EA045304B1 - GENE FOR RESISTANCE TO PLANT DISEASES - Google Patents

Description

The invention relates to a nucleic acid molecule that encodes a polypeptide, the nucleic acid molecule of which is capable of conferring resistance to Cercospora (Cercospora), in particular to the fungus Cercospora beticola (Beetroot) plant and, in particular, to a plant of the species Beta vulgaris (Common beet), in which the polypeptide is expressed, as well as the polypeptide encoded by the nucleic acid molecule of the present invention. In particular, the nucleic acid molecule of the present invention is characterized in that the effect of Cercospora resistance conferred by the polypeptide is dominant. Furthermore, the present invention relates to a Cercospora-resistant plant, plant cell, plant organ, plant tissue, plant part or seed, or plant progeny that contains a nucleic acid molecule or segments thereof as an endogenous gene, as an edited gene, or in as a transgene. In addition, the present invention also covers methods for increasing Cercospora resistance in a Beta vulgaris plant, as well as methods for producing or identifying and possibly selecting a Cercospora resistant plant. The present invention also covers methods for monitoring infection with the pathogen Cercospora beticola, as well as oligonucleotide probes and primers for hybridization with the nucleic acid molecule of the present invention.

Prerequisites for creating the invention

Leaf spot (cercospora blight) is one of the most dangerous, widespread worldwide leaf diseases of plants of the Beta vulgaris species. This disease is caused by the fungus Cercospora beticola. Plants affected by this disease usually develop small, relatively round spots on the leaves (2-3 mm), which are light gray in the middle and surrounded by a red-brown border. With severe infestation, the spots on the leaves overlap, causing entire segments of the leaf blade to dry out. Small black dots (pseudostromes) are visible within fully formed spots, and a gray felt-like covering (carriers of conidia with conidia) forms in moist conditions - mainly on the underside of the leaf. Heavily infected leaves first turn yellow, then turn brown and die. At the same time, new leaves grow, however, the leaves again become diseased and die. At first, symptoms of damage are visible only in individual plants, but as the disease spreads, nests with persistent infection often form. Further spread of infection throughout the area occurs through rain and wind.

The pathogen Cercospora beticola was first described in the second half of the 19th century in Italy. Up to 40% of the crop can be lost due to heavy infestation, which can be caused by wet weather, early row closure, high infestation potential from previous years, or over-irrigation. These losses are due to a reduction in beet yield and a decrease in sugar content; see Holtschulte ((2000) Cercospora beticola - distribution and incidence worldwide, p. 516, in Cercospora beticola Sacc. Biology, implications for agricultural practices and disease control of sugar beet, volume 2 (M.J.S. Asher , B. Holtschulte, M. R. Molard, F. Rosso, G. Steinroecken, R. Beckers, eds. International Institute for Beet Research, Brussels, Belgium, 215 pp.). To combat the disease, inter-row planting or fungicides are often used. Chemical control of Cercospora beticola using fungicides requires material costs from the farmer and pollutes the environment. Repeated applications of fungicides further increase selection pressure on fungicide-tolerant strains of Cercospora beticola. This is contrary to sustainable agricultural practices.

Indirect control is carried out by selecting varieties with healthy leaves and cultivating beets using at least a three-year crop rotation. Infestation can be controlled more effectively by using a combination of tolerant or resistant varieties. Less susceptible Cercospora-tolerant beet varieties have been offered on the market since 2000 (Steinruken 1997, Die Zuchtung von Cercospora-resistant Zuckerruben. [Breeding of Cercospora-resistant sugar beet.], Vortrage fur Pflanzenzuchtung [Lectures on plant breeding], Volume 37, Lecture Symposium, 4-5 March 1997, Kiel). These varieties are endowed with quantitative resistance to Cercospora beticola. The resistance of these varieties is based on several genes and is transferred quantitatively, while the exact number of genes responsible for resistance is unknown; see Weiland and Koch (2004), Leaf spot in sugar beet (Cercospora beticola Sacc), The Plant Journal, 5 (3), 157-166. Complex quantitative inheritance has been confirmed through a number of quantitative trait loci (QTL) analyses. This method makes it possible to map polygenic types of inherited resistance and is a reliable method for identifying the number and position of genetic resistance factors on the linkage map of genetic traits of the host plant. In this way, multiple causal QTLs could be identified on each sugar beet chromosome.

Mapping was carried out with different donors of Cercospora resistance, and the observed QTL effects were mostly small. The maximum reported phenotypic values were 5%.

Continuous studies have described lists of differentially expressed genes. In a study by Veltmeyer et al., (2011) Transcript profiles in sugar beet genotypes reveal the timing and strength of defense responses to infection by Cercospora beticola, Molecular plant

- 1 045304 microbe interactions, 758-772), genome-side expression profiles for different sugar beet genotypes (i.e., resistant, tolerant, sensitive, etc. to Cercospora) were generated using microarray technology during pathogen infection for analysis transcriptional changes in expression profile in association with leaf spot. Using these assays, we were able to generate a pathogen-inducible transcriptional profile in the various sugar beet genotypes tested and identify potential candidate genes. However, these genes have not yet been characterized in detail. The genetic and functional background of resistance to Cercospora and the identity of the resistance genes have so far been completely unclear.

However, with quantitative inheritance of QTL, not only the desired resistance to Cercospora beticola is introduced into the plant, but also, often rather undesirable traits, such as, for example, a decrease in yield due to the inheritance of additional genes that are linked to a positive trait of resistance to Cercospora. This phenomenon is also known as entangled load. In addition, the enormous breeding costs required to select for multiple resistance loci without thereby reducing yield can have a negative impact on plant viability; see Weiland and Koch, 2004.

Breeding companies have been offering Cercospora-tolerant varieties on the market for more than ten years. Resistance in these varieties is inherited through multiple resistance genes with little effect. However, the disadvantage of these varieties is that variety development is a very labor-intensive and complex process due to inheritance difficulties, and such varieties have significantly lower yields than conventional varieties in the absence of infection. Among other things, this may be due to the epigenetic interaction of some resistance genes with genes responsible for sugar production, which leads to reduced plant vigor in the absence of the pathogen.

The use of new breeding methods based on gene editing, for example using TALE nucleases or CRISPR systems, as well as transgenic approaches, is not possible in practice due to the complexities of inheritance and the multitude of genes involved in the development of resistance, most of which have not yet been identified or characterized.

For sustainable breeding of plants resistant to Cercospora leaf spot, that is, plants able to withstand the threat posed by Cercospora variants that overcome this resistance, it is necessary to continuously identify new resistance genes and integrate them into the gene pools of cultivated plants such as sugar beet . In particular, the goal was to propose suitable resistance genes that, once expressed in the plant, already produce a very strong, dominant resistance effect against Cercospora beticola. In accordance with the present invention, this object is achieved through the embodiments described in the claims and description.

Abstract of the invention

The present invention relates to a nucleic acid molecule that is capable of conferring resistance to Cercospora - in particular to the fungus Cercospora beticola - plant and, in particular, Beta vulgaris subsp. vulgaris (Chard). Thus, the polypeptide encoded by the nucleic acid molecule is produced in the plant. The nucleic acid molecule, after expression of which the polypeptide is produced by itself, already produces a very strong, dominant effect of resistance to Cercospora beticola in the plant.

Furthermore, the present invention relates to a Cercospora-resistant plant, plant cell, plant organ, plant tissue, plant part or seed, seed material or plant progeny that contains a nucleic acid molecule or segments thereof. The nucleic acid may be present, for example, as an endogen or a transgene. In addition, the nucleic acid may be present as introgression. Optionally, those plants and their components that were obtained through an essentially biological process are excluded.

Methods for increasing resistance to Cercospora in a plant of the species Beta vulgaris, as well as methods for producing or identifying and possibly selecting a plant resistant to Cercospora, are also covered by the present invention. The present invention also includes methods for monitoring infection with the pathogen Cercospora beticola, as well as oligonucleotide probes and primers for hybridization with the nucleic acid molecule of the present invention.

Thus, the present invention relates to the embodiments listed in the following paragraphs, which are also illustrated by examples and figures.

1. A nucleic acid molecule encoding a polypeptide that is capable of conferring resistance to Cercospora to a plant in which the polypeptide is expressed, characterized in that the nucleic acid molecule contains a nucleotide sequence that is selected from (a) a nucleotide sequence encoding a polypeptide having an amino acid sequence according to with SEQ ID NO: 3;

(b) a nucleotide sequence containing a DNA sequence in accordance with SEQ ID NO: 2;

- 2 045304 (c) a nucleotide sequence containing a DNA sequence selected from the group consisting of SEQ ID NO: 1 or SEQ ID NO: 53;

(d) a nucleotide sequence that hybridizes to a nucleotide sequence that is complementary to the nucleotide sequence in accordance with paragraphs (a), (b) or (c), under stringent conditions;

(e) a nucleotide sequence encoding a polypeptide that, by substitution, deletion and/or addition of at least one amino acid of the amino acid sequence, differs from the polypeptide encoded by the nucleotide sequence in accordance with paragraphs (a), (b) or (c) );

(f) a nucleotide sequence encoding a polypeptide that has an amino acid sequence that is at least 70% identical to the amino acid sequence according to SEQ ID NO: 3;

(g) a nucleotide sequence that is at least 70% identical to the DNA sequence according to SEQ ID NO: 1 or SEQ ID NO: 2;

wherein the Cercospora resistance in a preferred embodiment of the present invention is resistance to Cercospora beticola, or wherein the plant in a preferred embodiment of the present invention is a plant of the subspecies Beta vulgaris subsp. vulgaris, and in a particularly preferred embodiment of the present invention, sugar beet.

2. The nucleic acid molecule according to claim 1, characterized in that the Cercospora resistance effect conferred by the polypeptide is dominant in the plant, in a preferred embodiment of the present invention, wherein the polypeptide conferred a resistance effect of at least one rating point, and in a preferred embodiment of the present invention by more than one rating point, in a particularly preferred embodiment of the present invention by at least two rating points, in a particularly preferred embodiment of the present invention by at least three rating points, and in the most preferred embodiment of the present invention, by at least four rating points.

3. The nucleic acid molecule according to claim 1 or claim 2, characterized in that the nucleic acid molecule comes from Beta vulgaris subsp. maritima (sea beet).

4. A polypeptide encoded by a nucleic acid molecule according to one of claims 1-3.

5. A vector or expression cassette containing a nucleic acid molecule according to one of claims 1 to 3, wherein the nucleic acid molecule in a preferred embodiment of the present invention is heterologous with respect to the vector or expression cassette.

6. A cell that contains a nucleic acid molecule according to one of claims 1 to 3, or a vector or expression cassette according to claim 5, wherein the nucleic acid molecule or expression cassette in a preferred embodiment of the present invention is present as an endogene or transgene.

7. A plant or segment thereof resistant to Cercospora, characterized in that the plant or segment thereof contains a nucleic acid molecule according to one of claims 1-3, in the form of an endogene or transgene, or a vector or expression cassette according to claim 5, wherein , a plant that contains a nucleic acid molecule endogenously, is a plant of the species Beta vulgaris, but not the species Beta vulgaris subsp. maritima or the species Beta vulgaris subsp. vulgaris.

8. The plant according to claim 7, characterized in that the plant is a hybrid plant.

9. A plant according to claim 7 or claim 8, characterized in that the nucleic acid molecule is present in the plant genome in the form of a heterozygous or homozygous one.

10. Seeds or descendants of a plant according to one of claims 7-9, wherein the seed or descendant in the form of a transgene or endogene contains a nucleic acid molecule according to one of claims 1-3, or a vector or expression cassette according to claim 5.

11. A method for increasing plant resistance to Cercospora, including the following steps:

(i) integrating a nucleic acid molecule according to one of claims 1 to 3 or a vector or expression cassette according to claim 5 by means of homologously directed repair or homologous recombination, in a preferred embodiment of the present invention by means of a site-directed nuclease, into the genome, according to at least one plant cell and, optionally, regenerating the plant from the at least one plant cell; or (ii) increasing the expression of a nucleic acid molecule according to one of claims 1 to 3 in at least one plant cell, in a preferred embodiment of the present invention by modifying a native promoter, for example containing a DNA sequence in accordance with SEQ ID NO : 7, or by linking a nucleic acid molecule according to one of claims 1 to 3 with a heterologous promoter having a higher level of activity compared to the native promoter, for example containing a DNA sequence in accordance with SEQ ID NO: 7 - in particular, after infection with Cercospora, and optionally regenerating the plant from at least

- 3 045304 one plant cell; or (iii) increasing the activity and/or stability of the polypeptide according to claim 4 by modifying the nucleotide sequence of the nucleic acid molecule according to one of claims 1 to 3 in at least one plant cell and, optionally, regenerating the plant from at least , one plant cell; or (iv) transforming a plant cell with a nucleic acid molecule according to one of claims 1 to 3 or a vector or expression cassette according to claim 5, and optionally regenerating a (transgenic) plant from the transformed plant cell;

wherein, resistance to Cercospora is, in a preferred embodiment of the present invention, resistance to Cercospora beticola, or, the plant is, in a preferred embodiment of the present invention, a plant of the species Beta vulgaris, in a preferred embodiment of the present invention, Beta vulgaris subsp. vulgaris, and, in particular, sugar beets.

12. A method for producing a plant resistant to Cercospora, according to one of claims 7-9, including the following steps:

(a) transforming a plant cell with a nucleic acid molecule according to one of claims 1 to 3 or a vector or expression cassette according to claim 5, and (b) regenerating a transgenic plant from a transformed plant cell; or (i) introducing a site-directed nuclease and a repair template into a cell of a plant of the species Beta vulgaris, wherein the site-directed nuclease is capable of generating at least one double-stranded DNA break in the genome of the cell, in a preferred embodiment of the present invention - above and /or below the target region, and the repair matrix contains a nucleic acid molecule according to one of claims 1-3;

(ii) culturing the cell from step (i) under conditions allowing homologously directed repair or homologous recombination, wherein the nucleic acid molecule is incorporated from the repair matrix into the plant genome; and (iii) regenerating the plant from the cell modified in step (ii).

13. The method according to claim 12, characterized in that the target region contains an allelic variant of the nucleic acid molecule according to one of claims 1-3, wherein the allelic variant encodes a polypeptide that does not confer resistance or confers slight resistance to Cercospora.

14. The method according to claim 12 or claim 13, characterized in that at least one double-strand break occurs at a position located at a distance of no more than 10,000 base pairs above and/or below the target region, or no more than 10,000 base pairs, from the allelic variant, as defined in paragraph 13.

15. The method according to claim 12 or claim 13, characterized in that the allelic variant of the nucleic acid molecule contains a nucleotide sequence selected from (a) a nucleotide sequence encoding a polypeptide having an amino acid sequence in accordance with SEQ ID NO: 6;

(b) a nucleotide sequence containing a DNA sequence in accordance with SEQ ID NO: 5;

(c) a nucleotide sequence containing a DNA sequence in accordance with SEQ ID NO: 4;

(d) a nucleotide sequence that hybridizes to a nucleotide sequence that is complementary to the nucleotide sequence in accordance with paragraphs (a), (b) or (c), under stringent conditions;

(e) a nucleotide sequence encoding a polypeptide that, by substitution, deletion and/or addition of at least one amino acid of the amino acid sequence, differs from the polypeptide encoded by the nucleotide sequence in accordance with paragraphs (a), (b) or (c) ); or (f) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 80% identical to the amino acid sequence according to SEQ ID NO: 6.

16. A plant or a segment thereof, obtained or obtained in accordance with the method according to one of claims 12-15.

17. A method for identifying, and optionally offering, a plant of the species Beta vulgaris resistant to Cercospora, characterized in that the method includes at least step (i) or (ii):

(i) determining the presence and/or expression of a nucleic acid molecule according to one of claims 1 to 3, or the presence of a polypeptide according to claim 4, in a plant or plant segment; and/or (ii) determining at least one marker locus in the nucleotide sequence of the nucleic acid molecule according to one of claims 1-3 or in the cosegregation region; and (iii) optionally, selecting a plant resistant to Cercospora beticola.

18. A method for identifying a nucleic acid molecule encoding a polypeptide capable of

- 4 045304 to impart resistance to Cercospora to a plant of the species Beta vulgaris, in which a polypeptide is expressed, characterized in that the method includes the following steps:

(i) comparing the amino acid sequence of the polypeptide of claim 4 with amino acid sequences from a sequence database, or identifying allelic variants encoding the polypeptide of claim 4 in genotypes of the species Beta vulgaris;

(ii) identifying an amino acid sequence or an allelic variant encoding an amino acid sequence, wherein the amino acid sequence is at least 80% identical to the amino acid sequence of the polypeptide of claim 4;

(iii) introducing a nucleic acid molecule or allelic variant encoding the identified amino acid sequence into a plant of the species Beta vulgaris, and expressing the nucleic acid molecule in the plant; and (iv) determination of resistance to Cercospora.

19. A method for cultivating plants of the species Beta vulgaris, including (i) offering plants according to one of claims 7 to 9, producing plants of the species Beta vulgaris using a method according to one of claims 12 to 15, or identifying and selecting plants of the genus Beta using the method according to claim 17, and (ii) cultivating the plants from step (i) or their descendants, wherein the method prevents infection of the cultivated plants with Cercospora.

20. An oligonucleotide consisting of at least 15, 16, 17, 18, 19 or 20, in a preferred embodiment of the present invention at least 21, 22, 23, 24 or 25, in a particularly preferred embodiment in an embodiment of the present invention, of at least 30, 35, 40, 45 or 50, and, in a particularly preferred embodiment of the present invention, of at least 100, 200, 300 or 500 nucleotides in length, with In this case, the oligonucleotide hybridizes with the nucleotide sequence as defined in one of claims 1-3.

21. A pair of oligonucleotides, in a preferred embodiment of the present invention oligonucleotides according to claim 20, or a set containing these oligonucleotides, wherein the oligonucleotides are suitable for hybridization as a forward primer and a reverse primer for a region in the Beta vulgaris genome that in Beta vulgaris has cosegregation with resistance to Cercospora conferred by the polypeptide according to claim 4, or with a nucleic acid molecule according to one of claims 1-3.

22. Use of a nucleic acid molecule according to one of claims 1-3 for the production of Cercospora-resistant plants of the subspecies Beta vulgaris subsp. vulgaris.

23. A method of producing an organism containing a mutated version according to claim 1 and/or a mutated version of a promoter containing a nucleic acid sequence selected from (a) SEQ ID NO: 7 (b) a nucleotide sequence that hybridizes under stringent conditions with a sequence that is complementary sequence according to paragraph (a) (c) a nucleotide sequence that is at least 70% identical to the sequence according to SEQ ID NO: 7, wherein the method includes the following steps:

(I) Offering an organism or cell containing a nucleic acid molecule and/or promoter (II) Increasing the frequency of mutation of the organism or cell, or mutagenesis of the organism or cell (III) Phenotypic selection of an organism that, as a result of mutation, exhibits altered resistance or an altered level of resistance to Cercospora beticola, or Genotypic selection of an organism or cell containing a mutation in the nucleic acid molecule and/or promoter, wherein the mutation was created in step (II), and, optionally, (IV) Regeneration of the organism from the cell obtained in step (III) ).

24. The method according to claim 23, wherein the organism is a plant.

25. The method according to claim 24, wherein the plant is Beta vulgaris, in a preferred embodiment of the present invention - Beta vulgaris subsp. vulgaris, in a more preferred embodiment of the present invention - sugar beet.

First, certain terms used in this application are explained in more detail as follows:

A rating score in the context of the present invention refers to a qualitative assessment of resistance to Cercospora infection, which is presented using a scale from 1 to 9 (where 1=strong resistance and 9=no resistance).

- 5 045304

Table 1A

9-level resistance rating to Cercospora

Rating score Leaf phenotype Whole plant phenotype 1 Healthy leaf Healthy leaf, whole 3 Diseased leaf, spots on the outside leaves Whole plant, onset of disease, spots on outer leaves 5 Diseased leaf, merging of spots into dying areas Whole plant, progressive disease, spots merging into dying areas 7 Diseased leaf, most of the leaf is brown and dead, only the lower leaf blade is still alive The whole plant is diseased, most of the outer leaves die 9 Diseased leaves, leaf blade and petiole have died and dried out The whole plant is diseased, the outer leaves are dead, the inner leaves are seriously damaged, the growth of new leaves is strong

The genus Cercospora includes various species such as

Cercospora arachidicola, Cercospora ariminiensis, Cercospora asparagi, Cercospora bertoreae, Cercospora beticola, Cercospora bizzozeriana, Cercospora canescens, Cercospora carotae, Cercospora chenopodii, Cercospora cistinearum, Cercospora cladosporioides, Cercospora diazu , Cercospora dulcamarae, Cercospora erysimi, Cercospora hayii, Cercospora kikuchii, Cercospora malvacearum , Cercospora malvicola, Cercospora medicaginis, Cercospora oryzaem, Cercospora personata, Cercospora plantaginis, Cercospora ricinella, Cercospora setariae, Cercospora unamunoi, Cercospora violae or Cercospora zeae-maydis.

When combined with the length of the nucleotide sequence, the term approximately means a deviation of ±200 base pairs, in a preferred embodiment of the present invention by ±100 base pairs, and, in a particularly preferred embodiment of the present invention, by ±50 base pairs.

The plant of the genus Beta belongs to the amaranth family (Amaranthaceae). Among these plants are plants of the species Beta macrocarpa, Beta vulgaris, Beta lomatogona, Beta macrorhiza, Beta corolliflora, Beta trigyna and Beta papa. The plant of the species Beta vulgaris is, in particular, a plant of the subspecies Beta vulgaris subsp. vulgaris. For example, this subspecies includes: Beta vulgaris subsp. vulgaris var. altissima (sugar beet in a narrower sense), Beta vulgaris ssp. vulgaris var. vulgaris (chard), Beta vulgaris ssp. vulgaris var. conditiva (common beet/red beet), Beta vulgaris ssp. vulgaris var. crassalalba (fodder beet). It should be noted that the nucleic acid of the present invention does not occur naturally in sugar beets, Swiss chard, common beets or fodder beets, but can be introduced into them by humans.

The term functional fragment of a nucleotide sequence means a segment of a nucleotide sequence that has functionality identical to or comparable to the functionality of the entire nucleotide sequence from which the functional fragment is derived. As such, a functional fragment may have a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% identical or homologous to the entire nucleotide sequence. %, 94%, 96%, 97%, 98% or 99% by length. It also clearly covers the 90 to 100% range. In addition, the term functional fragment of a nucleotide sequence can also mean a segment of a nucleotide sequence that alters the functionality of the entire nucleotide sequence, for example, during post-transcriptional or transcriptional gene silencing. As such, a functional nucleotide sequence fragment may contain at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25, in a preferred embodiment of the present invention at least 30 , 35, 40, 45, 50, 60, 70, 80, 90, 100, 120 or 140, and in a particularly preferred embodiment of the present invention

- 6 045304 abbreviations - at least 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900 or 1000 consecutive nucleotides of the entire nucleotide sequence. It also clearly covers the range from 21 to 50 nucleotides.

The term functional part of a protein means a segment of a protein or a region of amino acid sequence that encodes a protein, which segment may exhibit functionality identical to or comparable to the functionality of the entire protein in a plant cell. In length by at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 96%, 97% 98% or 99 % the functional part of the protein has an amino acid sequence that is identical or, taking into account conservative and semi-conservative amino acid exchanges, similar to the protein from which the functional part is derived.

The term heterologous means that the introduced polynucleotide originates from a cell or organism having a different genetic background, of the same species or a different species, or is homologous to a prokaryotic or eukaryotic host cell, but is then placed in a different genetic background and thus it is different from the corresponding polynucleotide that may be present in nature. A heterologous polynucleotide may be present in addition to the corresponding endogenous gene.

Within the meaning of the present invention, the term homologue is understood to mean a protein having a similar phylogenetic origin; the term analogue is a protein that exhibits a similar function but has a different phylogenetic origin; The term ortholog refers to a protein from a plant of another species that exhibits a similar function; The term paralog is understood to mean a protein that has appeared in a species through duplication, in which case this copy either retains a similar protein function, changes its expression matrix but not its function, changes the function of its protein, or distributes the function of the ancestral gene between both copies.

The term hybridization should be understood as a process in which a single-stranded nucleic acid molecule binds to a nucleic acid chain that is complementary to the maximum possible extent, that is, forms base pairs with it. Standard hybridization methods are described, for example, in Sambrook et al., Molecular Cloning: Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. In a preferred embodiment of the present invention , is meant to be at least 60%, in a more preferred embodiment of the present invention at least 65%, 70%, 75%, 80% or 85%, and in a particularly preferred embodiment of the present invention 90 %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases of a nucleic acid molecule form a base pairing with a nucleic acid strand that is complementary to the greatest extent possible. The possibility of such annealing depends on the severity of the hybridization conditions. The term stringency refers to the hybridization conditions. High rigidity is present if base pairing is difficult, and low rigidity is present if base pairing is facilitated. For example, the stringency of hybridization conditions depends, for example, on salt concentration or ionic strength and temperature. Generally, hardness can be increased by increasing the temperature and/or decreasing the salt content. The term stringent hybridization conditions refers to conditions under which hybridization occurs predominantly only between homologous nucleic acid molecules.

Thus, the term hybridization conditions refers not only to the conditions prevailing during the actual addition of the nucleic acids, but also to the conditions prevailing during subsequent washing steps. For example, stringent hybridization conditions are conditions under which only those nucleic acid molecules that are preferentially hybridized are at least 70%, in a preferred embodiment of the present invention, at least 75%, at least 80% at least 85%, at least 90%, or at least 95% sequence identity. Stringent hybridization conditions include, for example: hybridization in 4xSSC at 65°C followed by multiple washes in 0.1xSSC at 65°C for approximately 1 hour in total. In a preferred embodiment of the present invention, hybridization occurs under harsh conditions.

With respect to a nucleic acid in the form of double-stranded DNA, the term complementary nucleotide sequence means that the second strand of DNA, complementary to the first strand of DNA, has nucleotides that match the bases of the first strand, according to the rules of base pairing. The complementary sequence, in a preferred embodiment of the present invention, is completely complementary to the opposite sequence and thus, in a preferred embodiment of the present invention, has the same length.

The term isolated nucleic acid molecule is meant to mean a nucleic acid molecule extracted from its natural or original environment. The term also includes a synthetically produced nucleic acid molecule. The term isolated polypeptide is meant to mean a polypeptide extracted from its natural or original environment. This term

- 7 045304 also covers a synthetically produced polypeptide.

The term molecular marker should be understood as a nucleic acid that is polymorphic in a plant population and is used as a reference or reference point. A marker to recognize a recombination event must be suitable for monitoring differences or polymorphisms in a plant population. Thus, such a marker is capable of recognizing and distinguishing between different allelic states (alleles). The term molecular marker also refers to nucleotide sequences that are complementary, or at least highly complementary or homologous, to genomic sequences - for example, nucleic acids that are used as probes or primers. These differences at the DNA level must be identified as markers, and they are, for example, differences in polynucleotide sequences, such as SSRs (simple sequence repeats), RFLPs (restriction fragment length polymorphisms), FLPs (fragment length polymorphisms) or SNPs ( single nucleotide polymorphisms). Markers may be derived from genomic or expressed nucleic acids, such as spliced RNA, cDNA or EST, and they may also refer to nucleic acids that are used as probes or primer pairs and, as such, are suitable for amplifying a sequence fragment with using PCR-based methods. Markers describing genetic polymorphisms (between parts of a population) can be recognized using traditional methods of the prior art (Introduction to Genetic Analysis, 7th edition, Griffith, Miller, Suzuki et al., 2000). These include, for example, DNA sequencing, sequence-specific PNR-based amplification, RFLP verification, verification of polynucleotide polymorphisms by allele-specific hybridization (ASH), recognition of amplified plant genome variable sequences, 3SR (self-sustaining sequence replication) recognition, SSR recognition, SNP , RFLP or AFLP (amplified fragment length polymorphisms). In addition, methods for recognizing EST (expressed sequence marker) and SSR markers derived from EST and RAPD (random amplified polymorphic DNA) sequences are also known. Depending on the context, the term marker as used herein may also refer to a specific chromosomal position in the genome of a species in which a specific marker (eg, SNP) may be identified.

Markers also include synthetic oligonucleotides that can be linked to at least one recognition molecule, wherein the recognition molecules can be used for a recognition reaction or signal generation as part of the verification method. Synthetic oligonucleotides also include labeled primers. Synthetic oligonucleotides and labeled primers are artificial compounds, they do not occur in nature, and they cannot be isolated from natural materials. The production of such compounds is described in more detail below.

The term promoter refers to an untranslated, regulatory DNA sequence, usually located upstream of the coding region, which contains the RNA polymerase binding site and initiates DNA transcription. The promoter additionally contains other elements that act as a regulatory gene for gene expression (eg, cis-regulatory elements). The term core or minimal promoter means a promoter that has the basic elements necessary for initiation of transcription (eg, TATA box and/or initiator).

The term pathogen means an organism that, when interacting with a plant, causes disease symptoms in at least one organ of the plant. For example, these pathogens include animal, fungal, bacterial or viral organisms, or oomycetes.

The term pathogen infection refers to the earliest time point at which the pathogen interacts with the tissue of the host plant. In this sense, the term infection means the occurrence of contact between the pathogen and the host. When a pathogen attaches to a host, for example, a fungal spore on the surface of a plant leaf, pathogen recognition and signal transmission mechanisms are activated in the host plant cell. In the case of Cercospora beticola, conidia are produced in humid, warm weather and are carried to neighboring plants by rain and wind. New cases of infection most often appear as isolated spots on the leaves, first on the physiologically older outer leaves. Often, these spots are quite clearly separated from healthy leaf tissue by a brown ring. Brown fungus-carrying conidia in the middle part of the spots can be observed with a magnifying glass (rating score 3). The number of these brown spots increases rapidly, with sporocarps initially covering even smaller dead zones (rating score 5). With the further progression of the disease, which now spreads to the inner leaves, the outer leaves finally die first (rating point 7), and then almost all leaves die off (rating point 9). The course of the disease and the severity of symptoms depend largely on location and on annually changing weather conditions.

The term plant organ means, for example, leaves, shoot, stem, roots, hypocotyl, vegetative buds, meristems, embryos, anthers, ovules, seeds or fruits. The term plant parts includes, but is not limited to, shoot or peduncle, leaves, flowers, inflorescence, roots, fruits and seeds, and pollen. The term plant parts also means an association of several organs, on

- 8 045304 example, a flower or seed, or part of an organ, for example, a cross section of a plant shoot. The term plant tissue means, for example, callus tissue, storage tissue, meristematic tissue, leaf tissue, shoot tissue, root tissue, plant tumor tissue or reproductive tissue, as well as cambium, parenchyma, vascular tissue, sclerenchyma and epidermis. However, the concept of fabric is not limited to this list. The term plant cells refers, for example, to isolated cells having a cell wall or its aggregates, or protoplasts.

In accordance with the present invention, the term regulatory sequence refers to a nucleotide sequence that affects the specificity and/or level of expression, for example, to the extent that the regulatory sequence confers a certain tissue specificity. Such a regulatory sequence may be located upstream or downstream of the transcription initiation point of a minimal promoter, for example, in a transcribed but untranslated leader sequence or in an intron.

The term resistance should be understood in a broad sense and covers the range of protection from retardation to complete blocking of disease progression. One example of a dangerous pathogen is Cercospora beticola. The resistant plant cell of the present invention or the resistant plant of the present invention in a preferred embodiment of the present invention achieves resistance to Cercospora beticola. Resistance to a pathogen must be equated with resistance to the disease that the pathogen causes; for example, resistance to Cercospora beticola is also resistance to leaf spot disease. For example, increased resistance can be measured by a decrease in fungal biomass on the host plant; To do this, fungal DNA can be determined using quantitative PNR in comparison with plant DNA in infected plant tissue. An additional approach to measuring resistance is optical rating, which assigns rating scores from 1 (insensitive) to 9 (very sensitive).

The term transgenic plant refers to a plant in which at least one polynucleotide is integrated into its genome. Thus, it may be a heterologous polynucleotide. In a preferred embodiment of the present invention, the polynucleotide is stably integrated, which means that the integrated polynucleotide is stably maintained in the plant, expressed, and can be stably transmitted to progeny. Stable introduction of a polynucleotide into the plant genome also involves integration into the plant genome of the previous parental generation, whereby the polynucleotide can be stably transmitted to descendants. The term heterologous means that the introduced polynucleotide is derived, for example, from a cell or organism having a different genetic background of the same species or a different species, or it is homologous to a prokaryotic or eukaryotic host cell, for example, but is then located in a different genetic environment and, thus, it is different from the corresponding polynucleotide that may be present in nature. A heterologous polynucleotide may be present in addition to the corresponding endogenous gene.

The term raw material for industrial sugar production refers to plant material that can be supplied to a sugar factory that specializes in extracting sugar from sugar beets. Such raw material is usually the body of the beet root (tap root) of the harvested sugar beet. To meet the requirements of the extraction process, the beet root body must have sufficient mass, volume and conical shape to allow the raw material to be mechanically cut into pieces (beet chips). These beet chips increase the surface area for sugar extraction and must be low in sodium, potassium and nitrogen to extract effectively. Once extracted, the remaining beet pulp is pressed, dried and used as animal feed.

Sucrose concentration is expressed as a percentage of the fresh weight of the root.

The term monogerminal means that a seed germinates exactly one plant, whereas a multigerminal seed (also called a seed pod) produces more than one plant.

The term bolting refers to the production of a flowering stem (or stems) on a sugar beet in a natural attempt to produce seeds and reproduce the plant. Sugar beet bolting is triggered due to stress caused by hypothermia, for example, due to overwintering. However, commercially grown sugar beets are harvested before bolting, as this process reduces the sugar content of the beets.

The term introgression means that a nucleotide sequence has been transferred into the genome of a plant, but the nucleotide sequence comes from a plant that is not of the same species or subspecies. This could, for example, mean that a nucleotide sequence originating from a plant of the subspecies Beta vulgaris maritima has been transferred to a plant of the subspecies Beta vulgaris vulgaris.

The circuits and embodiments of the present invention are described by way of example with reference to the sequences and figures in question:

fig. 1: Protein sequence alignment between resistance protein (protein that

- 9 045304 gives the plant resistance to Cercospora) and a sensitivity protein (a protein that does not give the plant resistance to Cercospora). Polymorphisms are highlighted in gray;

fig. 2: Alignment of the protein sequence between the resistance protein (the protein that gives the plant resistance to Cercospora) and the sensitivity protein (the protein that does not give the plant resistance to Cercospora). Polymorphisms are highlighted in gray;

fig. 3: Vector map of the pZFN-nptII vector including the LRR region;

fig. 4: Statistical boxplot evaluation of data generated eight days postinfection during transgenic resistance gene verification;

fig. 5: Statistical evaluation in the form of a boxplot of data generated eleven days after infection during transgenic verification of the resistance gene;

fig. 6: Statistical boxplot evaluation of data generated eight days postinfection during transgenic resistance gene verification;

fig. 7: Statistical boxplot evaluation of data generated fifteen days postinfection during transgenic resistance gene verification.

Detailed Description of Embodiments of the Invention

The present invention relates to a nucleic acid molecule that is capable of conferring resistance to Cercospora to a plant, in particular Cercospora beticola, in which the polypeptide encoded by the nucleic acid molecule is expressed. According to a preferred embodiment of the present invention, the pathogen is the fungus Cercospora beticola, which is one of the most dangerous and destructive leaf pathogens of sugar beet, red beet and chard and can, among other things, cause yield losses in excess of 40%. The fungus produces a secondary metabolite, cercosporin, which reacts with oxygen in the presence of light and leads to the formation of reactive oxygen species (ROS). ROS cause massive cellular damage in the leaf tissue of an infected plant, which manifests itself in the form of necrosis.

The present invention is based on fine genetic mapping, identification, isolation and characterization of a gene or gene locus that originates from the donor Beta vulgaris subsp. maritima, the presence of which in the plant, in particular in Beta vulgaris subsp. vulgaris correlates with or causes the corresponding plant's resistance to leaf spot disease caused by Cercospora. The starting material was a population of Beta vulgaris subsp. maritima, developed from 37 accessions of Beta vulgaris subsp. maritima obtained from various sources.

The nucleotide and amino acid coding sequence of the nucleic acid molecule of the present invention is characterized by multiple polymorphisms, which distinguishes the NPSLRR gene identified by the present invention from a susceptible gene variant, that is, a gene that does not confer resistance to Cercospora. Examples of polymorphisms are presented in Fig. 1.

The nucleic acid molecule of the present invention may be an isolated nucleic acid molecule. In a preferred embodiment of the present invention, this is DNA, and in a particularly preferred embodiment of the present invention, cDNA (coding DNA). The polypeptide that is encoded by the nucleic acid molecule of the present invention, in a preferred embodiment of the present invention, confers resistance to the pathogen Cercospora beticola, which causes leaf spot disease in plants. In addition, the polypeptide encoded by the nucleic acid molecule of the present invention confers, in particular, plants of the genus Beta, resistance to this pathogen. The plant in a preferred embodiment of the present invention is a plant of the species Beta vulgaris, in a particularly preferred embodiment of the present invention a plant of the subspecies Beta vulgaris subsp. vulgar is, among them, for example, varieties such as sugar beet, common beet, fodder beet, chard and Swiss chard.

In one embodiment of the present invention, the nucleic acid molecule of the present invention contains a nucleotide sequence that encodes a polypeptide with an amino acid sequence in accordance with SEQ ID NO: 3, and/or a DNA coding sequence in accordance with SEQ ID NO: 2. In addition, the present The invention provides a nucleotide sequence that contains DNA sequences in accordance with SEQ ID NO: 1 and SEQ ID NO: 53.

The gene identified by the present invention is a resistance gene/protein of the NBS-LRR type, which is characterized by specific structural motifs. The general structure of such resistance proteins in plants is already well understood (Martin et al., Annual Review Plant Biology 54 (2003), 23-61). However, the principle of structural implementation, in particular the so-called LRR domain, which is used as a potential recognition domain for most unknown pathogenic effectors, is unpredictable, and the functional background of resistance genes, that is, the genetic structure, is generally largely unknown. Therefore, identification of a gene or protein conferring resistance to Cercospora solely on the basis of a known structural motif is not possible. In addition, the sequence region was found to be a highly repetitive region that contained, among other things, tandem repeats with a very high degree of

- 10 045304 sequence homology, which makes the development of diagnostic markers, as well as the generation of sequence data, particularly difficult.

By recruiting a population of more than 4000 dividing progeny and developing specific recombination screens, the target region was reduced and thus further isolated through the analysis of informative recombinants (genotypic and phenotypic) in a series of resistance tests. This genetic mapping, as well as the creation of physical maps, accompanied by WHG (whole genome sequencing), comparative BAC (Bac-by-Bac) sequencing and bioinformatics analyses, led to the identification of three recombinant genotypes that confirmed a resistance gene (1 recombinant in an adjacent gene, on the one hand, and 2 recombinants in the neighboring gene, on the other hand). In light of the special requirements, the inventors placed a highly repetitive structure in a target region that, among other things, contains tandem repeats with a very high degree of sequence homology, which significantly hampered marker development and hence the identification of informative recombinants. The following steps were particularly decisive for the location of the genetic structure of the resistance gene:

Development of markers s4p0264s01, s4p2271s01, sxh0678s01, s4p4293s01, s4p4295s01, s4p4301s01 (see Table 1B).

Fine mapping combined with intensive phenotyping. Phenotypes were verified using 90-180 progeny per plant in a greenhouse trial and intensive statistical methods (eg t-test, power analysis, etc.).

Identification of the BAC clone and sequencing from BAC pools of the resistant genotype.

Sequence assessment and sequence and protein comparisons across RR (i.e., resistant) and ss (i.e., sensitive) genotypes; thus, generating a clear body of data on RR and ss sequence genotypes was not always possible due to the complexity of the sequences.

Table 1B

Marker in target area; information in square brackets [X/Y] indicates diagnostic

SNP, with X identifying the sensitive genotype and Y identifying the resistant genotype.

Marker Sequence [sensitive I resistant/consensus] Position on the genetic map [cm] Position on physical map [base pairs] s4p0264s01 SEQ ID NO: 54 / SEQ ID NO: 55 / SEQ ID NO: 10 62.79590373 57208510 s4p2271s01 SEQ ID NO: 56 / SEQ ID NO: 57 / SEQ ID NO: 11 62.81185523 57212240 s4p4293s01 SEQ ID NO: 58 / SEQ ID NO: 59 / SEQ ID NO: 12 62.84491806 57219956 s4p4295s01 SEQ ID NO: 60 / SEQ ID NO: 61 / SEQ ID NO: 13 62.85399055 57222060 s4p4301s01 SEQ ID NO: 62 / SEQ ID NO: 63 / SEQ ID NO: 14 62.94635089 57243521 sxh0678s01 SEQ ID NO: 64 / SEQ ID NO: 65 / SEQ ID NO: 15 62.97474964 57250119

The compounds presented in table. 1B can be used as molecular markers of the present invention.

Analyzes showed that the LRR gene has moderate protein homology with the Cf-2 resistance protein from tomato (UNIPROT|Q41397_SOLPI P. Cf-2.1) (sequence identity 322/830=38%). In fact, the identified protein conferring resistance to Cercospora is the best homologue of the sugar beet protein to the tomato resistance protein Cf-2. The resistance protein Cf-2 from tomato confers resistance to Cladosporium fulvum, a species of black mold (US 6,287,865 B1), through interaction with the avirulence protein Avr2 from C. fulvum. This leads to activation of the plant’s immune defense against the pathogen; see Dixon et al., 1996 (Dixon, Mark C, et al., The tomato Cf-2 protein disease resistance locus contains two functional genes encoding high-leucine proteins. Cell 84.3 (1996): 451-459). It should be assumed that due to the sequence homology between the Cf-2 gene and the identified LRR gene - but without committing to one theory - a similar defense mechanism underlying resistance to Cercospora also occurs in the case of sugar beet. However, due to moderate sequence homology, another mechanism cannot be excluded.

In addition, substitutions, deletions, insertions, additions and/or any other change may be introduced into the nucleotide sequence of the present invention which, individually or in combinations, actually alter the nucleotide sequence, however, the modified nucleotide sequence may the same function as the original sequence. In this case, we are talking about encoding an amino acid sequence that confers resistance to the leaf spot disease. Thus, a further embodiment of the present invention includes a nucleotide sequence encoding a polypeptide that is a derivative of the polypeptide that is encoded by the nucleotide sequence of the present invention, or that includes an amino acid sequence of the present invention. A derived amino acid sequence that has at least one substitution, deletion, insertion or addition of at least one amino acid while maintaining the functionality of the encoded polypeptide/protein is a derived polypeptide. Substitutions, deletions, insertions, additions and/or any other change, either alone or in combinations, which actually change the nucleotide sequence but perform the same function as the original sequence, can thus be introduced into the nucleotide sequence with using traditional methods known in the prior art, for example, through site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, genome editing and so on.

The substitution of one amino acid with another amino acid having the same or equivalent or similar chemical/physical properties is called a conservative substitution or semi-conservative substitution. Examples of physical/chemical properties of an amino acid are, for example, hydrophobicity or charge. Which amino acid substitution constitutes a conservative or semi-conservative substitution is known to one skilled in the art. In addition, the accumulated knowledge allows one skilled in the art to learn, identify and recognize which amino acid deletions and additions are harmless to the functionality of the resistance protein, and at what positions they are possible. One skilled in the art will know that when considering the NBS-LRR protein for amino acid sequence modifications (substitution, deletion, insertion or addition of at least one amino acid), the functionality, in particular of the conserved domains, must be preserved and therefore in these domains, only limited prior modifications are possible.

Thus, the present invention includes a functional fragment of the nucleotide sequence of the present invention. The term fragment thus includes genes with a nucleotide sequence sufficiently similar to the above-mentioned nucleotide sequence. The term sufficiently similar means that the first nucleotide sequence or amino acid sequence has a sufficient or minimal number of identical or equivalent nucleotides or amino acid groups relative to the second nucleotide sequence or second amino acid sequence.

As for the amino acid sequence, after modification by the above method, it also has a common structural domain and/or has a common functional activity. Nucleotide sequences or amino acid sequences having at least about 70%, at least about 99%, or at least about 100% identity with the nucleotide sequence or amino acid sequence of the present invention are defined in this document as being sufficiently similar. Identity also clearly covers the range from 90% to 100%. For functional fragments, sufficient similarity is established if the nucleotide sequence or amino acid sequence generally has the same property as the previously named nucleotide sequence or amino acid sequence of the present invention. Those nucleotide sequences that encode a derivative or derived amino acid sequence are generated either directly or indirectly (for example, through amplification or replication steps) from an original nucleotide sequence that corresponds along its entire length, or at least in part, to the nucleotide sequence of the present invention .

Accordingly, the present invention includes a nucleotide sequence that is capable of hybridizing under stringent conditions to a nucleotide sequence complementary to a nucleotide sequence of the present invention, or to a nucleotide sequence encoding an amino acid sequence of the present invention.

In another embodiment of the present invention, the nucleic acid molecule of the present invention is characterized in that, once expressed in a plant, it itself confers a dominant effect of pathogen resistance, in a preferred embodiment, infused

- 12 045304 of the present invention - to Cercospora beticola, or that it encodes a polypeptide that is capable of conferring a dominant effect of resistance to Cercospora. In a preferred embodiment of the present invention, the nucleic acid molecule or polypeptide imparts a resistance effect of at least one rating point, in a preferred embodiment of the present invention by at least two rating points, and, in a particularly preferred embodiment of the present invention, by three to four rating points. Such a gene, which by itself imparts such pronounced resistance to Cercospora to the plant or encodes a polypeptide capable of conferring such pronounced resistance, is not known from the prior art. As described above, in varieties previously available on the market, resistance to Cercospora is transmitted through many resistance genes with little effect, and the disadvantage of such varieties is that their development is very slow and expensive due to complex transmission, and that in the absence of infection, such varieties have significantly lower yields compared to conventional varieties. Among other things, this may be due to the epigenetic interaction of some resistance genes with genes responsible for sugar production, which leads to reduced plant vigor in the absence of the pathogen.

Thus, the inventors were able for the first time to propose a Cercospora resistance gene that can be used for significantly simplified plant breeding. Thanks to the inclusion of this gene in elite lines, high-yielding varieties with high resistance to Cercospora can now be developed very quickly. Accordingly, the present invention provides for the first time a sugar beet plant, a chard plant, a red beet plant or a common beet plant, and a fodder beet plant having resistance to Cercospora beticola according to the present invention, and thus they are covered by the present invention. Since all of the listed plants are cultivated plants, crops or plants suitable for cultivation in agriculture and have resistance according to the present invention, they are part of the present invention. In particular, part of the present invention are those crops that contain an underground storage organ used as food, raw material or industrial source of sugar, and which have the resistance of the present invention; these crops are another aspect of the present invention. The storage organ can be, for example, the sugar-containing body of the sugar beet root, the consumed body of the red beet root, or the nutritive body of the fodder beet root. The underground storage organ can account for more than 50%, and for sugar beet even more than 70% of the total mass of a full-fledged adult plant. Moreover, the seeds or seed material of these plants are also part of the present invention. The seeds or seed material can be technically processed as described further below.

In this context, the present invention also includes a nucleic acid encoding a protein in accordance with SEQ ID NO: 3, while in a particular embodiment of the present invention the naturally occurring nucleic acid in accordance with SEQ ID NO: 1 is excluded.

In addition, the present invention relates to a recombinant and/or heterologous DNA molecule that contains the sequences of the nucleic acid molecule of the present invention. In addition, this DNA molecule, in a preferred embodiment of the present invention, has a regulatory sequence. Thus, it may be operatively linked to or influenced by this regulatory sequence. This regulatory sequence in a preferred embodiment of the present invention is a promoter sequence and/or other transcriptional or translational control element sequences, for example cis elements. The regulatory sequence controlling the expression of a gene that includes a nucleic acid molecule of the present invention, in a preferred embodiment of the present invention, is a sequence capable of conferring or modulating expression following infection by a pathogen. This promoter, in a preferred embodiment of the present invention, is capable of controlling the expression of a DNA sequence specifically in the leaves of the plant. The regulatory sequence may be heterologous to the expression sequence. The advantage of this approach is that one skilled in the art can better control the rate of expression of the expression sequence, the tissue in which expression occurs, and the time point at which expression occurs, in the sense that he selects the regulatory sequence that best only suitable for use in the appropriate case. The heterologous DNA sequence in a preferred embodiment of the present invention includes a nucleotide sequence encoding a component of the plant's defense against pathogens (for example: resistance genes (R genes) or genes encoding enzymes involved in signal transduction, such as kinases or phosphatases, and for G- protein, or which encode a pathogenic effector (so-called avirulence (avr) genes). The heterologous DNA sequence may be one of the DNA sequences of the present invention. The heterologous DNA sequence may also further encode other components of plant defense against pathogens. Therefore, the heterologous DNA sequence Maybe

- 13 045304 be designed so that polycistronic mRNA is created after its transcription.

In addition, the present invention also provides a polypeptide that may be encoded by a nucleic acid molecule of the present invention, and a functionally and/or immunologically active fragment thereof, as well as an antibody that specifically binds to the polypeptide or fragment thereof. In a particularly preferred embodiment of the present invention, the polypeptide has an amino acid sequence according to SEQ ID NO: 3. The production of recombinant proteins, polypeptides and fragments is familiar to one skilled in the art (Sambrook et al., Molecular Cloning: Laboratory Manual, 3- e edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001, or Wingfield, P.T., 2008, Recombinant Protein Production, Current Protocols in Protein Science, 52:5.0:5.0.1-5.0. 4). Polyclonal or monoclonal antibodies to the protein of the present invention can be produced by one skilled in the art according to known methods (E. Harlow et al., editor, Antibodies: Laboratory Manual (1988)). The production of monoclonal antibodies, as well as Fab and F(ab')2 fragments, which can also be used in protein recognition methods, can be achieved by various conventional methods (Coding, Monoclonal Antibodies: Principles and Practice, pp. 98-118, New York: Academic Press (1983)). Antibodies can then be used to screen DNA expression libraries to identify identical, homologous, or heterologous genes through immunoassay screening (Sambrook et al., Molecular Cloning: Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, or Ausubel et al., 1994, Current Protocols in Molecular Biology. John Wiley & Sons), or can be used for Western blot analyses. In particular, the present invention relates to antibodies that selectively recognize the polypeptide encoded by the Cercospora resistance-conferring allele of the present invention and substantially do not recognize the polypeptide encoded by the corresponding susceptible allele, that is, they recognize 2 times less, in in a preferred embodiment of the present invention, 5 times less, and in a more preferred embodiment of the present invention, at least 10 times less, polypeptides encoded by the susceptible allele than the polypeptide encoded by the Cercospora resistance allele of the present invention.

In a preferred embodiment of the present invention, the antibody of the present invention is characterized in that it is a synthetic polypeptide that does not occur in nature.

In addition, the antibodies of the present invention can be coupled to a fluorescent dye so that they can be used, for example, in an immunohistochemical method, and so that they can cause staining of the antibodies. The fluorescent dye may be a fluorochrome. Antibodies of the present invention may also be present linked to other signaling molecules. These include, for example, biotin, radioisotopes, reporter enzymes such as alkaline phosphatase, or oligonucleotides.

An additional object of the present invention are vectors or expression cassettes comprising a nucleic acid molecule or a recombinant DNA molecule of the present invention - possibly under the control of regulatory elements and, in particular, under the control of functional regulatory elements in plants, as well as markers of negative and/or positive selection . Thus, the vector backbone is heterologous to the nucleic acid molecule of the present invention, which means that such a vector does not occur in nature and cannot be isolated from the natural environment. The vector is a plasmid, cosmid, bacteriophage or expression vector, transformation vector, shuttle vector or cloning vector; it can be double-stranded or single-stranded, linear or circular; or it can transform a prokaryotic or eukaryotic organism either through integration into its genome or extrachromosomalally. In a preferred embodiment of the present invention, the nucleic acid molecule or DNA molecule of the present invention is operably linked in an expression vector or expression cassette to at least one regulatory sequence that allows transcription and, optionally, expression in a prokaryotic or eukaryotic cell; (Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001). In a preferred embodiment of the present invention, these regulatory sequences are promoters or terminators, in particular a transcription initiation site, a ribosome binding site, an RNA processing signal, a transcription termination site and/or a polyadenylation signal. For example, a nucleotide sequence molecule herein is under the control of a suitable promoter and/or terminator. Suitable promoters may be constitutive promoters (example: the 35S promoter from Cauliflower mosaic virus (Odell et al., Nature 313 (1985), 810-812); particularly suitable promoters are those that are pathogen-inducible (example: PR1 promoter from parsley (Rushton and

- 14 045304 co-authors, female EMBO 15 (1996), 5,690-5,700)). Particularly suitable pathogen-inducible promoters are synthetic or chimeric promoters that do not occur in nature and that are composed of multiple elements and also contain a minimal promoter and have at least one cis-regulatory element upstream of the minimal promoter, wherein at least one cis-regulatory element serves as a binding site for specific transcription factors. Chimeric promoters can be designed according to desired requirements and induced or repressed by various factors. Examples of such promoters can be found in WO 00/29592, WO 2007/147395 and WO 2013/091612. For example, a suitable terminator is the nopaline synthase terminator (Demicker et al., Mol. Appl. Genet. 1 (1982), 561-573). Suitable promoters and terminators may also be a native promoter and a native terminator, the DNA sequences of which are reproduced in SEQ ID NOs: 7 and 8. Expression vectors or cassettes further contain conventional indicator/reporter genes or resistance genes to recognize the transfer of the desired vector or DNA molecule/molecule nucleic acid, as well as to select individuals that contain them, since direct recognition through gene expression is, for the most part, quite difficult. Since the nucleic acid molecule of the present invention in this case itself encodes a polypeptide that confers resistance to leaf spot disease, the provision of an additional resistance gene is not essential for expression in plant cells; however, this is recommended for quick screening.

Examples of indicator/reporter genes are, for example, the luciferase gene and the gene encoding green fluorescent protein (GFP). In addition, they also allow testing for gene promoter activity and/or regulation. Examples of resistance genes - especially for plant transformations - are the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene or the gene encoding phosphinotricin acetyltransferase. Additional markers of positive selection may be enzymes that provide the transformed plant with a selection advantage over the non-transformed plant, particularly an advantage in terms of nutrient availability, such as mannose-6-phosphate isomerase or xylose isomerase. However, this does not exclude the presence of additional indicator/reporter genes or resistance genes known to one skilled in the art. In a preferred embodiment of the present invention, the vector is a plant vector. In addition, the expression cassette may be present as a cassette integrated into the plant genome.

In another aspect, the present invention relates to cells including vectors, recombinant DNA molecules and/or nucleic acid molecules of the present invention. Within the meaning of the present invention, the cell may be a prokaryotic (eg, bacterial) or eukaryotic cell (eg, plant cell or yeast cell). In a preferred embodiment of the present invention, the cell is an Agrobacterium, for example, Agrobacterium tumefaciens or Agrobacterium rhizogenes, an Escherichia coli cell or a plant cell; in a particularly preferred embodiment of the present invention, the plant cell is a cell of a plant of the genus Beta, the species Beta vulgaris or the subspecies Beta vulgaris subsp. vulgaris. The cell may also be present as a culture. Therefore, the present invention also covers a cell culture that contains such cells. In a preferred embodiment of the present invention, the cell culture is a pure culture or isolate containing no other cell type.

One skilled in the art will be aware of numerous methods, such as conjugation or electroporation, by which he can introduce a nucleic acid molecule of the present invention, a recombinant DNA molecule and/or a vector or expression cassette of the present invention into an Agrobacterium, and methods such as as various transformation methods (biolistic transformation, Agrobacterium-mediated transformation) by which he can introduce a nucleic acid molecule of the present invention, a DNA molecule and/or a vector of the present invention into a plant cell (Sambrook et al., Molecular Cloning: How to laboratory work, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001.

Moreover, in a preferred embodiment, the present invention relates to a plant resistant to Cercospora, in a preferred embodiment of the present invention, to a plant of the species Beta vulgaris subsp. vulgaris or a segment thereof that contains a nucleic acid molecule of the present invention that confers resistance to Cercospora. A plant resistant to Cercospora may contain a nucleic acid molecule of the present invention as a transgene or endogene. Within the scope of the present invention, plants of the subspecies Beta vulgaris subsp. were obtained for the first time. vulgaris containing a nucleic acid molecule of the present invention. The present invention also includes plants of the subspecies Beta vulgaris subsp. vulgaris, which contain the nucleic acid molecule of the present invention as an endogen.

Thus, a segment may be a cell, tissue, organ, or a combination of many

- 15 045304 va cells, tissues or organs. The combination of several organs represents, for example, a flower or a seed. In a preferred embodiment of the present invention, the Cercospora resistant plant of the present invention exhibits higher resistance to Cercospora, in particular Cercospora beticola, than a corresponding plant that does not contain the nucleic acid molecule of the present invention (control plant). The control plant ideally has the same genotype as the transgenic plant and has been grown under identical conditions, but does not contain the nucleic acid molecule that confers resistance. The level of resistance, for example to Cercospora beticola, can be established qualitatively in plants of the genus Beta by determining rating points. Higher resilience is reflected by an increase in resilience by at least one rating point, at least two rating points, and, in a preferred embodiment of the present invention, by at least three or more rating points.

A plant cell or plant or segment thereof of the present invention which contains a nucleic acid molecule of the present invention, in particular a plant of the genus Beta, in a preferred embodiment of the present invention exhibits higher resistance to a pathogen, in particular to Cercospora beticola, than the corresponding a plant cell or plant, or a segment thereof, that does not contain a nucleic acid molecule of the present invention or contains a sensitive allelic variant of a nucleic acid molecule. The level of resistance, for example to Cercospora beticola, can be established qualitatively in plants of the genus Beta by determining rating points. Higher resilience is reflected by an increase in resilience by at least one rating point, at least two rating points, and, in a preferred embodiment of the present invention, by at least three or more rating points.

In the case of a transgenic plant cell or plant, or a segment thereof, it contains a nucleic acid molecule or DNA molecule of the present invention in the form of a transgene or vector or expression cassette of the present invention. Such a transgenic plant cell or plant or segment thereof is, for example, a plant cell or plant or segment thereof that is transformed, in a preferred embodiment of the present invention stably transformed, with a nucleic acid molecule, a DNA molecule of the present invention, or a vector or expression cassette according to the present invention. In a preferred embodiment of the present invention, the nucleic acid molecule is operably linked to at least one regulatory sequence that allows transcription and, optionally, expression in a plant cell. The general structure consisting of a nucleic acid molecule of the present invention and the regulatory sequence(s) subsequently constitutes a transgene. Such regulatory sequences are, for example, a promoter or a terminator. One skilled in the art is aware of numerous functional promoters and terminators used in plants.

The invention also includes the vacuole of the cell of the present invention and the substances contained therein.

In addition, the present invention also relates to a cell extract obtained from a cell, in a preferred embodiment of the present invention from a plant cell, in a particularly preferred embodiment of the present invention from a Beta vulgaris cell, and in a most preferred embodiment of the present invention from a cell one of the following crops: sugar beet, chard or red beet. No plant can be regenerated from cell extract.

Likewise, the present invention covers a plant genome containing a nucleic acid of the present invention. No plant can be regenerated from a plant genome.

Thus, the sugar concentration from the cell extract can be increased relative to a cell that is not a cell of the present invention, but that is of the same species or culture. This applies in particular to conditions where Cercospora infection occurs.

The present invention also covers the use of a cell extract for the production of sugar (sucrose) or for the production of juice, in a preferred embodiment of the present invention beet juice.

Likewise, the present invention covers sugar, in particular sucrose, contained in the cells of the present invention and in their vacuoles.

An additional aspect of the present invention is a seed material comprising seeds containing a nucleic acid of the present invention. The nucleic acid of the present invention may be present as a transgene or an endogene. Seed material and seeds can be technically processed. Thus, the present invention also contains technically processed seed material and technically processed seeds. A detailed explanation of the various varieties of technically processed seed material is given below, whereby the term seed

- 16 045304 material also includes seeds: The technically processed seed material may be present in ground form. This removes the outer layer of the seed, resulting in a more rounded seed. This is useful when sowing because an optimally uniform shape results in an even distribution of seed grains. In addition, technically processed seed material includes coated seed material. Thus, the seed material is placed in a pelleted mass, which protects the seed material contained therein and causes an increase in mass, with the result that the pelleted seed material exhibits greater resistance to wind drift and is thus less susceptible to being blown away by the wind, and at the same time At the same time, more accurate positioning during sowing is ensured. In a preferred embodiment of the present invention, all coated grains of the seed of the batch or supply intended for sale have essentially the same shape and the same weight. Deviations of 5% in diameter and weight are possible. However, in a preferred embodiment of the present invention, the deviations do not exceed 1%. As one of the main components, the pelleted mass may contain, for example, a mineral compound such as, for example, clay, bentonite, kaolin, humus and/or peat. An adhesive material such as polyacylamide can be added. Additional possible components are listed in US publication 4,067,141. In addition, the pelleted mass may contain additional chemical agents that have a positive effect on cultivation in practice. In this case, these may be substances that are classified as fertilizing agents. These include compounds rich in at least one of the following elements: nitrogen, phosphorus and potassium (macronutrients). Therefore, the fertilizer ingredients may contain, for example, nitrate nitrogen, ammonium nitrogen, magnesium nitrate, calcium ammonium nitrate, monoammonium phosphate, monopotassium phosphate and potassium nitrate. In addition, the pelleted mass may contain fungicides, insecticides and/or antifeeding agents. The fungicides may be thiram and/or hymexazole and/or other fungicides. The insecticide may be a substance from the group of neonicotinoids. The neonicotinoid substance in a preferred embodiment of the present invention is imidacloprid (ATC code: QP53AX17) and/or clothianidin (CAS number 210880-92-5). In addition, the insecticide may also be cyfluthrin (CAS number 6835937-5), beta-cyfluthrin or tefluthrin. It should be noted that the compounds included in the pickled or coated mass are absorbed by the plant and exhibit a systemic effect, thereby ensuring proper protection of the entire plant. Thus, plants derived from pelleted seed, including at least one pesticide, are different from naturally occurring plants and exhibit better performance under biotic stress conditions. In this context, the present invention also covers the mixture of pelleted mass and seed according to the present invention. In addition, the present invention also covers a method for producing pelleted seed according to the present invention, comprising the following steps:

a) offering a seed of a sugar beet plant containing a nucleic acid according to the present invention,

b) introducing the seed of a sugar beet plant into the pelleted mass,

c) drying the pelleted mass, wherein the seed may optionally be a primed seed, or a pre-germinated seed, or the seed may be primed in step b).

Coated seed is a specific embodiment of treated seed. In this context, technically processed seed also includes treated seed. However, the present invention is not limited to coated seed; on the contrary, it can be applied to any form of treated seed. The present invention therefore also relates to treated seed, which includes, but is not limited to, coated seed. Thus, it also covers dry etching, wet etching and suspension etching.

Thus, the dressing may also contain at least one dye (coloring), with the result that the treated seed material can be quickly distinguished from untreated seed material, and, in addition, after sowing, it is clearly visible in the environment. The dressing may also contain the same agrochemicals as described in the context of the granular mass. The present invention thus includes such treated seed, wherein the treatment contains at least one antifeeding agent, in particular an insecticide and/or at least one fungicide. Optionally, so-called electronic etching (etching using electrical energy) can be used. However, electronic etching is not etching in the strict sense of the word.

An additional form of technically processed seed is encrusted seed. In this context we also talk about what is called glazing, as well as seed material that has been treated with glazing. Difference from coated seed mate

- 17 045304 rial is that the seed grains retain their original shape, and this method is especially economical. This method is described, for example, in publication EP 0 334 258 A1. An additional form of technically processed seed is germinated or primed seed. Germinated seed material is pre-treated by pre-germination, while seed material subjected to priming has already been pre-treated by priming (sprouting). The advantage of pre-germinated and primed seed material is a shorter germination time. In addition, the moment of emergence of seedlings after sowing is more synchronized. This ensures better agronomic handling during cultivation and especially during harvesting, and further increases the yield. In pre-germination, the seed is germinated until the root emerges from the seed coat and the process is subsequently terminated. In priming, the process stops before the root emerges from the seed coat. Compared to pre-primed seed, primed seed is insensitive to the stress of re-drying, and after re-drying it has a longer shelf life than pre-primed seed, for which re-drying is generally not recommended. In this context, technically pre-treated seed also includes primed and re-dried seed. An explanation of the pre-germination process is given in publication US 4,905,411 A. An explanation of the various embodiments of priming is given in publication EP 0 686 340 A1. In addition to this, it is also possible to simultaneously granulate the seed and subject it to priming in one process. This method is described in publication EP 2 002 702 B1. The present invention covers primed seed material, which is also coated.

The technically treated seed material may be further provided with at least one type of herbicide resistance as described above. This makes it possible to further improve agricultural cultivation, since technically treated seed material can be used on a field that has previously been treated with a weed killer and is therefore weed-free.

In addition, the present invention also covers a mixture containing the seed material of the present invention or seeds of the present invention, and a dressing mass as defined above. Thus, the pickled mass, in a preferred embodiment of the present invention, is embodied in the form of a coated mass, as defined above.

When storing the seed material of the present invention, in a preferred embodiment of the present invention, storage conditions are selected that do not adversely affect the stability or shelf life of the seed material. Fluctuations in humidity can have a particularly unfavorable effect. Part of the present invention is a method of storing seed material in a bag or container that is both water-repellent and breathable. Such a bag or container can be made in the form of a cardboard box or packaging. Such a cardboard box or package may additionally contain an internal vapor-proof layer. If the cardboard box or packaging is made in the form of a two-tier box, then storage stability increases. A container, bag, carton or package containing the seed material of the present invention or the processed seed material of the present invention is also part of the present invention. Likewise, it is part of the present invention to store the seed material of the present invention or the processed seed material of the present invention in such a bag, container, package or carton.

In one embodiment of the present invention, the plant of the present invention is a hybrid plant or a double haploid plant. Hybrid plants and double haploid plants do not occur in nature and cannot be isolated from natural materials. In another embodiment of the plant of the present invention, the nucleic acid molecule of the present invention is present in a heterozygous or homozygous form. In the case of a hybrid plant, the nucleic acid molecule may also be present in a hemizygous form. The present invention also covers hybrid seeds and double haploid seeds containing a nucleic acid of the present invention or a polypeptide of the present invention.

Another embodiment of the present invention contains a plant, in a preferred embodiment of the present invention, the species Beta vulgaris, characterized in that the resistance to Cercospora in this plant is further increased. For example, this could be achieved through gene stacking, meaning resistance is enhanced through this dose effect. To do this, plants of the present invention containing a Cercospora resistance allele are over-transformed with the resistance allele to increase the level of gene transcription in the plant. An alternative approach involves gene editing/site-directed mutagenesis or TILLING-mediated modification of the native promoter of the resistance-conferring allele to increase

- 18 045304 the frequency of its expression, or modification of the resistance-conferring allele of the LRR gene itself to increase its activity or stability. Such a method of increasing activity by modifying a resistance gene is described, for example, in WO 2006/128444 A2, and can be carried out using techniques known to one skilled in the art. An additional approach may involve fusing a nucleic acid molecule of the present invention to a heterologous promoter that exhibits superior activity to the native promoter, particularly following Cercospora infection.

A further embodiment of the present invention is directed to a sugar beet plant, or the pelleted seed of such a plant, which is harvested before bolting because no bolting occurs in the sugar beet plant during the first 10, 11, 12, 13, 14 or 15 months after germination, and in This period ends the development of the beet root body.

In one embodiment of the present invention, the sugar beet plant or the pelleted seed of such a plant has a genome that allows the beet root body to develop to a mass that totals at least 50%, 60%, 70%, 80%, or even 90% of the total weight of a full-fledged adult plant.

In another embodiment of the present invention, a sugar beet plant or the pelleted seed of such a plant has a genome that allows the beet root body to develop to a mass of at least 200 g, 250 g, 300 g, 350 g, 400 g, 450 g or 500 g, and a maximum of 100 g, 1100 g, 1200 g, 1300 g, 1400 g, 1500 g, 1600 g, 1700 g, 1800 g, 1900 g or even 2000 g, through photosynthesis.

A further embodiment of the present invention is directed to a sugar beet plant or the coated seed of such a plant, wherein the genome of the sugar beet plant allows the beet root body to develop to a sucrose concentration of at least 10%, 11%, 12%, 13% , 14%, 15%, 16%, 17%, 18%, 19% or even 20%.

In one embodiment of the present invention, a sugar beet plant or the coated seed of such a plant includes at least one, at least two, at least three, at least four, at least five, at least ten, at least twenty, or even at least thirty mutations relative to SEQ ID NO: 4.

A method of producing an organism containing a mutated version of a nucleic acid molecule according to the above embodiment of the present invention 1 and/or a mutated version of a promoter containing a nucleic acid sequence selected from the group consisting of (a) SEQ ID NO: 7, (b) a nucleotide sequence, hybridizing under stringent conditions to a sequence complementary to the sequence in accordance with paragraph (a), and (c) a nucleotide sequence that is at least 70% identical to the sequence in accordance with SEQ ID NO: 7, wherein the method includes the following stages:

(I) Proposition of an organism or cell containing a nucleic acid molecule and/or promoter (II) Increasing the frequency of mutation of the organism or cell, or mutagenesis of the organism or cell (III) Phenotypic selection of an organism that, as a result of mutation, exhibits altered resistance or an altered level of resistance to Cercospora beticola, or Genotypic selection of an organism or cell containing a mutation in the nucleic acid molecule and/or promoter, wherein the mutation was created through step (II), and, optionally, (IV) Regeneration of the organism from the cell obtained in step (III).

The organism may be a plant. In a preferred embodiment of the present invention, the plant is Beta vulgaris. However, single-celled organisms such as bacteria can also be used. The bacterium may be E. coli. If the organism is a plant, then the method can be applied both in vivo and in vitro. If the organism is a plant and the method is applied in vitro, a culture of plant cells may be created, and an increase in the frequency of mutations or mutagenization may occur in the cell culture. Increasing the mutation rate includes, for example, the use of mutagenic agents, such as, for example, 5-bromouracil or ethyl methanesulfonate (EMS), or the use of physical mutagens, such as ionizing radiation or ultraviolet light. Mutagenization also covers targeted mutagenesis. Targeted mutagenesis can be achieved using precision techniques such as gene editing (as described below).

An explanation of the regeneration of an organism from cells is given in various standard reference books on cell biology. An explanation of plant regeneration is given, for example, in the standard reference Plant Biotechnology: Integrated Biotechnology, Supplement Two (Michael W. Fowler, Graham Warren, Murray Moo-Young, Pergamon Press, 1992). Regeneration of Beta vulgaris from cell culture is described in Lindsay and Gallois Transformation of sugar beet (Beta vulgaris) by Agrobacterium tumefaciens. Journal of experimental botany 41.5 (1990): 529-536.

These reference books also describe how plant cell cultures are created. As explained above, a mutated version of the nucleic acid molecule and therefore the promoter in

- 19 045304 in a preferred embodiment of the present invention are characterized by the frequency of expression of the resistance-conferring nucleic acid molecule, which increases as a result of mutation. This effect may also depend on the presence of several mutations. For example, two, three, four, five or more mutations can be introduced into a promoter or nucleic acid molecule.

Thus, by introducing mutations, more resistance-conferring protein can be built in the cell, or the protein can have a better effect. Thus, resistance compared to a control plant containing an unmodified nucleic acid of the present invention can be increased, for example, by at least 1, 2, 3, 4, 5 or more percent. The increase can be measured as described below. Moreover, resistance due to mutation or mutations may be increased by at least one rating point. An explanation of rating points is provided elsewhere in this document. In addition, the resistance protein may exhibit - as a result of mutations - an altered effect, and in some circumstances, it may exhibit an effect directed against those pathogens that have adapted to the primary resistance mechanism. In this context, the present invention also covers such mutated variants of the nucleic acids of the present invention and mutated variants of the protein of the present invention. In a preferred embodiment of the present invention, the present invention covers those variants that do not occur in nature and cannot be isolated from natural materials to ensure that the pathogen has not had the opportunity to adapt to such variants. In addition, the above-described method of obtaining an organism containing a mutated version of a nucleic acid molecule may include the additional step of identifying those organisms or plants that have additional increased resistance due to the mutation or mutations. Determination of whether sustainability has improved is possible through the rating scores explained herein or by measuring the level of sustainability.

In addition to the above-described method of producing organisms containing a mutated version of a nucleic acid molecule or promoter, it is also possible to modify the corresponding nucleic acids chemically in the isolated state to achieve the desired effects (eg, those described above). The advantage of this approach is that connections can be edited even more precisely. The following method is proposed for this:

Producing a chemically modified nucleic acid molecule according to the above embodiment of the present invention 1 and/or a chemically modified promoter containing a nucleotide sequence selected from (a) SEQ ID NO: 7;

(b) a nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence in accordance with paragraph (a);

(c) a nucleotide sequence that is at least 70% identical to the sequence according to SEQ ID NO: 7;

in this case, the method contains the following steps:

(I) Providing the nucleic acid molecule as above in isolated form (II) Chemically modifying the nucleic acid molecule or promoter by one of the following steps:

(IIa) Mutagenization (IIb) Gene editing (IIc) Restriction and ligation, insertion or deletion, respectively.

Additionally, chemical modifications can be generated by such approaches as discussed elsewhere herein in the context of allelic variants. Gene editing given in step (II) above is equivalent to the term genome editing. Optionally, the chemically modified nucleic acid molecule or the chemically modified promoter can subsequently be introduced into the cell, or they can be stably integrated. With the help of such a cell, a chemically modified nucleic acid molecule and a modified promoter can be propagated in the context of cell proliferation. Subsequently, they can be isolated in large numbers and gene expression assays can be performed. Gene expression assays are particularly suitable when the chemical modification involves the promoter. The cells can be harvested and the chemically modified resistance protein can be isolated for chemical analyses. If the cell containing the chemically modified nucleic acid molecule or modified promoter is a plant cell, then a whole plant can be regenerated from that cell. The approaches described in the present passage can be carried out after the above method of producing a modified form of a nucleic acid molecule and/or a modified promoter, and the resulting variants are also included in the present invention. In addition, a plant containing a chemically modified nucleic acid molecule or a modified promoter is also included in the present invention. Thus, the present invention also relates to a plant obtained by this method. In addition, the present invention also relates to chemically modified nucleic acid molecules obtained by this method

- 20 045304 bom, and to the encoded polypeptides. These compounds may be optimized versions of the original (unmodified) compounds, and the resulting level of stability - as explained above - may be increased by at least 1, 2, 3, 4, 5 or more percent, or it may be increased by at least one rating point. In this regard, a method for producing a chemically modified nucleic acid molecule is also a method for optimizing the nucleic acid molecule. In addition, the optimization method may contain an additional step in which those modified variants of the nucleic acid molecule are identified that lead, compared to unmodified variants, to increased plant resistance.

In another embodiment of the present invention, the plant of the present invention further, as a transgene or endogene, contains a second nucleic acid molecule at another position in the genome that encodes a polypeptide capable of conferring resistance to Cercospora to the plant in which the polypeptide is expressed. For example, at least one resistance gene or resistance locus described in the prior art may - since it is not already present in the original genotype - be introduced into the plant of the present invention through crossing, transformation, homologously directed repair or homologous recombination. Such genes include, for example, the rhizomania resistance gene RZ1 (Lewellen, R.T., I.O. Skoen and A.V. Eriksen, Breeding sugar beet for resistance to rhizomania: Assessment of host plant responses and selection and inheritance of resistance. 50th Winter Congress of the International Sugar Beet Research Institute, Brussels (Belgium), 11-12 February 1987. International Sugar Beet Research Institute. General Secretariat, 1987), or the rhizomania resistance gene RZ3 (WO 2014/202044 ).

The present invention further relates to a method for increasing resistance to Cercospora in a plant of the species Beta vulgaris, wherein the increase in resistance occurs without the participation of the resistance-conferring gene of the present invention compared to a plant of an isogenic line.

Increased resistance can occur through integration of the nucleic acid molecule of the present invention into the genome of at least one cell of a plant of the species Beta vulgaris, as well as through possible regeneration of the plant from a plant cell. Integration can occur either through sexual crossing, for example with one of the above-mentioned Beta vulgaris subsp. maritima and subsequent selection, as well as through homologously directed repair or homologous recombination. In a preferred embodiment of the present invention, the last two mentioned methods rely on site-directed nucleases, which may be selected from, but are not limited to, the following nucleases: CRISPR nuclease, including Cas9, CasX, CasY or Cpfl nuclease, TALE nuclease, zinc finger nuclease, meganuclease, Argonaut nuclease, restriction endonuclease including FokI or a variant thereof, recombinase or two site-specific, nicking endonucleases. Introduction of a resistance-conferring gene via CRISPR-mediated homologous recombination into the plant Beta vulgaris subsp. vulgaris is shown in example 1.

An alternative approach involves increasing the expression of the nucleic acid molecule of the present invention in the plant. This may occur through modification of the native promoter, wherein in a preferred embodiment of the present invention the modification occurs through gene editing or site-directed mutagenesis, which is mediated by site-directed nucleases, and optionally, repair models. Examples of such nucleases have already been given above. Increased expression of the nucleic acid molecule of the present invention can also occur by fusion of the nucleic acid molecule with a heterologous promoter that exhibits higher activity than the native promoter, particularly following Cercospora infection. Fusion can also occur through site-directed nuclease and repair models, as well as through direct insertion after a double-strand break.

As mentioned above, the method of increasing resistance to Cercospora can also lead to increased activity and/or stability of the polypeptide of the present invention by modifying the nucleotide sequence of the nucleic acid molecule of the present invention. Such a method of increasing activity by modifying a resistance gene is described, for example, in WO 2006/128444 A2, and can be carried out using techniques known to one skilled in the art. A detailed explanation of this approach is given below.

In an alternative embodiment of the present invention, a Cercospora-resistant genotype can be produced from a Cercospora-susceptible genotype by random or site-directed mutagenesis of the nucleic acid sequence of the susceptibility gene, and thus Cercospora resistance can be increased. Examples of polymorphisms that distinguish a susceptible allele from a resistant allele are presented in FIG. 1.

For example, the sensitivity allele can be modified through gene mutation by TALE nucleases (TALEN) or zinc finger nucleases (ZFN), as well as CRISPR/Cas systems, which

- 21 045304 are described, among others, by way of example in WO 2014/144155 A1 (Genome engineering of plants using CRISPR/Cas systems) and in the work of Osakabe and Osakabe, Plant Cell Physiol., 56 (2015), 389-400 . This can also be achieved by a method designated TILLING (targeting induced local damage in genomes), whereby, as described for example in German patent application DE 10 2013 101617, point mutations are caused in the sensitivity gene and then plants are selected demonstrating a suitable, that is, resistance-conferring, mutation, for example, barley resistant to yellow mosaic virus; see document DE 10 2013 101617 on pages 4, 8 and 12, paragraphs [0014], [0026] and [0038]. The TILLING method is also described in detail in the publication of Henikoff et al. (Henikoff et al., Plant Physiol. 135, 2004, 630-636).

In a preferred embodiment of the present invention, these methods result in an increase in resilience of at least one rating point, and in a particularly preferred embodiment of the present invention, an increase in resilience of at least two, three or more rating points. After mutagenesis of plant cells and subsequent regeneration of plants from mutagenized plant cells or plant mutagenesis, plants that exhibit at least one mutation can be identified, as shown in FIG. 1, in an endogenous nucleic acid molecule. In this context, the already mentioned plant of the present invention can be characterized in that the resistance is increased by at least one rating point, in a preferred embodiment of the present invention by at least two or more rating points. In an alternative embodiment of the present invention, the resistance of plants of the present invention can be increased, for example, by at least 1, 2, 3, 4, 5 or more percent compared to a control plant that does not contain the nucleic acid of the present invention. The increase can be measured by inoculating one healthy leaf with the pathogen isolate and identifying the infected surface 15 days later. A 5% reduction in contaminated surface area corresponds to a 5% increase in resistance. Other measurement parameters can be obtained from the resistance gene embodiment below.

A further embodiment of the present invention is a method for producing a plant resistant to Cercospora, which can be carried out by transforming a plant cell with a nucleic acid molecule of the present invention, a recombinant DNA molecule or a vector or expression cassette, and regenerating the transgenic plant from the transformed plant cell (see example 2), and also, as described above, by random or targeted mutagenesis of the nucleic acid sequence of the sensitivity gene to generate a genotype resistant to Cercospora, or by crossing and selection, for example, with one of the above-mentioned plants Beta vulgaris subsp. maritima. Expression vectors or cassettes, as well as methods for transforming plants, have already been described above.

A method for producing a plant resistant to Cercospora, in an alternative embodiment of the present invention, comprises, as described above, introducing a site-directed nuclease and a repair template into a cell of a plant of the species Beta vulgaris, wherein the site-directed nuclease is capable of generating at least one a double-stranded DNA break in the genome of the cell, in a preferred embodiment of the present invention, upstream and/or downstream of the target region, and the repair template contains a nucleic acid molecule of the present invention. In addition, the method includes cultivating this cell under conditions allowing homologously directed repair or homologous recombination, while the nucleic acid molecule is included in the plant genome from the repair matrix. In addition, the method covers the regeneration of a plant from a modified plant cell (see example 1).

In a preferred embodiment of the present invention, the target region is an allelic variant of a nucleic acid molecule of the present invention, wherein the allelic variant encodes a polypeptide that does not confer resistance to Cercospora. In another preferred embodiment of the present invention, the allelic variant contains a nucleotide sequence that encodes a polypeptide with an amino acid sequence in accordance with SEQ ID NO: 6 and/or contains an encoded DNA sequence in accordance with SEQ ID NO: 5, or a genomic DNA sequence in accordance with SEQ ID NO: 4.

As described with respect to the nucleic acid molecule of the present invention, substitutions, deletions, insertions, additions and/or any other changes may be introduced which, either individually or in combinations, actually alter the nucleotide sequence but perform the same function as and a parent sequence—in this case, the nucleotide sequence of an allelic variant of a nucleic acid molecule of the present invention. Thus, another embodiment of the present invention includes a nucleotide sequence encoding a polypeptide that is a derivative of a polypeptide that is encoded by an allelic variant of a nucleic acid molecule of the present invention, or that contains the amino acid sequence of an allelic variant of a nucleic acid molecule of the present invention. A derived amino acid sequence that has at least

- 22 045304 at least one substitution, deletion, insertion or addition of at least one amino acid, while the functionality of the encoded polypeptide/protein is retained, is a derivative of the polypeptide. Thus, using traditional methods known in the prior art, substitution, deletion, insertion, addition and/or substitution, deletion, insertion, addition and/or any other changes, either alone or in combination with a gene, that actually change the nucleotide sequence but perform the same function as the original sequence.

As for the amino acid sequence, after modification by the above method, it also has a common structural domain and/or has a common functional activity. Nucleotide sequences or amino acid sequences that are at least about 80%, at least about 85%, at least about 90%, at least about 91 %, at least by about 92%, at least by about 93%, at least by about 94%, at least by about 95%, at least by about 96%, by at least by about 97%, by at least by about 98%, by at least by about 99%, or by at least by about 100 % identical to the nucleotide sequence or amino acid sequence of the specified allelic variant of the nucleic acid molecule of the present invention is defined herein as being sufficiently similar. Accordingly, the present invention includes a nucleotide sequence that is capable of hybridizing, under stringent conditions, to a nucleotide sequence complementary to a nucleotide sequence of an allelic variant of a nucleic acid molecule of the present invention, or to a nucleotide sequence encoding a corresponding amino acid sequence.

In another preferred embodiment, the method of the present invention is characterized in that the double-strand break occurs in an allelic variant of the nucleic acid molecule according to the embodiment of the present invention according to claim 1, or in that at least one double-strand break occurs at a position equal to at least 10,000 base pairs upstream or downstream of the allelic variant, wherein the allelic variant encodes a polypeptide that does not confer resistance to Cercospora.

It will be apparent to one skilled in the art that numerous different sensitive sequences may occur that are derivatives of the nucleic acid molecule of the present invention but do not confer resistance to Cercospora, thus the above sequences (SEQ ID NOs: 4, 5 and 6) should be considered as example sequences only, and the present invention is not limited to the above allelic variant of the nucleic acid molecule of the present invention. Such an allelic variant may comprise a nucleotide sequence selected from:

(a) a nucleotide sequence encoding a polypeptide having the amino acid sequence according to SEQ ID NO: 6;

(b) a nucleotide sequence containing a DNA sequence in accordance with SEQ ID NO: 5;

(c) a nucleotide sequence containing a DNA sequence in accordance with SEQ ID NO: 4;

(d) a nucleotide sequence that hybridizes to a complementary sequence in accordance with paragraphs (a), (b) or (c) under stringent conditions;

(e) a nucleotide sequence encoding a polypeptide that, by substitution, deletion and/or addition of at least one amino acid of the amino acid sequence, differs from the polypeptide encoded by the nucleotide sequence in accordance with paragraphs (a), (b) or (c) );

(f) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical amino acid sequence according to SEQ ID NO: 6;

(g) a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the DNA sequence according to SEQ ID NO: 4 or SEQ ID NO: 5;

As described above, with the quantitative inheritance of QTL, often not only the desired resistance is introduced into the plant, but also often rather undesirable traits, such as, for example, a decrease in yield due to the inheritance of additional genes that are not linked to a positive resistance trait. This occurs increasingly if, as in the case of Cercospora resistance, resistance is inherited from pre-existing varieties through multiple resistance genes with little effect. Therefore, in a preferred embodiment of the present invention, the introduction of a nucleic acid molecule of the present invention, which itself exhibits a dominant effect of resistance, or a vector or expression cassette, is not associated with

- 23 045304 introduction of undesirable traits, while, in the preferred embodiment of the present invention, this does not negatively affect the yield. Moreover, the present invention relates to a plant obtained by this method.

Although QTL assays previously known in the art could recognize actual QTLs, downstream regions of the genome that exhibited the QTL effect also mediated the deficiencies described above, so the concept of linked cargo is also discussed in the context of this document. At the same time, QTL and their associated effects were not described uniformly in the relevant prior art and simply mediated a weak effect, so the use of these results in the breeding of plants resistant to Cercospora was only possible to a limited extent and was largely uncertain. Targeted selection and controlled integration of the resistance gene into the sugar beet gene pool is now possible through the identification of the resistance gene described herein. This enables the selection and generation of entirely new Cercospora resistant varieties that demonstrate high resistance to the pathogen without negatively impacting sugar yields.

The present invention also relates to a method for identifying and possibly providing a plant of the species Beta vulgaris resistant to the pathogen Cercospora, characterized in that the method includes the step of recognizing the presence and/or expression of a nucleic acid molecule of the present invention or a polypeptide of the present invention in the plant or its sample/segment. Testing for the presence and/or expression of a nucleic acid molecule of the present invention or a polypeptide of the present invention can be carried out using standard methods known to one skilled in the art, for example, PCR, RT-PCR or Western blotting.

In addition, the identification method of the present invention also includes recognizing the nucleic acid molecule of the present invention by recognizing at least one polymorphism between resistant and sensitive sequences, that is, between the sequences of the nucleic acid molecule of the present invention and the sequences of an allelic variant of the nucleic acid molecule according to the present invention described above, using molecular markers that recognize at least one polymorphism. As already described above, it will be apparent to one skilled in the art that there are multiple sensitive sequences, that is, multiple sequences that encode an allelic variant of the nucleic acid molecule of the present invention. One of them is shown by way of example by comparing the sequence with the nucleotide sequence of the nucleic acid molecule of the present invention in FIG. 1. In a preferred embodiment of the present invention, the method of the present invention therefore includes recognizing at least one polymorphism, which is presented in FIG. 1, using molecular markers that recognize polymorphisms - in particular diagnostic polymorphisms. Such recognition in a preferred embodiment of the present invention occurs using at least one molecular marker per polymorphism - in particular, a diagnostic polymorphism. Those skilled in the art will know which marker techniques should be used to recognize the respective polymorphism and how molecular markers are designed to do so (see Advances in Seed Science and Technology, Volume I, Vanangamudi et al., 2008). In addition, the present invention covers molecular markers that describe or recognize polymorphism in accordance with FIG. 1, for example, the use of a molecular marker for polymorphism recognition in accordance with FIG. 1. Thus, it is also possible to use markers that do not distinguish between different polymorphisms, as long as these markers are capable of recognizing such a polymorphism that occurs in the nucleic acid molecule of the present invention, but is not contained in the sensitive allelic variant.

In an alternative or additional embodiment of the present invention, the identification method of the present invention includes the step of recognizing at least one marker locus in the nucleotide sequence of a nucleic acid molecule of the present invention or in cosegregating regions thereof. In a preferred embodiment of the present invention, the cosegregation region is a region of the genome in the plant Beta vulgaris that cosegregates with Cercospora resistance conferred by a polypeptide of the present invention or with a nucleic acid molecule of the present invention, in a more preferred embodiment of the present invention, the cosegregation region comprises and is flanked by markers sxh0678s01 and s4p0264s01, markers s4p4301s01 and s4p2271s01, markers s4p4301s01 and s4p4293s01, or markers s4p4301s01 and s4p4295s01. Thus, recognition may occur through a method step in which at least one marker or at least one pair of primers is bound at a locus in accordance with SEQ ID NO: 74 or 75, in a preferred embodiment of the present invention - in locus in accordance with SEQ ID NO: 76 or 77, and optionally resulting in a signal being generated, for example a fluorescence signal or am

- 24 045304 sequence plific. Thus, in an alternative or additional embodiment of the present invention, the cosegregation region may comprise a sequence according to SEQ ID NO: 74 and/or 75, or SEQ ID NO: 76 and/or 77. In addition, the preceding identification methods are also methods selecting a plant that exhibits resistance to the Cercospora of the present invention. The selection method includes the final stage of selecting a resistant plant.

In this context, the present invention also includes the development or production of molecular markers that are suitable for recognizing the aforementioned polymorphisms between a nucleic acid molecule of the present invention (resistant allele) and a susceptible allelic variant, wherein the markers in a preferred embodiment of the present invention are suitable for recognizing polymorphisms , presented in Fig. 1, or designing hybridization probes that specifically bind to the nucleotide sequence of the nucleic acid molecule of the present invention, or producing a pair of nucleic acid molecules suitable for amplification in PCR, a region that is specific to the nucleic acid molecule of the present invention, and thus , for their recognition in a plant or plant cell.

In a preferred embodiment, the present invention includes a method for producing oligonucleotides having a length of at least 15, 16, 17, 18, 19 or 20, in a preferred embodiment of the present invention at least 21, 22, 23, 24 or 25, in a preferred embodiment of the present invention at least 30, 35, 40, 45 or 50, and in a particularly preferred embodiment of the present invention at least 100, 200, 300, 500 or 1000 nucleotides that specifically hybridize to the nucleotide sequence of a nucleic acid molecule of the present invention or a nucleic acid molecule that is complementary thereto, or a pair of nucleic acid molecules, in a preferred embodiment of the present invention in the form of oligonucleotides that are suitable for attachment as a forward and reverse primer to region that is specific to the nucleic acid molecule of the present invention and for its amplification in polymerase chain reaction (PCR), or which is suitable for hybridization as a forward and reverse primer with a region in the genome of a Beta vulgaris plant, in such Beta vulgaris that has cosegregation with Cercospora resistance conferred by a polypeptide of the present invention or with a nucleic acid molecule of the present invention. Examples of suitable primers for recognizing the resistance-mediating nucleotide sequence of the present invention are provided in SEQ ID NO: 98 and SEQ ID NO: 99. These two sequences form a primer pair that can be used in PCR.

Initially, a method for producing oligonucleotides involves: comparing the nucleotide sequence of a nucleic acid molecule of the present invention with the nucleotide sequence of a corresponding nucleic acid molecule that does not confer resistance, or with a sensitive allelic variant, which in a preferred embodiment of the present invention has a nucleotide sequence in accordance with SEQ ID NO : 4 or 5; identifying sequence differences between two nucleotide sequences; and generating nucleic acid molecules—in this case, oligonucleotides—that specifically bind to a nucleic acid molecule of the present invention, but not to a nucleic acid molecule that does not mediate resistance.

In addition, the oligonucleotide of the present invention can be coupled to a fluorescent dye to generate a fluorescence signal, for example, when excited by light of the appropriate wavelength. The fluorescent dye may be a fluorochrome. The oligonucleotides of the present invention may be conjugated with other compounds suitable for signal generation. Such oligonucleotides do not occur in nature, and they also cannot be isolated from natural raw materials. To obtain such labeled oligonucleotides, the following is done: DNA can be labeled in a bioorthogonal manner. For this purpose, DNA can be labeled in vivo or in vitro with nucleoside analogues, which, for example, can subsequently be coupled to a fluorophore via the Staudinger reaction. In addition to this, it is also possible to chemically endow DNA with fluorophores. Oligonucleotides can be labeled through phosphoramidite synthesis with fluorophores, which are, for example, used in quantitative PLR, DNA sequencing and in situ hybridization. In addition, DNA can be generated enzymatically by polymerase chain reaction with fluorescent nucleotides or tagged with a ligase or terminal deoxynucleotidyl transferase. DNA can also be indirectly recognized through biotinylation and fluorescent avidin. For conjugations, fluorescein, fluorescent lanthanides, gold nanoparticles, carbon nanotubes or quantum dots are used as fluorophores, among others. One of the most commonly used fluorescent substances is FAM (carboxyfluorescein). Therefore, oligonucleotides and, in particular, primers that have FAM labeling are covered by the present invention. In a preferred embodiment,

- 25 045304 of the present invention, FAM is present in the form of 6-FAM, however, depending on the desired emission and excitation wavelength, other variants of FAM, for example 5-FAM, can also be used. Examples of additional fluorescent markers include AlexaFluor, ATTO, Dabcyl, HEX, Rox, TET, Texas Red and Yakima Yellow. Depending on the application, oligonucleotides may be endowed with modifications to the bases or sugar phosphate backbone. Among them, among others, amino-dT, azide-dT, 2-aminopurine, 5-Br-dC, 2'-deoxyinosine (TNO), 3'-deoxy-A, C, G, 5-MetdC, 5-OH -Met-dCN6-Met-dA and others.

In addition, the present invention also relates to a marker chip (DNA chip or microchip) that contains at least one oligonucleotide of the present invention, which is suitable for recognition. The marker chip is suitable for use in at least one recognition method of the present invention.

The present invention also includes a method for producing the protein of the present invention. The method includes proposing or culturing a cell culture that contains SEQ ID NO: 2, and subsequent expression of the protein encoded by SEQ ID NO: 2.

In addition, the present invention also relates to a plant resistant to Cercospora, or a segment thereof, which has been identified and, if applicable, selected by the method described above. In particular, the present invention relates to a plant population comprising plants that are available in accordance with one of the methods of the present invention as described above, and which, in a preferred embodiment of the present invention, are resistant to leaf spot disease or Cercospora infestation, and are characterized by the presence nucleic acid molecules of the present invention. In a preferred embodiment of the present invention the population is at least 10, in a preferred embodiment of the present invention at least 50, in a more preferred embodiment of the present invention at least 100, in a particularly preferred embodiment of the present invention - at least 500 plants and, in particular, the population used in agriculture, in a preferred embodiment of the present invention, contains at least 1000 plants. The proportion of plants in the population that do not carry a nucleic acid molecule of the present invention and/or are susceptible to leaf spot disease is, in a preferred embodiment of the present invention, less than 25%, in a preferred embodiment of the present invention, less than 20%, in a more preferred embodiment of the present invention of the invention - less than 15%, in an even more preferred embodiment of the present invention - 10% and, in particular, in a preferred embodiment of the present invention - less than 5%, if present at all.

In the fine mapping described above, the position of the gene conferring resistance to Cercospora in the genome of Beta vulgaris subsp. maritima could be determined, and both the gene itself and the surrounding sequence regions could be identified. This, in turn, is the basis for the development of DNA hybridization probes or genetic markers in the target region that could recognize the gene that mediates resistance to Cercospora or could distinguish it from a gene that does not confer resistance.

DNA hybridization probes can be generated from the Cercospora resistance gene sequence and used to screen genomic and/or cDNA banks of the desired organism. The probes can be used to amplify identified homologous genes through the known polymerase chain reaction (PCR) process and to test whether the gene conferring resistance to Cercospora is present endogenously in the body or has been successfully introduced in a heterologous manner.

In this situation, one skilled in the art may resort to conventional hybridization, cloning, and sequencing techniques such as those listed in Sambrook et al., Molecular Cloning: Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. One skilled in the art can also synthesize and use oligonucleotide primers to amplify Cercospora resistance gene sequences. To achieve specific hybridization, such probes must be specific and at least 15 nucleotides in length, in a preferred embodiment of the present invention at least 20 nucleotides. A detailed guide to nucleic acid hybridization can be found in Thijssen, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization Using Nucleic Acid Probes, in Part 1, Chapter 2 of Overview of Hybridization Principles and Strategy for Nucleic Acid Quantification, Elsevier, New York ( 1993); and in the laboratory manual series Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., eds., Greene Publishing and Wiley Interscience, New York (1995).

Therefore, the nucleic acid molecule is at least 15, 16, 17, 18, 19 or 20 in length, in a preferred embodiment of the present invention at least 21, 22, 23, 24 or 25, in a particularly preferred embodiment of the present invention inventions - at least

- 26 045304 at least 30, 35, 40, 45, or 50, and in a particularly preferred embodiment of the present invention, at least 100, 200, 300, 500 or 1000 nucleotides are the object of the present invention, wherein this nucleic acid molecule acid specifically hybridizes with a previously described nucleotide sequence of the present invention, which contains a gene that confers resistance to Cercospora. It also clearly covers the nucleotide range from 15 to 35.

Thus, the present invention also relates to markers in the form of oligonucleotides, in particular to oligonucleotides in the form of primers. They contain a nucleic acid molecule of at least 15 nucleotides in length that specifically hybridizes to the nucleotide sequence defined as above.

In particular, the present invention covers a pair of nucleic acid molecules, in a preferred embodiment of the present invention in the form of oligonucleotides, or a set containing this pair of oligonucleotides, which are suitable for hybridization as a forward and reverse primer with a region that is specific to the nucleic acid molecule the present invention, and for amplification thereof by polymerase chain reaction (PCR), or which is suitable as a forward and reverse primer for hybridization with a region in the genome of a Beta vulgaris plant, such Beta vulgaris that exhibits cosegregation with Cercospora resistance conferred by the polypeptide of the present invention the invention, or with a nucleic acid molecule of the present invention.

The present invention can also achieve the following advantages in the field of breeding and development of new resistant lines of plants of the genus Beta. Sequence information, as well as identified polymorphisms that make it possible to distinguish between resistance alleles and sensitivity alleles of a recognized gene, that is, between alleles that confer resistance to Cercospora and alleles that are not capable of conferring this resistance, allows the development of a marker directly in the gene , as described above, as well as in the areas located above and below, which greatly facilitates the work of the plant breeder, in particular in the development of optimized elite lines without interlocking loads. Moreover, information about the sequence structure can be used to identify additional resistance genes, in particular to Cercospora, which are, for example, homologous or orthologous.

Thus, the present invention provides a method for identifying additional nucleic acid molecules encoding polypeptides or additional proteins that are capable of conferring Cercospora resistance to a plant in which the polypeptide is expressed. Thus, one skilled in the art can utilize databases using suitable search profiles and computer programs to screen for homologous sequences or to compare sequences. Moreover, using traditional molecular biology techniques, one skilled in the art can independently obtain additional DNA sequences encoding Cercospora resistance proteins and use them within the scope of the present invention. For example, suitable hybridization probes can be obtained from the sequence of a nucleic acid molecule of the present invention and used to screen genomic and/or cDNA banks of a desired organism. In this situation, one skilled in the art may resort to conventional hybridization, cloning, and sequencing techniques such as those listed in Sambrook et al., Molecular Cloning: Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. Using known sequences, one skilled in the art can also synthesize and use oligonucleotide primers to amplify sequences of nucleic acid molecules conferring resistance to Cercospora.

In one embodiment, the present invention thus provides a method for identifying a nucleic acid molecule encoding a polypeptide capable of conferring resistance to Cercospora to a Beta vulgaris plant in which the polypeptide is expressed. Thus, the method involves comparing the amino acid sequence of a polypeptide of the present invention that confers Cercospora resistance to the plant Beta vulgaris subsp. vulgaris using amino acid sequences from a sequence database, or using sequences of allelic variants of the polypeptide of the present invention in genotypes of plants of the species Beta vulgaris. In addition, the method of the present invention includes identifying an amino acid sequence or allelic variant that is at least 80% identical to the amino acid sequence of a polypeptide of the present invention, and introducing a nucleic acid molecule encoding the identified amino acid sequence or allelic variant into a plant of the species Beta vulgaris, expression of a nucleic acid molecule in a plant; and, optionally, subsequent verification of resistance to Cercospora.

As described above, additional proteins conferring resistance to Cercospora, or genes encoding them, that is, homologs, analogs and orthologs that are at least 70% identical, in a preferred embodiment of the present invention, at least 80%, in oso

- 27 045304 in a particularly preferred embodiment of the present invention, at least 90%, in the most preferred embodiment of the present invention, at least 95% or even 98% identical to the amino acid sequence of the polypeptide that is encoded by the nucleic acid molecule of the present invention can be identified through classical bioinformatic approaches (database searches and computer programs for screening homologous sequences).

The term homologue(s) thus means that the genes in question (from two different plant species) have essentially the same function and common ancestor, and therefore typically exhibit significant identity in their nucleic acid sequences or encoded amino acid sequences. However, there are also many genes that are homologous to each other without protein sequences resulting in a meaningful pairwise alignment. In contrast, the term analogue(s) describes genes or proteins that (in a similar way) have an identical or similar function, but are not created from the same structure, that is, do not have a common ancestor. In this case, it is often not possible to establish significant identity in their nucleic acid sequence or encoded amino acid sequence, or, at best, in specific functional domains.

In the context of genome sequencing, homologues are classified more precisely for annotation. For this purpose, the terms orthology and paralogy were introduced. Orthologs are genes linked through a speciation event. Paralogs are genes that can be traced back to a duplication event.

Thus, a gene is generally a homologue, analogue or ortholog within the meaning of the present invention if it is capable of conferring resistance to Cercospora in a plant. For testing, methods are used that have already been described above, known to a person skilled in the art, for example, amplification of the identified homolog or analogue or ortholog by PCR, cloning in expression vectors, introduction into a target plant or plant cell and testing for resistance.

As described above, the use of the resistance gene allele described herein in cis- or transgenetic approaches opens the possibility of the emergence of new resistant species of plants of the genus Beta, which, using a dose effect, demonstrate higher resistance, or in which resistance breakdown can be avoided and development optimized resistance by combining the recognized gene with other resistance genes. Gene modifications through TILLING or targeted engineering are also possible to optimize codon selection to increase expression or to develop new or modified resistance alleles. According to a preferred embodiment of the present invention, codon-optimized sequences or modified resistance alleles are not naturally occurring, but are artificial. An example of a modified genome sequence is provided by SEQ ID NO: 94, wherein the codon at position 16-18 is modified, but the encoded amino acid sequence is unchanged and corresponds to SEQ ID NO: 3. An example of a modified cDNA sequence is provided by SEQ ID NO: 95, with In this case, the codon at position 55-57 is modified, but the encoded amino acid sequence is unchanged and corresponds to SEQ ID NO: 3. An example of a modified allele conferring resistance is represented by the amino acid sequence in accordance with SEQ ID NO: 96, while the amino acid valine was is replaced by the amino acid leucine at position 209. The amino acid sequence in accordance with SEQ ID NO: 96 is encoded by a modified cDNA in accordance with SEQ ID NO: 97. These sequences do not occur in nature, but are artificial. When replacing amino acids, for example, in the sequence mediating resistance in accordance with SEQ ID NO: 3, it is recommended to replace amino acids in the following groups:

a) glycine, alanine, valine, leucine, isoleucine,

b) series, cysteine, selenocysteine, threonine, methionine,

c) phenylalanine, tyrosine, tryptophan,

d) histidine, lysine, arginine,

e) aspartate, glutamate, asparagine, glutamine.

The present invention also relates to the use in a plant of an allele of an identified gene conferring resistance to Cercospora in genetic or molecular association with other genetic elements that may confer beneficial agronomic properties. Thus, the economic value of cultivated plants can be markedly increased due to the fact that, for example, the yield is increased compared to plants having the same genetics, but not endowed with the nucleic acid of the present invention. Additionally, new planting areas may be opened up for the plant that were previously unavailable for cultivation of that plant due to biotic factors such as heavy pathogen pressure. In particular, the present invention relates to the use of an allele of the identified gene that confers resistance to Cercospora in methods of controlling infestation by the pathogen Cercospora beticola in agricultural or

- 28 045304 horticultural cultivation of plants of the genus Beta, covering, for example, the identification and selection of plants of the genus Beta using one of the methods described above, and/or the cultivation of plants so selected, or their descendants. Thus, the present invention includes a method for cultivating Beta vulgaris plants, including, in a first step, offering Cercospora-resistant Beta vulgaris plants of the present invention, or producing Beta vulgaris plants using the production method of the present invention, or identifying and selecting plants the species Beta vulgaris using the identification method of the present invention, which was described above; and including, in a second step, cultivating the plants from the first step, or placing seed material from the plants from the first step, or growing the plants from the first step. Thus, the cultivation method prevents Cercospora from infecting the cultivated plants. The cultivation method may be part of the sugar production method. The sugar production method includes the steps of a cultivation method and, additionally, as a penultimate step, collecting the cultivated plants and, as a last step, extracting sugar from the above-mentioned plants.

The cultivation method may also be part of the sugar production method. The method for producing seed material includes the steps of a cultivation method and, additionally, as a penultimate step, vernalization of cultivated plants and, as a last step, extraction of seeds from the above-mentioned plants.

The extracted seeds can optionally be pelleted to obtain pelleted seed material of a plant of the species Beta vulgaris. In this case, this is a method of producing pelleted seed material.

Moreover, a method for producing seed material can be developed as a method for producing seed material resistant to Cercospora. A method for producing Cercospora-resistant seed material includes the steps of the above-described method for producing seed material, and further, as a last step, verifying the nucleic acid of the present invention in accordance with the method described herein in at least one of the extracted seeds, in a preferred embodiment of the present invention in at least 0.1% or at least 1% of the extracted seeds. In a particularly preferred embodiment of the present invention, the verification is carried out in such a way that the seeds remain viable. This means that extracting DNA from seeds necessary for verification does not neutralize seed germination. In this case, the nucleic acid verification of the present invention could be carried out covering a particularly large proportion of all seeds recovered. For example, verification may be carried out on at least 2%, in a preferred embodiment of the present invention at least 3%, in a particularly preferred embodiment of the present invention at least 4% of all seeds recovered.

The plants of the present invention, their cells or seeds, or the seed material of the present invention may have or be endowed with additional, advantageous agronomic properties. One example is tolerance or resistance to herbicides such as glyphosate, glufosinate or ALS inhibitors. In a preferred embodiment of the present invention, tolerance to glyphosate or an ALS inhibitor herbicide. A specific embodiment of glyphosate resistance is disclosed in US Pat. No. 7,335,816 B2. Such glyphosate resistance is, for example, available from seed material deposited at NCIMB (National Collections of Industrial, Food and Marine Bacteria), Aberdeen (Scotland, UK) under accession number NCIMB 41158 or NCIMB 41159. Such seeds can be used to produce glyphosate-tolerant sugar beet plants. Glyphosate resistance can also be introduced into a plant of another species of the genus Beta through crossbreeding.

Thus, the present invention also covers plants, their cells or seeds or seed material, characterized in that they contain a nucleic acid according to the present invention, and further in that

a) a DNA fragment of genomic DNA of a plant, its segments or seeds can be amplified by polymerase chain reaction with a first primer having the nucleotide sequence SEQ ID NO: 81 and a second primer having the nucleotide sequence SEQ ID NO: 82, wherein , the DNA fragment is at least 95% identical, in the preferred embodiment of the present invention 100% identical, to the nucleotide sequence of SEQ ID NO: 83, and/or

b) a DNA fragment of genomic DNA of a plant, its segments or seeds can be amplified by polymerase chain reaction with a first primer having the nucleotide sequence SEQ ID NO: 84 and a second primer having the nucleotide sequence SEQ ID NO: 85, wherein, the DNA fragment is at least 95% identical, in the preferred embodiment of the present invention 100% identical, to the nucleotide sequence of SEQ ID NO: 86, and/or

c) a DNA fragment of the genomic DNA of a plant, its segments or seeds can be amplified by

- 29 045304 by polymerase chain reaction with a first primer that has the nucleotide sequence SEQ ID NO: 87, and with a second primer that has the nucleotide sequence SEQ ID NO: 88, and the DNA fragment is at least 95% identical , in a preferred embodiment of the present invention, 100% of the nucleotide sequence of SEQ ID NO: 89.

A specific embodiment of ALS inhibitor herbicide resistance is disclosed in WO2012/049268 A1. For example, such ALS inhibitor herbicide resistance can be obtained from the NCIMB repository, Aberdeen, UK, under NCIMB number 41705. Additionally, such ALS inhibitor resistance can be obtained through TILLING or site-directed mutagenesis, for example, through gene editing, e.g. through the use of CRISPR/Cas, CRISPR/Cpfl, TALENS or zinc finger nucleases. Thus, the present invention also covers plants, cells thereof or seeds or seed material, characterized in that they contain a nucleic acid of the present invention, and, in addition, they exhibit a mutation in the endogenous acetolactate synthase gene, wherein the acetolactate synthase gene encodes a protein acetolactate synthase, which, as a result of mutation at position 569, has an amino acid different from tryptophan. As a result of the mutation, the amino acid at position 569 in a preferred embodiment of the present invention is alanine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, valine or arginine. Position 569 in a preferred embodiment of the present invention is defined by position 569 of SEQ ID NO: 90. In addition, a preferred embodiment of the present invention is the specific sequence of the mutated acetolactate synthase gene SEQ ID NO: 91. The sequence of the mutated acetolactate synthase gene, or the sequence in accordance with SEQ ID NO: 91, does not occur in nature and cannot be isolated from natural materials. In addition, the mutation may be present either in a heterozygous form or in a homozygous form in plants, their cells or seeds, or in seed material. We recommend that the presence of the mutation be in a homozygous form, as this contributes to a more stable or more intense phenotypic expression of resistance.

Numerous additional herbicides and their usefulness are known to one skilled in the art from the prior art. He can refer to the prior art to obtain information about which genetic elements should be used and how to implement appropriate tolerance in plants.

Moreover, herbicide tolerance has the synergistic effect of reducing weed growth through the use of herbicides. This is an advantage in Cercospora control as the conidia (asexual spores) or pseudostroma (mycelium) of Cercospora beticola are known to survive on plant material for up to 2 years.

Another example of an agronomic benefit is additional resistance to pathogens, where pathogens can be, for example, insects, viruses, nematodes, bacteria or fungi. For example, large-scale plant protection against pathogens can be achieved through a combination of different types of pathogen resistance/tolerance, since genetic elements can exhibit additive effects with respect to each other. For example, numerous pathogen resistance genes are known to one skilled in the art as genetic elements. For example, US patent 20160152999A1 discloses the RZ gene, which is resistant to Rhizomania disease. This disease is caused by the pathogen Beet necrotic yellowing virus. Several types of disease resistance contained in one plant have a synergistic effect on each other. When a plant is infected with a pathogen for the first time, its immune system is usually weakened and the epidermis, being the outer barrier, is often damaged, making further spread of the infection more likely. An additional example of an advantageous agronomic trait is cold hardiness or frost resistance. Plants that exhibit this property can be sown as early as the beginning of the year, or they can be left in the field for a longer period, which can lead to, for example, increased yields. In this case, one skilled in the art can also refer to the prior art and find suitable genetic elements. Additional examples of beneficial agronomic traits include water efficiency, nitrogen efficiency, and yield. Genetic elements that can be used to impart such properties can be found in the prior art.

In addition, numerous modifications to the defense against pathogens are known to one skilled in the art. In addition to the frequently described R gene families, the Avr/R approach, Avr gene complementation (WO 2013/127379), R gene self-activation (WO 2006/128444) or the HIGS approach (inducible gene silencing) can be successfully used. host plant) (eg WO2013/050024). In particular, self-activation of the R gene may be relevant to the present invention. To do this, it is necessary to create a nucleic acid that encodes a self-activated resistance protein to generate pathogen resistance in plants. However, this nucleic acid has only a limited segment of the NBS-LRR class resistance gene, such as the wb-R gene, which extends downstream from the 5' end of the coding region of the NBS-LRR class resistance gene to the beginning of the codi

- 30 045304 formation of the NBS domain of the resistance gene of the NBS-LRR class.

Also included herein is a method that comprises the step of removing that region of the nucleic acid of the present invention that encodes the N-terminal region, and which begins with a p-loop in the NBS domain and extends up to the end of the N-terminal region.

Resistance proteins that are encoded by such truncated nucleic acids are typically self-activating because these resistance proteins trigger an immune response in the plant, even in the absence of an associated pathogen, and thus enhance the plant's basal immunity. In addition, the present invention covers such a truncated nucleic acid of the present invention and the polypeptide encoded therewith.

In addition, the present invention also includes the use of an allele of the Cercospora resistance gene identified as described above in combination with one of the previous modifications or with a genetic element described above that can impart at least one advantageous agronomic property to the plant.

In addition to the fact that the present invention relates to the plant of the present invention, the present invention also relates to the seeds or progeny, or organ, part of a plant, tissue or cell thereof, which are used in the production of products that are usually made from environmentally friendly raw materials such as as food and animal feed, in the preferred embodiment of the present invention - sugar or syrup (molasses), while molasses is also used for industrial applications, for example, for the production of alcohol or as a growing medium for the production of biotechnological products, for the production of materials or substances for the chemical industry, such as refined chemicals, pharmaceuticals or their precursors, diagnostics, cosmetics, bioethanol or biogas. An example of the use of sugar beet as a biogenic raw material in installations for producing biogas is described in application DE 10 2012 022 178 A1; see, for example, paragraph 10.

The examples presented below explain the invention, but do not limit the subject matter of the invention. Unless otherwise stated, standard molecular biology techniques were used; see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001, Fritsch et al., Cold Spring Harbor Laboratory Press : 1989; Mayer et al., Immunochemical Methods in Cellular and Molecular Biology, ed., Academic Press, London, 1987, and Weir et al., Handbook of Experimental Immunology, Volumes I-IV, Blackwell, ed., 1986.

A detailed explanation of some of the most important sequences of the present invention is given below:

SEQ ID NO: 1: Genomic DNA sequence of the Cercospora resistance gene from Beta vulgaris subsp. maritima.

SEQ ID NO: 2: cDNA sequence of the gene conferring resistance to Cercospora, as not found in nature.

SEQ ID NO: 3: The amino acid sequence of the Cercospora resistance-conferring protein as encoded by the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

SEQ ID NO: 4: Genomic DNA sequence of the sensitive Variant gene conferring resistance to Cercospora.

SEQ ID NO: 5: cDNA of a sensitive Variant of the gene conferring resistance to Cercospora

SEQ ID NO: 6: Amino acid sequence of the sensitive Variant of the gene conferring resistance to Cercospora.

SEQ ID NO: 7: Native promoter of the Cercospora resistance gene from Beta vulgaris subsp. maritima.

SEQ ID NO: 8: Native terminator of the Cercospora resistance gene from Beta vulgaris subsp. maritima.

SEQ ID NO: 53: Locus sequence from Beta vulgaris subsp. maritima containing a gene conferring resistance to Cercospora according to SEQ ID NO: 1.

Examples

Example 1: Introduction of a resistance-conferring gene via CRISPR-mediated homologous recombination into the plant Beta vulgaris subsp. vulgaris

Design and selection of crRNAs:

Suitable crRNAs for Cpfl-mediated double-strand break induction were designed using CRISPR RGEN tools (J. Park, S. Bay, and J.-S Kim. Cas-Designer: A web tool for selecting target sites of the CRISPR-Cas9 system. Bioinformatics 31, 4014 -4016 (2015); Bae S, Park J and Kim J-S. Cas-OFFinder: A fast and versatile algorithm that searches for potential off-target sites of RNA-guided Cas9 endonucleases. Bioinformatics 30, 1473-1475 (2014)). For this purpose, we searched for suitable protospacers in genomic DNA sequences of 500-1300 base pairs in length that flank the 5'-end and 3'-end of the Cercospora resistance gene from the plant

- 31 045304

Beta vulgaris subsp. maritima. To ensure the functionality of the endonuclease Cpfl from Lachnospiraceae bacterium ND2006 (Lb), protospacers of 24 nucleotides in length were selected, in which the genome binding sequence at the 5' end was flanked by the necessary prospacer adjacent motif (PAM) having the sequence 5' TTTV-3' (V=G or C, or A). Suitable protospacers were selected according to predefined instrument quality criteria and checked for potential off-target sites against the reference genome of B. vulgaris subsp. vulgaris. For continuous testing, only crRNAs that, in addition to the actual target sequence, have no more than 15 identical bases with a functional PAM were selected. Since the first 18 nucleotides of the protospacer are required for recognition and cutting of the target sequence, unwanted cutting in other sequences of the genome could be prevented in this way (Tang, X., L.G. Lowder, T. Zhang, A.A. Malzahn, X. Zheng, D. F. Wojtas, Z. Zhong, Y. Chen, Q. Ren, K. Li, E. R. Kirkland, Y. Zhang and Y. Qi (2017), CRISPR-Cpfl System for Efficient Genome Editing and transcriptional repression in plants. Nat Plants 3: 17018). Thus, four potential crRNAs in the 5'-flanking region (5'crRNA no. 1-4) and three crRNAs in the 3'-flanking region (3'crRNA no. 1-3) of the resistance gene can be identified (see Table A ).

Table A

Selected target sequences in the 5' and 3' flanking DNA sequences of the resistance gene in the plant B. vulgaris. RAM is underlined.

crRNA name Genome target sequence with 5' flanking PAM (underlined) Linking to +/- chains 5 crRNA #1 TTTATTTCGATTTCGATTCTTGGATTAT (SEQIDNO: 16) - 5'crRNA No. 2 TTTCAACCCAGTATCCTTATCCGTCACT (SEQUIDNO: 17) - 5'crRNA No. 3 TTTATTTAAACATGATACGTATCATATT (SEQUIDNO: 18) + 5'crRNA No. 4 TTTAAACATGATACGTATCATATTGAGT (SEQIDNO: 19) + Z'crRNA No. 1 TTTGTGGGTGGGTGGTTTTCACGTGTGT (SEQ ID NO: 20) - Z'crRNA No. 2 TTTCCCCTCCCTTTGCCGCTGCGAAGTT (SEQ ID NO: 21) - Z'crRNA No. 3 TTTCTTCTTCTTGCTTCCACCATAACAC (SEQ ID NO: 22) -

Cloning of Genetic Elements: To clone the cp fl expression cassette and the crRNA expression cassette, first the restriction enzyme recognition sequence BbsI, which prevents cloning, was removed from the target vector pZFNnptll by introducing a point mutation (T to G). Mutagenesis was performed using a mutagenesis kit according to the manufacturer's specifications using two mutagenesis primers (see Table B).

Table B

Mutagenesis primer used to introduce a point mutation (T to G, underlined) to remove the BbsI recognition sequence.

Name Sequence 5’^-3’ Mutagenesis primer 1 TCAGTGCAGCCGTCGTCTGAAAACGACA (SEQ ID NO: 23) Mutagenesis primer 2 TGTCGTTTTCAGACGACGGCTGCACTGA (SEQ ID NO: 24)

For expression of the Lbcpfl gene in B. vulgaris, a DNA sequence codon-optimized for A. thaliana with a 5' flanking PcUbi promoter sequence from Petroselinum crispum (SEQ ID NO: 79) and a 3' flanking terminator sequence 3A from Pea sp. , as a DNA fragment, was produced synthetically. Restriction interface (Hindlll), which has a relative

-32045304 cloning decision in the Lbcpfl coding sequence (CDS) [SEQ ID NO: 78], was removed by introducing a silent mutation (base substitution without modification of the amino acid sequence) to avoid inadvertent cutting in the coding region. Codon optimization was performed using the GeneArt algorithm from Invitrogene/ThermoScientific. To promote transport of Cpfl into the cell nucleus, the SV40 nuclear localization signal (NLS) coding sequence was integrated into the cpfl CDS at the 5' end, and the nucleoplasmin NLS was integrated at the 3' end. For ligation into the binary targeting vector pZFNnptII (Fig. 2), the expression cassette was flanked with two HindIII restriction interfaces and then ligated into pZFNnptII_LbCpfl. Successful insertion of the PcUbi::Cpfl::TPea expression cassette was verified by sequencing, with the binding regions of the primers used for sequencing located both in the flanking regions of the vector and within the expression cassette (see Table C).

Table C

Primer used to sequence the PcUbi::Cpfl::TPea expression cassette integrated into __________________________________pZFNnptII_________________________________________

Name Sequence 5’—>3’ pSeq_CRBM4_Fl SEQ ID NO: 25 pSeq_CRBM4_Rl SEQ ID NO: 26 pSeq_CRBM4_F2 SEQ ID NO: 27 pScq_CRBM4_R2 SEQ ID NO: 28 pSeq_CRBM4_F3 SEQ ID NO: 29 pSeq_CRBM4_R3 SEQ ID NO: 30 pSeq_CRBM4_F4 SEQ ID NO: 31 pSeq_CRBM4_R4 (SEQ ID NO: 32)

After transcription into a plant cell, crRNAs must be excised by two flanking ribozymes. To do this, the crRNA precursor was flanked by the coding sequences of the hammerhead ribozyme and the HDV ribozyme (Tang, X., L. G. Lowder, T. Zhang, A. A. Malzahn, X. Zheng, D. F. Wojtas, Z. Zhong, Y. Chen, K. Ren, K. Li, E. R. Kirkland, Y. Zhang and Y. Qi (2017), The CRISPR-Cpfl system for efficient genome editing and transcriptional repression in plants. Nat Plants 3: 17018).

To ideally ligate individual protospacers within the crRNA repeat coding sequence, two BbsI recognition sequences were integrated between the crRNA repeat and the HDV ribozyme, and the sticky ends used for cloning were adapted accordingly. To ensure equal expression strength of cpfl and crRNA, the crRNA ribozyme cassette was limited at the 5' end by the PcUbi promoter sequence and at the 3' end by the 3A termination sequence. For subsequent ligation into the pZFNnptII Cpfl target vector, the crRNA expression cassette was flanked by two PstI interfaces and sequenced as a synthetic DNA fragment. Protospacers were synthesized as complementary oligonucleotides and annealed according to a standard protocol. The 24 bp DNA fragment that was generated in this way was flanked by 4 nucleotide sticky ends that are relevant for ligation (see Table D).

- 33 045304

Table D

Sequence of oligonucleotides that were used to generate short protospacers, 24 base pairs in length. The 4-nucleotide overhangs used for ligation are the corresponding first four nucleotides of each sequence listed.

crRNA name Sequence 5’—>3’ 5 crRNA #1 SEQ ID NO: 33 SEQ ID NO: 34 5 crRNA #2 SEQ ID NO: 35 SEQ ID NO: 36 5 crRNA #3 SEQ ID NO: 37 SEQ ID NO: 38 5 crRNA #4 SEQ ID NO: 39 SEQ ID NO: 40 3 crRNA #1 SEQ ID NO: 41 SEQ ID NO: 42 3 crRNA #2 SEQ ID NO: 43 SEQ ID NO: 44 3 crRNA #3 SEQ ID NO: 45 SEQ ID NO: 46

The efficiency of four crRNAs was tested using Agrobacterium-mediated gene transfer in B. vulgaris leaves. Plasmid pZFNtDTnptII was cotransformed to test transformation efficiency. Transformation of the leaf explant occurred through vacuum infiltration according to a standard protocol. tDT fluorescence was checked after six days using fluorescence microscopy, and leaf explants with heterogeneous fluorescence were discarded. Ten days after infiltration, leaf explants were quickly frozen in liquid nitrogen, ground with a pestle, and genomic DNA was isolated using the CTAB method (Clark, Joseph D., Rapid, Fine-Scale Isolation of Cetyltrimethylammonium Bromide (CTAB)-Based Plasmid DNA for Plant DNA Isolation. Cold Spring Harbor Protocols 2009.3 (2009): pdb-prot5177). The efficiency of individual crRNAs was determined by an external service provider using the frequency of inserted edits (e.g., insertions, deletions, or base exchanges) versus unedited sequences in genomic DNA using NGS.

As a synthetic DNA construct, the most efficient crRNAs - 5'crRNA No. 3 and 3'crRNA No. 1 - with previously described ribozymes, promoter and termination sequences were arranged as expression cassettes with reverse orientation. The entire DNA construct was flanked with two PstI restriction interfaces for cloning into the pZFNnptII_LbCpfl target vector. After crRNA insertion occurred, the LbCpfl and crRNA expression cassettes were ligated from the pZFNnptII_LbCpfl_KpRNA vector into the pUbitDTnptII vector via HindIII.

As a repair template to be integrated into the B. vulgaris genome through homologous recombination, the resistance gene expression cassette was flanked by a binding sequence at the 5' end by 5'crRNA #3 and at the 3' end by 3'crRNA #3. 1. This allowed the resistance gene expression cassette to be excised from the plasmid by Cpfl. The whole DNA template was synthesized as an 87,326 bp synthetic DNA fragment (SEQ ID NO: 80) and used directly in the transformation vector backbone. The resistance gene plasmid and pUbitDTnpfllLbCpflKpRNA plasmid were introduced into B. vulgaris callus cultures using a gene gun.

Transformation efficiency was determined using tDT transient fluorescence one day after transformation using fluorescence microscopy. Callus cultures were grown in shoot induction medium without selection pressure (no kanamycin), and the regenerated shoots were then tested for site-directed integration of a resistance gene cassette conferring resistance. For this purpose, genomic DNA was isolated using CTAB. Integration of the resistance gene was amplified by PLR using primers pCRBM4_F1, according to SEQ ID NO: 47, and pCRBM4_R1, according to SEQ ID NO: 48 (see Table E), and the PCR products were subsequently sequenced using both primers. Shoots in which successful insertion

- 34 045304 expression cassettes could be verified in this way were identified in the following resistance gene integration site analyses. In order to verify the insertion within the desired target sequence in the genome, the flanking regions of the resistance gene expression cassette were amplified by PCR. In this case, primer binding occurred within the DNA sequence of the resistance gene; binding of the second primer occurred outside the 5' or 3' flanking homology region of the inserted expression cassette (see Table E). The amplified DNA sequences were sequenced using the same primers, and integration at the desired location was thus confirmed. To exclude binding of primers pCRBM4_F1 (SEQ ID NO: 47), pCRBM4_R1 (SEQ ID NO: 48), pCRBM4_R2 (SEQ ID NO: 50) and pCRBM4_F3 (SEQ ID NO: 51) in regions with similar genome sequences, all primer sequences were previously compared with the B. vulgaris genome. For primer pCRBM4_F3 (SEQ ID NO: 51), it was not possible to select the nucleotide sequence in such a way that binding to the wild type sequence could be excluded. Therefore, the 3' flanking region was amplified in all shoots that tested positive for the resistance gene, and the site-specific insertion was verified solely by subsequent sequencing. Thus, the generated PCR product differs from the wild-type sequence by 18 base pairs. To ensure complete sequencing of the amplified sequences, the PCR products were further sequenced using a third primer at the binding site in the amplified sequence (pCRBM4_S2, pCRBM4_S3; see Table E). To exclude nonspecific binding of primers pCRBM4_F1 (SEQ ID NO: 47), pCRBM4_R1 (SEQ ID NO: 48) and pCRBM4_R2 (SEQ ID NO: 50) in the wild-type genome, nucleotide sequences were compared with the internal reference genome of B. vulgaris. By PCR, the primers were further tested for binding against the genomic sequences of wild-type B. vulgaris plants.

To exclude integration of the resistance gene into other regions of the genome, targeted amplification of the target location (Target Locus Amplification, TLA) was performed.

Table E

Primer used to verify insertion of the resistance gene expression cassette at the desired ________________________________ integration site_________________________________

Name Sequence 5’ —>3’ PCR product size Binding pCRBM4_Fl pCRBM4_Rl pCRBM4_F2 pCRBM4_R2 pCRBM4_S2 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: 47 48 49 50 66 450 base pairs 1140 base pairs, within a resistance gene expression cassette within a resistance gene expression cassette top strand of 5'-flanking homology region within the promoter sequence of the resistance gene pCRBM4_F3 SEQ ID NO: 51 1280 within the termination sequence of the resistance gene pCRBM4_R3 SEQ ID NO: 52 bottom strand of 3'-flanking homology region pCRBM4_S3 SEQ ID NO: 67

In addition to the verification and successful insertion of the resistance gene expression cassette into the B. vulgaris genome, unwanted integration of plasmid DNA was also verified. For this purpose, genomic DNA, in which verification has already confirmed the successful insertion of the resistance gene at the desired target site, was checked for the presence of plasmid DNA through PNR. The sequence regions within the cpfl, crRNA ribozyme cassette and tDT were thus amplified using the primers listed in Table. F, and subsequently sequenced.

- 35 045304

Table F

Primers used to verify stably integrated plasmid-specific _____ sequences in the genome of regenerated shoots of B. vulgaris_____

Name Sequence 5’—>3’ Product size PCR Binding pSeq_LbCpfl_F4 SEQ ID NO: 68 214 Cpfl pSeq_LbCpfl_R3 SEQ ID NO: 69 pSeq_Pn6o3HM_F SEQ ID NO: 70 172 crRNA ribozyme cassette pSeq_PH6o3HM_R SEQ ID NO: 71 pSeqtDTF SEQ ID NO: 72 400 tDT (terminal deoxynucleotide transferase) pSeqtDTR SEQ ID NO: 73

Example 2: Introduction of a resistance-conferring gene as a transgene by gene transformation into the plant Beta vulgaris subsp. vulgaris

The transgenic approach to producing Cercospora-resistant plants has served not only as an alternative validation of the LRR gene as a resistance-conferring gene, but also as a means of producing transgenic resistance events that confer a new type of Cercospora resistance or improve existing types of Cercospora resistance. .

The binary vector pZFN-nptII-LRR was generated using the following standard cloning procedures: Within the T-DNA of this vector, the cDNA of the resistance gene according to SEQ ID NO: 2 was cloned along with its native promoter sequence. In addition, the T-DNA included the neomycin phosphotransferase II (nptII) gene, which confers resistance to a wide range of aminoglycoside antibiotics such as kanamycin or paromomycin. These types of antibiotic resistance have been used to select transgenic plant cells and tissues. The NOS promoter and terminator pAG7 flanked the nptII gene. In addition, the binary vector backbone contained a colE1 and pVS1 source for plasmid replication in Escherichia coli or Agrobacterium tumefaciens. The aadA gene confers streptomycin/spectinomycin resistance to select bacteria. Plasmid pZFN-nptII-LRR was transformed into Agrobacterium strain AGL-1 using a standard procedure.

Transformation of sugar beet occurred as described in Lindsay and Gallois (1990), Transformation of sugar beet (Beta vulgaris) by Agrobacterium tumefaciens. Journal of Experimental Botany 41.5, 529-536.). For this purpose, micropropagated shoots of genotype 04E05B1DH5, which did not carry the resistance gene of the present invention, were used as the starting material. Shoots were propagated in appropriate media as described in Lindsay and Gallois (1990). To induce as many meristems as possible, shoots were transferred to another medium (see Lindsay and Gallois (1990)) and incubated in the dark for several weeks at approximately 30°C. Agrobacterium strain AGL-1 with the vector pZFN-nptII-LRR (Fig. 3) was cultured in additional medium (see Lindsay and Gallois (1990)), additionally equipped with appropriate antibiotics for selection. Sections of meristem tissue from the shoot to be treated were incubated with Agrobacteria for several hours in supplementary medium (see Lindsay and Gallois (1990)). Plant and Agrobacterium explants were cocultured in the dark for at least 2 days in medium (see Lindsay and Gallois (1990)), and then the inoculated explants were incubated in the dark for approximately 2 weeks in supplementary medium (see Lindsay and Gallois (1990)). The explants were then further expanded in supplementary medium (see Lindsay and Gallois (1990)) and subcultured to allow selection of transgenic tissue. To complete the selection phase and reduce the level of chimera formation, green shoots were transferred to H medium and all were propagated for 2 weeks. Leaf material was then removed from green, growing shoots and examined by PCT for the presence of the transgene. Suitable shoots were rooted in medium I and subsequently transferred to the greenhouse to obtain seed material T1. In addition, leaf material obtained from these shoots was used to analyze the expression of the transformed resistance gene.

Expression level analysis

RNA was isolated from shoot leaves in vitro and used in qRT-PCR. qRT-PCR was performed as described in Veltmeyer et al. 2011 (see Background to the invention). Measured values were normalized to the reference gene PLT3075F09 (see Veltmeyer et al. 2011). Expression was determined using the following primer sequences:

- 36 045304

Subsequence Size [NO: nucleotides] Tm (melting temperature) [C°] Amplification product size [NO: nucleotides] SEQ ID NO: 92 21 59.8 170 SEQ ID NO: 93 21 58.9 170

Test for resistance of sugar beet after inoculation with Cercospora beticola in greenhouse conditions:

A pure culture of Cercospora beticola with known high virulence was propagated on vegetable juice agar in Petri dishes (9 cm in diameter) at 20°C under near-ultraviolet (NUV) conditions. After 14 days, the agar surface on which the mold was grown was poured at the rate of 10 ml of sterile water per Petri dish, and conidial and mycelial fragments were carefully scraped off using the subject's vehicle. To inoculate the plants, an inoculum was used at a density of 20,000 conidial/mycelium fragments per ml, plus 0.1% TWEEN 20. At the time of inoculation, the plants had been cultivated for 8-9 weeks under greenhouse conditions. The upper side and underside of the leaves were treated with inoculum. The plants were then incubated for 5-7 days at 25°C, 18h/6h light/dark and approximately 100% humidity. The first symptoms of Cercospora on sugar beet leaves appeared after 12-14 hours. Symptoms of individual plants were assessed regularly using an assessment based on the rating points given in Table. 1 A. The results are shown below.

Table G

Results of transgene verification of the function of the resistance gene of the present invention in transformed plants

Subject group Number of individuals Average rating score Function Expression level of the resistance gene of the present invention 8 dpi 11 dpi 13 dpi 15 dpi 1 57 1.60 3.82 5.24 6.46 negative control 0.0 2 38 1.28 3.07 4.42 6.04 validation against tpansgenes 4.6 3 60 1.26 2.83 4.38 6.20 validation against transgenes 12.5 4 45 1.50 3.40 4.62 6.18 no validation of expression in vitro 0.0 uh 60 1.44 3.62 5.29 6.38 validation against transgenes 2.6 6 57 1.68 3.69 5.30 6.52 validation against transgenes 3.3 7 66 1.58 3.84 5.43 6.57 validation against tpansgenes 2.9 8 60 1.31 2.81 4.19 5.48 validation against tpansgenes 11.3 9 72 1.25 3.07 4.61 5.97 validation against transgenes 26.8 10 60 1.44 3.26 4.77 6.00 validation against transgenes 10.7 eleven 57 1.60 3.83 5.48 6.64 validation against tpansgenes 4.4 12 72 1.34 2.62 3.75 5.19 plant that is a source of resistance undefined final average 58.66 1.44 3.32 4.8 6.13 Banner eLSD - 0.17 0.47 0.48 0.4

LSD=minimum significant difference;

dpi=number of days since infection.

Results of validation against resistance gene transgenes of the present invention (see Table G).

Subject Group 1 represents the negative control. The genotype is the same as in groups of subjects 2-11, but no transformation occurred. Thus, no expression could be recognized. Subject Group 4 was transformed, but no expression could be recognized. Subject groups 2, 3 and 5-11 represent transformants that carry the resistance gene of the present invention only due to transformation. Group of subjects 12 pre

- 37 045304 provides a crossing line containing the resistance gene of the present invention in a non-transgenic version. Rating scores of all lines were established after inoculation of plant material with Cercospora beticola as described above. Group 12 of subjects demonstrates the highest stability, as evidenced by the final value of 5.19.

The transgenic lines showed a rating score according to the following table: Table H

group 4). Below are rating scores only for those transgenic lines that demonstrated an expression level of at least 10 (groups 3, 8, 9, 10; see Table G). In this case, the final rating score is 5.91. This is significantly more robust than Negative Control Group 1, which had a rating score of only 6.46 (LSD=0.4; see Table G). The best transgenic group of subjects (group 8) demonstrates even better resistance, with a rating score of 5.48 (see Table G).

It is worth noting that the level of expression of transgenic insertions can be influenced by the integration locus. Since the expression level was measured in vitro, the actual expression level under infection conditions could be higher - especially in cases where the resistance gene is under the control of a pathogen-inducible promoter.

Statistical evaluation of transgene validation results

Table I ___________Statistical clustering___________

Group of subjects Cluster 8 dpi Cluster 11 dpi Cluster 13 dpi Cluster 15 dpi 1 ab A a ab 2 e de be CD 3 e ef c bed 4 bc bed be bed 5 CD abc a abc 6 A ab a ab 7 ab a a a 8 de ef c e 9 e de be d 10 CD CD b d eleven ab a a a 12 de f d e

In table I shows the statistical assessment of the rating points contained in table. G. Each letter symbolizes assignment to a statistical group. For example, it is clear that after the final assessment (15 dpi), subject group 8 (transgene verification) is in the same cluster as subject group 12 (source of resistance), but in a different cluster from the cluster of test group

-

Claims (27)

1 (negative control). In accordance with this, group of subjects 8 is significantly different from group of subjects 1, but not significantly different from group of subjects 12. Additionally, a box plot analysis was performed. An illustration of box plots is shown in FIG. 4-7. CLAIM 1. A nucleic acid molecule encoding a polypeptide that is capable of conferring resistance to Cercospora beticola to a plant in which the polypeptide is expressed, characterized in that the nucleic acid molecule contains a nucleotide sequence that is selected from (a) a nucleotide sequence encoding a polypeptide having an amino acid sequence in according to SEQ ID NO: 3; (b) a nucleotide sequence containing a DNA sequence in accordance with SEQ ID NO: 2; (c) a nucleotide sequence containing a DNA sequence in accordance with SEQ ID NO: 1 or SEQ ID NO: 53; (f) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 90% identical to the amino acid sequence according to SEQ ID NO: 3. (g) a nucleotide sequence that is at least 90% identical to the DNA sequence according to SEQ ID NO: 1 or SEQ ID NO: 2; the plant belongs to the subspecies Beta vulgaris subsp. vulgaris. 2. A polypeptide encoded by a nucleic acid molecule according to claim 1. 3. A vector or expression cassette containing a nucleic acid molecule according to claim 1. 4. A cell containing a nucleic acid molecule according to claim 1 or a polypeptide according to claim 2. 5. A plant or part thereof resistant to Cercospora beticola, characterized in that the plant or part thereof contains a nucleic acid molecule according to claim 1, wherein the plant containing the nucleic acid molecule belongs to the subspecies Beta vulgaris subsp. vulgaris. 6. Plant seed according to claim 5, characterized in that the seed contains a nucleic acid molecule according to claim 1. 7. A plant descendant according to claim 5, characterized in that the descendant contains a nucleic acid molecule according to claim 1. 8. Seed that has undergone technical treatment according to claim 6, characterized in that the technical treatment is selected from the group consisting of: (a) polishing, (b) etching, panning, (c) inlaying, (d) staining. 9. A method for increasing the resistance of plants of the subspecies Beta vulgaris subsp. vulgaris to Cercospora beticola, including the following steps: (i) integration of the nucleic acid molecule according to claim 1 through homologously directed repair or homologous recombination; or (ii) increasing the expression of the nucleic acid molecule according to claim 1 in the plant; or (iii) increasing the activity and/or stability of the polypeptide according to claim 2 by modifying the nucleotide sequence of the nucleic acid molecule according to claim 1; or (iv) transforming a plant cell with a nucleic acid molecule according to claim 1, or a vector or expression cassette according to claim 3, and regenerating a transgenic plant from the transformed plant cell. 10. The method for increasing resistance according to claim 9, which includes step (i) integration of the nucleic acid molecule according to claim 1 through homologously directed repair or homologous recombination stimulated by site-directed nuclease into the genome of at least one cell of a plant of the subspecies Beta vulgaris subsp. vulgaris. 11. The method for increasing resistance according to claim 10, which in step (i) includes regenerating the plant from the plant cell. 12. The method for increasing resistance according to claim 9, which includes step (ii) increasing the expression of the nucleic acid molecule according to claim 1 in the plant, by modifying the native promoter in accordance with SEQ ID NO: 7 or by fusing the nucleic acid molecule with a heterologous promoter, which demonstrates higher activity compared to the native promoter - in particular, after infection with Cercospora beticola. 13. The method for increasing resistance according to claim 12, which includes step (ii) increasing the expression of the nucleic acid molecule according to claim 1 in the plant, by modifying the native promoter in accordance with SEQ ID NO: 7 or by fusion of the nucleic acid molecule - 39 045304 leic acid with a heterologous promoter, which shows higher activity compared to the native promoter after infection with Cercospora beticola. 14. A method for producing a plant resistant to Cercospora beticola according to claim 5, including the following steps: (Ia) transforming a plant cell with a nucleic acid molecule according to claim 1, or a vector or expression cassette according to claim 3; and (Ib) regenerating the transgenic plant from the transformed plant cell; or (IIa) introducing a site-directed nuclease and a repair matrix into a cell of a plant of the genus Beta vulgaris, characterized in that the site-directed nuclease is capable of generating at least one double-stranded DNA break in the genome of the cell, and the repair matrix contains a nucleic acid molecule according to claim. 1; (IIb) culturing the cell from step (IIa) under conditions allowing homologously directed repair or homologous recombination, wherein the nucleic acid molecule is integrated from the repair matrix into the plant genome; and (IIc) regenerating the plant from the cell modified in step (b). 15. The method according to claim 14, characterized in that at least one double-strand break occurs in a sensitive allelic variant of the nucleic acid molecule according to claim 1, or in that at least one double-strand break occurs at a position spanning no more than 10,000 pairs bases upstream or downstream of the sensitive allelic variant, wherein the allelic variant encodes a polypeptide that does not confer resistance to Cercospora beticola. 16. The method according to claim 15, characterized in that the sensitive allelic variant contains a nucleotide sequence selected from (a) a nucleotide sequence encoding a polypeptide containing an amino acid sequence in accordance with SEQ ID NO: 6, (b) a nucleotide sequence containing the sequence in accordance with SEQ ID NO: 5, (c) a nucleotide sequence containing a sequence in accordance with SEQ ID NO: 4, (f) a nucleotide sequence encoding a polypeptide containing an amino acid sequence that is at least 70% identical to the amino acid sequence in according to SEQ ID NO: 6, or (g) a nucleotide sequence that is at least 70% identical to the sequence according to SEQ ID NO: 4 or SEQ ID NO: 5. 17. Method for identifying plants of the subspecies Beta vulgaris subsp. vulgaris resistant to Cercospora beticola, characterized in that the method includes at least step (i) or (ii): (i) determining the presence and/or expression of a nucleic acid molecule according to claim 1, or the presence of a polypeptide according to claim 2, in a plant or part of a plant; and/or (ii) identifying at least one marker locus that: (a) contains a marker having the sequence of SEQ ID NO: 65 and a marker having the sequence of SEQ ID NO: 63, or (b) contains a sequence in accordance with SEQ ID NO: 74 or SEQ ID NO: 75 in nucleotide sequence of a nucleic acid molecule according to claim 1. 18. The identification method according to claim 17, which includes selecting a plant. 19. The method according to claims 17 and 18, which includes step (ii) identifying at least one marker locus that: (a) contains a marker having the sequence of SEQ ID NO: 65 and a marker having the sequence of SEQ ID NO: 63, or (b) contains a sequence in accordance with SEQ ID NO: 74 or SEQ ID NO: 75 in the nucleotide sequence of a nucleic acid molecule according to claim 1 or in a cosegregation region, wherein the cosegregation region is a genomic region in Beta vulgaris subsp. vulgaris, which cosegregates with resistance to Cercospora beticola conferred by the polypeptide of claim 2 or with the nucleic acid molecule of claim 1. 20. The method according to claims 17-19, in which in step (ii) the cosegregating region a) contained and was flanked by a marker having the sequence SEQ ID NO: 65 and a marker having the sequence SEQ ID NO: 63, or b) contains an amino acid sequence in accordance with SEQ ID NO: 74 and/or 75. 21. The method according to claims 17 to 20, which comprises step (iii) selecting a plant resistant to Cercospora beticola. 22. Method for cultivating plants of the species Beta vulgaris subsp. vulgaris, comprising (i) offering plants according to claim 5, producing plants of the species Beta vulgaris subsp. vulgaris using the method according to one of claims 9 to 16, or identification and selection of plants of the subspecies Beta vulgaris subsp. vulgaris using the method according to claim 16, and - 40 045304 (ii) cultivation of plants from point (i) or their descendants, characterized in that the method prevents infection of the cultivated plants by Cercospora beticola. 23. An oligonucleotide consisting of at least 15, 16, 17, 18, 19 or 20 nucleotides in length, wherein the oligonucleotide specifically hybridizes with at least 90% sequence identity to one of the following: (a) a nucleotide sequence encoding a polypeptide having an amino acid sequence in accordance with SEQ ID NO: 3; (b) a nucleotide sequence that contains the DNA sequence according to SEQ ID NO: 2; (c) a nucleotide sequence comprising the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 53; (f) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 98% consistent with the amino acid sequence according to SEQ ID NO: 3; or (g) a nucleotide sequence that is at least 98% identical to the DNA sequence according to SEQ ID NO: 1 or SEQ ID NO: 2. 24. An oligonucleotide according to claim 23, consisting of at least 21, 22, 23, 24 or 25 nucleotides in length, wherein the oligonucleotide specifically hybridizes with at least 90% sequence identity to one of the following: (a) a nucleotide sequence encoding a polypeptide having an amino acid sequence in accordance with SEQ ID NO: 3; (b) a nucleotide sequence that contains the DNA sequence according to SEQ ID NO: 2; (c) a nucleotide sequence comprising the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 53; (f) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 98% consistent with the amino acid sequence according to SEQ ID NO: 3; or (g) a nucleotide sequence that is at least 98% identical to the DNA sequence according to SEQ ID NO: 1 or SEQ ID NO: 2. 25. An oligonucleotide according to claim 24, consisting of at least 30, 35, 40, 45 or 50 nucleotides in length, wherein the oligonucleotide specifically hybridizes with at least 90% sequence identity to one of the following: (a) a nucleotide sequence encoding a polypeptide having an amino acid sequence in accordance with SEQ ID NO: 3; (b) a nucleotide sequence that contains the DNA sequence according to SEQ ID NO: 2; (c) a nucleotide sequence comprising the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 53; (f) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 98% consistent with the amino acid sequence according to SEQ ID NO: 3; or (g) a nucleotide sequence that is at least 98% identical to the DNA sequence according to SEQ ID NO: 1 or SEQ ID NO: 2. 26. An oligonucleotide according to claim 25, consisting of at least 100, 200, 300 or 500 nucleotides in length, wherein the oligonucleotide specifically hybridizes with at least 90% sequence identity to one of the following: (a) a nucleotide sequence encoding a polypeptide having an amino acid sequence in accordance with SEQ ID NO: 3; (b) a nucleotide sequence that contains the DNA sequence according to SEQ ID NO: 2; (c) a nucleotide sequence comprising the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 53; (f) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 98% consistent with the amino acid sequence according to SEQ ID NO: 3; or (g) a nucleotide sequence that is at least 98% identical to the DNA sequence according to SEQ ID NO: 1 or SEQ ID NO: 2c. 27. A method for producing a plant or cell containing a mutated version of a nucleic acid molecule according to claim 1 and/or a mutated version of a promoter containing a nucleic acid sequence selected from (a) SEQ ID NO: 7, -