli codant pour la β- galactosidase (Chen et al., J. Basic Microbiol. 2£ (1988) 211). De ce fait, l'expression d'une protéine fusionnée à la β-galactosidase doit permettre la croissance de la souche SD6 sur lactose après transformation. Ce crible positif a été utilisé pour sélectionner rapidement des clones portant des promoteurs forts.The fusion DNA prepared above was used to transform, by electroporation, a receptor strain of Klactis. This receptor strain, designated SD6, carries the mutations leu2 (corresponding to the selection marker of the mini-mu MudIIZKl) and lac4-8. This last mutation prevents the strain from growing on a medium containing lactose as the only carbon source, but it can be complemented by overexpression of the lacZ άΕ.coli gene coding for β-galactosidase (Chen et al., J. Basic Microbiol £ 2 (1988) 211). Therefore, the expression of a protein fused to β-galactosidase must allow the growth of the strain SD6 on lactose after transformation. This positive screen was used to rapidly select clones carrying strong promoters.
B.l. Construction de la souche réceptrice Klactis SD6.B.l. Construction of the receptor strain Klactis SD6.
La souche SD6 (Chen et al., Mol. Gen. Genêt. 222 (1992) 97) a été obtenue par croisement de la souche Klactis CXJ1-7A (a, lac4-8, ura3A, adel-1, Kl, K2, pKDl) (Chen et Fukuhara, Gène £2 (1988) 181) avec la souche AWJ-137 (leu2, trpl, homothallique) (Kâmper et al, Curr. Genêt. 12 (1991) 109), et sélection des spores ayant le génotype ADE+, uraA, leu2, lac4-8. Comme les spores obtenues n'étaient pas capables de régénérer après tranformation par protoplastes, un croisement retour a été fait avec la souche CXJ1-7A. Après sporulation en masse, les spores du génotype choisi ont été testées par transformation au chlorure de lithium avec le plasmide KEp6 selon une technique dérivée de celle décrite par Ito et al. (J. Bacteriol. 153 (1983) 163) (la concentration en LiCl est de 20 mM, soit 10 fois moins que celle utilisée par Ito pour S.cerevisiae). La souche CXJ1-7A a servi de témoin de transformation.The strain SD6 (Chen et al., Mol. Gen. Genêt. 222 (1992) 97) was obtained by crossing the strain Klactis CXJ1-7A (a, lac4-8, ura3A, adel-1, Kl, K2, pKDl) (Chen and Fukuhara, Gene £ 2 (1988) 181) with the strain AWJ-137 (leu2, trpl, homothallic) (Kâmper et al, Curr. Genêt. 12 (1991) 109), and selection of spores having the ADE + genotype, uraA, leu2, lac4-8. As the spores obtained were not capable of regenerating after transformation by protoplasts, a back crossing was made with the strain CXJ1-7A. After mass sporulation, the spores of the selected genotype were tested by transformation with lithium chloride with the plasmid KEp6 according to a technique derived from that described by Ito et al. (J. Bacteriol. 153 (1983) 163) (the LiCl concentration is 20 mM, ie 10 times less than that used by Ito for S. cerevisiae). The strain CXJ1-7A served as a transformation control.
La souche SD6, sélectionnée sur ces critères, se transforme correctement : 1 à 3 . 10^ transformants par μg d'ADN; et les transformants ont une stabilité satisfaisante : 30 à 40 % des colonies gardent le phénotype [Ura+] après 6 générations en milieu non sélectif.The strain SD6, selected on these criteria, transforms correctly: 1 to 3. 10 ^ transformants per μg of DNA; and the transformants have satisfactory stability: 30 to 40% of the colonies retain the [Ura + ] phenotype after 6 generations in a non-selective medium.
B.2. Isolement du fragment BglII-BamHI.B.2. Isolation of the BglII-BamHI fragment.
La souche SD6 a été transformée par électroporation selon Becker etThe strain SD6 was transformed by electroporation according to Becker and
Garante (in Methods in Enzymology vol 194 (1991) 182) (appareil Jouan ; 2500 V/cm; 80-100 ng d'ADN/transformation) avec l'ADN de 11 pools de transductants obtenus en A.4.2. (correspondant à une banque de 11000 clones dans Ecoli). Après 5 heures de régénération en milieu YPD (extrait de levure 10 g1 ; peptone 10 g/1 ; glucose 20 g/1), les cellules ont été étalées sur milieu minimum lactose. Les transformants capables de pousser sur lactose ont été restriés et, pour chaque clone, le plasmide a été extrait, amplifié dans E.coli, et, après vérification rapide de la carte de restriction du vecteur et du mini-mu, utilisé pour retransformer la levure SD6. Parmi les clones de Klactis obtenus après retransformation, l'un d'entre-eux, le clone 2C5, a été étudié par restriction (voir figure 3) et par analyse de la séquence de la jonction entre la protéine de Klactis et la β-galactosidase. Pour cela, la séquence de la jonction, à partir de l'extrémité lacZ du mini-mύ (séquence double brin) a été déterminée par séquençage, au moyen de l'oligonucléotide suivant situé à -59 nucléotides de la jonction :Garante (in Methods in Enzymology vol 194 (1991) 182) (Jouan apparatus; 2500 V / cm; 80-100 ng DNA / transformation) with the DNA of 11 pools of transductants obtained in A.4.2. (corresponding to a bank of 11,000 clones in Ecoli). After 5 hours of regeneration in YPD medium (yeast extract 10 g1; peptone 10 g / 1; glucose 20 g / 1), the cells were spread on minimum lactose medium. The transformants capable of growing on lactose were restricted and, for each clone, the plasmid was extracted, amplified in E. coli, and, after rapid verification of the restriction map of the vector and of the mini-mu, used to transform the SD6 yeast. Among the Klactis clones obtained after retransformation, one of them, clone 2C5, was studied by restriction (see FIG. 3) and by analysis of the sequence of the junction between the Klactis protein and the β- galactosidase. For this, the sequence of the junction, starting from the lacZ end of the mini-mύ (double-stranded sequence) was determined by sequencing, using the following oligonucleotide located at -59 nucleotides from the junction:
5'-CTGTTTCATTTGAAGCGCG-3*5'-CTGTTTCATTTGAAGCGCG-3 *
L'analyse de la séquence protéique déduite de la séquence nucléotidique ainsi obtenue par comparaison avec les séquences de banques de protéines d'autres levures ou eucaryotes (Genbank, MIPS, EMBL, etc), montre que la séquence portée par le clone 2C5 correspond à un gène impliqué dans le transport de sucres. Le fragment BglII-BamHI de 3 kb contenant la région en amont de la fusion a ensuite été sous-cloné dans le vecteur Bluescript KS+ (Stratagène), une carte de restriction a été faite (figure 4), et la séquence a été déterminée par délétions séquentielles sur 1 kb (SEQ ID n° 1). L'obtention d'éléments de séquence permet également à l'homme du métier de préparer des sondes spécifiques et de recloner la région promotrice de l'invention par hybridation selon les techniques classiques de biologie moléculaire. II - Transformation de Kluyveromyces.Analysis of the protein sequence deduced from the nucleotide sequence thus obtained by comparison with the sequences of protein banks of other yeasts or eukaryotes (Genbank, MIPS, EMBL, etc.), shows that the sequence carried by the clone 2C5 corresponds to a gene involved in the transport of sugars. The 3 kb BglII-BamHI fragment containing the region upstream of the fusion was then subcloned into the vector Bluescript KS + (Stratagene), a restriction map was made (FIG. 4), and the sequence was determined by sequential deletions on 1 kb (SEQ ID n ° 1). Obtaining sequence elements also allows a person skilled in the art to prepare specific probes and to reclonate the promoter region of the invention by hybridization according to conventional molecular biology techniques. II - Transformation of Kluyveromyces.
Différentes techniques permettant l'introduction d'ADN dans la levure peuvent être utilisées.Different techniques allowing the introduction of DNA into yeast can be used.
Avantageusement, les différentes souches de Kluyveromyces utilisées ont été transformées en traitant les cellules entières en présence d'acétate de lithium et de polyéthylène glycol, selon la technique décrite par Ito et al. (J. Bacteriol. 153 (1983)Advantageously, the different Kluyveromyces strains used were transformed by treating the whole cells in the presence of lithium acetate and polyethylene glycol, according to the technique described by Ito et al. (J. Bacteriol. 153 (1983)
163-168). La technique de transformation décrite par Durrens et al. (Curr. Genêt. 1£163-168). The transformation technique described by Durrens et al. (Curr. Broom. £ 1
(1990) 7) utilisant l'éthylène glycol et le diméthylsulfoxyde a également été utilisée. Il est aussi possible de transformer les levures par électroporation, par exemple selon la méthode décrite par Karube et al. (FEBS Letters 1≤2 (1985) 90).(1990) 7) using ethylene glycol and dimethyl sulfoxide was also used. It is also possible to transform the yeasts by electroporation, for example according to the method described by Karube et al. (FEBS Letters 1≤2 (1985) 90).
Un protocole alternatif a encore été décrit en détail dans la demande EP 361 991. III - Utilisation du promoteur de la SEQ ID n° 1 pour l'expression de gènes hétérologues.An alternative protocol has also been described in detail in application EP 361 991. III - Use of the promoter of SEQ ID No. 1 for the expression of heterologous genes.
L'activité de promoteur transcriptionnel de la région de Klactis décrite sur la séquence SEQ ID n° 1 a été mise en évidence lors même de son isolement, par sa capaciter à induire la complémentation de la mutation lac4-8 de la souche SD6. Cette capacité résulte en effet de l'expression du gène lacZ de Exoli, et démontre par là même la capacité d'expression de gènes hétérologues.The activity of transcriptional promoter of the Klactis region described on the sequence SEQ ID No. 1 was demonstrated during its isolation, by its ability to induce the complementation of the lac4-8 mutation of the strain SD6. This capacity results in fact from the expression of the lacZ gene from Exoli, and thereby demonstrates the capacity for expression of heterologous genes.
IV - Construction d'un promoteur portableIV - Construction of a portable promoter
Un promoteur portable est préparé par PCR, par insertion sur le fragment BglII-BamHI de 3 kb d'un site de restriction en position +1 par rapport au codon ATG.A portable promoter is prepared by PCR, by insertion on the 3 kb BglII-BamHI fragment of a restriction site in position +1 relative to the ATG codon.
L'insertion de ce site permet de générer un fragment comprenant la région promotrice et d'introduire en aval du promoteur ainsi obtenu tout gène que l'on désire exprimer. The insertion of this site makes it possible to generate a fragment comprising the promoter region and to introduce any gene which it is desired to express downstream of the promoter thus obtained.
LISTE DE SEQUENCESLIST OF SEQUENCES
(1) INFORMATION GENERALE:(1) GENERAL INFORMATION:
(i) DEPOSANT:(i) DEPOSITOR:
(A) NOM: RHONE-POULENC RORER S.A.(A) NAME: RHONE-POULENC RORER S.A.
(B) RUE: 20, avenue Raymond ARON(B) STREET: 20, avenue Raymond ARON
(C) VILLE: ANTONY (E) PAYS: FRANCE(C) CITY: ANTONY (E) COUNTRY: FRANCE
(F) CODE POSTAL: 92165(F) POSTAL CODE: 92165
(ii) TITRE DE L* INVENTION: PROMOTEUR DE LEVURE ET SO UTILISATION.(ii) TITLE OF THE INVENTION: YEAST PROMOTER AND UNDER USE.
(iii) NOMBRE DE SEQUENCES: 1(iii) NUMBER OF SEQUENCES: 1
(iv) FORME LISIBLE PAR ORDINATEUR: (A) TYPE DE SUPPORT: Tape (B) ORDINATEUR: IBM PC compatible(iv) FORM READABLE BY COMPUTER: (A) TYPE OF SUPPORT: Tape (B) COMPUTER: IBM PC compatible
(C) SYSTEME D' EXPLOITATION: PC-DOS/MS-DOS(C) OPERATING SYSTEM: PC-DOS / MS-DOS
(D) LOGICIEL: Patentin Release #1.0, Version #1.25 (OEB)(D) SOFTWARE: Patentin Release # 1.0, Version # 1.25 (EPO)
(2) INFORMATION POUR LA SEQ ID NO: 1 :(2) INFORMATION FOR SEQ ID NO: 1:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 1119 paires de bases(A) LENGTH: 1119 base pairs
(B) TYPE: acide nucléique (C) NOMBRE DE BRINS: double(B) TYPE: nucleic acid (C) NUMBER OF STRANDS: double
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(ii) TYPE DE MOLECULE: ADNc (vi) ORIGINE:(ii) TYPE OF MOLECULE: cDNA (vi) ORIGIN:
(B) SOUCHE: Kluyveromyces lactis(B) STRAIN: Kluyveromyces lactis
(ix) CARACTERISTIQUE ADDITTONELLE: (A) NOM/CLE: CDS (B) EMPLACEMENT: 1018..1119(ix) ADDITTONAL CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1018..1119
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 1: GAACTAAACT CAAAAATTTT AGTAAGGAAA TATTCCGACT GGCTATTTC TCGGTCCCCA 60 TCTGACATGT CACGGAAAAA CTGTTCCCCA GAAATTTTTC TTTCCCCGC AGATTCTTTT 120 AAGACGTAAC AAATATGAGA AATGACTTTG CACACAGAAA CATTTGCAG AGTTTTCCGA 180(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: GAACTAAACT CAAAAATTTT AGTAAGGAAA TATTCCGACT GGCTATTTC TCGGTCCCCA 60 TCTGACATGT CACGGAAAAA CTGTTCCCCA GAAATTTTTC TTTCCCCGC AGATTCTTTT 120 AAGACGTAAC AAATATGAGA AATGACTTTG CACACAGAAA CATTTGCAG AGTTTTCCGA 180
AGACATACAG CAAAACCGCC ATCTCAGAAA TGAAAAAGTA ATTTCAGGG ACTGAAAAAG 240AGACATACAG CAAAACCGCC ATCTCAGAAA TGAAAAAGTA ATTTCAGGG ACTGAAAAAG 240
TTCGACGATT CGTAATTTAC ATTTCGTATC ACTTTCATCA GCAGACCGA AGACAGGCTA 300TTCGACGATT CGTAATTTAC ATTTCGTATC ACTTTCATCA GCAGACCGA AGACAGGCTA 300
GTGATTGTTC CGTATTGCTA ATTTGGTGTC ATTGTTGCAA ^CTCGGTCAT ATTACACCTT 360GTGATTGTTC CGTATTGCTA ATTTGGTGTC ATTGTTGCAA ^ CTCGGTCAT ATTACACCTT 360
GAAGGGGTGG CTGGTTTCGT TAGTCAGGAG GATTATACTC CGGTCAGCGG AATGTAACGC 420 CATTTACAAA CGATATTATC AATGGTATAG TTGGGCTGGA AGAAAAGTG CAGGACCCAG 480GAAGGGGTGG CTGGTTTCGT TAGTCAGGAG GATTATACTC CGGTCAGCGG AATGTAACGC 420 CATTTACAAA CGATATTATC AATGGTATAG TTGGGCTGGA AGAAAAGTG CAGGACCCAG 480
AATTCCGAGC AGTGAGTGAG AACGGTAATG TTGAGGATTG TAGTGTTTTT CTTTTATTGA 540AATTCCGAGC AGTGAGTGAG AACGGTAATG TTGAGGATTG TAGTGTTTTT CTTTTATTGA 540
TAGAAGATGC TCATCGCATC GTCGTGTTCC GTGAAAGCTC TCCATGTTAG AAAGTCCACC 600TAGAAGATGC TCATCGCATC GTCGTGTTCC GTGAAAGCTC TCCATGTTAG AAAGTCCACC 600
GTTGCCAGTT GGCAGGCTGT ATCCTCCCCG CTCTTCCTTG GTGCCGGATT TTCTTTAGCT 660GTTGCCAGTT GGCAGGCTGT ATCCTCCCCG CTCTTCCTTG GTGCCGGATT TTCTTTAGCT 660
CCTTACACAA TGACGCTTTG GGACAATGTT TCGTTATTCC ATCGACGATG TTGCCCCAGA 720 CTAATTAATC AACGGGCTAA GAAATTAGCG TAACTGATGT AGAATGATCA GAGGGTTTTT 780CCTTACACAA TGACGCTTTG GGACAATGTT TCGTTATTCC ATCGACGATG TTGCCCCAGA 720 CTAATTAATC AACGGGCTAA GAAATTAGCG TAACTGATGT AGAATGATCA GAGGGTTTTT 780
TTTTCTTTCT TAGTTCTATT TACACTATTT TCCAGCTTGA ATGGTTTAAG ATTTAATCCG 840TTTTCTTTCT TAGTTCTATT TACACTATTT TCCAGCTTGA ATGGTTTAAG ATTTAATCCG 840
TTGTTTCTGA TATAAAAGCC AGGTAATAAA CCTTCTAACT TGCCTCTTCT TGGTGTCGAT 900TTGTTTCTGA TATAAAAGCC AGGTAATAAA CCTTCTAACT TGCCTCTTCT TGGTGTCGAT 900
TCGAAAACAC TTTTCGGTTG TTTGTTTCTG TTTTTTTCCC TTTCGATTCA ATAACCCAAT 960 TAAAAAACGT ATTATAACAA ACTATAACAA ACATCAACTT TAGCTAATA CAACAAA 1017TCGAAAACAC TTTTCGGTTG TTTGTTTCTG TTTTTTTCCC TTTCGATTCA ATAACCCAAT 960 TAAAAAACGT ATTATAACAA ACTATAACAA ACATCAACTT TAGCTAATA CAACAAA 1017
ATGTCATTGAAAAATTGGCTTTTGCTACGTGATATCCAATACGAGGG 1065ATGTCATTGAAAAATTGGCTTTTGCTACGTGATATCCAATACGAGGG 1065
Met Ser Leu Lys Asn Trp Leu Leu Leu Arg Asp Ile Gin Tyr Glu Gly 1 5 10 15Met Ser Leu Lys Asn Trp Leu Leu Leu Arg Asp Ile Gin Tyr Glu Gly 1 5 10 15
ACGTTTTATAAAAAGTTCCCCCATGTCTACAACATTTACGTCATCGG 1113ACGTTTTATAAAAAGTTCCCCCATGTCTACAACATTTACGTCATCGG 1113
Thr Phe Tyr Lys Lys Phe Pro His Val Tyr Asn Ile Tyr Val Ile Gly 20 25 30Thr Phe Tyr Lys Lys Phe Pro His Val Tyr Asn Ile Tyr Val Ile Gly 20 25 30
TTC ATA 1119 Phe Ile TTC ATA 1119 Phe Ile

Claims

R E V E N D I C A T I O N S
1. Fragment d'ADN comprenant tout ou partie de la séquence SEQ ID n° 1 ou de son brin complémentaire, ou d'un dérivé de celles-ci, et possédant une activité de promoteur transcriptionnel.1. DNA fragment comprising all or part of the sequence SEQ ID No. 1 or its complementary strand, or a derivative thereof, and having a transcriptional promoter activity.
2. Fragment d'ADN comprenant tout ou partie du fragment BglII-BamHI de2. DNA fragment comprising all or part of the BglII-BamHI fragment from
3 kb présenté sur la figure 4.3 kb shown in Figure 4.
3. ADN recombinant comprenant un fragment d'ADN selon la revendication l ou 2.3. Recombinant DNA comprising a DNA fragment according to claim 1 or 2.
4. ADN recombinant selon la revendication 3 caractérisé en ce qu'il contient en outre un ou plusieurs gènes de structure.4. Recombinant DNA according to claim 3 characterized in that it also contains one or more structural genes.
5. ADN recombinant selon la revendication 4 caractérisé en ce qu'il contient également des signaux permettant la sécrétion du produit d'expression du ou desdits gènes de structure.5. Recombinant DNA according to claim 4 characterized in that it also contains signals allowing the secretion of the expression product of the said structural gene (s).
6. ADN recombinant selon les revendications 4 et 5 caractérisé en ce que le ou les gènes de structure codent pour des protéines d'intérêt pharmaceutique ou agroalimentaire.6. Recombinant DNA according to claims 4 and 5 characterized in that the structural gene or genes code for proteins of pharmaceutical or agrifood interest.
7. ADN recombinant selon la revendication 6 caractérisé en ce que le ou les gènes de structure codent pour des protéines choisies parmi les enzymes (tels que notamment la superoxide dismutase, la catalase, les amylases, les lipases, les amidases, la chymosine etc.), les dérivés sanguins (tels que la sérum-albumine, l'alpha- ou la béta-globine, le facteur VIII, le facteur IX, le facteur de von Willebrand, la fibronectine, l'alpha-1 antitrypsine etc.), l'insuline et ses variants, les lymphokines (telles que les interleukines, les interférons, les facteurs de stimulation des colonies (G-CSF, GM-CSF, M-CSF...), le TNF, le TRF etc.), les facteurs de croissance (tels que l'hormone de croissance, l'érythropoiétine, le FGF, l'EGF, le PDGF, le TGF etc.), les apolipoprotéines, des polypeptides antigéniques pour la réalisation de vaccins (hépatite, cytomégalovirus, Eppstein-Barr, herpès etc.), ou encore des fusions de polypeptides telles que notamment des fusions comportant une partie active fusionnée à une partie stabilisatrice (par exemple des fusions entre l'albumine ou des fragments d'albumine et le récepteur ou une partie d'un récepteur de virus (CD4, etc.)). 7. Recombinant DNA according to claim 6 characterized in that the structural gene or genes code for proteins chosen from enzymes (such as in particular superoxide dismutase, catalase, amylases, lipases, amidases, chymosin etc.) ), blood derivatives (such as serum albumin, alpha- or beta-globin, factor VIII, factor IX, von Willebrand factor, fibronectin, alpha-1 antitrypsin etc.), insulin and its variants, lymphokines (such as interleukins, interferons, colony stimulating factors (G-CSF, GM-CSF, M-CSF ...), TNF, TRF etc.), growth factors (such as growth hormone, erythropoietin, FGF, EGF, PDGF, TGF etc.), apolipoproteins, antigenic polypeptides for the production of vaccines (hepatitis, cytomegalovirus, Eppstein -Barr, herpes etc.), or alternatively fusions of polypeptides such as in particular fusions comprising a p active part fused to a stabilizing part (for example fusions between albumin or albumin fragments and the receptor or part of a virus receptor (CD4, etc.)).
8. ADN recombinant selon l'une quelconque des revendications 3 à 7 caractérisé en ce qu'il fait partie d'un plasmide d'expression, qui peut être à réplication autonome ou intégratif.8. Recombinant DNA according to any one of claims 3 to 7 characterized in that it is part of an expression plasmid, which can be autonomous or integrative replication.
9. Cellule recombinée contenant une séquence d'ADN ou un ADN recombinant selon l'une quelconque des revendications précédentes.9. Recombinant cell containing a DNA sequence or a recombinant DNA according to any one of the preceding claims.
10. Cellule recombinée selon la revendication 9 caractérisée en ce qu'il s'agit d'une levure.10. Recombinant cell according to claim 9 characterized in that it is a yeast.
11. Cellule recombinée selon la revendication 10 caractérisée en ce qu'il s'agit d'une levure du genre Kluyveromyces.11. Recombinant cell according to claim 10 characterized in that it is a yeast of the genus Kluyveromyces.
12. Utilisation d'une séquence d'ADN selon l'une quelconque des revendications 1 à 8 pour l'expression de gènes recombinés.12. Use of a DNA sequence according to any one of claims 1 to 8 for the expression of recombinant genes.
13. Utilisation selon la revendication 12 pour l'expression de gènes codant pour des protéines d'intérêt pharmaceutique ou agroalimentaire.13. Use according to claim 12 for the expression of genes coding for proteins of pharmaceutical or agrifood interest.
14. Procédé de production de protéines recombinantes caractérisé en ce que l'on cultive une cellule recombinée selon l'une quelconque des revendications 9 à 11 et on récupère les protéines produites.14. A method of producing recombinant proteins characterized in that a recombinant cell is cultured according to any one of claims 9 to 11 and the proteins produced are recovered.
15. Procédé selon la revendication 14 pour la production de protéines d'intérêt pharmaceutique ou agroalimentaire.15. The method of claim 14 for the production of proteins of pharmaceutical or agrifood interest.
16. Procédé selon la revendication 15 caractérisé en ce que la protéine est préférentiellement la sérum-albumine humaine ou un de ses variants moléculaires. 16. The method of claim 15 characterized in that the protein is preferably human serum albumin or one of its molecular variants.
PCT/FR1994/000698 1993-06-15 1994-06-13 Yeast promotor and use thereof WO1994029463A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP7501423A JPH08511161A (en) 1993-06-15 1994-06-13 Yeast promoter and its use
EP94918915A EP0703986A1 (en) 1993-06-15 1994-06-13 Yeast promotor and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR9307164A FR2706485B1 (en) 1993-06-15 1993-06-15 Yeast promoter and its use.
FR93/07164 1993-06-15

Publications (1)

Publication Number Publication Date
WO1994029463A1 true WO1994029463A1 (en) 1994-12-22

Family

ID=9448120

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1994/000698 WO1994029463A1 (en) 1993-06-15 1994-06-13 Yeast promotor and use thereof

Country Status (5)

Country Link
EP (1) EP0703986A1 (en)
JP (1) JPH08511161A (en)
CA (1) CA2164864A1 (en)
FR (1) FR2706485B1 (en)
WO (1) WO1994029463A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0148668A2 (en) * 1983-12-06 1985-07-17 Etablissement Public dit: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE (CNRS) Plasmid cloning and expression vectors for a protein in a microorganism, comprising at least the expression promotor of beta-glucosidase in the yeasts; these vectors containing microorganisms; fermentation process and enzymes so obtained
EP0511912A1 (en) * 1991-04-30 1992-11-04 Aventis Pharma S.A. Yeast promoter and its use
WO1993004176A1 (en) * 1991-08-21 1993-03-04 Rhone-Poulenc Rorer S.A. Yeast promoter and use thereof
FR2693475A1 (en) * 1992-07-08 1994-01-14 Rhone Poulenc Rorer Sa Identification and opt. cloning of gene promoters - using DNA library contg. transposon bearing selectable marker

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0148668A2 (en) * 1983-12-06 1985-07-17 Etablissement Public dit: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE (CNRS) Plasmid cloning and expression vectors for a protein in a microorganism, comprising at least the expression promotor of beta-glucosidase in the yeasts; these vectors containing microorganisms; fermentation process and enzymes so obtained
EP0511912A1 (en) * 1991-04-30 1992-11-04 Aventis Pharma S.A. Yeast promoter and its use
WO1993004176A1 (en) * 1991-08-21 1993-03-04 Rhone-Poulenc Rorer S.A. Yeast promoter and use thereof
FR2693475A1 (en) * 1992-07-08 1994-01-14 Rhone Poulenc Rorer Sa Identification and opt. cloning of gene promoters - using DNA library contg. transposon bearing selectable marker

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
WEBSTER, T. D. ET AL.: "The organization and transcription of the galactose gene cluster of Kluyveromyces lactis", NUCLEIC ACIDS RESEARCH, vol. 16, no. 16, August 1988 (1988-08-01), ARLINGTON, VIRGINIA US, pages 8011 - 8028 *
XIN JIE CHEN ET AL.: "Glucose transport in the yeast Kluyveromyces lactis", MOLECULAR AND GENERAL GENETICS, vol. 233, 1992, BERLIN DE, pages 97 - 105 *

Also Published As

Publication number Publication date
FR2706485A1 (en) 1994-12-23
FR2706485B1 (en) 1995-09-01
JPH08511161A (en) 1996-11-26
CA2164864A1 (en) 1994-12-22
EP0703986A1 (en) 1996-04-03

Similar Documents

Publication Publication Date Title
EP0531181A1 (en) Highly stable recombinant yeasts for the production of recombinant proteins
EP0652964B1 (en) K. lactis transaldolase gene promoter and use thereof
EP0651810B1 (en) K. lactis pyruvate-decarboxylase promoter gene and use thereof
EP0599971B1 (en) Yeast promoter and use thereof
EP0584166B1 (en) Yeast promoter and use thereof
EP0651811B1 (en) K. lactis rp28 ribosomal protein gene promoter and use thereof
EP0672150B1 (en) Modified kluyveromyces yeasts, their preparation and use
EP0703986A1 (en) Yeast promotor and use thereof
FR2732691A1 (en) NEW PROMOTERS FOR THE EXPRESSION OF PROTEINS OF INTEREST IN YEAST
FR2693475A1 (en) Identification and opt. cloning of gene promoters - using DNA library contg. transposon bearing selectable marker

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2164864

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1994918915

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 1996 564252

Country of ref document: US

Date of ref document: 19960209

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 1994918915

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1994918915

Country of ref document: EP