WO2022226617A1

WO2022226617A1 - Polynucleotide, pairs of primers, methods for detecting plant material, gene construct, kit for detecting presence in a sample of plant material, event ctc75064-3, insect-resistant plant, commodity product, method for producing an insect-resistant sugarcane plant and use of a plant, plant cell, part of a plant or seed

Info

Publication number: WO2022226617A1
Application number: PCT/BR2022/050142
Authority: WO
Inventors: Antonio Adalberto KAUPERT NETO; Ana Carolina VIEIRA ZAKIR PEREIRA; Lucas CUTRI; Agustina GENTILE; Maria Lorena SERENO; Wladecir SALLES DE OLIVEIRA; Adriana CHEAVEGATTI GIANOTTO; Karina YANAGUI DE ALMEIDA
Original assignee: Ctc - Centro De Tecnologia Canavieira S.A.
Priority date: 2021-04-27
Filing date: 2022-04-27
Publication date: 2022-11-03
Also published as: BR102021008065A2

Abstract

The present invention pertains to the field of biotechnology. More precisely, a gene construct and method are described for the production of a transgenic plant event, especially a sugarcane (Saccharum spp.) event, which is resistant to infestation by the pest Diatraea saccharalis, popularly known as the common borer, sugarcane borer or simply borer. The invention describes the event, methods for identifying the event, and also methods for detecting the insertions on the basis of the junction regions between the insert and the host genome and the flanking regions characterizing same.

Description

Descriptive Report of the Patent of Invention for "POLYNUCLEOTIDE, PAIRS OF INITIATORS, METHODS OF DETECTION OF PLANT MATERIAL, GENETIC CONSTRUCTION, KIT FOR DETECTION OF THE PRESENCE IN A SAMPLE OF PLANT MATERIAL, EVENT CTC75064-3, PLANT RESISTANT TO INSECTS, COMMODITY PRODUCT, METHOD FOR PRODUCING AN INSECT-RESISTANT SUGARCANE PLANT AND USE OF A PLANT, PLANT CELL, PLANT PART OR SEED".

Technical Field

[001] The present invention is related to the area of biotechnology. More precisely, a genetic construct and method for producing a transgenic plant event, especially a sugarcane event ( Saccharum spp.), which expresses the CrylAc toxin showing resistance to D/D pest infestation, is described. atraea saccharalis, popularly known as common borer, sugarcane borer or just borer. The invention describes methods for detecting the event and material derived from the event resistant to sugarcane borer infestation, thus presenting initiator polynucleotides, probes and the flanking regions identifying such event.

Description of the State of the Technique

[002] Sugarcane (Saccharum spp.) is a grass plant belonging to the botanical family Poaceae, originating in Southeast Asia, more precisely in the great central region of New Guinea and Indonesia. It is one of the most important plant species cultivated in tropical and subtropical regions, with an area greater than 23 million hectares distributed in 121 countries (FAO Statistical Yearbook 2012 p. 233).

[003] Sugarcane is a source of raw material for the production of sugar, wine, molasses, rum, cachaça (Brazil's national distillate). sil) and ethanol for fuel. The bagasse that is produced after crushing the sugarcane can be used for baling and supplying heat energy, used in the mill, and electricity, which is typically sold to the consumer's electrical grid, or as raw material. raw material for the production of second-generation ethanol (BR 11 2014 02385-1). In this way, the sugarcane agroindustry, responsible for generating millions of jobs in the area, is of great economic and social importance, generating foreign exchange through the commercialization of sugar and ethanol and the rational use of plant biomass.

[004] More recently, with the advent of global warming and the use of alternative sources to fossil fuels (biofuels), world interest in sugarcane has increased significantly. The use of ethanol derived from sugar cane as a source of renewable energy has been considered of extreme importance to reduce greenhouse gases and dependence on fossil fuels, having been considered one of the key pieces among the efforts for controlling global climate change (Savage, 2011).

[005] Due to the economic and social importance of sugarcane, there is a great effort in research with the objective of defining better agricultural practices for its cultivation and to improve the quality of the cultivated varieties. Efforts to improve the agronomic characteristics of sugarcane have focused on increasing the production and accumulation of sugars, increasing tolerance to biotic and abiotic stresses, resistance and tolerance to pests and pathogens, and the development of alternative technologies for the production of ethanol from lignocellulosic biomass (PI 0802153-8; PI 0904538-4; PI 1101295-1).

[006] The complexity of the polyploid and aneuploid genome of modern sugarcane varieties, added to their relatively restricted genetic base and low fertility, impose great difficulties and innumerable limitations in the selection of plants with the desirable agronomic characteristics by conventional breeding techniques (Souza et al. al, 2011; D'Hont ^& Glaszmann, 2005, Basel, v. 109, n. 1-3, p. 27-33; Cheavegatti-Gianotto et al., 2011), demanding large investments, intensive labor and deadlines too long to be considered reasonable considering the context and current demand of the global market.

[007] The increase in sugarcane production observed in the last 20 years is the result not only of the increase in sugarcane productivity, but also of the diversification of cultivated varieties, which allowed the expansion of the sugarcane cultivated area to other geographic regions. This geographic expansion demands the development of varieties adapted to different soil and climatic conditions, ensuring the sustainability of the sugarcane market through the continuous supply of new germplasm, better adapted to local conditions and capable of controlling diseases and pests.

[008] Conventional breeding is important for the continuous supply of varieties, but not enough to meet the current market since part of the desirable and necessary characteristics for modern crops cannot be found in the genetic background of the species, being the development of techniques for the introduction of exogenous genes is fundamental. Due to the limitations of conventional breeding methods and the growing need to quickly and efficiently incorporate desirable traits into different varieties, the use of genetic engineering techniques (biotechnology) in cane genetic improvement programs of sugar gained prominence, especially due to the commercial process of incorporating desirable agronomic traits through genetic engineering into other plant species (soybean, corn, canola, sugar beet and cotton, for example).

[009] Plant genetic engineering involves the transfer of genes of interest into plant cells (genetic transformation) in such a way that fertile and agronomically superior progeny maintain and stably express the gene responsible for the desired trait.

[0010] Despite the proven possibility of genetic alteration (incorporation of desirable characteristics) of sugarcane through genetic engineering [virus resistance (Guo et al., 2015; Zhu et al., 2011), insects (Kalunke, Kolge, Babu, & Prasad, 2009; Weng et al, 2011), herbicides (Enriquez-Obregon, Vazquez-Padron, Prieto-Samsonov, De la Riva, & Selman-Housein, 1998; van der Vyver, Con- radie, Kossmann, & Lloyd, 2013), drought tolerance (Molinari et al, 2007; Reis et al, 2014), salinity (Kumar, Uzma, Khan, Abbas, & Ali, 2014) and aluminum toxicity (Ribeiro, 2016). ), increased production and sugar accumulation (Bewg, Poovaiah, Lan, Ralph, & Coleman, 2016; Mudge et al, 2013)], this approach is also limited by the intrinsic characteristics of sugarcane, which has genotype-dependent responses to the application of tissue culture techniques, low rate of induction and regeneration of embryogenic callus, in addition to the impossibility of using the zygotic embryo as te target in genetic transformation, unlike corn, rice, wheat and other commercial cereals [(Anderson & Birch, 2012; Basnayake, Moyle, & Birch, 2011 ; Molinari et al, 2007)]. It is common to obtain a low rate of transformation efficiency, with high variability between genotypes being observed, and there are still numerous challenges to be overcome in order to incorporate desirable agronomic traits through genetic engineering in sugarcane. [0011] Sugarcane is considered a recalcitrant species for genetic transformation and, although several genetic engineering approaches have been evaluated for this species, there are still no standard protocols that guarantee the production of transgenic events. (Smith et al. 1992; Rathius & Birch. 1992.; Chen et al. 1987; Arencibia. 1998; Manickavasagam et al. 2004.; Elliott et al. 1998). [0012] Added to the inherent limitations of the species for the application of existing techniques of genetic engineering due to the complexity of the sugarcane genome (high degree of ploidy, allied to the presence of aneuploidy), there are no programs of introgression of traits of agronomic interest in sugarcane cultivars through backcrosses (reconstitution of a specific genotype), as is commonly performed in other crops of commercial interest. Thus, for the "introduction" of the same trait in more than one germplasm, enabling gains in productivity in different growing regions, it is necessary to carry out a new genetic transformation, incurring the same costs and risks associated with the first one. event obtained for that feature. Even today there is very little predictability of success for the introduction of the same trait in different varieties of sugarcane, being an extremely genotype-dependent process, which makes the construction of a portfolio of genetically modified products for this species challenging.

[0013] The genotypic complexity of sugarcane also significantly impacts the characterization of the events generated in order to guarantee the necessary characteristics for its commercialization. The unequivocal identification of transgenic events is essential to ensure their traceability and monitoring, being a regulatory requirement for their commercialization. The high polyploidy of the sugarcane genome and the high number of repeated regions, as- Due to the little information available about its organization and structure, they constitute challenges for the characterization of the transgenic events generated.

[0014] There are several technical challenges to be overcome in the field of genetic improvement of sugarcane to increase the predictability of the expected results, even when widely known conventional and/or molecular/genetic techniques are applied. Even so, there is no doubt about the urgency of obtaining improved varieties that present characteristics that significantly impact the crop's productivity and, therefore, its market.

[0015] Historically, agricultural pests are one of the main factors that cause losses in agriculture. In Brazil, the main pest of sugarcane is the species Diatraea saccharalis Fabricius, 1794 (Lepidoptera: Crambidae), popularly known as common borer, sugarcane borer or just borer. This is found in practically the entire cultivated area of the crop, whose area is approximately 10 million hectares in the current 2019/20 crop (CONAB, 2019).

[0016] After mating, the female sugarcane borer lays 200 to 400 eggs, on both sides and also in the sheaths of green leaves. After the eggs hatch, the neonate larvae feed on the leaf parenchyma, migrating to the sheath region in search of shelter. They remain in this region for 7 to 10 days, feeding by scraping the leaf sheath or the bark of young internodes. After an ecdysis, the caterpillars pierce the stem bark, penetrating its interior. The insect opens galleries inside the culms, usually in an upward direction, as it feeds. Inside the stalk, the caterpillar passes through approximately six ecdyses before becoming a winged adult (DINARDO-MIRANDA, 2014). This is the development phase ment in which the insect causes economic damage to the crop (Figure 1).

[0017] The attack of the sugarcane borer also causes serious secondary damage to the quality of the raw material used for the production of sugar and alcohol because the drilling of the sugarcane stalk by the borer creates conditions for the entry of fungi and opportunistic bacteria, especially Fusarium moniliforme and Colletotrichum falcatum, causing red rot. The borer/red rot complex causes physiological, microbiological and technological deterioration of sugarcane. Bacteria associated with raw material with red rot produce undesirable fermentations, resulting in products foreign to the alcoholic fermentation of industrial processing. In addition, these bacteria also produce organic acids and gums (dextrans) from the sugars contained in the must, which negatively affect the viability of yeast cells, requiring their replacement in the fermentation vats (PRECETTI and TERÁN, 1983; PRECETTI et al. ai, 1988; BOTELHO and MACEDO, 2002). Another problem arising from the presence of bacteria in the fermentation vats is the possibility of flocculation of the yeast. In this case, the contaminating bacteria form a mucilage that aggregates the yeast cells, causing their flocculation. In addition to the loss of yeast and sugar productivity, plants attacked by borer/red rot also have high levels of phenolic compounds (METCALF and LUCKMANN, 1994; PRICE, 1997).

[0018] Using average values of agricultural losses and in the industrial process of sugar and ethanol production caused by the borer, and an Infestation Intensity Index of 4%, very common in Brazilian sugarcane plantations, added to the control costs used, estimates It is known that this plague causes economic losses of more than R$ 5 billion per year to the Brazilian sugar-energy sector. [0019] The sugarcane borer is a pest difficult to control by chemical insecticides, due to the feeding behavior of the larva in the stem, preventing the effective contact of the insecticide with the insect. As an alternative to chemical insecticides, insecticidal proteins, identified mainly from the bacterium Bacillus thuringiensis (Bt), have been used with great effectiveness to control agricultural pests, among them Diatraea sp. Among the insecticidal proteins derived from Bt strains, the crystal proteins Cry stand out for their specific toxicity to the larvae of species of Lepidoptera, Diptera and Coleoptera common as agricultural pests. These proteins, produced as protoxins (65-149 KDa), are solubilized and activated in the intestine of susceptible insects by proteolysis and bind to the membrane of intestinal cells, inducing osmotic lysis of the epithelium, which causes the death of the insect.

[0020] Cry proteins are classified into several groups according to the homology of their sequences, among them, the group of proteins classified as Cry1 has high specificity against lepidopteran insects, being an excellent candidate for genetic manipulation of sugarcane germplasm. -sugar for the production of varieties resistant to the sugarcane borer. The heterologous expression of Cry1 proteins in sugarcane varieties, despite being challenging, has great potential for controlling the sugarcane borer, reducing economic losses in the sugar-alcohol sector, as well as the release of chemical insecticides in the sugarcane industry. environment.

[0021] There remains, therefore, the need to develop strategies to mitigate the damage caused to sugarcane crops by pest infestation, mainly by infestation by the sugarcane borer pest. By offering sugarcane producers varieties with high production potential for different soil and climatic environments, combined with a characteristic of resistance to the borer, the agricultural biotechnology makes an important contribution to the sugar-energy sector and sugarcane growers.

[0022] The genetically modified sugarcane event CTC75064-3 presented by the present invention aims to provide Brazilian sugarcane producers with a cultivar that has the genetic background of the cultivar RB 867515 (Certificate of protection of cultivar Ne 271) and is resistant to sugar cane borers. In the 2018/2109 harvest, the RB 867515 variety was planted on approximately 1,730,000 hectares in the Center-West region of Brazil. The cultivation of this variety in the northeast region of Brazil was approximately 57 thousand hectares. Considering the total area of sugarcane cultivated (CONAB, 2019), this variety has a market share in Brazil of around 21%.

Objectives of the invention

[0023] It is a first objective to provide polynucleotides that unequivocally identify the event CTC75064-3.

[0024] It is a second objective to describe pairs of primers and probes capable of identifying the polynucleotides that characterize the CTC75064-3 event.

[0025] It is a third objective to provide methods for detecting plant material derived from a genetically modified sugarcane plant from event CTC75064-3.

[0026] As a fourth objective, the present invention describes a kit for detecting the presence of event CTC75064-3 in a sample of plant material.

[0027] As a fifth objective of the present invention, a genetic construct capable of conferring resistance to insect infestation, particularly by the pest Diatraea saccharalis, to a sugarcane plant (Saccharum spp.) is described.

[0028] It is a sixth object of the invention to provide a sugarcane genetically modified sugar, a plant part, a plant cell, a plant tissue or a seed comprising the genetic construct of interest located at defined sites in the genome of the transformed sugarcane plant, characterized by specific flanking sequences .

[0029] The seventh objective of the present invention is to provide a commodity product.

[0030] An eighth objective of the present invention is through an insect resistant plant.

[0031] Finally, as a ninth and tenth object, the invention further provides as a method of producing and cultivating an insect resistant sugarcane plant and/or using such a plant, plant cell, plant part or seed. Additionally, it provides a method for growing a sugarcane plant in an insect infestation environment, a method for controlling insects and a method for increasing sugarcane production in the field.

Brief Description of the Invention

[0032] The first objective is achieved by using polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 22.

[0033] The second object of the invention is achieved by means of primer pairs wherein the sense primer having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with SEQ ID NO: 6 and the antisense primer having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 7 and/or the sense primer having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 8 and the antisense primer can be having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 9.

[0034] The third objective is achieved by a method of detection of plant material derived from a genetically modified sugarcane plant of event CTC75064-3 characterized by comprising the steps of: a) obtaining a sample for analysis; b) extracting DNA from the sample; c) providing primer pairs comprising at least one sense and one antisense primer; d) amplification of the region that lies between the sites where the primers bind; and e) detecting the presence of amplification product.

[0035] Still to achieve the third objective, the primer pairs of step c) are designed to bind to a polynucleotide comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 29, wherein at least one pair of primers comprises contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31.

[0036] Continuing to achieve the third objective, the present invention describes a method of detecting plant material derived from a genetically modified sugarcane plant of event CTC75064-3 characterized by comprising the steps of: a) obtaining a sample for analysis; b) extracting DNA or RNA from the sample; c) providing a probe designed or a combination of probes designed to bind at least one polynucleotide comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 29, SEQ ID NO 30 , SEQ ID NO 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38 and SEQ ID NO 39; d) hybridizing said probe with the material extracted from the sample of step (II), and ee) detecting the hybridized probe.

[0037] The fourth objective of the invention is evidenced by means of a kit for detecting the presence in a sample of plant material derived from the event CTC75064-3 characterized by comprising a means for detecting the presence in a sample of a polynucleotide that comprises at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33 and/or a Cry protein. [0038] The fifth objective is achieved through genetic construction, characterized by the fact that it comprises at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO 2 and SEQ ID NO 14.

[0039] The sixth objective is achieved through event CTC75064-3, which is characterized by the fact that it is a variety of sugarcane (Saccharum spp.) and comprises at least 14 contiguous nucleotides of the sequences selected from the group consisting of SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 3 and SEQ ID NO 4. Additionally, event CTC75064-3 is characterized by the fact that it is a variety of sugarcane ( Saccharum spp.) and comprise at least one sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 22.

[0040] Additionally, the invention also provides a plant, plant part, plant cell, plant tissue or sugarcane seed. genetically modified sugar ( Saccharum spp.) comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 3 and SEQ ID NO 4. a genetically modified plant part, plant cell, plant tissue or seed of sugarcane ( Saccharum spp.) characterized in that it comprises at least one sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 22;

[0041] The commodity product of the seventh object of the invention is achieved from the genetically modified sugarcane of the present invention.

[0042] The eighth object of the present invention provides a method for producing an insect resistant sugarcane plant comprising SEQ ID NO: 20 and SEQ ID NO: 21. The invention also provides a method for producing a insect resistant sugarcane plant comprising crossing a first sugarcane plant with a second sugarcane plant comprising event CTC75064-3.

[0043] The present invention further provides a method for producing an insect resistant plant characterized in that it comprises introducing a genetic modification into a sugarcane plant ( Saccharum spp) comprising SEQ ID NO 5 or SEQ ID NO 22, to produce a genetically modified sugarcane plant (Saccharum spp ) from event CTC75064-3. Additionally, the present invention provides a method for producing a genetically modified insect resistant sugar cane plant comprising inserting a T DNA fragment at a specific site in the genome comprised among sequences selected from the group consisting of SEQ ID NO 23 and SEQ ID NO 24 via homologous recombination. Preferably, said method is for producing a sugarcane plant of genetically modified insect resistant sugar from event CTC75064-3.

[0044] Finally, the tenth object of the invention describes the use of a plant, plant cell, plant part or seed characterized in that it comprises at least one sequence selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19 to regenerate a plant, plant or cultivate a field of plants, or produce a plant product. Preferably, the invention describes the use of a plant, plant cell, plant part or seed characterized by comprising event CTC75064-3 to regenerate a plant, plant or cultivate a field of plants, or produce a plant product. . Additionally, the present invention describes a method for growing a genetically modified sugarcane plant comprising growing a sugarcane plant comprising SEQ ID NO 2 under conditions comprising insect infestation. Additionally, the present invention provides a method for controlling insects comprising providing a genetically modified plant, tissue, plant part, cells or seeds, characterized by comprising SEQ ID NO 2, for feeding to the insect. . Additionally, the invention further provides a method for increasing the production of sugarcane in the field, characterized in that it comprises cultivating a genetically modified sugarcane plant characterized by comprising SEQ ID NO 2. Summary Description of the Figures

[0045] Figure 1 exemplifies the damage to sugarcane plants caused by Diatrea saccharalis (sugarcane borer).

[0046] Figure 2 exemplifies the red rot-borer complex caused by Diatrea saccharalis (sugarcane borer) infestation. [0047] Figure 3 represents the map of the T-DNA introduced in the event of the present invention. [0048] Figure 4 represents the plasmid used as a basis for construction of the plasmid used in the present invention.

[0049] Figure 5 represents the resulting plasmid, used to obtain the event of interest.

[0050] Figure 6 represents one of the amplification graphs of qPCR via Taqman® (relative fluorescence x cycle) for the event of interest.

[0051] Figure 7 represents the melting curves of qPCR via SYBR GREEN™ (relative fluorescence x temperature) for the event of interest. The arrows indicate the specific amplification peak of the event of interest as well as the baseline indicative of absence of amplification for the other events and negative controls. [0052] Figure 8 is the result of the comparison of means of CrylAc expression in leaves (Fresh Tissue) of event CTC75064-3 during the sugarcane cycle. Joint analysis for Barrinha, Piracicaba, Valparaiso (SP), Quirinópolis (-GO), Mandaguaçu (PR) and Juazeiro (BA). Bars followed by the same letter do not differ from each other by the t Test at the 5% probability level. Each bar represents the mean ± standard error, according to the results of the joint analysis.

[0053] Figure 9 is the result of the comparison of means of CrylAc expression in leaves (dry tissue) of event CTC75064-3 for the sugarcane cycle. Joint analysis for Barrinha, Piracicaba, Valparaiso (SP), Quirinópolis (GO), Mandaguaçu (PR) and Juazeiro (BA). Bars followed by the same letter do not differ from each other by the t Test at the 5% probability level. Each bar represents the mean ± standard error, according to the results of the conjoint analysis.

[0054] Figure 10 is the result of the comparison of means of CrylAc expression in leaf, stem and root of event CTC75064-3 (fresh tissue and dry tissue). Bars followed by the same letter do not differ from each other by the t Test at the 5% probability level. each bar represents the mean ± standard error.

[0055] Figure 11 is the result of the comparison of means of Nptll expression in leaves (fresh tissue) of event CTC75064-3 for the sugarcane cycle. Joint analysis for Barrinha, Piracicaba, Valparaiso (SP), Quirinópolis (GO), Mandaguaçu (PR) and Juazeiro (BA). Bars followed by the same letter do not differ from each other by the t Test at the 5% probability level. Each bar represents the mean ± standard error, according to the results of the joint analysis.

[0056] Figure 12 is the result of the comparison of means of the expression of Nptll in leaves (Dry tissue) of the event CTC75064-3 for the sugarcane cycle. Joint analysis for Barrinha, Piracicaba, Valparaiso (SP), Quirinópolis (-GO), Mandaguaçu (PR) and Juazeiro (BA). Bars followed by the same letter do not differ from each other by the t Test at the 5% probability level. Each bar represents the mean ± standard error, according to the results of the joint analysis.

[0057] Figure 13 is the result of the comparison of means of Nptll expression in stem, leaf and root of event CTC75064-3 (fresh tissue and dry tissue). Bars followed by the same letter do not differ from each other by the t test at the 5% probability level. Each bar represents the mean ± standard error.

[0058] Figure 14 is the result of the Western blot methodology to identify the CrylAc protein. M: Molecular weight marker (KDA). R1 to R4: biological repeats of event CTC75064-3. WT (Negative control): total protein extracted from the parental cultivar RB867515. CP (Positive Control): 1ng CrylAc protein; WT+CP: 1ng of purified CrylAc protein diluted in total proteins extracted from the parental cultivar. 0: Empty well.

[0059] Figure 15 is the result of the Western blot methodology to identify the Nptll protein. M: molecular weight marker (kDa). R1 and R2: biological repeats of event CTC75064-3. CP (control positive): 5 ng NptII protein; WT+CP: 5 ng of Nptll protein diluted in total proteins extracted from the parental cultivar. WT: total protein extracted from the parental cultivar.

[0060] Figure 16 represents A) infestation index (l.l.%), B) Relative length of damage in event CTC75064-3 and in controls (first cut plants). The letters represent the result of the analysis of variance by the T test and the bars refer to the standard error. [0061] Figure 17 represents the relative effectiveness of the borer control by the event CTC75-064-3 in 4 places (l.l% = infestation index). The bars refer to the standard error of the analysis.

[0062] Figure 18 demonstrates A: larval mortality in leaf disc assay with plant material from the insect resistant event (sugar cane borer) CTC75064-3 compared to the parental material (no genetic modification) CTC75-TC (cultivate RB867515); B: Relative effectiveness of sugarcane borer control by CTC75-064-3; C: Examples of larval sizes (larval development) after seven days of feeding in the leaf disc assay. On the left are examples of larvae that fed on plant material resistant to event CTC75064-3, and on the right are examples of larvae that fed on plant material of the parental cultivar (without genetic modification) CTC75-TC ( cultivar RB867515).

[0063] Figure 19 shows examples of expression cassettes for generating event CTC75064-3 through genomic editing. Cassette A comprises codon-optimized Cas9 for sugar cane with expression directed through the pZmUbi promoter and the T-35s terminator; Cassette B comprises crRNA for Cas9 with expression driven by the wheat U3 promoter and Cassette C comprises the HR template comprising the T-DNA region of event CTC75064-3 (SEQ ID NO 2) with homologous arms (flanking sequences). ) for site-specific integration.

[0064] Figure 20 represents an example of a genome editing construction comprising the cassettes “Cas 9” and “crRNA”.

[0065] Figure 21 demonstrates an example of a genome editing construct comprising the HR template CTC75064-3 comprising the T-DNA region of event CTC75064-3 (SEQ ID NO 2) with homologous arms (flanking sequences) for site-specific integration.

[0066] Figure 22 represents a genome-editing construct comprising all cassettes for generating event CTC75064-3: the cassette of Cas9 with codon-optimized sugar cane with expression directed through the pZmUbi promoter and the T-terminator. 35s; the crRNA cassette for Cas9 with expression driven by the wheat U3 promoter and the HR template cassette comprising the T-DNA region of event CTC75064-3 (SEQ ID NO 2) with homologous arms (flanking sequences) for site-specific integration.

[0067] Figure 23 A) presents a schematic representation of the Southern blot strategy using two restriction enzymes Hindlll and EcoRV to identify the T-DNA inserted in event CTC75064-3. Gray lines below the schematic representation of the T-DNA indicate the expected sizes of the generated T-DNA fragments from event CTC75064-3. B) is a schematic representation of the Southern blot strategy for detection of vector (backbone) fragments using the restriction enzyme Sph\.

[0068] Figure 24 shows Southern blot results using restriction enzymes Hindll (left) and EcoRV (right). Results for hybridization with the Cry probe that recognizes the crylAc gene. M: molecular weight marker; WT: negative control; 1C: positive control 1 copy. T0: plant cane (first cut). T1: punch 1 (second cut); T2: stump (third cut) 2; T3: clog 3 (fourth cut). [0069] Figure 25 shows Southern blot results using restriction enzymes EcoRV (left) and Hind\\\ (right). Results for the 35s probe that recognizes the 35s promoter. M: molecular weight marker; WT: negative control; 1C: positive control 1 copy. TO: plant cane (first cut). T1: stump 1 (second cut); T2: stump (third cut) 2; T3: clog 3 (fourth cut).

[0070] Figure 26 shows Southern blot results using the restriction enzymes Hind\\\ (left) and EcoRV (right). Results for the nptll probe that recognizes the nptll gene. M: molecular weight marker; WT: negative control; 1C: positive control 1 copy. T0: plant cane (first cut). T1: stump 1 (second cut); T2: stump (third cut) 2; T3: clog 3 (fourth cut).

[0071] Figure 27 A) represents Southern blot results using Sph\ restriction enzymes and vector (backbone) probes BB1 and BB3. M: molecular weight marker; WT: negative control; 1C: positive control 1 copy with pCTC146; 1C ^* : positive control 1 copy with pCTC302. BB1: positive control with backbone probe 1; BB2: positive control with backbone probe 2; BB3: positive control with backbone probe 3. Red lines indicate two repetitions of event CTC75064-3. Well (Lane) 1: other events. B) using SphI restriction enzymes and the BB2 vector (backbone) probe. M: molecular weight marker; WT: negative control; 1C: positive control 1 copy with pCTC146; 1C ^* : positive control 1 copy with pCTC302. BB1: positive control with backbone probe 1; BB2: positive control with the backbone probe 2; BB3: positive control with backbone probe 3. Red lines indicate two repeats of event CTC75064-3. Well (Lane) 1: other events.

[0072] Figure 28 demonstrates the confirmation of the integrity of the flanking regions of the T-DNA inserted in event CTC75064-3. (THE) Confirmation of the integrity of the left edge (5'). (B) Confirmation of the integrity of the right edge (3'). Event: DNA from event CTC75064-3; WT: parental CT 7515 DNA (culture RB 867515); C-: negative control.

Detailed Description of the Invention

[0073] Initially, an "event" is considered to be the genetically modified plant produced by any method of genetic modification and/or transformation that significantly and constantly expresses the characteristic that was intended to be included in it, which is conferred by the introduced transgene. More particularly, in the present case, the genetically modified plant is considered an "event", preferably a genetically modified sugarcane plant (Saccharum spp.) which, after genetic modification, expresses the characteristic of resistance to pest, particularly Diatraea saccharalis (sugarcane borer). In a preferred scope, genetically modified sugarcane produced by genetic transformation is designated “CTC75064-3” and may alternatively be referred to as “Event CTC75064-3”.

[0074] Also, for reference purposes, unless expressly mentioned to the contrary, by region LB is understood the left transfer edge of the T-DNA (5'), and by region RB is understood the right transfer edge of the T-DNA (3').

[0075] Additionally, all biological sequences described herein, unless explicitly stated otherwise, also encompass sequences having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with the sequences to which they refer.

[0076] Finally, plant material means any and all plant tissue or its derivatives, such as, but not limited to, seeds, trunks, stems, stems, leaves, straws, bark, roots, cellu- them, molecules of vegetable origin, among others, and also any product of a plant or derivative thereof, for example, but not limited to, sap, sugar, ethanol, among others.

[0077] Recombinant DNA technology enabled the isolation of genes and their stable insertion into a host genome. This technique, also called genetic transformation, can be defined as the controlled introduction of nucleic acids ("DNA" or DNA) into a recipient genome, excluding introduction by fertilization. It is a controlled process, where normally only the defined fragment of DNA is introduced into the host genome, or receptor genome, and must be integrated into it. The stable insertion of these molecules into a host genome gives rise to an individual equal or substantially equal to the receptor of the recombinant molecule, but with a new and particular characteristic. By "substantially the same" is meant an organism that has greater than 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to the recipient organism.

[0078] There are several techniques for genetic transformation of plants, which can, in general, be grouped into two main categories: indirect and direct gene transfer. Indirect transfer is one in which exogenous DNA is inserted into the genome by the action of a biological vector or any other type of carrier molecule, and its insertion is facilitated by endogenous or exogenous mechanisms, while direct transfer is facilitated by endogenous or exogenous mechanisms. based mainly on physico-biochemical processes.

[0079] The tissues and/or cells to be transformed may vary according to the genetic transformation techniques used and according to the species or genotype to be transformed. These tissues generally include, without limitation, embryogenic callus, callus, protoplasts, embryos, somatic embryos, meristematic tissues, and any part, tissue or plant cell that has a regenerative capacity.

[0080] The indirect transformation is mainly based on the system mediated by bacteria of the genus Agrobacterium and has been the most used method to obtain transgenic plants, as it has some advantages, such as the possibility of transferring DNA segments relatively long with no rearrangement and integration of low copy numbers of the transgenes, ensuring greater genotypic stability for the generated events. Several species and strains of Agrobacterium, plasmids and protocols have been developed and adapted for the genetic transformation of different plant species. The advantages of the Agrobacterium-mediated transformation method include the higher probability of single copy insertions, the stable integration and genetic inheritance of the introduced traits, as well as consistent gene expression across generations, in addition to lower chances of gene silencing. .

[0081] Agrobacterium tumefaciens and A. rhizogenes are phytopathogenic soil bacteria, gram negative, belonging to the family Rhizobiaceae, which cause diseases in dicots, known as crown gall and wig root, respectively. In this plant-pathogen interaction, a process of natural gene transfer occurs between the agrobacteria and the plant cell, when bacterial DNA fragments are transferred into the plant cell (T-DNA), integrating the nuclear genome. In its natural form, the bacterium transfers T-DNA ("transferred DNA"), which is part of the bacterial plasmid called Ti ("tumour-inducing"), and it integrates into the genome of infected plant cells. . In the T-DNA fragment that is transferred to the plant cell are the genes involved in the constitutive biosynthesis of phytohormones (auxins and cytokinins) that alter the program of normal development of infected tissue, causing tumor formation. Furthermore, it also contains oncogenes for the synthesis of sugars and amino acids called opines, which are responsible for the survival of the bacterium, which uses them as a source of carbon and nitrogen (Oger et al 1997). Repeated ends of 25 base pairs (bp) on the right and left edges delimit the T-DNA, and are essential for its transfer. Phenolic compounds released by injured plant tissues activate specific regions (vir regions), initiating the process of transferring T-DNA to the plant cell. Agrobacterium also has chromosomal genes ( chv ) that guarantee the connection between bacterial and host cells, allowing the formation of the passage pore of the complex containing the T-DNA (Sheng & Citovsky, 1996).

[0082] Once the segment to be transferred (transgene) is defined by its edges, any sequence flanked by the edges can be transferred to a plant by means of agrobacteria, allowing the manipulation of these sequences for the transfer of coding sequences of interest. The substitution or elimination of the coding regions of the wild-type T-DNA (oncogenes) allows the generation of non-oncogenic (disarmed) Agrobacterium strains that carry the sequences of interest, without prejudice to the transfer of the T-DNA to plants as long as the virulence genes (vir region) are maintained.

[0083] Additionally, the indirect transformation system by Agrobacterium allows the use of artificial plasmid constructs for the transfer of genes to plants as long as they contain such T-DNA borders, allowing a great flexibility for the use of the tools molecular and material available and developed for other bacterial strains.

[0084] These artificial plasmid constructs have pro- motors of different origins, including plant gene promoters, viral, bacterial and/or chimeric promoters, in addition to genes that confer antibiotic resistance, herbicide resistance or that have enzymatic activity (phosphomannose isomerase (PMI)/mannose ( Man)) so that these markers can be used for the selection of transformed cells or plants.

[0085] Additionally, these constructs may contain auxiliary genes that interfere in signaling pathways relevant to the morphogenesis of plant tissues, increasing the efficiency of the process of genetic modification and regeneration. The following stand out, without limitations: LEAFY COTYLEDON1 (Lotan et al, 1998), Lec1 (Lowe et al, 2002), LEAFY COTYLEDON2 (Stone et al, 2001), WUSCHEL (WUS; Zuo et al, 2002), and BABY BOOM (BBM; Boutilier et al, 2002), among others.

[0086] In a first aspect of the present invention, the foreign or exogenous DNA that will be introduced into the plant is cloned into a binary plasmid, between the left and right edge consensus sequences (T-DNA). The binary plasmid is transferred into an Agrobacterium cell, which is subsequently used to infect plant tissue. The region of the vector's T-DNA that comprises the exogenous DNA is inserted into the plant genome. The expression cassette with the marker gene and the expression cassette with the trait gene can be present in the same region of the T-DNA, in different regions of the T-DNA in the same plasmid, or even in different regions of the plasmid. T-DNA on different plasmids. In one embodiment of the present invention, the cassettes are present in the same region of the T-DNA. One skilled in the art is familiar with methods of indirect transformation by Agrobacterium.

[0087] Still alternatively, the direct transfer of DNA can be used to introduce DNA directly into a plant cell. These methods offer an alternative for the integration of a gene of interest with minimal cellular toxicity at random locations in the genome. In these cases, the introduction of exogenous DNA is performed without the aid of a vector. A suitable method of direct DNA transfer may be to bombard plant cells with a vector comprising the DNA for insertion using a particle gun (particle-mediated biolistics transformation). Other methods for transforming plant cells include protoplast transformation (optionally in the presence of polyethylene glycols); ultrasound treatment of plant tissues, cells or protoplasts in a medium comprising the polynucleotide or vector; sonication, the microinjection of the polynucleotide or vector into plant material; macroinjection, electroporation of plant cells and the like, vacuum infiltration, use of silicon carbide fibers, chemical transformation mediated by polyethylene glycol (PEG), among others. Among the disadvantages associated with direct transformation methods are the challenges related to regeneration and low expression of transgenes.

[0088] Still alternatively, the genetic transformation can be carried out in a site-directed manner through homologous recombination aided by nucleases (genomic editing). In recent years, genomic editing technology based on the use of "engineered" or chimeric nucleases has gained prominence, enabling the generation of genetically modified organisms in a more precise and specific way. In this case, the introduction of exogenous genes occurs through homologous recombination mechanisms through the introduction of a homologous recombination (HR) template containing the DNA of interest linked to a DNA fragment homologous to the genome of the recipient organism. Among the tools available are the chimeric enzyme system CRISPR (clustered, regularly interspaced, short palindromic repeats) - Cas, in addition to Zinc finger nucleases (ZFN) and TAL effector nucleases (TALENs). CRISPR/Cas systems are enzymatic systems that comprise 2 main components: an endonuclease (Cas) and a guide RNA (single-guide RNA - sgRNA). Guide RNA comprises 2 main parts: "crispr RNA" (crRNA), a 17-20 nucleotide sequence complementary to specific sites in genomic DNA; "tracr RNA", a template for binding Cas nuclease, responsible for guiding the endonuclease to the specific cleavage site. The specific cleavage performed by the endonuclease and directed by the guide RNA can be repaired through homologous recombination, integrating in a site-directed manner the exogenous DNA flanked by sequences homologous to the cleavage site. The introduction of this enzymatic system into the cell can occur in different ways, using plasmids, through direct or indirect transformation, or even using proteins and other carrier molecules. The expression of the components of the system can occur transiently or stably using the cellular machinery of the receptor organism or even be performed exogenously, in which case, the components of the system are delivered to the cell "ready to use" (endonucleases + sgRNAs transcribed in vitro and combined prior to their introduction into the cell). The description presented here should not be considered exhaustive and, therefore, the use of such genomic editing methods within the scope of the present invention should not be limited to the description presented, and the application of variations of these systems and methods, as known in this - that of Art, as well as those that are yet to be discovered.

[0089] After the transformation, the transgenic plants must be regenerated starting from the transformed plant tissue and the progeny that has exogenous DNA selected using an appropriate marker such as resistance to kanamycin, geneticin or glufosinate ammonium. One skilled in the art is familiar with the composition of suitable regeneration media.

[0090] Alternatively, other selection methods can be applied, without the need to introduce a selection marker into the recipient organism as exemplified above.

[0091] In a preferred embodiment, the genetic transformation is mediated through a bacterium of the genus Agrobacterium.

[0092] In an even more preferred embodiment, the genetic transformation is mediated by Agrobacterium tumefasciens.

[0093] Event CTC75064-3 displays a new genotype comprising two expression cassettes. The first expression cassette comprises a promoter suitable for expression in plants operably linked to a gene encoding an insecticidal CrylAc toxin useful in controlling lepidopteran insect pests and a suitable polyadenylation signal. The second expression cassette comprises a promoter suitable for expression in plants operably linked to a gene encoding a protein used as a selective marker in obtaining the event of the present invention.

[0094] Suitable promoters can be isolated or expressed, among other organisms, in plants. Several promoters have been isolated or developed, including constitutive, "on and off" promoters, responsive to abiotic stresses, tissue-specific, among others. Many of these promoters have intronic sequences described as relevant for proper gene expression. In a preferred aspect of the invention, the promoters are constitutive promoters and may be selected from the non-limiting group consisting of CaMV 35S, CoYMV (Commelina yellow mottle virus), FMV (Figwort mosaic virus) 35S, Ubiquitin, Rice Actin promoter 1 (Act-1), Rice Actin promoter 2 (Act-2), Nopaline synthase promoter (NOS), octopine synthase promoter ( OCS), corn alcohol dehydrogenase promoter (Adh-1), PvUbil, among others. [0095] Additional elements such as enhancer and driver sequences (transporters) can also be incorporated into the expression cassette for the purpose of improving gene expression levels, for example transcriptional or translational enhancers such as the CaMV enhancers 35S, FMV 35S, Nos, supP, Wheat Major Chlorophyll a/b Binding Polypeptide a/b (L-Cab) non-transcribed leader sequences, kosak sequences 5' upstream of the translation start site, among others.

[0096] In one embodiment of the invention, the promoter is the Cauliflower Mosaic Virus 35s (CaMV 35Ss) promoter. In an even more preferred embodiment, the CaMV 35s promoter has the duplicated enhancer sequence (2xCaMV35s).

[0097] In a scope of the invention, the sequence Kosak 5' upstream of the translation start site and the rice Actin 1 intron ( Oryza sativa Actin 1 introrr, OsACTI) are contemplated in the CaMV 35s promoter region. Additionally, the L-Cab leader sequence is also contemplated in the CaMV 35s promoter region.

[0098] In a preferred scope, crylAc gene expression is regulated by the combination of elements selected from the group consisting of Cauliflower Mosaic Virus 35s promoter with duplicate enhancer sequence (2xCaMV35s), non-trans leader sequence - Wheat Major Chlorophyll a/b Binding Polypeptide a/b crita (L-Cab), Rice Actin 1 intron (Oryza sativa Actin 1 intron; OsACTI) and Kosak sequence 5' upstream from the translation start site. In a preferred scope, crylAc gene expression is regulated by the promoter region of Cauliflower Mosaic Virus 35s with sequence Duplicated enhancer (2xCaMV35s), non-transcribed leader sequence of Wheat Major Chlorophyll a/b Binding Polypeptide (L-Cab), Rice Actin 1 intron (Oryza sativa Actin 1 introrr, OsACTI) and Kosak 5' sequence upstream from the translation start site.

[0099] In another scope, the promoter region is the corn Ubiquitin gene (pUBI). In a preferred scope, the promoter region is that of the corn Ubiquitin gene (pUBI) contains an intron in the 5' sequence of the leader RNA.

[00100] The promoter region ( UBI-1 ) of the present invention has 1992 base pairs which are subdivided into: promoter fragment (899 bases), first exon of the polyubiquitin-1 gene (83 bases) and first intron (1010 bases) .

[00101] In one scope, the expression of the nptll gene is regulated by the corn ubiquitin promoter (pUBI). In a preferred scope, the expression of the nptll gene is regulated by the corn ubiquitin promoter (pUBI) containing an intron in the 5' sequence of the leader RNA. In a specific scope, the expression of the nptll gene is regulated by the promoter region (UBI-1) of the present invention has 1992 base pairs that are subdivided into: promoter fragment (899 bases), first exon of the polyubiquitin-1 gene (83 bases) and first intron (1010 bases).

[00102] Terminator sequences are also contemplated in the expression cassette. Examples of suitable and functional polyadenylation signals in plants include that from the nopaline synthase (nos) gene of Agrobacterium tumefaciens, that from the proteinase inhibitor II gene, rbcS (pea ribulose-1,5-bisphosphate carboxylase small subunit), Lhcbl (tobacco chlorophyll a/b-binding proteins), CaMV 35S, octopine synthase, the one from the alpha-tubulin gene, among others.

[00103] In a scope of the present invention, the polyadeny- lation is derived from the CaMV 35s gene (T35s). In one embodiment of the present invention, the polyadenylation signal is that from the nopaline synthase (nos) gene of Agrobacterium tumefaciens.

[00104] Preferably, the polyadenylation signal for the crylAc cassette is CaMV 35s terminator (T-35s) and the polyadenylation signal for the nptII gene is Agrobacterium tumefaciens nopaline synthase terminator - NOS.

[00105] The crylAc gene encodes a 615 amino acid toxin with an estimated molecular weight of 68 KDa, originating from Bacillus thuringiensis serovar kustaki (strain HD73) that confers resistance to D/atraea saccharalis (sugarcane borer). The present invention contemplates gene modifications for the expression of only the active tryptic core of the native CrylAc protein. Thus, in a preferred embodiment of the present invention, the polynucleotide encoding the CrylAc protein is truncated, encoding the 52 kDa insecticidal tryptic core. In a preferred embodiment, the CrylAc protein is SEQ ID NO 34. The present invention also contemplates sequences comprising at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% of identity with SEQ ID NO: 34. The tryptic nucleus is responsible for the insecticidal activity of the protein, binding to specific proteins of the insect intestine, leading to the disruption of the functional and anatomical integrity of this organ that alters the absorption of nutrients and rapid toxicity. - insect death and death.

[00106] In accordance with the invention, the polynucleotide encoding the CrylAc protein may have codons optimized or otherwise altered to improve its expression in plant material. Such codon optimization can be used to alter the predicted secondary structure of the RNA transcript produced in any transformed cell or to destroy the cryptic RNA instability elements present in the unaltered transcription product. thereby improving the stability and/or availability of the transcription product in the transformed cell.

[00107] Preferably, the crylAc gene present in the event of the invention corresponds to a synthetic DNA sequence, truncated and optimized with sugarcane preferred codons. In an even more preferred aspect of the present invention, the crylAc gene has the sequence SEQ ID NO: 20. The present invention also contemplates sequences comprising at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with SEQ ID NO: 20. [00108] Several marker genes for plant selection events have been characterized, including some that confer antibiotic tolerance and others that confer herbicide resistance. Examples of marker genes that may be selected for use in the present invention include those that confer resistance or tolerance to hygromycin, kanamycin, gentamicin, glyphosate, glufosinate ammonium or resistance to toxins such as eutypine. Other forms of selection are also available, such as hormone-based selection systems, visual selection through the expression of fluorescent proteins, mannose isomerase, xylose isomerase, among others. In one embodiment of the present invention, the event selection marker gene of the present invention is one that confers tolerance to antibiotics of the aminoglycoside class. In one scope of the present invention, the event selection marker gene confers tolerance to kanamycin and geneticin.

[00109] In a preferred embodiment of the invention, the marker gene used in the second expression cassette is the nptII gene, which encodes the 265 amino acid neomycin phosphotransferase II (nptII) enzyme with an estimated molecular weight of 29.2KDa . In an even more preferred aspect of the present invention, the nptll gene has the sequence SEQ ID NO 21. Neomycin phosphotransferase II confers resistance to propensity to antibiotics of the aminoglycoside class, such as kanamycin and geneticin. The npt11 gene used as a selection marker in obtaining the transformed events is derived from the Tn5 transposon of Escherichia coli as described by BECK et al (1982). The Nptll protein is produced by several prokaryotes widely found in the environment, both in aquatic and terrestrial habitats, as well as in human and animal intestinal microflora. The Nptll protein inactivates aminoglycoside antibiotics such as neomycin, gentamicin, paromycin and kanamycins A, B and C, using adenosine triphosphate (ATP) to phosphorylate them, thus preventing them from causing injury to cells when exposed to mentioned antibiotics. This mechanism allows its use as a selection marker for transformed plants. In a preferred embodiment, the Npt11 protein is SEQ ID NO 35. The present invention also contemplates sequences having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO 35.

[00110] The use of selection marker genes, such as the nptll gene, is important to select transformed cells in the process of genetic modification (HORSCH et al., 1985). The objective of inserting the nptll gene in the event of the present invention was, therefore, the selection of cells transformed with the crylAc gene.

[00111] In addition to the expression cassettes described, additional expression cassettes are optionally comprised in event CTC75064-3.

[00112] The first and second expression cassettes comprised in event CTC75064-3 can be introduced into the plant on the same or different plasmids. If the first and second expression cassettes are present on the same plasmid and were introduced into the plant via an Agrobacterium-mediated transformation method, they may be present within the same or from different regions of the T-DNA. In one embodiment of the present invention, the first and second expression cassettes are present in the same region of the T-DNA.

[00113] More particularly, the event of the present invention was obtained by Agrobacterium tumefasciens-mediated transformation with a genetic construct comprising a DNA fragment (T-DNA) containing the expression cassettes of the crylAc and nptll genes (Figure 1). Preferably, the genetic construct of the present invention is characterized in that it comprises the nucleotide sequence having at least 80% identity to SEQ ID NO:1, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO:1.

[00114] The event of the present invention was obtained by Agrobacterium tumefasciens-mediated transformation comprising the T-DNA fragment as defined above (SEQ ID NO:1).

[00115] This T-DNA fragment was inserted into a binary plasmid that contains in its host spectrum the bacteria Escherichia coli and Agrobacterium tumefaciens. The specific genetic elements, origins of the components of the original binary plasmid of the present invention are shown in Figure 4.

[00116] The binary plasmid comprising the construct of the present invention is represented in Figure 5. In a preferred embodiment, the genetic construct of the present invention is characterized in that it comprises a nucleotide sequence having at least 80 %, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 14.

[00117] Said genetic construct is inserted by heat shock into the DH5a strain of Escherichia coli. An isolated colony containing the construct (SEQ ID NO 14) was inoculated into liquid LB medium supplemented with 150 μg/mL spectinomycin and incubated at 37°C, with stirring at 250 rpm for a period of 16 hours. Stocks containing bacterial suspension and 10% glycerol (v/v) were then prepared and stored in an ultrafreezer -80°C. Plasmid DNA was extracted from the same bacterial suspension using the QIAGEN Plasmid Giga Kit according to the manufacturer's recommendations (Qiagen, Germany).

[00118] The construct SEQ ID NO 14 was then transferred to a strain of Agrobacterium tumefaciens (vector) by means of techniques known to a person skilled in the art, such as electroporation, heat shock, among others. Preferably, the construct is transferred to a strain of Agrobacterium tumefaciens via electroporation. An isolated colony of agrobacteria containing the construct is inoculated into liquid LB medium supplemented with 100 μg/ml of spectinomycin and 50 μg/ml of rifampicin and incubated at 28°C, shaking at 200 rpm for a period of 24 hours. Stocks containing bacterial suspension and 10% glycerol (v/v) are prepared and stored in an ultrafreezer -80°C. These stocks are used in genetic transformation experiments.

[00119] In an even more preferred embodiment, the vector is an EHA105 strain of Agrobacterium tumefaciens.

[00120] A method for producing a genetically modified insect resistant sugarcane plant (Saccharum spp) is also described. In a preferred embodiment, said method comprises the steps of: a) introducing the genetic construct into an Agrobacterium strain; b) Obtaining embryogenic calluses from palm hearts of a variety of sugarcane (Saccharum spp.); c) Co-cultivation of embryogenic calluses with Agrobacterium from stage I; d) Selection of transformed cells that contain the functional fragment in a culture medium containing aminoglycoside antibiotics; and e) Regeneration of transformed sugarcane plants.

[00121] In one aspect of the present invention, the method for producing a genetically modified sugarcane plant (Saccharum spp..) is based on or identical to that described by BR 11 2017 005441, the teachings of which are incorporated into the present invention. In a further aspect, step a) of the method for producing a genetically modified sugarcane plant ( Saccharum spp.) of event CTC75064-3 comprises introducing a genetic construct comprising SEQ ID NO 20 and SEQ ID 21 in an Agrobacterium strain. In another aspect, step d) comprises the selection of transformed cells containing a functional fragment in a culture medium containing geneticin. Additionally, step e) of that method comprises regenerating transformed sugarcane plants, wherein the transformed sugarcane plants comprise SEQ ID NO 20 and SEQ ID NO 21. Preferably, the method for producing a plant of genetically modified sugarcane ( Saccharum spp ) described is for production of the event of interest, CTC75064-3. The invention also contemplates a plant part, a plant cell, a plant tissue, or a seed of the genetically modified sugarcane plants produced by the method described above.

[00122] The person skilled in the art is familiar with the composition of suitable culture media for the generation of embryogenic callus (step b), as well as with the media of the co-cultivation stages (step c: co-cultivation + rest) , selection (step d) and regeneration (step e; regeneration + elongation). Preferably, the culture media used Lysates are based on compositions comprising ingredients such as MS salts (Murashige and Skoog, 1962), sucrose, vitamins B5 and, optionally: amino acids selected from the group comprising proline and asparagine; casein hydrolyzate; Citric acid; mannitol; copper sulfate; glycine; gelling agent; auxins; antibiotics; acetosyringone; and selection agents. The use of auxins in the means of embryogenic callus generation, co-culture and selection stands out, as well as geneticin in the selection medium.

[00123] The "co-cultivation" step refers to the incubation of infected or contacted plant tissue with Agrobacterium in order to allow the transfer of Agrobacterium T-DNA to plant cells. This stage corresponds to the period between the moment immediately after inoculation (contact of the Agrobacterium with the plant tissue) until the moment when the bacteria is removed or inactivated.

[00124] The inoculated tissue can be co-cultured for about 1 to 30 days, preferably 1 to 20, more preferably 1 to 10 days.

[00125] During the co-cultivation step, the temperature can be any suitable temperature for the target plant known in the art. Illustratively, for sugar cane, the temperature can range from about 15°C to about 30°C and from about 16°C to about 29°C. In some embodiments, the co-cultivation step takes place in the absence of light.

[00126] After co-cultivation with Agrobacterium, the medium is removed and the cells are transferred to a culture medium in the absence of Agrobacterium, being incubated in the dark, at a temperature of 20°C to about 26°C, for a period of 1 to 20 days.

[00127] The method provided herein further includes selecting cells comprising at least one copy of the genetic sequence of interest. "Select", as used herein, means the situation in which it is A selective agent for transformants is used, where said selective agent will allow the preferential growth of plant cells containing at least one copy of the marker gene positioned within the T-DNA and transferred by Agrobacterium to the detriment of those cells that have not been transformed . As indicated above, any suitable selection marker can be used. Preferably, the selection marker gene used is the nptll gene, which encodes an enzyme that confers resistance to antibiotics of the aminoglycoside class, such as kanamycin and geneticin.

[00128] In some embodiments, an agent that inhibits the growth of Agrobacterium is also added after step c. [00129] Selection can occur under light or dark conditions, depending on the plant species being transformed, and the genotype, for example. In some cases, embryogenic callus or other tissues undergoing transformation can be subcultured at regular or irregular intervals in the same medium. In the case of callus transformation, it is possible to keep individual calluses separate to ensure that only one plant is regenerated per callus and therefore all regenerated plants are derived from independent transformation events. In a preferred embodiment, the selection step takes place in the dark, for about 1 to 10 weeks, more preferably 2 to 5 weeks.

[00130] After the selection period, the plant tissue that continued to grow in the presence of the selection agent, and which, therefore, was genetically modified, can be manipulated and regenerated, placing it in culture media and conditions suitable growth. The transgenic plants thus obtained can be tested for the presence of the DNA of interest. The term "regenerate", for purposes of this invention, refers to the formation of a plant, which includes a shoot and roots. Regenerated plants can be planted in substrate suitable, such as soil and be transferred to the greenhouse. As used herein, "genetically modified" or "transgenic" or "stably transformed" means a plant cell, plant part, plant tissue, or plant that comprises a DNA sequence of interest that is introduced into its genome via transformation.

[00131] In one embodiment, the bacterium is of the genus Agrobacterium.

[00132] In a more preferred embodiment, the bacterium is Agrobacterium tumefaciens.

[00133] In an even more preferred embodiment, the bacterium is an EHA105 strain of Agrobacterium tumefaciens.

[00134] The present invention also relates to the characterization of the selected event (CTC75064-3) and methods of detecting plant material derived therefrom. Analytical methods for detecting and characterizing transgenic plants include indirect methods (protein-based detection methods) or direct methods (DNA-based detection methods)

[00135] The definition of the site of stable integration of the T-DNA in the genome of the host cells and characterization of the flanking sequences is necessary for the development and validation of methodologies for the identification and unequivocal characterization of the event. [00136] To identify the flanking regions of the ends of the T-DNA inserts present in the CTC75064-3 event, several DNA amplification and sequencing experiments were performed. Reverse PCR (iPCR) assays were performed for both ends of the T-DNA sequences in order to isolate and clone the flanking regions of the inserts. Subsequently, the obtained and isolated fragments were sequenced by Sanger to validate the results obtained by iPCR. The map of genetic insertions cas present in event CTC75064-3 is represented in Figure 3 (SEQ ID NO 2). The flanking sequences of event CTC75064-3 are characterized by comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 23 and SEQ ID NO 24. In a preferred scope, the flanking sequences of event CTC75064-3 are characterized by SEQs ID NO 23 and SEQ ID NO 24.

[00137] In accordance with one aspect of the invention, there is provided a polynucleotide comprising at least 14 contiguous nucleotides of the sequence SEQ ID NO 18. In one embodiment, a polynucleotide comprising at least 15 contiguous nucleotides of SEQ is provided. ID NO 18. In one embodiment, a polynucleotide comprising at least 16 contiguous nucleotides of SEQ ID NO 18 is provided. In one embodiment, said polynucleotide comprises at least 17 contiguous nucleotides of SEQ ID NO 18. embodiment, said polynucleotide comprises at least 18 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises at least 19 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises at least 20 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises at least 21 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises at least 22 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises at least 23 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises at least 24 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises at least 25 contiguous nucleotides of SEQ ID NO 18. In one embodiment, said polynucleotide comprises SEQ ID NO 18. In a further aspect of the invention, said poly - nucleotide is characterized by the fact that it comprises SEQ ID NO 13.

[00138] According to one aspect of the invention, there is provided a polynucleotide comprising at least 14 contiguous nucleotides SEQ ID NO. 19. In one embodiment, a polynucleotide comprising at least 15 contiguous nucleotides of SEQ ID NO. 19. According to one aspect of the invention, there is provided a polynucleotide comprising at least 16 contiguous nucleotides of SEQ ID NO. 19. In one embodiment, said polynucleotide comprises at least 17 contiguous nucleotides of SEQ ID NO 19. In one embodiment, said polynucleotide comprises at least 18 contiguous nucleotides of SEQ ID NO 19. In one embodiment, said polynucleotide comprises at least 19 contiguous nucleotides of SEQ ID NO 19. In one embodiment, said polynucleotide comprises at least 20 contiguous nucleotides of SEQ ID NO 19. In one embodiment, said polynucleotide comprises at least 21 contiguous nucleotides of SEQ ID NO 19. In in one embodiment, said polynucleotide comprises at least 22 contiguous nucleotides of SEQ ID NO 19. In one embodiment, said polynucleotide comprises at least 23 contiguous nucleotides of SEQ ID NO 19. In one embodiment, said polynucleotide comprises at least 24 contiguous nucleotides of SEQ ID NO 19. In accordance with one aspect of the invention, there is provided a polynucleotide comprising at least 25 contiguous nucleotides of SEQ ID NO. 19. In one embodiment, said polynucleotide comprises SEQ ID NO 19. In one aspect of the invention, said polynucleotide is characterized in that it comprises SEQ ID NO 12.

[00139] In a further aspect of the present invention there is provided a polynucleotide comprising at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO 3. In a single aspect of the present invention there is provided a polynucleotide comprising at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO 4. a further aspect is provided a polynucleotide comprising at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO 5. In a still further aspect of the present invention there is provided a polynucleotide comprising at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO 22.

[00140] According to one aspect of the invention, there is provided a plant comprising at least 14 contiguous nucleotides of SEQ ID NO. 18. In one embodiment, a plant is provided that comprises at least 15 contiguous nucleotides of SEQ ID NO. 18. According to one aspect of the invention, there is provided a plant comprising at least 16 contiguous nucleotides of SEQ ID NO. 18. In one embodiment, the plant comprises at least 17 contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises at least 18 contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises at least 19 nucleotides - contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises at least 20 contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises at least 21 contiguous nucleotides of SEQ ID NO 18. In one embodiment , the plant comprises at least 22 contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises at least 23 contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises at least 24 contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises at least 25 contiguous nucleotides of SEQ ID NO 18. In one embodiment, the plant comprises SEQ ID NO 18. In a further embodiment, the plant comprises comprises SEQ ID NO 13.

[00141] According to one aspect of the invention, there is provided a plant comprising at least 14 contiguous nucleotides of SEQ ID NO. 19. In one embodiment, a plant is provided that comprises at least 15 contiguous nucleotides of SEQ ID NO. 19. In one embodiment, a plant is provided that comprises at least 16 contiguous nucleotides of SEQ ID NO. 19. In one embodiment, the plant comprises at least 17 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 18 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 19 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 20 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 21 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 22 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 23 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least at least 24 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 24 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises at least 25 contiguous nucleotides of SEQ ID NO 19. In one embodiment, the plant comprises SEQ ID NO 19. In an additional embodiment, the plant comprises SEQ ID NO 12.

[00142] Additionally, said plant is a genetically modified sugar cane (Saccharum spp). Additionally, said plant is resistant to insects and is characterized by comprising a sequence with at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with SEQ ID NO 5. In a further aspect, the insect resistant plant of the present invention is characterized by characterized by comprising a sequence having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO 22. In one embodiment of the present invention, said plant is a sugarcane plant. In an additional embodiment, said plant is an insecticidal sugarcane plant which is event CTC75064-3 or a plant derived therefrom.

[00143] In one aspect of the invention, event CTC75064-3 is provided, characterized in that it is a variety of sugar cane ( Saccharum spp.) comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19. Additionally, event CTC75064-3 is characterized by the fact that it is a variety of sugarcane ( Saccharum spp.) comprising SEQ ID NO 5. In a further aspect, event CTC75064 -3 is characterized by the fact that it comprises SEQ ID NO 22.

[00144] A method for detection and unambiguous characterization of the event of interest (specific event) is still desirable. In one aspect, the present invention provides a specific method of detecting and identifying event CTC75064-3.

[00145] In one aspect, the invention provides a method of detecting plant material derived from a genetically modified sugar cane plant of event CTC75064-3, characterized by comprising the steps of: a) obtaining a sample of the plant material for analysis; b) extracting DNA from the sample; c) providing primer pairs comprising at least one sense and one antisense primer; d) amplifying the region between the sites where the primers bind; and e) detecting the presence of amplification product. [00146] In one scope, primer pairs (step c) according to the described detection method are designed to bind to polynucleotides comprising contiguous nucleotides of sequence selected from the group consisting of SEQ ID NO 2 and SEQ ID NO 36. [00146] 00147] In another scope, the primer pairs of step c) are designed to bind to polynucleotides comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 29, where at least one (1) primer pair comprises contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31.

[00148] In one scope, the above primer pairs (step c) are designed to bind to polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, where at least in the 1(one) pair of primers comprises at least 3 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31. In one scope, the primer pairs are designed to bind polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, wherein at least one (1) primer pair comprises at least 7 nucleotides contigs of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31. Additionally, primer pairs are designed to bind to polynucleotides comprising at least - in the 14 nucleotides c sequences selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, wherein at least one (1) primer pair comprises at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31.

[00149] In yet a further aspect, primer pairs according to the described detection method are designed to bind to polynucleotides comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 29, where at least one (1) pair of primers consists of a first primer comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31 and a second primer comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36. [00150] In one aspect, primer pairs according to the described detection method are designed to bind to polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 29, wherein at least one (1) pair of primers consists of a first primer comprising comprising at least 3 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31 and a second primer comprising at least 3 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36. In a still further aspect, primer pairs according to the described detection method are designed to bind to polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 29, wherein at least one (1) pair of primers consists of a first primer comprising at least 7 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31 and a second primer comprising at least 7 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36. Additionally, primer pairs according to the described detection method are designed to bind to polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 29, wherein at least one (1) pair of primers consists of a first primer comprising at least 14 contiguous nucleotides of selected sequences from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31 and a second primer comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36.

[00151] In one embodiment, primer pairs, as described in the detection method, are designed to bind to a polynucleotide comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37, wherein at least one (1) primer pair comprises contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39. In one aspect, primer pairs, according to the detection method described, are designed to bind to a polynucleotide comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37, where at least 1 (a) primer pair comprises at least 3 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39. primers are designed to bind to a polynucleotide and which comprises at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37, wherein at least 1 (one) pair of primers comprises at least 7 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39. In one aspect, the primer pairs, as the detection method described, are designed to bind to a polynucleotide comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37, where at least one (1) pair of ini - constructor comprises at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39.

[00152] In one aspect, primer pairs according to the described detection method are designed to bind to polynucleotides comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO. :37, wherein at least one (1) primer pair consists of a first primer comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39 and a second primer comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36. In a further aspect, primer pairs are designed to bind to polynucleotides comprising at least least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 37, wherein at least one (1) pair of primers consists of a first primer comprising at least 3 contiguous nucleotides of sequence. those selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39 and a second primer comprising at least 3 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36. In one aspect, primer pairs are drawn to bind to polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 37, wherein at least one (1) pair of primers consists of a first primer comprising at least 7 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39 and a second primer comprising at least 7 contiguous nucleotides of selected sequences from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36. Additionally, primer pairs are designed to bind to polynucleotides comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 37, wherein at least one (1) pair of primers consists of a first primer comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ I D NO: 38 and SEQ ID NO: 39 and a second primer comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 36.

[00153] Preferably, the method of detecting plant material derived from a genetically modified sugar cane plant of event CTC75064-3 of the present invention comprises: a) obtaining a sample of plant material for analysis; b) extracting DNA from the sample; c) providing primer pairs designed to bind at least one polynucleotide comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29; d) amplification of the region that lies between the sites where initiators bind; and e) detecting the presence of the amplification product, wherein, the amplification product is characterized by comprising contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 32 and SEQ ID NO 33.

[00154] According to the detection method described, the primer pairs (step c) are designed to bind to at least one polynucleotide comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 22 , SEQ ID NO 29. Additionally, primer pairs are designed to bind to at least one polynucleotide comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, where, the amplification product detected in step e) is characterized by comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 32 and SEQ ID NO 33. In a further aspect, primer pairs are designed to bind at least one polynucleotide comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, where and, the amplification product detected in step e) is characterized in that it comprises contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 38 and SEQ ID NO 39. In one aspect related, the amplification product detected in step e) is characterized in that it comprises at least 104 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 038, SEQ ID NO 39.

[00155] In one embodiment, the initiating pairs, as per the method, detection whole described, are designed to bind to at least one polynucleotide comprising contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37. In an additional embodiment, primer pairs, as detection method described, are designed to bind to at least one polynucleotide comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37. Additionally, primer pairs are designed to bind to at least one polynucleotide comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37, wherein, the amplification product detected in step e) is characterized by comprise at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 32 and SEQ ID NO 33. In a further embodiment, the in The invention writes primer pairs designed to bind at least one polynucleotide comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 37, wherein, the amplification product detected in step e) is characterized in that it comprises at least 104 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 38, SEQ ID NO 39.

[00156] In one embodiment, primer pairs are provided by the present invention and characterized in that they are selected from the group consisting of sequences with at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 6 and SEQ ID NO: 7; SEQ ID NO: 8 and SEQ ID NO: 9. In a particular aspect, the primer pairs used in step c) of the event-derived plant material detection method CTC75064-3 are characterized in that they are selected from the group consisting of sequences with at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with SEQ ID NO: 6 and SEQ ID NO: 7; SEQ ID NO: 8 and SEQ ID NO: 9. Additionally, the primer pairs used in step c) of the method for detecting plant material derived from event CTC75064-3 comprise sequences selected from the group consisting of SEQ ID NO: 6 and SEQ ID NO: 7; SEQ ID NO: 8 and SEQ ID NO: 9. Further, in a preferred embodiment, primer pairs are provided, where the sense primer consists of SEQ ID NO: 6 and the antisense of SEQ ID NO: 7 and/or, the sense primer consists of SEQ ID NO: 8 and the antisense of SEQ ID NO: 9.

[00157] In one embodiment of the present invention, pairs of primers are provided for the detection of plant material derived from the event of genetically modified sugar cane CTC75064-3 characterized by the fact that the sense primer has at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 6 and the antisense primer has at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 7 and/or the sense primer has at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 8 and the antisense primer has at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with SEQ ID NO: 9. In a preferred embodiment - rida, primer pairs are characterized by the sense primer comprising SEQ ID NO: 6 and the antisense primer comprising SEQ ID NO: 7 and/or the sense primer comprising SEQ ID NO: 8 and the antisense primer co comprising SEQ ID NO:9.

[00158] In an even more specific embodiment, the amplification product (or amplicom) produced by the primers of the described detection is between 100 and 1000 base pairs in length. In a preferred scope, the amplicon produced by the primers of the described detection method is between 100 and 300 base pairs in length. Even more preferably, the amplicom is obtained using primer pairs comprising at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with SEQ ID NO: 6 and SEQ ID NO: 7 is characterized by comprising SEQ ID NO 12 and the amplification product (or amplicon) produced by the primers having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with SEQ ID NO: 8 and SEQ ID NO: 9 is characterized by comprising SEQ ID NO 13.

[00159] It is common knowledge, especially those skilled in the art, that the DNA molecule (or DNA) is made up of two chains or strands of nucleotides that are held together by hydrogen bonds between the bases of the nucleotides. Pairing occurs according to the complementarity of the bases, following the general rule of: Adenine with Thymine and Cytosine with Guanine. Thus, although the representation of the nucleotide sequences is performed only for one of the strands, its complementary strand or complementary sequence is included in the scope of this invention, being considered for the definition of the primers and probes described herein.

[00160] Methods for obtaining samples for DNA extraction for molecular analysis are widely known to a person skilled in the art and include the collection of any plant material derived from the transgenic event CTC75064-3, such as stems, roots and leaves . Preferably, the samples are obtained from intact leaves. Methods of extracting plant DNA include, without limitation, those based on the use of CTAB detergent (Alianabi et al, 1999), followed or not by further purification of the sample with cesium chloride or ammonium acetate, in addition to commercially available methods. [00161] Primer pairs suitable for use in this detection method can be designed using parameters well known to those skilled in the art of molecular biology now that the SEQ IDs of the present invention have become available, in particular SEQ IDs Nos 2, 3, 4, 5.18, 19, 22, 23, 24, 29, 30, 31.32, 33, 36, 37, 38 and 39.

[00162] For example, one or both of the primers in the pair can be designed to be construct specific, trait gene specific, promoter specific, sequence specific for the junction between the inserted DNA and the genomic DNA and/or specific to flanking sequences.

[00163] There are many amplification methods that can be used in accordance with this aspect of the invention. The basic principle, one of the techniques known to those skilled in the art, is the polymerase chain reaction (PCR). The amplification product of a PCR reaction can be visualized by staining the nucleotide chain with, for example, ethidium bromide, and excitation with UV light, typically after size separation using agarose gel electrophoresis. .

[00164] One of the embodiments of the present invention uses variations of the PCR principle such as, for example, quantitative real-time PCR, nested PCR (nested PCR), inverse PCR (iPCR), digital PCR, Long PCR, Touchdown PCR, Hot Start PCR, Multiplex PCR, among others. The amplification product can also be detected by different methodologies, which are contemplated in the present invention, such as, for example, the SYBR Green™ system, which emits fluorescence when this reagent binds to DNA strand. dual and the Taqman® system, where detection is based on the interaction of fluorescent probes. The Taqman® methodology uses a probe that is complementary to the intended PCR product segment, located between between the reaction initiators. Accordingly, single-stranded nucleotide sequences complementary to polynucleotides comprising contiguous nucleotides of sequence selected from the group consisting of SEQ ID NO. 2, SEQ ID NO 3, SEQ ID NO. 4, SEQ ID NO 5, SEQ ID NO. 12, SEQ ID NO 13, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38 and SEQ ID NO. 39. During the hybridization step of the PCR cycle, the probe is bound to the target DNA, and during the extension of the Taq polymerase, through its 5'-exonuclease activity, it removes the probe, releasing the presenting fluorochrome, allowing the emission of its fluorescence. Additional embodiments of this aspect of the present invention include, but are not limited to: loop-mediated isothermal amplification ("LAMP"), capillary gel electrophoresis ("CGE"), "microarray" , Luminex technology, "DNA walking" and "Next Generation Sequencing (NGS), Sanger method, Illumina, among others. [00165] The present invention describes a specific detection methodology based on the technique of quantitative PCR in time. (qPCR) known as "Plus-Minus" or "Presence-Absence", with two variations of the methodology being presented: via SYBR GREEN™ and via Taqman® technology.

[00166] Thus, it is an aspect of the present invention that the detection of amplification products (or amplicons) obtained through the use of primer pairs selected from the group having at least 80%, preferably 85%, 90%, 95%, 98 %, 99% or 100% identity to SEQ ID NO: 6 and SEQ ID NO: 7; SEQ ID NO: 8 and SEQ ID NO: 9 is performed by hybridizing probe selected from the group consisting of, respectively, SEQ ID NO 10 and SEQ ID NO 11. Additionally, the amplification product (or amplicom) produced by primers having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 6 and SEQ ID NO: 7 is visualized through a labeled probe comprising the sequence SEQ ID NO. 10. The amplification product (or amplicom) produced by primers having at least 80%, preferably 85%, 90%, 95%, 98%, 99% or 100% identity to SEQ ID NO: 8 and SEQ ID NO: 9 is visualized through a labeled probe comprising the sequence SEQ ID NO. 11. It is a further aspect of the present invention that detection of the amplification product obtained using primers SEQ ID NO: 6 and SEQ ID NO: 7 and/or SEQ ID NO: 8 and SEQ ID NO: 9 is carried out via hybridization with a probe comprising the sequences SEQ ID NO: 10 or SEQ ID NO: 11.

[00167] Figures 6 (specific detection reaction for the event of the invention via Taqman ^® ) and 7 (assay via SYBR GREEN™), represent the validation of both Methods.

[00168] The primers and probes described in the present invention can be used in combination to detect event CTC75064-3. Thus, an additional embodiment of the present invention involves the use of multiplex PCR to identify plant material from event CTC75064-3.

[00169] Alternative primers and probes to aid in the detection and characterization of event CTC75064-3 are included in the invention. These and other variations can be used with any of the direct detection methods described above, but not limited to these.

[00170] Additionally, event CTC75064-3 can be detected from plant material by hybridizing DNA samples with the probes. Specifically, the present invention describes a method for the detection of plant material derived from a genetically modified sugarcane plant of event CTC75064-3, which comprises: a) obtaining a sample for analysis; b) extracting DNA or RNA from the sample; c) providing a probe or combination of probes designed to bind to at least one polynucleotide comprising contiguous nucleotides of sequence selected from the group consisting of SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38 and SEQ ID NO 39, wherein said polynucleotide is single-stranded; d) hybridizing said probe or combination of probes with the sample, and ee) detecting the hybridized probe or combination of probes.

[00171] Optionally, the detection method through the use of probes contemplates an additional step (b1) comprising obtaining amplification product from the material of Step b) through the primers described by the present invention. Such an amplification product is used in the later stages of hybridization and detection of the hybridized probe (c - e).

[00172] In a preferred scope, in step c) of the described method a probe or combination of probes designed to bind to at least one polynucleotide comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO is provided : 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. Additionally, step c) of the described method is ca- characterized in that it comprises providing a probe or combination of probes designed to bind to at least one polynucleotide comprising at least 15 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In another aspect, step c) comprises a probe or combination of probes designed to bind to at least one polynucleotide comprising at least 16 contiguous nucleotides of a sequence. selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, step c) comprises a probe or combination of probes designed to bind to at least at least one polynucleotide comprising at least 17 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, the step c) comprises a probe or combination of probes designed to read to at least one polynucleotide comprising at least 18 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In an aspect , step c) comprises a probe or combination of probes designed to bind at least one polynucleotide comprising at least 19 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, step c) comprises a probe or combination of probes designed to bind to at least one polynucleotide comprising at least 20 contiguous nucleotides of a sequence selected from the group consisting of in SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, step c) comprises a probe or combination of probes designed to bind to at least one polynucleotide that comprises at least 21 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, step c) comprises a probe or combination of probes designed to bind at least one polynucleotide comprising at least 22 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, step c) comprises a probe or combination of probes designed to bind to at least one polynucleotide comprising at least 23 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, step c) comprises a probe or combination of probes designed to bind to at least a polynucleotide comprising at least 24 contiguous nucleotides of a sequence selected from the group consisting of See SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. In one aspect, step c) comprises a probe or combination of probes designed to bind to at least one polynucleotide comprising at least 25 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. Of acprdp with another aspect , step c) comprises a probe or combination of probes designed to bind to at least one polynucleotide comprising at least 26 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 33. [00173] The probe can be, for example, a PCR product or a restriction digest fragment. In an additional embodiment, the probe as described herein may be labeled with a fluorescent, radioactive, enzymatic, or other suitable label to enable that hybridization can be detected. One skilled in the art will now know how to design suitable probes now that he has taken advantage of the present disclosure.

[00174] In an additional embodiment, a method of hybridizing a probe to the sample under stringent conditions (high specificity) is provided. Stringent hybridization conditions are well known to those skilled in the art and comprise for example: hybridization at a temperature of approximately 65°C in a solution containing 6x SSC, 0.01% SDS and 0.25% desiccated milk powder. - swimming, followed by washing at the same temperature in a solution containing 0.2 x SSC and 0.1% SDS.

[00175] Suitable techniques for the specific detection of plant material derived from event CTC75064-3 based on the hybridization principle include, but are not limited to Southern Blots and in situ hybridization. One skilled in the art is familiar with techniques such as these.

[00176] Typically, these involve incubating a probe with a sample, washing to remove the unbound probe, and detecting that the probe has hybridized. Said detection method is dependent on the type of demarcation attached to the probe - for example - a radioactively labeled probe can be detected through exposure to and development of the X-ray film. Alternatively, an enzyme-labeled probe can be detected by converting a substrate to effect a color change. [00177] Additionally, another aspect of the invention contemplates a method for detecting plant material derived from event CTC75064-3 which comprises obtaining a sample for analysis; the provision of an antibody designed to bind to a Cry or Nptll protein contained within a plant that comprises at least 14 contiguous nucleotides of a selected sequence from the group consisting of SEQ ID NO. 18 and/or SEQ ID NO 19; incubating said antibody with the sample; and detecting that the antibody has bound. In one embodiment of the present invention, said Cry protein is encoded by the nucleotide sequence SEQ ID NO 20 and the Nptll protein is encoded by the nucleotide sequence SEQ ID NO 21. In a further aspect, the Cry protein comprises SEQ ID NO: 34 and the Nptll protein comprises SEQ ID NO: 35.

[00178] Suitable methods for the detection of plant material derived from event CTC75064-3 based on said antibody binding include, but are not limited to western blots, ELISA ("Enzyme-Linked ImmunoSorbent Assays") and to mass spectrometry (SELDI - "Surface-enhanced laser desorption/ionization" or MALDI - "matrix-assisted laser desorption/ionization"). One of skill in the art is familiar with these immunological techniques. Typical steps include incubating a sample with an antibody that binds to Cry or NptII protein, washing to remove unbound antibody, and detecting that the antibody has bound. Many such detection methods rely on enzymatic reactions - for example, the antibody can be linked with an enzyme such as peroxidase and on application of a suitable substrate, a color change is detected. Such antibodies may be monoclonal or polyclonal.

[00179] In another aspect the invention contemplates a method for detecting plant material derived from event CTC75064-3 which comprises obtaining a sample for analysis; providing a protein extract from the sample; the provision of test strips designed to detect the presence of a Cry or Nptll protein contained within a plant comprising at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO. 18 and SEQ ID NO. 19; incubation of test strips with the sample; and detection. In one embodiment of the present invention, said Cry protein is encoded by the nucleotide sequence SEQ ID NO 20 and the Nptll protein is encoded by the nucleotide sequence SEQ ID NO 21. In a further aspect, the Cry protein comprises SEQ ID NO: 34 and the Nptll protein comprises SEQ ID NO: 35. [00180] In one embodiment of the invention, there is provided a method for detecting plant material derived from a genetically modified sugar cane plant of event CTC75064-3 comprising the obtaining a sample derived from event CTC75064-3 and a sample of a non-transgenic sugarcane species for analysis (control); subjecting one or more insects of the species Diatraea saccharallis (susceptible to CrylAc) to the samples; to detect the insecticidal effect on the insects in the samples. In this aspect of the invention, "Insecticide" refers to any inhibitory effect on the insect, including, but not limited to, reduced feeding, retarded growth, reduced fecundity, paralysis, death.

[00181] The method of detecting event CTC75064-3 plant material includes, but is not limited to, leaf feeding biological assays in which a leaf or other suitable part of the event CTC75064-3 plant or any plant material derived from the event CTC75064-3, is infested with one or more insect pests. Detection can be done by evaluating leaf or plant damage after set periods of time, evaluating mortality or other insecticidal effect on insects. Such biological assays can be carried out in the field or in a greenhouse and can be submitted to natural or artificial infestation of insects.

[00182] In another aspect of the invention, there is provided a kit for detecting the presence in a sample of plant material derived from event CTC75064-3 which comprises a means for detecting the presence of a polynucleotide comprising at least 14 nu- contiguous cleotides of a sequence selected from the group consisting of SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 32 and SEQ ID NO. 33 and/or a Cry protein. In one embodiment of the present invention, said kit may comprise DNA amplification detection technology such as PCR, qPCR or Taqman ^® . In a further embodiment of the present invention, said kit may comprise detection technology by hybridization of probes such as Southern Blots or In situ Hybridization. In one aspect, detecting the presence in a sample of plant material derived from a transgenic sugar cane comprising the CrylAc protein (CTC75064-3 event) comprises primer pairs designed to bind at least one polynucleotide comprising nucleotide contiguous genes of a sequence selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29. Additionally, detection of the presence in a sample of plant material derived from a transgenic sugar cane comprising the CrylAc protein (event CTC75064-3) comprises primer pairs designed to bind at least one polynucleotide comprising contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, wherein at least one primer comprises contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31. Additionally, detection of such a sample comprises pair primers where the sense primer comprises SEQ ID NO: 6 and the antisense primer comprises SEQ ID NO: 7, or the sense primer comprises SEQ ID NO: 8 and the antisense primer comprises SEQ ID NO: 9. In In another aspect, detecting the presence in a sample of plant material derived from a transgenic sugar cane comprising the CrylAc protein (event CTC75064-3) comprises a probe comprising sequences selected from the group consisting of SEQ ID NO 10 and SEQ ID NO 11. In another embodiment of the present invention, said kit may comprise antibody-binding detection technology such as western blots, ELISAs, in addition to mass spectrometry (SELDI or MALDI) or test strips. In a further embodiment of the present invention, said kit may comprise insect bioassay detection technology such as leaf feeding biological assays or biological mortality assays. In a further embodiment of the present invention, said kit may comprise any combination of the detection technologies mentioned above.

[00183] The transgenic event as described in the present invention has an effect on insects of one or more species of the group comprising insects of the order Lepidoptera. As a result, a reduced number of insecticidal sprays are required during the cultivation of said plant compared to a non-GM sugarcane plant of the same variety.

[00184] The present invention is not bound by itself to event CTC75064-3, but is further extended to include any plant material derived therefrom, including seed, provided they contain at least one of the polynucleotides of the present invention. In one aspect, the present invention comprises a plant part, a plant cell, a plant tissue, or a seed of a genetically modified sugarcane plant (Saccharum spp.), wherein said plant, part of plant, plant cell, plant tissue, or seed comprising at least one sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 19. In one scope, the invention comprises plant, plant part, cell of plant, plant tissue, or seed comprising at least one sequence selected from the group consisting of SEQ ID NO: 12 and SEQ ID NO: 13. Additionally, the invention includes plant, part of plant, plant cell, plant tissue, or seed comprising at least one sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 22. The present invention includes, but is not limited to, plants that are derived from crosses from lines with event CTC75064-3 or a derivative thereof through conventional breeding or other methods. Thus, an embodiment of the present invention relates to the use of a plant, plant cell, plant part or seed of a genetically modified sugarcane plant (Saccharum spp.), as described above, characterized by comprising at least one sequence selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19, for regenerating a plant, planting or cultivating a field of plants, or producing a plant product. Preferably, the invention describes the use of a plant, plant cell, plant part or seed characterized by comprising event CTC75064-3 to regenerate a plant, plant or cultivate a field of plants, or produce a plant product. [00185] Additionally, the present invention describes a method for growing a genetically modified sugarcane plant, comprising growing a sugarcane plant comprising at least one sequence selected from the group consisting of SEQ ID NO 2 under conditions comprising infestation of insects. Preferably, the present invention describes a method for growing a genetically modified sugarcane plant, comprising growing a sugarcane plant characterized by comprising SEQ ID NO 5 and/or SEQ ID NO 22, under conditions comprising insect infestation. In an even more preferred aspect, the invention features a method for growing a genetically modified sugarcane plant of event CTC75064-3, comprising growing a sugarcane plant characterized by comprising SEQ ID NO 5 e/ or SEQ ID NO 22, under conditions comprising insect infestation. Preferably, the insect is Dia trea Saccharalis.

[00186] In one aspect, the present invention provides a method for controlling insects comprising providing a plant, tissue, plant part, cells or seeds of genetically modified sugar cane from event CTC75064-3 for feeding to the insect. . The present invention further provides a method for controlling insects comprising providing a genetically modified sugarcane plant, tissue, plant part, cells or seeds characterized by comprising SEQ ID NO 2 for feeding to the insect. In a preferred scope, said method comprises providing a genetically modified sugarcane plant, tissue, plant part, cells or seeds characterized by comprising SEQ ID NO 5 and/or SEQ ID NO 22 for feeding the insect. Preferably, the insect is Diatrea Saccharalis.

[00187] The invention further provides a method for increasing the production of sugarcane in the field characterized by culturing a genetically modified sugarcane plant of event CTC75064-3. The present invention further provides a method for increasing the production of sugarcane in the field characterized by cultivating a genetically modified sugarcane plant characterized by comprising SEQ ID NO 2. In a preferred scope, a method for increasing the production of sugarcane field sugar characterized in that it comprises cultivating a genetically modified sugar cane plant characterized in that it comprises SEQ ID NO 5 and/or SEQ ID NO 22. Preferably, the insect is Diatrea Saccharalis.

[00188] The present invention also contemplates the tissue culture of a genetically modified sugarcane plant (Sac-charum spp.) comprising at least one sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 19. In a further scope, the present invention contemplates the tissue culture of a genetically modified sugar cane plant ( Saccharum spp.) comprising at least one selected sequence from the group consisting of SEQ ID NO: 12 and SEQ ID NO: 13. Also contemplated in the present invention is tissue culture tissue culture of a genetically modified sugar cane plant ( Saccharum spp.) comprising at least one sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 22. Additionally, a genetically modified sugar cane plant regenerated from the tissue culture described above is also included in the present invention, wherein the regenerated plant comprises at least one sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 19. Examples of plant cells, plant parts, include, but are not limited to: suspension cells, callus, somatic embryos, t meristematic acid, upper stem or stem, stem or stem, stem, leaf, leaf disc, shoots, among others. Another aspect contemplates a method for producing an insect resistant sugarcane plant, characterized in that it comprises crossing a first sugarcane plant with a second sugarcane plant. comprising event CTC75064-3 and producing an offspring of insect resistant sugarcane plants. The plant comprising event CTC75064-3 is a genetically modified sugar cane plant ( Saccharum spp.) comprising at least one sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 19. The present invention also includes a sugarcane plant (Saccharum spp.) and part of the plant, cells, tissues and seeds of the same generated by the method of producing an insect resistant sugarcane, as described above. [00189] Still in this aspect, the present invention provides a method for producing an insect resistant sugarcane plant comprising inserting at least one fragment of T DNA in a specific site of the genome comprised between the sequences selected from the group consisting of SEQ ID NO 23 and SEQ ID NO 24 via homologous recombination. Additionally, the invention provides a method for producing an insect resistant sugarcane plant comprising inserting at least one T DNA fragment selected from the group consisting of a sequence having at least 80% identity with any of SEQ ID NO 2, preferably 85%, 90%, 95%, 98%, 99% or 100% identity with any one of SEQ ID NO 2, at a specific site in the genome comprised among the selected sequences of the group consisting of SEQ ID NO 23 and SEQ ID NO 24 via homologous recombination. In a further aspect, the insertion of the T-DNA fragment as described above occurs so as to comprise, after insertion, at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19. The present invention also contemplates a sugarcane plant (Saccharum spp.) and part of the plant, cells, tissues and seeds thereof generated by the method of producing an insect resistant sugarcane as described above. Preferably, said method is for producing a genetically modified sugarcane plant resistant to event CTC75064-3.

[00190] In an additional embodiment, the present invention provides a commodity product, characterized in that it is produced from a sugarcane plant comprising event CTC75064-3. Thus, the invention includes a commodity product, produced from a genetically modified sugarcane plant (Saccharum spp.) comprising at least one sequence selected from the group. po consisting of SEQ ID NO: 18 and SEQ ID NO: 19. In a further scope, the present invention contemplates a commodity product, produced from a genetically modified plant ( Saccharum spp.) comprising at least one sequence selected from the group consisting of SEQ ID NO: 12 and SEQ ID NO: 13. Also contemplated in the present invention is a commodity product, produced from a genetically modified plant (Saccharum spp.) comprising at least one sequence selected from the group consisting of having SEQ ID NO: 5 and SEQ ID NO: 22. Examples of commodity products include, but are not limited to: bagasse, sugar cane juice, syrup, first generation ethanol (produced from from sugar cane), second-generation ethanol (cellulosic ethanol produced from biomass), biomass, sugar, raw sugar, refined sugar, molasses, vinasse and fiber.

[00191] The invention further includes plant material derived from event CTC75064-3 which may comprise additional, modified or shorter polynucleotide sequences compared to event CTC75064-3 or exhibit other phenotypic characteristics. For example, it may be desirable to transform plant material derived from event CTC75064-3 to generate a new event that has an additional trait, such as a second insect resistance gene. This process is known as gene stacking. The second insect resistance gene can encode, for example, insecticidal lectins, insecticidal protease inhibitors and other insecticidal proteins derived from Bacillus thuringiensis species.

[00192] The present invention further provides a method of controlling insects that comprises the provision of plant material derived from event CTC75064-3 in a place where said insects feed. The invention still further provides a method of controlling insects which comprises providing plant material derived from CTC75064-3 at the place where said insects feed and the application of other agrochemical or biological reagents to said plant material such as herbicides, fungicides and others.

[00193] In another scope, the invention describes a method for producing a genetically modified sugarcane plant ( Saccharum spp.) of event CTC75064-3, comprising introducing a genetic modification to a sugarcane plant ( Saccharum spp. .) comprising at least one sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 22 to produce a genetically modified sugar cane plant ( Saccharum spp.) from event CTC75064-3, where the sugarcane plant (Saccharum spp.) genetically modified sugar cane ( Sac charum spp.) has improved insect resistance when compared to a sugar cane plant ( Sac charum spp.) without the genetic modification. In a further scope, the invention provides a method for growing a genetically modified sugarcane plant ( Saccharum spp.) of event CTC75064-3, comprising growing a genetically modified sugarcane plant ( Saccharum spp.) comprising at least a sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 22 under conditions comprising insect infestation, wherein the genetically modified sugar cane plant (Saccharum spp.) has increased insect resistance compared to a sugarcane plant (Saccharum spp.) without genetic modification growing under the same conditions. The invention also provides a genetically modified sugar cane plant (Saccharum spp.) characterized in that it comprises at least one sequence selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19. In a further aspect, the invention contemplates a genetically modified sugarcane plant ( Saccharum spp.) comprising at least one sequence selected from the group consisting of SEQ ID NO 12 and SEQ ID NO 13. Still in a related scope, the invention features a genetically modified sugar cane plant ( Saccharum spp .) comprising at least one sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 22, where the plant is insect resistant. Preferably, the genetically modified sugarcane plant (Saccharum spp.) is from event CTC75064-3.

Description of Transgenic Sugarcane CTC75064-3 [00194] The plants of the transgenic sugarcane event 'CTC75064-3' are substantially genetically equivalent and phenotypically similar to the parental variety 'RB 867515' (Certificate of protection of cultivar Ne 271 ), but with a new and particular characteristic (CrylAc expression.), which guarantees resistance to the sugarcane borer, Diatrea saccharalis (Lepidoptera). Like its parent variety RB 867515, CTC75064-3 is a modern sugarcane hybrid that has many desirable agronomic characteristics such as genetic potential for high ratoon cane sprouting vigor, high productivity, excellent tillering, medium-late maturity, high sucrose content and tolerances to scald, blight and sugarcane mosaic.

[00195] Briefly, the plants of the event 'CTC75064-3' are characterized by purple culms when exposed to the sun and purple-green when in the shade. 'CTC75064-3' plants exhibit medium to long curved internodes and medium width greenish yellow growth rings. The internodes are smooth in appearance and without growth cracks, with medium waxiness. Plants 'CTC75064-3' exhibit obovate-shaped buds with pubescence in the apical position of the bud. The leaf architecture is erect with curved tips. The middle auricle is lanceolate, with a ligule in crescent shape.

[00196] Agronomic and phenotypic characteristics of plants of event CTC75064-3 were evaluated in comparison to the parental variety RB ^' 867515' and three commercial reference cultivars, in 6 representative locations of the parental variety's cultivation area. The average plant height (measurements performed at 330 days after planting - DAP, except in Juazeiro, where the measurement was performed at 210 DAP), stem diameter (measurements performed at 330 days after planting - DAP, except in Juazeiro, where the measurement was performed at 210 DAP); number of offspring (measurements carried out at 30, 60, 90, 120, 150, 180, 210, 240, 270, 300 and 330 DAP; test not carried out in Juazeiro-BA), plot weight (measurements carried out at 330 Days after planting - DAP, except in Juazeiro, where the measurement was carried out at 210 DAP), sugar content (BRIX %; measurements carried out at 330 Days after planting - DAP, except in Juazeiro, where the measurement was carried out at 210 DAP), flowering (observations throughout the development cycle up to 330 DAP, except in Juazeiro, where observations were carried out up to 210 DAP) and tons of pol% (% sucrose in sugarcane juice) per hectare (TPH ; measurements performed at 330 days after planting - DAP, except in Juazeiro, where the measurement was performed at 210 DAP) were evaluated. TPH is calculated according to the formula:

[00197] For each dataset, data from all sites were combined for statistical analysis. The combined analysis was performed using the following statistical model:

where y, _jk measure of repetition j at site / for treatment k; μ is the general mean; If local effect /, / = 1 to 6; B _j effect of repetition j, j = 1 to 4; B(S) _ij effect of repetition j within site / (j=1 to 4); G _k is the effect of treatment k, k = 1 to 7; (SG)i _k interaction between site / and treatment k; Sijk is experimental residual error.

[00198] The main effect analyzes and interaction models are performed as described Kuznetsova et al. (2017). All information was analyzed using a mixed linear model through Ime4 (Bates et al., 2015).

[00199] The results of the analysis of agronomic and phenotypic traits are shown in the table below and corroborate the conclusion that the event 'CTC75064-3' is similar to its parental variety ( ^' RB867515 ^' ).

TABLE 01. Comparison of means for agronomic and phenotypic traits for OTC75064-3' and 'RB867515' (parental). Combined analysis for the locations Barrinha-SP, Piracicaba-SP, Valparaíso-SP, Quirinópolis-GO, Mandaguaçu-PR and Juazeiro-BA. The results of Juazeiro - BA were collected at 210 DAP, while in the other locations the collections were carried out at 330 DAP.

^* Significant difference between the transgenic event and the parental variety by the t test at the 5% level (p < 0.05). ^** Interval: Minimum and maximum average values of 3 reference commercial varieties. † Not rated in Juazeiro (BA).

[00200] Other compositional studies were carried out and also demonstrate that 'CTC75064-3' is similar to its parental variety ('RB 867515') [compositional parameters related to nutrition and use of sugar cane in the diet, as defined by the OECD Guidance Document (OECD, 2011)]. Based on the results of the joint analysis (6 representative locations of sugarcane growing regions in Brazil), it is suggested that the presence of CrylAc and Nptll proteins present in the analyzed samples do not significantly interfere in the bromatological composition of the event CTC75064 -3 compared to the parental variety RB 867515, and that the compositional equivalence observed for the 11 evaluated parameters corroborate the premise that there is a high similarity between the event CTC75064-3 and its parental variety RB 867515.

TABLE 02. Mean values of the compositional parameters measured in the genetically modified event 'CTC75064-3' and its conventional parental variety 'RB 867515'.

¹ Results are expressed on a dry weight basis; ² Values expressed based on sugar cane stalk; ^* Significant difference between the transgenic event and the parental variety by the t test at the 5% level (p < 0.05). ^** Interval: Minimum and maximum average values of 3 reference commercial varieties. † Not evaluated in Juazeiro (BA).EP: Standard Error; Examples

Example 1. Generation of Event CTC75064-3 - Transformation by Agrobacterium.

[00201] Event CTC75064-3 was obtained by genetic transformation mediated by Agrobacterium tumefasciens of the cultivar RB 867515. [00202] The cultivar RB 867515 is a commercial hybrid that is a genotype donor for event CTC75064-3 (genetic background) ; thus, it represents the reference untransformed manifold for event CTC75064-3. This cultivar has medium to late maturation and has been planted especially in south-central Brazil. Thus, like other commercial hybrids, it is a material with high ploidy and many chromosomes derived from two parental varieties: S. officinarum and S. spontaneum (DANIELS and ROACH, 1987; SREENIVASAN et al., 1987).

[00203] Event CTC75064-3 has the crylAc gene, which expresses a toxin to control D. saccharalis, and the nptll gene, used as a selection marker during the genetic modification process. The development of event CTC75064-3 was proposed to control the sugarcane borer. It is expected that after the hatching of the larvae from the eggs in the leaves of the event CTC75064-3, the young larvae begin to feed and, when ingesting the CrylAc protein, they are controlled before penetrating the stem of the plants of the event CTC75064-3, avoiding the economic damage of the pest to the crop. The crylAc gene expression is regulated by the promoter region comprising CaMV 35s promoter with duplicated enhacer (2xCaMV35s), wheat L-Cab leader sequence, rice actin intron (OsACTI) and Kosak sequence 5' upstream from the transcription start site. The expression of the nptll gene is regulated by the corn ubiquitin gene promoter - UBI-1 (which has an endogenous intron). The crylAc expression cassette uses the CaMV 35S terminator and the nptll cassette uses the no- paline synthase from Agrobacterium tumefaciens (nos).

1.1 Development of the Construct containing the crvIAc and notII genes (Figure 5: SEQ ID NO 14).

[00204] Conventional gene cloning techniques using commercial bacterial plasmids and digestion and ligation of fragments through the use of restriction enzymes and ligases were used to construct the construct of the present invention (Figure 5).

[00205] The construction of the present invention was developed by joining the 2xCaMV35s-cry1Ac-T35s and UBI-nptlITNOS cassettes. The T-DNA containing both cassettes was transferred by traditional cloning to the base plasmid (Figure 4; binary plasmid vector, which contains the bacteria Escherichia coli and Agrobacterium tumefaciens in its host spectrum), generating the plasmid bi - nary containing the construct of the present invention (Figure 5; SEQ ID NO 14).

[00206] After the final cloning of the construct (SEQ ID NO 14), it was inserted by heat shock into the Escherichia coli TOP10 strain. An isolated colony containing the construct, which was inoculated in liquid LB medium supplemented with 150 μg/mL of spectinomycin and incubated at 37°C, with agitation of 250 rpm for a period of 16 hours. Stocks containing bacterial suspension and 10% glycerol (v/v) were then prepared and stored in an ultrafreezer at 80°C.

[00207] The construct of the present invention was then transferred from E. coli to Agrobacterium tumefaciens strain EHA105 by isolating and purifying the plasmid DNA and transforming the Agrobacterium by electroporation. An isolated colony of agrobacteria containing the desired vector was inoculated into liquid LB medium supplemented with 100 μg/ml of spectinomycin and 50 μg/ml of rifampicin and incubated at 28°C, with agitation at 200 rpm for a period of 24 h. - ras. Stocks containing bacterial suspension and 10% glycerol (v/v) were then prepared and stored in an ultrafreezer -80°C. These stocks were used in the genetic transformation experiments that gave rise to event CTC75064-3.

1.2 Transformation of plants mediated by Aarobacterium [00208] To obtain embryogenic callus, young curled leaves (palm hearts) of sugarcane variety RB 867515, grown in the field or in a greenhouse for up to 12 months, were collected for isolation of initial explants.

[00209] After surface disinfection, cross-sections about 0.05-5mm thick were cut from the region above the meristem under aseptic conditions. Sections were placed on the surface of callus-inducing culture medium [Salts MS - Murashige and Skoog, 1962; sucrose, vitamins B5, amino acids selected from the group comprising proline, casein hydrolyzate, citric acid, mannitol, copper sulfate, glycine, gelling agent, 2,4D] Cultures were kept in the dark at a temperature of 26°C± 2°C , being subcultured every 15 days, for three to five cycles of 7-28 days each. One week before transformation, the calluses were again selected for embryogenic characteristics (nodular, compact, opaque and slightly yellow).

[00210] The Agrobacterium culture, comprising the EHA105 strain transformed with the binary plasmid of the present invention, was started from a glycerol stock and kept in the dark at 28°C for two to three days. The Agrobacterium suspension to infect the plant material was prepared by resuspending the culture in MS liquid medium plus acetosyringone, adjusting to a final ODeoo of 0.1-1.0 (MS salts, sucrose and vitamins B5).

[00211] The calluses with embryogenic characteristics were visually selected and directly transferred to the suspension of Agrobacterium, where they remained for 30 minutes, in the dark with constant agitation at 50 rpm.

[00212] After this period, the calluses were separated from the Agrobacterium suspension and the excess suspension was removed. Then, the calluses were cultured for 1-5 days in semi-solid (MS salts, sucrose, vitamins B5, citric acid, gelling agent, 2,4D and acetosyringone) at 22°C in the dark.

[00213] After co-cultivation, the calluses were transferred to DT resting medium (MS salts; sucrose, vitamins B5, amino acids selected from the group comprising proline and asparagine, casein hydrolyzate, citric acid, copper sulfate, glycine , gelling agent, 2,4D, thimetine]) and kept for 5-14 days at 26°C in the dark.

[00214] The transformed cells were selected by successive subcultures in a selection culture medium containing phytoregulators and the selective agent, geneticin (selection medium with geneticin, MS Salts; sucrose, vitamins B5, amino acids selected from the group comprising proline and asparagine, casein hydrolyzate, copper sulfate, glycine, gelling agent, 2,4D, thimetine). The calluses remained in this condition for 21 days at 26°C in the dark. Then, the calluses were transferred to the regeneration medium (equivalent to the selection medium without 2,4D) and later to the elongation medium (MS salts; sucrose, vitamins B5, casein hydrolyzate, gelling agent, timetine), and for a photoperiod of 16 hours at 4000 lux. Plants regenerated in the presence of the antibiotic used as a selective agent were multiplied, rooted and acclimatized before being transferred to a greenhouse, including the clone that later gave rise to event CTC75064-3, for which the methods for its characterization.

Example 2. Molecular Characterization of event CTC75064-3

2.1 DNA Extraction. [00215] Approximately 10 mg of leaf tissue from event CTC75064-3 was used. Genomic DNA extraction was performed in the BioSprint 96 nucleic acid extractor (Quiagen, GER) with the BioSprint 96 DNA Plant Kit (Quiagen, GER) extraction kit, according to the manufacturer's instructions. The DNA obtained was normalized to a concentration of 10 ng/μL in a Multiskan GO spectrometer (Thermo Scientific, USA).

2.2 Determination of the number of copies of the transgene inserted into the germplasm of the host plant.

[00216] The number of copies of genes crylAc and nptll inserted in event CTC75064-3 was initially evaluated by quantitative PCR via Taqman ^® (qPCR/Taqman ®), and its results were later confirmed via Southern blot and/or or sequencing.

[00217] Real-time PCR reactions via Taqman ^® were performed using the 7500 Real-Time PCR System equipment (Applied Biosystems, USA) in its Fast mode. The sets of primers and probes used are described in TABLE 3.

TABLE 3: Primers and probes (Taqman®) used to determine the number of copies via qPCR.

Assay Primers I probes Sequences 5' - 3' Amplicon

_ (Pb) crylAc - 0 pCTC001_Cry1Ac.F GAGGTGCCAATCCACTTCCC 82

crylAc - 1 cry1AcF.1_SB CAT CCCAT ACAACTGCCT GAG 103

SEQ ID NO 43 cry 1 AcR .1 _SB CTGGGTCAAGGACAGGGAGAT

probe1_cry1Ac_SB CCGGTTACACCCCC

SEQ ID NO 45 Assay Primers I probes Sequences 5' - 3' Amplicon

probe2_cry1Ac_SB TCTCCGCGAGGAAA

SEQ ID NO 48 crylAc - 3 cry1AcF.3_SB CACCGTGCTGGACATT GT GT 77

SEQ ID NO 49 cry1AcR.3_SB T GAGTTGGG ACACGGT GC

SEQ ID NO 50 probe3_cry1Ac_SB CTCTT CCCG AACT ACG ACT

SEQ ID NO 51 crylAc - 4 cry1AcF.4_SB ACCCTGTCCTCCACCCTGTA 107

Assay Primers I probes Sequences 5' - 3' Amplicon

(Pb)

(, backbo - c-StaA.R CCGCCGACCTGGTGGA ne) SEQ ID N065 c-StaA_BB_probe FAM-CGTGACCTCAATGCG-MGB

aad-A aad-A_BB_F CACAATCGTCACCTCAACCG 75

SEQ ID NO 67

(backbo-aad-A_BB_R AT CAACG ACCTT CTGGAAACG ne) SEQ ID NO 68 aad-A_BB_probe N ED-CGCAGGATTTCGCTCTCG-

MGB

SEQ ID NO 69

[00218] As endogenous control of the reactions for crylAc and nptll, in order to confirm the presence and quality of the DNA used, as well as the effectiveness of the reaction, the sugarcane polyubiquitin gene was used [Initiator sense: 5 'ACCATTACCCTGGAGGTTGAGA 3 ' (SEQ ID NO: 15); antisense primer: 5' GTCCT GGAT CTT CGCCTT CA 3' (SEQ ID NO: 16); probe: VIC -5 'CTCTGACACCATCGAC 3'-MGB (SEQ ID NO:17)], in a multiplex mode.

[00219] The qPCR reactions used 1X TaqMan® Fast PCR Master Mix II (Applied Biosystems, USA), 300 nM of each primer and 200 nM of the corresponding probes. The cycling used was: one cycle of 50°C for 2 minutes for activation of uracil-N-glycosylase, one cycle of 95°C for 20 seconds for activation of DNA polymerase, 40 cycles of 95°C for 3 seconds (denaturation) and 60°C for 30 seconds (annealing and extension).

[00220] Data analysis was performed by manually entering the threshold (threshold) in the exponential phase of the amplification curve. For the crylAc and nptll genes, the copy number was inferred from the analysis of DeltaCt (dCt), in which the Ct (cycle in which the fluorescence signal emitted by the amplification product reaches the threshold) of the endogenous gene is subtracted from the Ct of the target gene. In this type of analysis, it is considered that the number of copies doubles for each Ct and is taken as reference the number of copies of controls of the same variety whose value is known. Additionally, the number of copies for the crylAc gene was confirmed by calculating delta-Ct (dCt), using as a reference internal controls of the variety itself, whose result is expressed in exponential numbers (1, 2, 4, 8, 16 copies).

[00221] The results of the assays indicate the presence of 1 copy of the crylAc gene and 1 copy of the nptll gene present in the genome of the CTC75064-3 event.

[00222] For the Southern blot assay, 10 μg of genomic DNA from event CTC75064-3 was digested separately with different restriction enzymes (EcoRV, Hindlll and Shpl), followed by the probe cold labeling procedure (Digoxigenin - DIG). Briefly, genomic DNAs from event CTC75064-3 and from the parental variety RB 867515 were extracted using NucleoSpin® Plant II kit in tubes, following the manufacturer's recommendations (Macherey-Nagel GmbH & Co. KG, Germany). The quality of the extracted DNA was verified on a 1% agarose gel in 1X TAE buffer (Tris-Acetate EDTA) and 10 μg of DNA was digested using 100 units of restriction enzyme (10 U/μg of gDNA) per sample, in a final volume of 400 µl of reaction. [00223] The enzymatic reaction was performed according to the manufacturer's instructions (Thermo Fisher, USA). The digestion product was precipitated in 2 volumes of ethanol and 10% 7.5M ammonium acetate, and incubated for 48 h at -20°C. The precipitated DNA was centrifuged at 14,000 x g for 30 min and the formed pellet was resuspended in 35 µl milli-Q water until complete dissolution. Digestion quality was visualized on 1% agarose gel with 1X TAE buffer (Tris-Acetate - EDTA). EcoRV and Hindlll enzymes were used to detect cassettes containing crylAc and nptll genes (Figure 23 A). The Sphl enzyme was used to detect the vector backbone (Figure 23B).

[00224] Probes were designed to detect the crylAc gene (CrylAc probe - 1.079 bp), nptII gene (nptII probe 579 bp), and CaMV 35s promoter region (CaMV 35s promoter and OsACT intron; 35S probe - 904 bp), present in event CTC75064-3. The probes to detect fragments of the vector (backbone) were designed through the vector, covering ~98% of the backbone (probe BB1 - 1875 bp; probe BB2 -2305 bp; probe BB3 -2282 bp; Figure 23 B). Probes were prepared and used to detect targets using PCR reagents from the DIG Probe Synthesis Kit (Roche, cat # 11636090910, Switzerland). About 100 μg of the linearized vector were used as a template for amplification of regions of interest and incorporation of the digoxigenin molecule (DIG; labeling) by PCR for use as a probe. The primers used to produce the probes, the annealing temperatures (Thyb) and the expected size of each amplicon are listed in Table 04.

[00225] DNA from the RB 867515 variety was used as a negative control. As a positive control, plasmid DNA containing the construct used to obtain event CTC75064-3 was added to the genomic DNA of RB 867515. The plasmid DNA was previously linearized with the restriction enzyme used in each assay.

Table 04. List of primers used in the synthesis of probes labeled with DIG.

[00226] The transfer of the digested DNA to the nylon membrane was performed according to well-established protocols. Briefly, electrophoresis of DNA digested on 1% agarose gel with 1X TAE buffer is performed at 40 V for approximately 20 hours, using SYBR Safe DNA gel stain (Invitrogen # S33102, USA) as an intercalating agent. Subsequently, the agarose gel was treated with four different solutions in the following order:

• Depuration Solution (1.1% HCL); 10-15 min;

• Denaturation Solution (0.5 N NaOH; 1.5 M NaCI); 30-40 min;

• Neutralization Solution (1.5 M NaCI; 0.5 M Tris); 30-40 min;

• SSC 20x (Saline Sodium Citrate); 20 min [00227] Transfer of DNA to nylon membrane was performed using TurboBlotter Transfer System 20 x 25 (Sigma # WHA1 0416324, USA) according to manufacturer's instructions. The membrane with the transferred DNA samples was placed in a UV Crosslinker equipment (UVP-Analytik-Jena, Germany) for DNA fixation (2 cycles of 700 x 100 μJ/cm ² ). Prehybridization and hybridization were then performed.

[00228] The Prehybridization treatment consists of incubating the membrane with DIG Easy Hyb solution (Roche # 11603558001, Switzerland) at 40 °C for 3 hours, with denatured salmon sperm DNA at a final concentration of 100 μg. ml_-1 and constant rotation (0.5 x g). Afterwards, hybridization was performed with the same Prehybridization solution (DIG Easy Hyb with salmon sperm DNA) added to the DIG-labeled and denatured probe. The concentration used for the probes was 65 μg.ml_-1. The annealing temperature was 50°C.

[00229] Hybridization was performed in a hybridization oven for approximately 16 hours with constant rotation (0.5 xg). Hybridized membranes were washed and blocked. Afterwards, the blocking solution was discarded and the membrane was covered with a new blocking solution with Anti-Digoxigenin AP fragments (Roche # 11093274910, Switzerland) diluted in a ratio of 1:20,000. The membrane was then incubated for 30 min at room temperature and gently shaken. The antibody solution was discarded and the membrane was washed and incubated with Detection buffer (Roche # 11585762001, Switzerland) plus CDP-Star ready to use (Roche # 12041677001, Switzerland) at a final concentration of 1X, according to the manufacturer's instructions. A photographic film was added to detect chemiluminescence (Roche # 11666657001, Switzerland), kept in contact with the membrane for at least 16 hours and then immersed in 1x Developing Solution (Kodak # 1900943, USA) to visualize the bands. Fixation solution (1x) (Kodak # 1901875, USA) was used to fix the images of the detected bands. [00230] In the hybridization with the probes CrylAc and 35S, for the materials digested with Hindlll, a single band with about 8.5 kb is observed in all samples of event CTC75064-3 (Figure 24 - left; Figure 25 - right). For the same probes, samples digested with EcoRV show fragments of about 2.79 kb in all samples of event CTC75064-3 (Figure 24 - right; Figure 25 - left). Hybridization with the nptII probe, in materials digested with HindIII, a fragment with expected size of ~3.5 kb is observed in all samples from event CTC75064-3 (Figure 26 - left). For the EcoRV enzyme, a fragment > 12 kb is observed (Figure 26 - right).

[00231] The results of the Southern blot, using the enzymes EcoRV and Hindlll in combination with the probes that recognize the genes crylAc, nptll and the 35s promoter, confirm the results obtained using qPCR, which indicate that the event CTC75064-3 it has only a single T-DNA integration, with a single copy of the crylAc gene and a single copy of the nptll gene in the genome. Additionally, the presence of the same fragments in all generations of event CTC75064-3, from samples from consecutive vegetative generations (T0 - T3; Figures 24, 25 and 26), confirm the genetic stability of the insertion of the event over 4 generations of vegetative multiplication. Vector backbone sequences were not detected in event CTC75064-3 (Figure 27).

2.3 Definition of flanking sequences.

[00232] To isolate the flanking regions at the ends of the T-DNA inserts present in event CTC75064-3, several DNA sequencing experiments were performed. The genetic insertion map present in event CTC75064-3 resulting from the data generated by these experiments is shown in FIGURE 3.

[00233] Reverse PCR (iPCR) assays were performed for am- at the ends of the T-DNA in order to isolate and clone the flanking regions of the insert. The iPCR methodology is based on the digestion of genomic DNA using enzymes that cleave the T-DNA sequence and a random sequence of the event's genome. The cleavage products are circularized and subjected to multiple cycles of nested PCR (nested PCR), using primers for known regions of the T-DNA (TABLE 5). From the isolation, sequencing and analysis of the amplified bands in the iPCR reactions by Sanger methodology, a consensus sequence of the flanking regions was defined (SEQ ID NO: 23 and SEQ ID NO: 24).

TABLE 5. Restriction enzymes and primer sequences used to carry out the iPCR reactions and conditions of the amplification reactions.

Number of Denaturation Annealing Extension cycles

1st 94°C, 5 min

2-36th 94 °C, 30 sec 50 °C 45 sec 72 °C, 3 min

37th - - 72°C, 7 min

[00234] In parallel, as there is currently no fully sequenced genome that could be used as a reference for the RB 867515 germplasm, a capture sequencing methodology was adopted as an additional effort for the isolation of T-DNA inserted in event CTC75064-3 and its flanking ions. In this strategy, small overlapping polynucleotide fragments (probes) were developed in order to cover the entire T-DNA sequence. These probes were hybridized with fractionated genomic DNA from both cultivars, RB 867515 and CTC75064-3, and the hybrid sequences were isolated. The isolated fragments were then sequenced using lllumina® technology according to standard protocol. The data obtained were aligned with the T-DNA sequence present in the transformation vector and, together with the data obtained by iPCR mentioned above, the consensus sequence of the T-DNA insertion (SEQ ID NO 2) present in the event CTC75064-3 was defined, as well as its flanking sequences (SEQ ID NO: 23, SEQ ID NO: 24) and the sequences of the junction between the ends of the inserts and the sugarcane genome of event CTC75064-3 (SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 18, SEQ ID NO 19). In this way, the consensus sequences of event CTC75064-3 were defined (SEQ ID NO 5 and SEQ ID NO 22). 2.4 Method of detection and characterization of event CTC75064-3 - event-specific assay.

[00235] For the validation of the methodology, leaf samples from the event from Piracicaba were used) As experimental controls, other genetically modified events that have the same construction and untransformed control plants (WT) were used. DNA extraction took place as described above.

[00236] From the molecular characterization of the sequences flanking the insertion of the T-DNA in the genome in the event CTC75064-3 of genetically modified sugarcane, it was possible to design and validate real-time PCR assays for the unequivocal identification of the event. For the development of a specific detection methodology, the real-time PCR (qPCR) technique known as "Plus-Minus" or "Presence-Absence" was chosen, both of which were validated. Methodology variations: via SYBR GREEN and via Taqman ^® technology. Two specific amplification primers (primers) were designed to generate information about the T-DNA insertions in both methodologies, so that, for each primer pair, one primer anchors in the spacer region and one second primer anchors in the genome. For the use of Taqman ^® technology, specific probes were designed between the primers.

[00237] In a preferred embodiment of the invention, the primers designed are characterized as defined in SEQ ID Nos: 6 to 9, where Primer SEQ ID NO: 6 is the right edge sense primer and the sequence primer SEQ ID NO: 7 is the right edge antisense primer, the SEQ ID NO: 8 primer is the left edge sense primer, and the sequence primer SEQ ID NO: 9 is the left edge antisense primer (Table 06).

[00238] In a preferred embodiment of the invention, the probe employed in the PCR via Taqman ^® technology to identify the CTC75064-3 event comprises the SEQ ID NO: 10 in the right border (RB border) and/or the SEQ ID NO: 11 on the left border (LB border).

[00239] Real-time PCR reactions via Taqman ^® were performed using the 7500 Real-Time PCR System equipment (Applied Biosystems, USA) in its Fast mode.

[00240] As an endogenous reaction control, in order to confirm the presence and quality of the DNA used, the sugarcane poly-ubiquitin gene was used (sense primer: SEQ ID NO: 15; antisense primer: SEQ ID NO: 16; probe: SEQ ID NO: 17) multiplexed with the assay developed for the event. TABLE 6. Sequences of primers and probes developed in the present invention for event-specific identification (Real-time PCR).

[00241] The qPCR reactions used 1X TaqMan® Fast PCR Master Mix II (Applied Biosystems, USA), 150 nM of each specific primer for the event of the invention and 100 nM of the corresponding probe, 300 nM of the primers for the gene endogenous poly-ubiquitin and 200 nM of your probe, 100-200 ng of DNA and enough water to complete the volume of 20 μL. The cycling used was: one cycle of 50°C for 2 minutes for activation of uracil-N-glycosylase, one cycle of 95°C for 20 seconds for activation of DNA polymerase, 40 cycles of 95°C for 3 seconds (denaturation) and 60°C for 1 minute (annealing and extension).

[00242] The qPCR reactions using SYBR GREEN were also performed using the 7500 Real-Time PCR System equipment (Applied Biosystems, USA), in its standard mode for this type of assay. Reactions were performed using 1X the QuantiFast SYBR Green PCR Kit (QIAGEN™), 150 nM sense primer and 150 nM antisense primer, 20 ng DNA and enough water for a final volume of 25 μL. They were performed using the event of the invention and, as negative controls, the other events transformed with the same construction of the event of the invention (negative controls), in addition to samples of wild sugarcane (WT) and experimental controls. (extraction and reaction blank).

[00243] The cycling parameters used were: a cycle of DNA denaturation at 95°C for 5 minutes, 35 cycles of primer annealing and amplification at 95°C for 15 seconds and 60°C for 1 minute and a cycle of dissociation to generate the "melting peak" (95°C for 15 sec, 60°C for 1 min, 95°C for 15 sec). The reaction with SYBR safe does not allow the use of multiplex, requiring the preparation of a new endogenous gene amplification reaction, using the same DNA, to eliminate false negatives.

[00244] As a result, it was possible to validate the specific detection reaction for the event of the invention via Taqman ^® with high accuracy, as illustrated in Figure 6. Taqman® technology probes specifically bind to DNA and are released during DNA amplification, generating a fluorescence signal captured by the equipment during the process.

[00245] Multiplex qPCR reactions, comprising primers and probes from all flanking regions that characterize the event, as well as the endogenous control of poly-ubiqutitin, can be performed to identify the event. In the same way, the specific reactions for each flanking region performed only in multiplex with the poly-ubiquitin gene are also sufficient to unequivocally identify the event.

[00246] The samples corresponding to the event of the invention presented specific amplification, with formation of an amplification curve. well-defined formation, with a characteristic sigmoid shape, while the samples from the other events, as well as WT and blanks from the extraction and reaction, showed no event-specific amplification. The endogenous control showed amplification for all samples, except for extraction and reaction blanks, as expected, evidencing the quality of the DNA used in the reaction, as well as the quality of the reaction and cycling.

[00247] The assay via SYBR GREEN™, in turn, showed specific amplification of the samples from the event of the invention at the expected melting temperature. The samples from the other events, as well as WT and blanks, showed no amplification peak (Figure 7). Example 3. Reconstruction of event CTC75064-3 using site-directed insertion techniques (Genomic Editing).

[00248] The CTC75064-3 event can be generated using genomic editing (GE) tools, recreating the event initially developed through an Agrobacterium-mediated genetic transformation method, as presented by the present invention. [00249] In this way, the event CTC75064-3 is recreated by inserting the CrylAc gene at the same location in the genome of the cultivar RB 867515 as described for the event CTC75064-3. The expression of the CrylAc gene is regulated by a promoter or a promoter region and a terminator capable of driving the expression of the CrylAc protein to levels sufficient to control the infestation of the target pest. Additionally, a marker gene or a selection system is also inserted (transiently or stably) to allow selection of the event. Preferably, the T-DNA of the present invention (SEQ ID NO: 2) is inserted into the genome-specific site(s) as described for event CTC75064-3. In this way, the CTC75064-3 event is recreated with the insertion of the crylAc gene, which expresses the toxin that controls D. saccharalis, and the nptll gene. THE crylAc expression by the promoter region comprising CaMV35s promoter with duplicated enhancer, wheat L-Cab leader sequence, OsACTI intron and Kosak sequence 5' upstream from the transcription start site. The expression of nptll genes is regulated by the maize ubiquitin 1 (UBI-1) promoter, which has an endogenous intron. The crylAc expression cassette has CaMV35s terminator (T35s) and the nptII expression cassette uses Agrobacterium tumefaciens nopaline synthase terminator (nos).

[00250] If the GE strategy defined for the generation of the CTC75064-3 event results in a low efficiency of T-DNA integration at the specific insertion site of CTC75064-3, developmental genes, morphogens or other regulatory elements may be used in conjunction with Genomic Editing (GE) reagents to improve integration efficiency.

3.1 Development of Constructions

[00251] Conventional gene cloning techniques using commercial plasmids, restriction enzyme digestion, ligation of fragments through ligases and other known methodologies are used to develop the constructs (plasmids) of the present invention.

[00252] GE reagents can be delivered in multiple constructs (plasmids), each comprising an element of the enzyme complex (endonuclease, crRNA or guide RNA, and the homologous recombination template-HR).

[00253] In one embodiment of the present invention, the construct of the homologous recombination (RH or HR) template comprises the T-DNA (SEQ ID NO 2), flanked by DNA fragments homologous to the flanking sequences of event CTC75064-3 (SEQ ID Nos: 23 and SEQ ID Nos: 24), located on both sides of the T-DNA. Thus, it is an aspect of the present invention a construction comprising the T-DNA sequence selected from the group consisting of SEQ ID NO: 2 and flanked at the 5' and 3' ends by DNA sequences homologous to the flanking sequences characterizing event CTC75064-3, which are selected from the group consisting of SEQ ID Nos: 23 and SEQ ID Nos: 24. The orientation of the sequences is defined by the orientation of the T-DNA in the genome of the event CTC75064-3 such that the homologous recombination template is characterized by comprising an identical or substantially identical sequence. to SEQ ID NO 22. In a preferred scope the homologous recombination (HR) template construct comprises SEQ ID NO: 26 (Figure 21). [00254] The invention also comprises a second construct comprising an endonuclease expression cassette. In a preferred scope, the endonuclease expression cassette comprises the sequence of a Cas9 endonuclease. In an even more preferred scope the endonuclease sequence is codon optimized for expression in sugar cane. A third construct is also contemplated by the present invention comprising only the guide RNA/crRNA expression cassette is also contemplated by the present invention. In an alternative aspect of the invention, the Cas 9 endonuclease-containing construct additionally comprises the guide RNA/crRNA sequence. Preferably, the Cas9 construct comprises the crRNA sequence SEQ ID NO: 28. In a more specific scope, the Cas9 construct comprises SEQ ID NO: 27 (Figure 20). A third construct comprising only the guide RNA expression cassette is also contemplated in the present invention and comprises SEQ ID NO: 28 [00255] ) which comprises the endonuclease expression cassettes, the guide RNA (sgRNA) and the homologous recombination template containing the sequence(s) sequences of interest. In a scope of the invention, the single construct comprises the T-DNA sequence of the present invention (SEQ ID NO: 2), flanked at the 5' and 3' ends by DNA sequences homologous to the flanking sequences that characterize event CTC75064-3 , which are selected from the group consisting of SEQ ID Nos: 23 and SEQ ID No 24 located at both ends of the T-DNA. In a preferred scope, the construct comprises SEQ ID NO: 25 (Figure 22). The orientation of the sequences is defined by the orientation of the T-DNA in the genome of event CTC75064-3 such that the homologous recombination template is characterized by comprising sequence identical or substantially identical to the sequence selected from the group consisting of SEQ ID NO 22.

[00256] Optionally, the constructs also comprise selection/fluorescent markers and/or other genetic engineering systems for removing selection markers and/or nuclease cassettes, such as the Cre homologous recombination system /loxP of bacteriophage P1. In this case, the marker/nuclease expression cassette, which must be deleted, is flanked by LoxP regions, while the Cre recombinase removes this fragment during its transient expression.

3.2 Direct Delivery

[00257] In one aspect, the event of the invention is generated using methodologies for the direct delivery of proteins, RNA or plasmids. Methodologies for direct delivery are selected from the group consisting of particle bombardment, electroporation, lipofection and protoplast transfection; however, other methodologies known to one skilled in the art may also be used.

3.2.1 Direct Delivery - RNP (ribonucleoprotein) strategy

[00258] In a preferred embodiment, the event of the present invention can be generated using ribonucleoproteins (RNP) or the direct delivery of sgRNA to the cells or plant tissue to be transformed. Among the preferred methodologies for the direct delivery of the RNP/sgRNA complex are the bombardment of sugarcane callus particles and the transfection of protoplasts, without, however, being limited to these, being possible to use other methods. methodologies for the transmembrane transport of molecules, as is known in the State of the Art. In addition, other cell types can be used for transformation, including, but not limited to: leaf discs, meristem, callus, and suspension cells.

[00259] In this modality, the endonucleases and the crRNA or guide RNA are delivered directly to the plant cell in the form of an RNP, separated from the homologous recombination (RH) template, which is delivered through a plasmid.

[00260] The guide RNA must be preliminarily produced by in vitro transcription or be chemically synthesized as a ribooligonucleotide, while the corresponding nuclease can be produced in vivo and later purified (bacterial expression) or purchased from the manufacturer of these products. In one scope of the invention, the nuclease is Cas9.

[00261] The ready-to-use ribonucleoprotein (RNP) complex consisting of the corresponding nuclease and guide RNA, and the plasmid containing the RH template are absorbed into gold particles and delivered directly to cells or tissues.

3.2.2 Direct Delivery - Plasmids

[00262] In another embodiment, event CTC75064-3 is recreated through the direct delivery of plasmids containing the sequences necessary for the expression of the components of CRISPR-Cas systems and provision of the template for homologous recombination using the machinery of the cell/plant tissue itself, which must be expressed transiently for the synthesis of the complement. enzyme capable of performing site-specific cleavage for homologous recombination. The methodologies for the delivery of plasmids are selected from the group consisting of particle bombardment (biolistics) of sugarcane callus and transformation of protoplasts with polyethylene glycol; however, other transformation methodologies known in the state of the art can be used, as well as other tissues besides callus, such as: protoplasts, leaf discs, meristems, fine cells in suspension, among others.

[00263] Still in an additional modality, the event of the invention can be generated through the use of plasmids, where the components of the enzymatic complex are stably inserted in the genome of the recipient organism (RB 867515), being expressed and needed. excised after transformation through, for example, the use of a Cre/Lox system or equivalent. The choice of this alternative can generate the permanence of LoxP sites inserted in the plant genome. Other DNA excision strategies known from the prior art can be used to remove the EG reagent from the DNA of the plant genome of event CTC75064-3. Genome editing reagents can be delivered in multiple plasmids, but are preferably delivered in a single plasmid, which comprises LoxP sites, a selection marker, the endonuclease sequence, sgRNA, and the homologous recombination template. .

3.3 Indirect delivery

[00264] In one scope, the event of the present invention is generated using indirect plasmid delivery methodologies, such as, for example, Agrobacterium-mediated transformation. Agrobacterium tumefaciens and Agrobacterium rhizogenes can be used. Plant viruses can also be used for indirect delivery of plasmids to plant cells and tissues. For example, geminivirus ge- netically modified genes make it possible to achieve a high efficiency of transformation, especially if the considered strategy does not contemplate the stable insertion of the constructs in the genome. In addition, different tissues and cell types can be used for transformation including, but not limited to: calus, protoplasts, leaf discs, meristems, and calus-derived suspension cells. [00265] In a preferred scope, Agrobacterium-mediated transformation is carried out as described in Example 1.

[00266] In another preferred scope, the event of the invention is generated through delivery of the plasmid by Agrobacterium-mediated transformation, where the EG reagents are expressed in a transient manner, achieving site-directed integration of CTC75064 -3 without the integration of additional transgenes associated with the EG strategy.

[00267] EG reagents can be delivered on multiple plasmids, but preferably, on a single plasmid. In a preferred scope, the construct is SEQ ID NO: 25 and comprises a selectable marker, a nuclease, the guide RNA/crRNA, and the homologous recombination template (RH; Figure 22). The homologous recombination template comprises a T-DNA sequence selected from the group consisting of SEQ ID NO: 2 and flanked at the 5' and 3' ends by DNA sequences homologous to the flanking sequences that characterize event CTC75064-3, the which are selected from the group consisting of SEQ ID Nos: 23 and SEQ ID Nos: 24 and located on either side of the T-DNA. The orientation of the sequences is defined by the orientation of the T-DNA in the genome of event CTC75064-3 such that the homologous recombination template is characterized by comprising sequence identical or substantially identical to the sequence selected from the group consisting of SEQ ID NO 23 and SEQ ID NO 24. [00268] In one scope, the event of the invention is generated using indirect delivery through plasmids where EG reagents are stably expressed, thus necessitating excision of EG reagents and/or selection markers integrated through, for example - by the Cre/Lox system. The choice of this alternative can generate the permanence of LoxP sites inserted in the plant genome. Other DNA excision strategies known from the prior art can be used to remove the EG reagent from the plant genome DNA of event CTC75064-3.

[00269] Morphogenetic genes or other regulatory elements can be included in any of the strategies described above, enabling improvements in transformation efficiency (delivery and genomic integration).

[00270] Considering any of the transformation processes described above, the resulting transformed cells will be regenerated to form a plant identical or substantially identical to the event of the present invention.

3.4 Molecular Characterization

[00271] The event generated through the use of Genomic Editing, is evaluated by the exact incorporation of the T-DNA in the insertion sites that characterize the CTC75064-3 event, through the primers (SEQ ID NO: 6-9) and probes (SEQ ID NO: 10-11) described in the present invention. [00272] Pairs of primers designed to amplify sequences close to the insertion sites of the homologous recombination template can be used to confirm the integrity of the recombination site (Table 7, Figure 28). Additionally, amplification reactions using specific primers for the amplification of the sequences of the genomic editing reagents should be performed to confirm the absence of these components from the genome of the regenerated plant. TABLE 7. Primer pairs designed for the flanking sequences of CTC75064-3.

[00273] PCR reactions use 0.2 mM primers (Table 7), 20ng DNA, 1X Dream Taq- Thermo Fisher buffer (Thermo Fisher Scientific Inc - USA), Taq polymerase (final volume 20 mI_). Reaction conditions: 1 cycle at 94°C for 1 min; 35 cycles at 94°C for 30 seconds, 65°C for 45 seconds and 72°C for 3 min; and 1 extension cycle at 72°C for 7 minutes. For Amplicons with more than 2kb, the reactions are performed with 1U of Takara LA Taq enzyme - Takara (Takara Bio Inc- USA), 1 X LA PCR Buffer (Takara Bio Inc - USA), 2.5 mM MgCl2, 2 .5 mM dNTP, 0.5 mM primers and 200 ng DNA (50 µl final volume).

[00274] The amplicons obtained by PCR reactions with the combination of primers “T-DNA” and “Flanking Regions” of TABLE 07, must be submitted later to sequencing, for example Sanger sequencing, using the primer pairs de- coded in the internal regions of the T-DNA of event CTC75064-3 to, after alignment and generation of the final consensus sequence, confirm the integrity of the modified genomic region and the inserted sequences (TABLE 08).

TABLE 8. Primer pairs designed for the inner regions of the T-DNA of event CTC75064-3.

invention event.

[00275] The product of gene expression in the event of the present The invention was characterized in detail through the use of ELISA methodology, to determine the concentration of CrylAc and Nptll proteins, and Western blot, to prove the identities of these heterologous proteins. The expression of crylAc and nptll genes in event CTC75064-3 was characterized in different tissues, stages of crop development and planting locations.

ELISA (Enzvme-Linked Immunosorbent Assav)

[00276] For the production of tissue samples from the event CTC75064-3 and the control (parental variety) for carrying out the ELISA assays, experiments were carried out in representative locations of the cultivation areas of the parental cultivar RB 867515, namely , Piracicaba, Barrinha and Valparaíso (SP), Quirinópolis (GO) and Juazeiro (BA) and Mandaguaçu (PR) (TABLE 09). At each site, the experiments were conducted in a randomized complete block design with 4 repetitions. The plots were composed of 10 lines of 8 meters, with a spacing of 1.5 meters between the lines.

TABLE 09. Information of the assays where the collections of samples for analysis of the expression of crylAc and nptll produced by the event of the invention were carried out. (Days after planting - DAP)

[00277] The analysis of the expression of the proteins CrylAc and Nptll in the event CTC75064-3 was investigated in different tissues and in different periods of the development of the culture cycles. The tissues and times evaluated (± 5 days) were:

1) Leaves throughout the crop cycle of event CTC75064-3 (100, 200 and 300 Days After Planting (DAP);

2) Leaves, stems and roots at the end of the crop cycle (330 DAP) of the first sugarcane cut. In Juazeiro, the material was evaluated at 210DAP.

[00278] Leaf samples were collected in plots of experimental treatments in AGRO/PHENO trials at 100, 200, 300 and 330DAP. Stems and roots were collected only at 330 DAP. The 330DAP samples were collected at 210 DAP in Juazeiro. After collection, samples were sent for ELISA analysis to determine the expression of CrylAc and Nptll proteins in event CTC75064-3.

[00279] Leaf Samples: 30 cm of tissue were collected from the tip of 5 to 10 "diagnosis" leaves in lines 2 and 3 in a zigzag pattern, avoiding diseased leaves. After removing the midrib, the leaves were chopped into pieces, homogenized and placed in previously identified plastic ziplock bags.

[00280] Stem samples: 10 whole canes were collected in a zigzag pattern. After removing the dry leaves and shoots, the canes were cut into small pieces, homogenized and packed in previously identified packages.

[00281] Root samples: a representative clump of lines 2 and 3 of the experimental plot was collected. The soil was crumbled and the roots washed with clean water to remove excess soil. Then, the clean roots were chopped into pieces, homogenized and placed in previously identified plastic bags. [00282] All tissue samples (leaf, stem and roots) were transferred to the styrofoam box with dry ice within 15 min after collection. The genetic identity of all clumps sampled was confirmed by an event-specific assay as described in the present invention.

[00283] For the analysis of CrylAc protein, 30 ± 1 mg of leaf, 200 ± 1 mg of stem and 20 ± 1 mg of roots frozen in dry ice or liquid nitrogen were used. Maceration was performed on the TissueLyser equipment. To the leaf macerated tissue was added 750 µl of phosphate saline extraction buffer (PBS) supplemented with Tween20 (0.138 M NaCl; 0.027 mM KCl; 200.05% Tween, pH 7.4) diluted according to the instructions of the manufacturer (Envirologix™ USA). In the case of stems, 375 ml of the same buffer were used, and for roots 1,500 ml of the same buffer.

[00284] For analysis of Nptll protein in leaves, 40 ±1 mg of the macerated tissue were weighed, and 200 ±1 mg of stem and root were weighed. Similarly, 750 ml of extraction buffer was added to leaf tissue samples; while in the stem and root samples 1,500 mI_ were added. The extraction buffer used in this case was PEB1 1x (pH 7.0), which accompanies the kit used for the quantification of NPTII protein: PathoScreen® Kit for NPT II (Agdia, USA). [00285] In all cases, after adding the buffer to the leaf samples, homogenization was performed with vortexing. The homogenization This was followed by centrifugation for 20 minutes at 4000 *g. The resulting supernatant was collected and proceeded to the step of quantification of total proteins by the Bradford (CrylAc) or BCA (NPTII) methodologies.

[00286] The standards used to obtain the calibration curve for protein quantification were commercial standards already diluted (Albumin Standard Thermo Scientific, cat#23209). Calibrators at the concentration of 2000, 1000, 500, 250, 125 and 0 μg/mL (prepared in PBST buffer) were used. 10 pL of each calibrator standard was added in triplicate to the wells on the plates. In total, 6 curves were generated from independent dilutions. For the samples, 10pL of 3 individual protein extractions were used in each well. Subsequently, 200pL of Coomassie Plus Reagent Solution was added to each well containing the calibrators and samples. The plates were covered and incubated for 5 minutes at room temperature. Absorbance was read at 595 nanometers (nm) using SoftmaxPro 7.0 software (Molecular Device, US).

[00287] Total proteins were obtained in triplicates for each sample studied. After the quantification of total proteins, the sample with the smallest variation of the median value of the quantification was chosen. After quantification, the leaf samples were diluted as follows: leaf samples for CrylAc analysis were diluted 2500x, except for the 100 DAP samples which were diluted 3500x; stem samples for CrylAc analysis were diluted 2,500x; while root samples for CrylAc analysis were diluted 200x. All samples (leaf, root, and stem) for Nptll analysis were diluted 8x.

[00288] Obtaining results for CrylAc and Nptll proteins was done by spectrometry in 96-well plates with reading at two different wavelengths: 450 nm and 630 nm in a Pia-reader. ca SpectraMax (Molecular Devices, USA). For the detection and quantification of CrylAc protein, the AP003 CRBS kit (Envirologix, USA) was used, following the manufacturer's recommendations. For the detection and quantification of Nptll protein, the PathoScreen® Kit for NPT II (Agdia, USA) was used, following the manufacturer's recommendations. [00289] The analysis was based on the association of the absorbance values of the test samples with the predicted values in an equation estimated by the absorbance measurement of a standard curve. Synthetic proteins were diluted to desired concentrations in PBST buffer. Analyzes were performed in experimental duplicate for each sample. The concentrations of CrylAc and Nptll proteins were presented based on Total Protein (μg/mg), Fresh Weight - FP (μg/g) and Dry Weight - PS (μg/g).

[00290] The results of statistical analyzes of quantification of proteins CrylAc and Nptll are found in Tables 10 and 11, respectively. Protein expression results were obtained from the average of four biological replicates (experimental plots) in duplicate. Table 10 presents the results of individual and joint analyzes by locality for the expression of CrylAc protein in sugarcane leaves collected during 1 year of cultivation (100, 200 and 300 DAP). Table 11 shows the results of the analyzes for the Nptll protein under the same conditions.

TABLE 10: Comparison of means of CrylAc expression in leaves of event CTC75064-3 throughout a year of sugarcane cultivation (100 DAP, 200 DAP and 300 DAP). Individual and joint statistical analysis for the 6 tested sites. Results not available for Juazeiro (BA) At 300DAP. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. Ep: Standard Error.

TABLE 11: Comparison of means of Nptll expression in leaves of event CTC75064-3 over a year of sugarcane cultivation (100 DAP, 200 DAP and 300 DAP). Individual and joint statistical analysis for the 6 tested sites. Results not available for Juazeiro (BA) at 300DAP. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. Ep: Standard Error.

[00291] The results of the joint analysis for 6 localities, referring to the expression of CrylAc in leaves (μg/g Fresh and Dry Tissue) throughout the 1-year cultivation cycle are shown in TABLE 10 and FIGURE 8 (μg protein /g fresh tissue) and FIGURE 9 (μg protein/g dry tissue). The results of the joint analysis for 6 sites, referring to the expression of Nptll in leaf (μg/g Fresh and Dry Tissue) throughout the 1-year cultivation cycle are shown in TABLE 11 and FIGURE 11 (μg protein /g tissue fresh) and FIGURE 12 (μg protein/g dry tissue).

[00292] The average expression of CrylAc protein in leaves from event CTC75064-3 over the 1-year cycle of sugarcane cultivation in all locations (except for Juazeiro at 300DAP - no results) was 125.18 μg/g of fresh tissue and 423.75 μg/g of dry tissue. For Nptll, mean protein expression in leaves from event CTC75064-3 over the 1-year cycle of sugarcane cultivation in all locations (with the exception of Juazeiro at 300DAP - no results) was 1,401 μg/g of fresh tissue and 6,370 μg/g dry tissue.

[00293] The results of CrylAc protein expression in leaves from event CTC75064-3 collected at 330 DAP (210 DAP for Juazeiro) are presented in TABLE 12 and Figure 10 (in μg protein/g fresh and dry tissue).

TABLE 12. Comparison of means of CrylAc expression in leaves from event CTC75064-3 collected at 330 DAP ( ^* 210 DAP for Juazeiro). Individual and joint statistical analysis for the 6 tested sites. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. NA: not evaluated. EP: Standard Error.

event CTC75064-3 collected at 330 DAP (210 DAP for Juazeiro) are shown in Table 13 and Figure 13 (μg protein/g of fresh and dry tissue).

TABLE 13: Comparison of Nptll expression means in leaves from event CTC75064-3 at 330 DAP ( ^* 210 DAP for Juazeiro). Individual and joint statistical analysis for the 6 tested sites. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. EP: Standard Error.

[00295] The results of CrylAc protein expression in the stem of samples from event CTC75064-3 collected at 330 DAP are presented in Table 14 and Figure 10 (μg/g fresh and dry tissue). TABLE 14: Comparison of means of CrylAc expression in stem from event CTC75064-3 at 330 DAP ( ^* 210 DAP). Individual and joint statistical analysis for the 6 tested sites. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. EP: Standard Error.

[00296] The results of Nptll protein expression in stem of samples from event CTC75064-3 collected at 330 DAP are presented in Table 15 and Figure 13 (μg/g fresh and dry tissue).

TABLE 15: Comparison of Nptll expression means in the stem of event CTC75064-3 at 330 DAP ( ^* 210 DAP). Individual and joint statistical analysis for the 6 tested sites. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. EP: Standard Error.

[00297] The results of CrylAc protein expression in root of event CTC75064-3 samples collected at 330 DAP are presented. shown in Table 16 and Figure 10 (μg/g fresh and dry tissue).

TABLE 16: Comparison of means of CrylAc expression in roots of event CTC75064-3 at 330 DAP ( ^* 210 DAP). Individual and joint statistical analysis for the 6 tested sites. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. EP: Standard Error.

and

[00298] The results of Nptll protein expression in root samples from event CTC75064-3 collected at 330 DAP are presented in Table 17 and Figure 13 (μg/g fresh and dry tissue).

TABLE 17: Comparison of Nptll expression means in roots of event CTC75064-3 at 330 DAP ( ^* 210 DAP). Individual and joint statistical analysis for the 6 tested sites. Means followed by the same letter do not differ from each other by the t test at the level of p < 0.05. EP: Standard Error.

[00299] The average expression of CrylAc protein in stems from event CTC75064-3 in the evaluated locations was 42.94 μg/g of fresh tissue and 173.54 μg/g of dry tissue. For Nptll, the mean expression in stems of CTC75064-3 in all localities was 0.138 μg/g of fresh tissue and 0.558 μg/g of dry tissue.

[00300] The average expression of CrylAc protein in roots of event CTC75064-3 in the evaluated locations was 10.21 μg/g of fresh tissue and 46.30 μg/g of dry tissue. For Nptll, the mean root expression of CTC75064-3 in all localities was 0.092 μg/g fresh tissue and 0.422 μg/g dry tissue.

[00301] The results obtained in leaf, stem and roots indicate that the event of the invention has expression levels of the CrylAc protein much higher than the expression of NptII.

[00302] The average concentration of CrylAc in sheets of the event of the invention at 100 DAP is lower than the average concentration at 200 and 300 DAP. For Nptll, the average expression in leaves throughout the sugarcane cycle remains constant.

[00303] The expression levels of proteins CrylAc and Nptll in event CTC75064-3 at 330 DAP were much higher in leaves than in stems and roots. The CrylAc protein expression results also showed significant differences between stems and roots, with roots demonstrating the lowest protein expression. For Nptll, the average expression of the protein in stems and roots did not differ significantly.

[00304] It is observed that the expression levels of the proteins CrylAc and Nptll of the event of the invention were characterized in different culture ages, tissues and localities. For CrylAc, protein expression levels, especially in leaves from the event of the invention, remain high throughout the entire cultivation cycle, ensuring the desired effect of resistance to infestation by Diatraea saccharalis. western blot

[00305] To identify the heterologous proteins expressed in the event of the invention, 50 mg (±0.5 mg) of leaf frozen in liquid nitrogen were used for CrylAc and 300mg (±0.5 mg) for NptII. Maceration was performed in the TissueLyser equipment for 1 minute at 25 Hz, with the addition of three steel balls (3 mm - Qiagen). To the macerated tissue, 500 μL of phosphate saline extraction buffer (PBS) supplemented with Tween 20 (NaCI 0.138 M; KCI - 0.027 mM; Tween 20 - 0.05%, pH 7.4) diluted according to with the manufacturer's instructions ( Envirologix ™, USA). After the addition of the buffer, homogenization was carried out with a vortex and centrifuged for 20 minutes at 4,000 rpm at 4°C. The resulting supernatant was collected and proceeded to the step of total protein quantification.

[00306] The quantification adopted for the analysis of CrylAc and Nptll proteins was performed according to the recommendations of the ThermoScientific ™ Coomassie Plus (Bradford) Protein Assay Kit (23236) - Procedure in microplate and BCA. For the Nptll protein, the method of quantification of total proteins called BCA was used. Quantification with the BCA method was performed according to the kit manufacturer's recommendations: PierceTM BCA Protein Assay Kit (23225). Thus, the standards used to obtain the calibration curve were commercial standards already diluted of BSA (Pre- Diluted Protein Assay Standards: Bovine Serum Albumin (BSA) set-23208, (Thermo Scientific, USA) at a concentration of 2,000, 1,500, 1000, 750, 500, 250, 125 and 0 µg/ml, prepared in PBST buffer. 10 ml of each calibrator standard was added in triplicate wells on the plate. The plates were covered and incubated for 5 minutes at room temperature. Absorbance was read at 595 nanometers (nm) using SoftmaxPro 7.0 software (Molecular Device). After the extraction of total proteins, 3 μg of protein extract were mixed with the 2X sample buffer Laemmli Sample Buffer (Bio-Rad, USA) and subjected to denaturation via heating at 100°C for 5 minutes to identify the CrylAc protein present in the sample. . In the case of the detection and identification of the Nptll protein, the concentration of the extract of total proteins was first performed using Amicon® Ultra-0.5 Centrifugal Filter Devices columns (3000 NMWL) following the manufacturer's recommendations. 40 μg of protein extract were used, mixed with the sample buffer as described for CrylAc.

[00307] For the negative control of the presence of heterologous proteins, 3 μg of protein extract extracted from the conventional parental variety RB 867515 was used in the experiments with CrylAc and 40 μg for the Nptll assays. Additionally, positive controls were prepared to detect CrylAc and Nptll proteins, with 0.5 ng of ~69 kDa CrylAc proteins (GenScript, USA) or ~29 kDa Nptll (Bon Opus Biosciences, USA) purified, diluted in total protein solution extracted from plant leaves of the conventional variety RB 867515. The second positive control was obtained by diluting 1ng of purified CrylAc protein or 5ng of purified Nptll protein in PBST extraction buffer.

[00308] The samples were denatured and applied in a 4-20% polyacrylamide gel (Mini-PROTEAN ® TGXTM Precast Gel) submerged in Tris/glycine/SDS running buffer (Bio-Rad, USA) and separated by electrophoresis at 50 V for 5 minutes and then at 120 V for approximately 90 minutes. Next, the polyacrylamide gels were equilibrated in Tris/Glycine Buffer Transfer Buffer (Bio-Rad, USA), to which 20% methanol was added for 10 - 15 minutes. The PVDF membrane was treated with absolute methanol. The transfer system was mounted in a vat filled with ice-cold Transfer Buffer for immersion transfer ("wet transfer"), at a constant voltage of 50V for 3 hours. After the transfer was completed, the membrane was blocked for 16 hours at 4°C, under constant agitation, in blocking solution [5% skimmed milk powder (Bio-Rad, USA) and TBS/T (20mM Tris, 150mM NaCI, 1% Tween20] to prevent possible unspecific binding to the membrane.

[00309] In the next step, the membrane was incubated with the primary antibody for 90 minutes to detect and confirm the presence and integrity of the CrylAc and Nptll proteins. The polyclonal antibodies used in this assay were Anti-Cry1Ab (Fitzgerald, USA) produced in rabbit and which reacts with CrylAc and CrylAb proteins; and Anti-NptII (Rhea, BRA IM0770-18088), also produced in rabbit, and which reacts with NptII protein, diluted at a concentration of 1:500 in TBS/T (v/v).

[00310] The membrane was washed in 3 cycles of 5 minutes (3x5) in TBS/T and incubated with secondary Anti-Rabbit antibody conjugated to HRP produced in goats (Sigma), at a concentration of 1:20,000 or Fitzgerald, at a concentration of 1:5,000 - v/v) for 60 minutes. After the incubations, the membrane was washed again with TBS/T (3x5 minutes) and the enzyme immunoreaction was verified on Amersham Hyperfilm ECL X-ray films (GE Healthcare, USA) by reacting with Clarit Western ECL Substrate Kit (Biorad, USA), from according to the manufacturer's instructions. Exposure of the X-ray film to the membrane ranged from 15 seconds to 3 minutes.

[00311] The results revealed that the CrylAc protein expression profile is presented as an immunoreactive band of molecular weight ~66 kDa (Figure 14). Both samples (R1-R4) are biological repetitions of the event of the invention CTC75064-3, obtained from four different experimental plots at the Piracicaba Pole. As expected, the negative control (WT) did not show immunoreactivity. The negative control consisted of total protein samples extracted from the untransformed parental variety RB 867515. The positive control (WT+CP) where CrylAc protein was added to the total protein extract of the conventional RB 867515 variety showed two reactive bands. In this case (WT+CP), it is commonly known as doublet and is accepted as a product of intracellular proteolytic cleavages of Cry protein in plant leaves, usually produced through the removal of terminal amino acid residues by proteases released during tissue processing. vegetal, as well as the other bands of smaller molecular weights (~20 and 10 kDa) visualized in the samples.

[00312] The detection of the protein expressed by the nptll selection gene was also performed by the Western blot assay. Even though it is expressed at lower levels than the CrylAc protein, Western blot assays demonstrated the presence of an immunoreactive band of the expected size of ~29 kDa, in all biological repeats used for event CTC75064-3 (FIGURE 15) . Two positive controls and one negative control were added to the membrane. The positive control (CP) corresponds to 0.5 ng of purified Nptll protein (~29 kDa, Bon Opus Biosciences, USA), and a second positive control (WT+CP) corresponds to 0.5 ng of purified Nptll protein. and diluted in conventional sugarcane protein extract (RB 867515). The Negative Control corresponds to the protein extract of the parental variety. The diagnostic band corresponding to the Nptll protein is present in the positive control at the expected time and is identical to the band present in event CTC75064-3, confirming its identity. [00313] The results of the Western blot assays confirmed the presence and integrity of both CrylAc and Nptll proteins and the absence of unexpected alternative forms of these proteins, in the genetically modified event CTC75064-3.

[00314] It is concluded that the identity of CrylAc and Nptll proteins expressed by the event of the invention was confirmed by western blot. The proteins expressed by the event of the invention have the expected size and no evidence was found of truncated/fused proteins being expressed by said event.

Example 5. Biological assays: Resistance to sugarcane borer (D. saccharalis)

[00315] Biological Assays (bioassays) with the target pest of the crop, D. saccharalis (sugarcane borer), can also be used for the detection and characterization of event CTC75064-3, demonstrating the control effectiveness provided by the CrylAc insecticidal protein expressed. Different Bioassays can be contemplated within the scope of the present invention, such as, for example, Leaf Disc Assay, Telado Efficacy Assays, Tissue Dilution Assays, among others.

[00316] In the case of leaf disc test, leaf samples from event CTC75064-3 are collected, cut into discs and then kept moist. Then, the leaf discs are distributed in culture plates containing solid medium (agar), infested with neonatal caterpillars (0-24h of age) of D. saccharalis and incubated at a temperature of 27±1°C, relative humidity 60±10% and photoperiod 12:12 (light:dark), for a period of 7 days. At the end of incubation, evaluate larval mortality and inhibition of larval development of surviving individuals, and the relative efficiency is calculated from this using the formula:

Caption: Relative efficacy of LDA, live event larvae, live control larvae)

[00317] Surviving larvae are subjected to image analysis to assess larval stage based on head capsule size. Larvae that do not reach the first instar are considered dead. Non-transgenic sugarcane varieties genetically very similar to the transgenic event of the invention can be used as assay controls.

[00318] To characterize the effectiveness of the event in the control of D. saccharalis in the laboratory, leaf disc assays were performed on leaf plant tissue from event CTC75064-3 (30 DAP). The non-transgenic sugarcane RB 867515 was used as a control (CTC75-TC). The experimental design was completely randomized with 4 replicates per treatment. An average of 98.2% mortality rate was observed when comparing the conventional variety (CT75-TC) and the event CTC75064-3 after 7 days of feeding with leaf discs. Based on head capsule size measurements, it was observed that 100% of surviving individuals do not develop beyond the first instar, evidencing a high suppression in D. saccharalis development after feeding with the transgenic event (Figure 18). ).

[00319] For tissue dilution tests, the leaves of event CTC75064-3 were sampled in Agro/pheno test fields in Piracicaba, Valparaíso, Barrinha (SP) and Quirinópolis (GO), with collection points at 100, 200 and 300 DAP. These samples were cut, dehydrated, frozen and then macerated to obtain a green powder. uniform. To prepare bioassay plates, each 16-cell quadrant received a sample diluted 25x with MS diet (Multiple Species), filling approximately 1 ml per cell. For infestation, 2 neonate larvae (0-24h of age) were transferred into each cell (32 larvae per quadrant). The plates were identified and incubated at a temperature of 27 ± 1 °C, relative humidity of 60 ± 10% and a photoperiod of 12:12 (light: dark), for a period of 10 days. At the end of incubation, each quadrant was evaluated to calculate the effective mortality and mean larval mass. Effective mortality was calculated using the equation:

Caption: Effective mortality, n dead larvae + n first instar larvae / total number of live larvae

[00320] The relative effectiveness for the dilution tests was calculated using the equation:

Caption: Relative dilution efficacy, Live event larvae, Live control larvae

[00321] Through the analysis of tissue dilution of samples from the Agro/pheno fields, it was possible to verify the effectiveness, both the effective mortality and the larval mass redaction, is 51% and 94%, respectively.

[00322] In the Efficacy test in Telado, seedlings of the transgenic event are planted in a screened nursery, where the plants are planted in the soil and are kept in environmental conditions compatible with natural conditions, but with restriction to the entry or exit of biological forms , such as Diatraea saccharalis, guarantee the non-occurrence of natural infestations. At least 5 infestations are carried out, containing 20-35 Diatraea saccharalis eggs per tiller. The evaluations Actions occur when all infected stalks are harvested and split lengthwise to quantify the damage. Infestation intensity is calculated by dividing the number of damaged internodes by the number of total internodes and the result is multiplied by 100 (Infestation Intensity). The percentage of effective damage was calculated considering the total internodes with damage caused by the insect divided by the total number of culms evaluated in the plot.

[00323] Screening trials were performed to characterize the effectiveness of event CTC75064-3 in controlling the borer attack compared to its parental variety RB 867515 (WT; non-transgenic) in a randomized block design with 4 replicates. Each experimental plot consisted of eight clumps of sugarcane that received 10 artificial infestations with approximately 30 eggs of D. saccharalis every 15 days. After eight months, the infestation index and the effective damage for both varieties were calculated. The relative effectiveness was calculated according to the formula below:

Caption: relative efficacy, average of the event, average of the controls [00324] On artificial infestation, event CTC75064-3 presented relative efficacy in the control of infestation by D. saccharalis of 98.8% and control of damage to the stems (length) greater than 99.9% in relation to the non-transgenic parental variety RB 867515 (Control). The damage caused by D. saccharalis in the culms of event CTC75064-3 was noticeably lower than in conventional non-transgenic sugarcane RB 867515. There are statistically significant differences (t-test, P < 0.05) between CTC75064-3 and the non-transgenic variety RB 867515 in both parameters evaluated (df = 16; P < 0.0001), demonstrating that under massive infestation with D. Saccharalis the event prevents the damage caused by this pest (Figure 16) . [00325] In commercial sugarcane plantations, D. saccharalis is considered controlled when the infestation intensity is below 3% (Gallo et al., 2002). For CTC75064-3, the infestation intensity was less than 0.01%, reinforcing the event's effectiveness in controlling this pest.

[00326] The observation and analysis of artificial or natural infestations in planting areas also allow the characterization of the effectiveness of materials against D. saccharalis. The l.l (Intensity of infestation), for example, can be calculated through the evaluation of natural infestations by defining an experimental area for the collection of culms and longitudinal opening to count the total internodes and the brocade internodes ( with damage caused by the borer), thus obtaining the infestation index (l.l).

[00327] To characterize the effectiveness of event CTC75064-3 against the target pest in the field, experiments were installed in 4 locations (Piracicaba-SP, Barrinha-SP, Valparaíso-SP and Quirinópolis-GO). The fields were designed in 4 plots per event tested in randomized blocks. The conventional variety RB 867515 (parental; non-transgenic) was used as a control. This assay illustrates the resistance of event CTC75064-3 to infestation by D. saccharalis compared to the parental variety (RB 867515): a lower intensity of infestation was observed for plants of event CTC75064-3 compared to the parental variety ( RB 867515) in all four experimental areas (Joint analysis; Figure 17). The event CTC75064-3 relative efficacy in the control of infestation by D. saccharalis of 100% in all locations, except for Valparaiso, which demonstrated 99.1% efficacy, very close to 100%. Thus, the event of the present invention was, on average in the 4 localities, 99.7% more effective than non-transgenic plants (conventional materials) to control Diatrea saccharallis (Figure 17). [00328] The examples described represent the preferred scopes, it being understood that the scope of the present invention contemplates other possible variations, being limited only by the content of the claims, including possible equivalents.

Claims

1. Polynucleotide, characterized in that it comprises at least 14 contiguous nucleotides of SEQ ID NO: 18.

2. Polynucleotide, according to claim 1, characterized in that it comprises at least 15 contiguous nucleotides of SEQ ID NO: 18.

3. Polynucleotide, according to claim 1, characterized in that it comprises at least 16 contiguous nucleotides of SEQ ID NO 18.

4. Polynucleotide, according to claim 1, characterized by the fact that it comprises SEQ ID NO 18.

5. Polynucleotide according to any one of claims 1 to 4, characterized in that it comprises SEQ ID NO 13.

6. Polynucleotide, characterized in that it comprises at least 14 contiguous nucleotides of SEQ ID NO 19.

7. Polynucleotide, according to claim 6, characterized in that it comprises at least 15 contiguous nucleotides of SEQ ID NO 19.

8. Polynucleotide, according to claim 6, characterized in that it comprises at least 16 contiguous nucleotides of SEQ ID NO 19.

9. Polynucleotide, according to claim 6, characterized by the fact that it comprises SEQ ID NO 19.

10. A polynucleotide according to any one of claims 6 to 9, characterized in that it comprises SEQ ID NO 12.

11. A polynucleotide according to any one of claims 1 to 10, characterized in that it comprises at least 80% identity with SEQ ID NO 5.

12. A polynucleotide according to any one of claims 1 to 11, characterized in that it comprises at least 80% identity with SEQ ID NO 22.

13. Primer Pairs, characterized in that the sense primer has at least 80% identity with SEQ ID NO: 6 and the antisense primer has at least 80% identity with SEQ ID NO: 7 and/or the sense primer has at least 80% identity to SEQ ID NO:8 and the antisense primer has at least 80% identity to SEQ ID NO:9.

14. Method for detecting plant material derived from a genetically modified sugarcane plant of event CTC75064-3, characterized in that it comprises the steps of: a) obtaining a sample of plant material for analysis; b) extracting DNA from the sample; c) providing primer pairs comprising at least one sense and one antisense primer; d) amplifying the region that lies between the sites where the primers bind; and e) detecting the presence of amplification product.

15. Method according to claim 14, characterized in that it comprises providing primer pairs in step c) designed to bind to at least one polynucleotide that comprises contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, wherein at least one of the primers comprises contiguous nucleotides of sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31.

16. Method, according to claim 14, characterized in that it comprises the provision of primer pairs in step c) designed to bind to at least one polynu- cleotide comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 29, wherein at least one pair of primers consists of a first primer comprising contiguous nucleotides of a selected sequence from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31 and a second primer comprising contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 2 and SEQ ID NO 36.

17. Method according to claim 14, characterized in that it comprises providing primer pairs in step c) designed to bind to at least one polynucleotide that comprises contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 37, wherein at least one pair of primers comprises contiguous nucleotides of sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39.

18. Method according to claim 14, characterized in that it comprises providing primer pairs in step c) designed to bind to at least one polynucleotide comprising contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 37, wherein at least one pair of primers consists of a first primer comprising contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 3 , SEQ ID NO: 4, SEQ ID NO: 38 and SEQ ID NO: 39 and a second primer comprising contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 2 and SEQ ID NO 36.

19. Method according to claim 14, characterized in that it comprises primer pairs designed to bind to at least one polynucleotide comprising nucleus- contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, wherein, the amplification product detected in step e) comprises contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 32 and SEQ ID NO 33.

20. Method according to claim 19, characterized in that the amplification product detected in step e) comprises contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 38 and SEQ ID NO 39.

21. Method according to claim 14, wherein the primer pairs used in step c) are characterized in that they are selected from the group consisting of sequences with at least 80% identity with SEQ ID NO: 6 and SEQ ID NO: 7; SEQ ID NO: 8 and SEQ ID NO: 9.

22. Method according to claim 14, characterized in that the amplification products obtained are selected from the group consisting of SEQ ID NO 12 and SEQ ID NO 13.

23. Method according to claim 14, characterized in that the detection of the amplification product is carried out through the hybridization of a probe selected from the group consisting of SEQ ID NO 10 and SEQ ID NO 11.

24. Method for detecting plant material derived from a genetically modified sugarcane plant of event CTC75064-3, characterized in that it comprises the steps of: a) obtaining a sample of plant material for analysis; b) extracting DNA or RNA from the sample; c) provide a probe designed or a combination of probes designed to bind to at least one polynucleotide that comprises contiguous nucleotides from sequences selected from the group consisting of SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38 and SEQ ID NO 39; d) hybridizing said probe with the material extracted from the sample of step (b), and ee) detecting the hybridized probe.

25. Genetic construct, characterized in that it comprises a nucleotide sequence having at least 80% identity with SEQ ID NO: 1.

26. Genetic construct, characterized in that it comprises a nucleotide sequence of SEQ ID NO: 2

27. The genetic construct of claims 25 and 26, characterized in that it comprises a nucleotide sequence having at least 80% identity to SEQ ID NO:14.

28. Kit for detecting the presence of a sample of plant material from a transgenic sugarcane comprising a CrylAc protein (event CTC75064-3), characterized in that it comprises a means for detecting the presence of a polynucleotide that comprises at least 14 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO. 32, SEQ ID NO 33 and/or a pesticidal crystal protein (Cry).

29. Kit according to claim 28, characterized in that the means for detection comprises pairs of primers designed to bind to at least one polynucleotide comprising contiguous nucleotides of selected sequences from the group consisting of SEQ ID NO 22 and SEQ ID NO 29, wherein at least one of the primers comprises contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30 and SEQ ID NO: 31.

30. Kit according to claim 28, characterized in that the means for detection comprises a probe selected from the group consisting of SEQ ID NO 10 and SEQ ID NO 11.

31. A genetically modified sugarcane plant (Saccharum spp), characterized in that it comprises at least one sequence selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19.

32. A genetically modified sugarcane plant (Saccharum spp), characterized in that it comprises at least one sequence selected from the group consisting of SEQ ID NO 12 and SEQ ID NO 13.

33. A genetically modified sugarcane plant (Saccharum spp), characterized in that it comprises at least one sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 22, where the plant is insect resistant.

34. Event CTC75064-3, characterized in that it is a variety of sugarcane (Saccharum spp.) comprising at least 14 contiguous nucleotides of sequences selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19.

35. Event CTC75064-3, characterized in that it is a variety of sugarcane (Saccharum spp.) comprising at least one sequence selected from the group consisting of SEQ ID NO 5 and SEQ ID NO 22.

36. Insect resistant plant, characterized by the fact that it is a variety of sugarcane ( Saccharum spp.) comprising at least 14 contiguous nucleotides of selected sequences. nothing from the group consisting of SEQ ID NO 18 and SEQ ID NO 19.

37. Insect resistant plant according to claim 36, characterized in that it comprises at least one sequence selected from the group consisting of sequences with at least 80% identity with SEQ ID NO 5 and SEQ ID NO 22 .

38. Plant part, plant cell, plant tissue or seed of a genetically modified sugarcane plant ( Saccharum spp ) characterized in that it comprises at least one sequence selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19.

39. Tissue culture, characterized by the fact that it is from a genetically modified sugarcane plant (Saccharum spp) as defined in claim 31.

40. Genetically modified sugarcane plant (Saccharum spp.) regenerated from a tissue culture as defined in claim 39, characterized in that the regenerated plant comprises at least one sequence selected from the group consisting of SEQ ID NO 18 and SEQ ID NO 19.

41. Commodity product, characterized in that it is produced from a sugarcane plant as defined in claim 31.

42. Method for producing an insect resistant sugarcane plant, characterized in that it comprises crossing a first sugarcane plant with a second sugarcane plant comprising event CTC75064- 3, producing an offspring of insect resistant sugarcane plants.

43. Plant part, plant cells, plant tissue or seed of a sugarcane plant, characterized in that it is produced according to the method of claim 42.

44. Method for producing a sugarcane plant (Saccharum spp) genetically modified insect resistant, characterized by the fact that it comprises the steps: a) introducing a genetic construct comprising SEQ ID NO 20 and SEQ ID NO 21 into an Agrobacterium strain, b) obtaining from embryogenic callus of palm hearts of a variety of sugarcane (Saccharum spp.), c) co-cultivate the embryogenic callus with the Agrobacterium from step a); d) select the transformed cells that contain the functional fragment in a culture medium containing aminoglycosidic antibiotics; and e) regenerating the genetically modified sugarcane plants comprising SEQ ID NO 20 and SEQ ID NO 21.

45. Plant part, plant cells, plant tissue or seed of a sugarcane plant, characterized in that it is produced according to the method of claim 44.

46. Method for producing a genetically modified sugarcane plant ( Saccharum spp.) of event CTC75064-3, characterized in that it comprises introducing a genetic modification to a sugarcane plant comprising at least one sequence selected from the group consisting in SEQ ID NO 5 and SEQ ID NO 22, wherein the genetically modified sugar cane plant has improved insect resistance when compared to the unmodified sugar cane.

47. Method for producing a genetically modified insect-resistant sugarcane plant ( Saccharum spp.), characterized by the fact that it comprises the insertion of a fragment of T DNA in a specific site of the genome comprised between the selected sequences from the group consisting of SEQ ID NO 23 and SEQ ID NO 24 via homologous recombination.

48. Plant part, plant cells, plant tissue or seed of a genetically modified insect resistant sugarcane plant ( Saccharum spp.), characterized in that it is produced by the method as defined in any of claims 46 and 47.

49. Method of growing a genetically modified sugar cane plant ( Saccharum ssp.), characterized in that it comprises growing a sugar cane plant comprising SEQ ID NO 2 under insect infestation conditions, where the genetically modified sugarcane has an increased insect resistance compared to sugarcane without the genetic modification growing under the same conditions.

50. Use of a genetically modified plant, plant cell, plant part or seed of a sugarcane plant (Saccharum spp.) as defined in claims 42, 44, 46 and 46, characterized in that it is to regenerate a plant, plant, produce seeds, grow or cultivate a field of plants, or produce a plant product.

51. Method for controlling insects, characterized in that it comprises providing a plant, tissue, plant part, cells or seed of a genetically modified sugarcane, defined by comprising SEQ ID NO 2, for feeding the insect.

52. Method according to claim 51, characterized in that it comprises plant, tissue, plant part, cells or seeds of a genetically modified sugarcane plant of event CTC75064-3.

53. Method, according to claim 51, characterized by the fact that the insects are of the species Diatrea saccharalis.

54. Method to increase the production of sugar cane in the field, characterized by the fact that it comprises cultivating a genetically modified sugarcane plant defined by comprising SEQ ID NO 2.

55. Method according to claim 54, characterized in that it comprises a genetically modified sugarcane plant from event CTC75064-3.