EA043809B1 - VECTOR SYSTEM OF BIRD ADENOVIRUS 9 (FAdV-9) AND RELATED METHODS - Google Patents

Description

Related application

This application claims the benefit of U.S. Provisional Patent Application No. 62/190,913, filed July 10, 2015, the contents of which are hereby incorporated by reference in their entirety.

Field of invention

The present invention relates to avian adenovirus 9 (FAdV-9), and more particularly to the FAdV-9 dual delivery vector system and related methods, and their use in preventing disease.

BACKGROUND OF THE INVENTION

Avian adenoviruses (FAdVs) are ubiquitous pathogens of poultry and are members of the family Adenoviridae.

Adenoviruses (AdV) of the Mastadenovirus genus have been investigated as anticancer agents (Huebner et al. (1956), Cody & Douglas (2009), Yamamoto & Curiel (2010)) and vaccine vectors (Lazaro & Ertl (2009)).

The issue of pre-existing immunity against HAdV-5, exemplified by the STEP HIV study using recombinant HAdV-5 (Buchbinder et al. (2008), McElrath et al. (2008)), has sparked interest in the study of less common AdV serotypes and non-human AdVs as both oncolytic ((Cody & Douglas (2009), Gallo et al. (2005), Shashkova et al. (2005)) and vaccine vectors (Barouch (2008), Lasaro & Ertl, ( 2009), Sharma et al. (2009)) Avian adenoviruses (FAdV) of the genus Aviadenovirus, including species FAdV-A to FAdV-E (Adair, B. & Fitzgerald, S. (2008), Benko et al. (2005)) have been studied as vaccine vectors. The first generation of FAdV-based vaccine vectors have been shown to be effective in inducing the formation of antibodies against the delivered transgene (Corredor & Nagy (2010b), Ojkic & Nagy (2003)), and chickens received protective immunity against the virus infectious bursitis virus (IBDV) (Francois et al. (2004), Sheppard et al. (1998)) and infectious bronchitis virus (Johnson et al. (2003)). Analysis of the complete genomes of FAdV-1, chicken embryo lethal orphan virus (CELO) (Chiocca et al. (1996)) and FAdV-9 (Ojkic & Nagy (2000)) (FAdV-A and FAdV-D species, respectively) and terminal genomic regions of FAdV-2, -4, -10 and -8 (Corredor et al. (2006), Corredor et al. (2008)) showed that FAdVs have a common genomic organization.

Adenovirus-based vaccine vectors have been shown to be promising tools for pathogen control (Bangari & Mittal (2006), Ferreira et al. (2005)). The first generation of avian adenovirus (FAdV) vaccine vectors have been used effectively to induce antibody production against an inserted foreign gene (transgene) (Corredor, & Nagy (2010a), Ojkic & Nagy (2003)), and protective immunity has been confirmed in chickens against infectious bursitis virus (Francois et al. (2004), Sheppard et al. (1998)) and infectious bronchitis virus (Johnson et al. (2003)).

Adenoviral vectors of the prior art, in particular from avian adenoviruses, are constrained by a size limit on the size of the foreign DNA insert into the vector DNA. Therefore, it is not possible to clone particularly large DNA inserts representing important portions of immunogenic proteins in an independently replicating virus. It is also impossible to clone more than one gene. The significance of a vector capable of expressing two or even more antigens is that only one vaccine will be needed to protect against two or more diseases. This is not possible with current state of the art adenoviral vectors due to the lack of usable capacity.

Therefore, there remains a need for new adenoviral vectors and, in particular, new adenoviral vectors for dual delivery, as well as their uses.

The essence of the invention

The authors of the invention have developed new adenoviral vectors based on recombinant avian adenovirus 9 (FAdV-9). The vectors can be used in particular for the delivery and/or expression of exogenous sequences and as adenoviral vectors for dual delivery. One or more exogenous nucleotide sequences can be inserted into the new vector. Optionally, one or more exogenous nucleotide sequences encode one or more antigenic sites of a disease of interest.

Accordingly, in one aspect, the invention relates to a viral vector from recombinant avian adenovirus 9 (FAdV-9). In one embodiment, the recombinant FAdV-9 viral vector is a dual delivery viral vector.

In one aspect, the FAdV-9 viral vector has a deletion at the left end of the genome. In one embodiment, the deletion at the left end of the genome comprises a deletion of one or more of ORF0, ORF1 and ORF2. In one embodiment, the FAdV-9 viral vector has a deletion at the right end of the genome. In one embodiment, the deletion at the right end of the genome comprises a deletion of one or more of ORF19, TR2, ORF17, and ORF11. In one embodiment, the FAdV-9 viral vector has deletions at both the left end and the right end of the genome. In one embodiment, the FAdV-9 viral vector has a deletion of ORF0, ORF1, ORF2, TR2, ORF17, and ORF11. In one embodiment, the FAdV-9 viral vector has a deletion of ORF1, ORF2,

- 1 043809

TR2, ORF17 and ORF11. In another embodiment, the FAdV-9 viral vector has a deletion of ORF1, ORF2, and ORF19. In another further embodiment, the FAdV9 viral vector has a deletion of ORF1, ORF2 and ORF19, TR2 or ORF11.

In one embodiment, the FAdV-9 viral vector has a deletion at the left end of the genome of approximately 2291 base pairs, optionally between about 1900 and 2500 base pairs. In one embodiment, the FAdV-9 viral vector has a deletion at the right end of the genome of approximately 3591 base pairs. In one embodiment, the FAdV-9 viral vector has a deletion at the right end of the genome between approximately 3000 base pairs and 4000 base pairs.

In one embodiment, the viral vector contains a nucleotide sequence with at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the two-deletion sequence shown in fig. 10A. In one embodiment, the viral vector comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 1 with one or more deletions, optionally one or more of the deletions shown in FIG. 10A.

In one embodiment, the viral vector has an insertion capacity greater than 4000 bp, greater than 5000 bp, greater than 6000 bp. or optionally more than 7000 bp.

In one embodiment, the viral vector comprises at least one of the following:

(a) a nucleotide sequence with sequence identity set forth in SEQ ID No. 1, in which nucleotides 575 to 2753 are deleted, (b) a nucleotide sequence with sequence identity set forth in SEQ ID No. 1, in which nucleotides 847 through 2753 deleted, (c) a nucleotide sequence with sequence identity set forth in SEQ ID No. 1, in which nucleotides 38807 to 42398 are deleted, (d) a nucleotide sequence with sequence identity set forth in SEQ ID No. 1, in which nucleotides with 34220 to 36443 deleted, (e) a nucleotide sequence with sequence identity to the sequence sequence set forth in SEQ ID No. 1 in which nucleotides 38807 to 40561 were deleted or in which nucleotides 41461 to 42 3 98 were deleted, and (f) the nucleotide sequence of with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the nucleotide sequences set forth in (a), (b), (c ), (d) or (e).

For example, in one embodiment, the viral vector contains, consists essentially of, or consists of a nucleotide sequence with sequence identity to the sequence set forth in SEQ ID No. 1, in which nucleotides 575 to 2753, 847 to 2753, and /or from 38807 to 42398. In one embodiment, the viral vector contains, consists essentially of or consists of a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1, in which nucleotides 575 to 2753 are deleted in whole or in part and from 38807 to 42398. In one embodiment, the viral vector contains, consists essentially of or consists of a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1, in which nucleotides 847 to 2753 and 38807 are deleted in whole or in part to 42398. In another embodiment, the viral vector contains, consists essentially of, or consists of a nucleotide sequence with sequence identity to the sequence set forth in SEQ ID No. 1, in which nucleotides 847 to 2753 and 34220 to 36443 are deleted in whole or in part. In another embodiment, the viral vector contains, consists essentially of, or consists of a nucleotide sequence with sequence identity to the sequence set forth in SEQ ID No. 1 in which nucleotides 847 to 2753, 34220 to 36443, and 38807 to 40561 or from 41461 to 42398.

Another aspect of the invention provides a viral vector into which one or more exogenous nucleotide sequences are inserted. In one embodiment, the viral vector contains one or more exogenous nucleotide sequences encoding one or more polypeptides of interest, optionally one or more antigenic and/or therapeutic polypeptides. In one aspect, the viral vector is a dual delivery vector capable of expressing two or more exogenous nucleotide sequences. In one embodiment, the viral vector contains exogenous nucleotide sequences encoding one or more antigenic sites of the disease of interest. In one embodiment, the viral vector contains a sequence corresponding to at least one gene listed in table. 1, or its homologue.

The invention also relates to host cells transformed with one or more viral vectors as disclosed herein.

- 2 043809

An additional aspect of the invention is a method for producing a viral vector, as disclosed herein. In one embodiment, the method includes inserting an exogenous nucleotide sequence into a recombinant FAdV-9 viral vector, as disclosed herein.

In one embodiment, the FAdV-9 viral vector contains one or more recombinant control sequences, such as one or more promoters. Optionally, the viral vector contains one or more cloning sites to facilitate the recombinant insertion of exogenous nucleotide sequences into the viral vector.

In one aspect, an immunogenic composition is provided comprising an aFAdV-9 viral vector, as disclosed herein, that has an exogenous nucleotide sequence encoding at least one antigenic site of a disease of interest inserted therein. In one embodiment, the immunogenic composition further comprises a pharmaceutically acceptable carrier. In one embodiment, the immunogenic composition further comprises an adjuvant. In one embodiment, the immunogenic composition is a vaccine.

In another aspect, the invention relates to a method of creating an immunogenic response in a patient. In one embodiment, the method includes administering to a patient a viral vector or immunogenic composition as disclosed herein. The invention also relates to a viral vector or immunogenic composition, as disclosed herein, for use in creating an immunogenic response in a patient. In one embodiment, the methods and uses described herein are intended to generate an immunogenic response against a disease antigen, optionally one or more of the diseases listed in Table. 1. In one embodiment, the methods and uses described herein are for the prevention of a disease and/or the vaccination of a patient against one or more diseases.

Other features and advantages of the present invention will be apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while reflecting preferred embodiments of the invention, are provided by way of illustration only, as various changes and modifications to the spirit and scope of the invention will be apparent to those skilled in the art from the detailed description.

Brief description of the figures

New features of the present invention are established, in particular, in the attached claims. However, the invention itself, together with its other objects and advantages, will be better understood from the following detailed description of a specific embodiment, read in conjunction with the accompanying drawings, in which:

in fig. Figure 1 shows the FAdV-9 vector system (FAd-mida). FAd-mid has the following characteristics: a non-pathogenic strain of FAdV-9, optional regions at the left and right ends, recombinant FAdV grows like wild-type FAdV-9, reduced viral shedding and production of antibodies to the viral scaffold, and EGFP (reporter gene) is expressed using this framework when an exogenous (foreign) promoter (CMV) is used (Corrector, J. C. & Nagy, E. (2010b));

in fig. Figure 2 shows the sequence of the left end of FAdV-9. Function of ORF1 and 1C: modulates the innate and adaptive immune response; function of ORF0, 1A, 1B and 2: unknown. When ORF0 is deleted, the native early promoter does not function and there is no expression of foreign genes (eg mCherry). When only ORF1 and 2 are deleted, the native promoter is functional;

in fig. Figure 3 shows the deletion of ORFs 0, 1, and 2. (A) Scheme for creating pFAdV9-A0-1-2-RED: ORF0, ORF1, 1A, 1B, 1C, and 2 were replaced with a CAT cassette flanked on both sides by SwaI sites in order to to generate pFAdV9-A0-1-2CAT via homologous recombination. The CAT cassette was removed by SwaI digestion, followed by religation to generate untagged pFAdV9-A0-1-2SwaI. The mCherry coding sequence was then cloned into the SwaI site to generate pFAdV9-A0-1-2RED; MLP, major late promoter; ITR, inverted terminal repeat; (B) and (D) NotI digestion and PCR amplification of DNA to verify FAd-mids and corresponding viruses. Lanes Δ0-2; pFAdV9-A0-12-RED or passage virus 3; wt lanes: pFAdV9-wt or virus; M: DNA marker 1 t.o. DNA cleavage of pFAdV9-wt using NotI: fragment sizes 26 kb, 11.4 kb, 6 kb, 4 kb. and 1.4 t.o.; NotI digestion of lane Δ0-2; fragment sizes are 26 kb; 11.4 t.o., 5.9 k and 4 t.o.; PCR product of lane Δ0-2 1619 bp. and PCR product wt 3107 bp; (C) cytopathic effect (CPE) and mCherry expression by RecFAdV;

in fig. Figure 4 shows the deletion of ORF1 and 2. (A) Scheme of creation of pFAdV9-A1-2-RED: ORF1, 1A, 1B, 1C and 2 were replaced with a CAT cassette flanked on both sides by SwaI sites to create pFAdV9-A1-2CAT through homologous recombination. The CAT cassette was removed by SwaI digestion, followed by religation to generate untagged pFAdV9-A1-2SwaI. The mCherry coding sequence was then cloned into the SwaI site to

- 3 043809 to create pFAdV9-A1-2RED; MLP, major late promoter; ITR, inverted terminal repeat; (B) and (D) NotI digestion and PCR amplification of DNA to verify FAdmids and corresponding viruses. Lanes Δ1-2; pFAdV9-A1-2RED or passage virus 3; wt lanes: pFAdV9-wt or virus; M: DNA marker 1 t.o. Digestion of pFAdV9-wt DNA using NotI: fragment sizes are 26 kb, 11.4 kb, 6 kb, 4 kb. and 1.4 t.o.; cleavage of lane Δ1-2 using NotI; fragment sizes are 26 kb; 11.4 t.o., 6.2 k and 4 t.o.; PCR product of lane Δ1-2 1912 bp. and PCR product wt 3107 bp; (C) expression of mCherry by RecFAdV;

in fig. Figure 5 shows the sequence of the right end of FAdV-9. The function of TR-2, ORF17, and ORF11 is unknown; TR-2: The longest repeat region consists of 13 adjacent direct repeats of 135 bp. length; ORF17 and 11 are likely membrane glycoproteins;

in fig. Figure 6 shows the deletion of ORF17. (A) Scheme of construction of pFAdV9-A17. ORF17 was replaced with a CAT cassette flanked on both sides by SwaI sites via homologous recombination to generate pFAdV9-A17 (B) and (C) NotI digestion and PCR amplification of DNA to verify FAd-mids and corresponding viruses. Lanes Δ17; pFAdV9-A17 or passage virus 3; wt lanes: pFAdV9-wt or virus; M: DNA marker 1 t.o. Digestion of pFAdV9-wt DNA using NotI: fragment sizes are 26 kb, 11.4 kb, 6 kb, 4 kb. and 1.4 t.o.; cleavage of lane Δ17 using NotI; fragment sizes are 26381 bp; 11485 p.o., 6056 p.o., 4078 p.o. and 1391 bp; PCR product of lane Δ17 2822 bp. and wt PCR did not yield any product;

in fig. Figure 7 shows the deletion of TR2, ORF17 and 11. (A) Scheme for creating pFAdV9-ΔTR2-17-11EGFP: TR2, ORF17, ORF11 were replaced with a CAT cassette flanked on both sides by SwaI sites to create pFAdV9-ΔTR2-17-11CAT through homologous recombination. The CAT cassette was removed by SwaI digestion, followed by religation to generate untagged pFAdV9-ΔTR2-17-11SwaI. The EGFP cassette was then cloned into the SwaI site to generate pFAdV9-ΔTR2-17-11EGFP; MLP, major late promoter; ITR, inverted terminal repeat; EGFP cassette, CMV-EGFP; (B) and (D) NotI digestion and PCR amplification of DNA to verify FAd-mids and corresponding viruses. Lanes ΔTR2; pFAdV9-ΔTR2-1711EGFP or passage virus 3; wt lanes: pFAdV9-wt or virus; M: DNA marker 1 t.o. Digestion of pFAdV9-wt DNA using NotI: fragment sizes are 26 kb, 11.4 kb, 6 kb, 4 kb. and 1.4 t.o.; cleavage of the ΔTR2 track using NotI; fragment sizes are 21 kb; 11.4 t.o., 6 t.o., 4 t.o., 3 t.o. and 1.4 t.o.; PCR product of lane ΔTR2 3014 bp. and PCR product wt 4966 bp; (C) expression of mCherry by RecFAdV;

in fig. 8 shows that the recombinant FAdV-9 viral vector is a dual delivery vector capable of expressing exogenous nucleotide sequences at the left end and right end. (A) Scheme of construction of pFAdV9-Δ1-2RED/TR2-17-11EGFP. TR2, ORF17, and ORF11 in pFAdV9-Δ1-2RED were replaced with a CAT cassette flanked on both sides by SwaI sites to generate pFAdV9-Δ1-2REDΔTR2-17-11CAT through homologous recombination. The CAT cassette was replaced with an EGFP cassette by SwaI digestion, followed by ligation to generate pFAdV9-Δ1-2RED/TR2-17-11EGFP. MLP, major late promoter; ITR, inverted terminal repeat; EGFP cassette, CMV-EGFP; (B) and (D) NotI digestion and PCR amplification of DNA to verify FAd-mids and corresponding viruses. Lanes ΔDual: pFAdV9-Δ1-2RED/TR2-17-11EGFP or viruses 3 passaging. Lane M: DNA marker 1 kb. Lanes wt: pFAdV9-wt or virus. Digestion of pFAdV9-wt DNA using NotI: fragment sizes are 26 kb; 11.4 t.o., 6 t.o., 4 t.o. and 1.4 t.o.; cleavage of ΔDual tracks using NotI: fragment sizes are 21 kb, 11.4 kb, 6.2 kb, 4 kb. and 3 t.o.; left PCR product of lane ADual 1912 bp. and PCR product wt 3017 bp; right PCR product of lane ADual 3014 bp. and wt PCR product 4966 bp;

in fig. 9 shows rec viruses based on FAdV-9 with reporter genes;

in fig. 10(A) shows the nucleotide sequence of one embodiment of a recombinant FAdV-9 viral vector as disclosed herein in which ORF1, ORF2, TR2, ORF17 and ORF11 have been deleted; (B) nucleotide sequences of genes inserted into the recombinant viruses: enhanced green fluorescent protein (EGFP, SEQ ID No. 2) and mCherry red (SEQ ID No. 3); (C) Nucleotide sequences of promoters inserted into recombinant genes: human cytomegalovirus immediate early promoter (CMV; SEQ ID no. 4), chicken CMV enhancer/promoter of β-actin (CAG, SEQ ID no. 5), human elongation factor 1α promoter (EF1a, SEQ ID NO: 6), L2R promoter (SEQ ID NO: 7) and β-actin promoter (SEQ ID NO: 8); and (D) the nucleotide sequence of the enhancer/regulatory sequence used in the recombinant viruses: woodchuck hepatitis virus post-transcriptional regulatory element (WPER, SEQ ID NO: 9);

in fig. 11 is a schematic representation of pCI-Neo. Plasmid pCI-Neo (Promega) was selected to generate dual expression constructs due to its unique restriction enzyme sites at and upstream of the multiple cloning site and the neomycin resistance gene;

- 4 043809 in Fig. 12 shows the creation of recombinant FAdV-9A4 viruses. (A) The EGFP expression cassette was amplified by PCR from the pHMR intermediate construct or gel extracted after double digestion with BamHI and BglII. (B) pFAdV-9A4 was linearized and digested with SwaI. (C) Both the EGFP cassette and linearized pFAdV-9A4 were cotransformed into E. coli BJ5183 cells to undergo homologous recombination. (D) The resulting plasmid was transformed into E. coli DH5a cells, propagated, screened by NotI digestion, and ultimately linearized using Pad to release the viral genome from the plasmid. Linear recombinant viral DNA was transfected into CH-SAH cells. (E) Recombinant virus was collected in the supernatant. This procedure was carried out for each EGFP expression cassette, resulting in the following viruses: FAdV-9A4-CMV-EGFP, FAdV-9A4-CMV-EGFPWPRE, FAdV-9A4-CAG-EGFP, FAdV-9A4-CAG-EGFP-WPRE, FAdV-9A4 -EF1a-EGFP and FAdV-9A4-EF1aEGFP-WPRE;

in fig. 13 is a schematic representation of dual EGFP/luciferase expression plasmids. (A) EGFP PCR was amplified from pEGFP-N1 and cloned into the multiple cloning site of pCI-Neo. The neomycin resistance gene (NeoR) from pCI-Neo was removed by restriction enzyme digestion. Firefly luciferase PCR was amplified from pGL-4.17 and cloned under the SV40 promoter, resulting in a dual expression plasmid. (B) Plasmid pCMVEGFP-Luc was digested with SpeI and EcoRI to clone into the promoters of interest, resulting in five vectors with EGFP driven by different promoters and luciferase driven by the SV40 promoter: pCMV-EGFP-Luc, pCAG-EGFP -Luc, pEF1a-EGFP-Luc, vactin-EGFP-Luc, and pL2R-EGFP-Luc. Five additional plasmids were generated by omnidirectional cloning of the Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) into each dual expression plasmid at the NotI site, yielding the constructs: pCMV-EGFPWPRE-Luc, pCAG-EGFP-WPRE-Luc, pEF1a-EGFP-WPRE-Luc , pv-actin-EGFP-WPRE-Luc and pL2R-EGFPWPRE-Luc;

in fig. 14 shows a comparison of EGFP expression with fluorescence microscopy. CHSAH cells were seeded in 35 mm dishes (1.8 x 10 ⁶ cells/dish) and transfected with 2 μg of plasmid DNA. EGFP fluorescence was measured by microscopy at 12, 24, 36, 48, 60, and 72 h posttransfection. Mock transfection was used as a negative control, while pEGFP-N1 was a positive control;

in fig. 15 shows normalized EGFP expression over time. CHSAH cells were seeded in 35 mm dishes (1.8 x 10 ⁶ cells/dish) and transfected with 2 μg of plasmid DNA. At each time point, transfected cells were washed, trypsinized, and resuspended in PBS. After three freeze-thaw cycles, samples were centrifuged and the protein concentration of the collected supernatant was measured using Nanodrop. EGFP fluorescence was measured in a microplate reader at excitation and emission wavelengths of 480 and 528 nm, respectively. Luciferase luminescence was measured using the Pierce Firefly Luciferase Glow Assay kit (Thermo). The dual expression (fluorescence/luminescence) of each construct was normalized to the expression level of pCMV-EGFP-Luc (normalized to 1.0) at each time point. Student's t test was used to determine the significance of expression compared to pCMV-EGFP-Luc, which is indicated by an asterisk (*), where P <0.05;

in fig. 16 is a schematic representation of the intermediate constructs used to create recFAdV. (A) FAdV-9 DNA flanking the A4 deletion site (VF1 and VF2) was PCR amplified and directionally cloned into the dual expression plasmid pCMVEGFP-Luc. The resulting construct pHMR-CMV-EGFP was further used to create the recombinant virus FAdV-9A4-CMV-EGFP. (B) Five additional intermediate constructs were created, leading to the plasmids: pHMR-CAG-EGFP, pHMR-EF1a-EGFP, pHMR-CMV-EGFP-WPRE, pHMR-CAG-EGFP-WPRE, and pHMR-EF1a-EGFP-WPRE;

in fig. 17 shows agarose gel electrophoresis screening for NotI-digested FAd-mids. FAd-mids obtained by homologous recombination of plasmids pFAdV-9A4 and pHMR were digested using NotI and the resulting banding patterns were screened on an agarose gel. Cleaved pFAdV-9A4 has the expected banding pattern of 4 kb, 5.1 kb, 13.7 kb. and 23.8 t.o. Recombinant FAd-mids with an EGFP expression cassette contain an additional NotI site for screening. The diagnostic bands corresponding to each cassette are as follows: CMV-EGFP=2.2 kb, CMV-EGFP-WPRE=2.2 kb. and 0.55 kb, CAG-EGFP=2.9 kb, CAG-EGFP-WPRE=0.55 kb, EF1aEGFP=2.7 kb. and EF1a-EGFP-WPRE=2.7 kb. and 0.55 t.o. White arrows indicate diagnostic bands;

in fig. Figure 18 shows virus growth curves. One-step growth curves for each recombinant avian adenovirus were determined in CH-SAH cells. Cells were seeded in 35 mm dishes (1.8 x 10 ⁶ cells/dish) and infected at an MOI of 5. Intracellular and extracellular virus were collected between 0

- 5 043809 and 72 h.p.i. One-step growth curves were obtained in duplicate for each sample, and all extracellular virus was titrated by plaque assay;

in fig. 19 shows that the cytopathic effect of recombinant FAdV is the same as FAdV-9A4. CH-SAH cells were seeded in 35 mm dishes (1.8 x 10 ⁶ cells/dish) and infected at an MOI of 5. The cytopathic effect of the recombinant viruses was compared with the wild-type control FAdV-9A4. All recombinant viruses (data not shown) were observed to have a CPE similar to FAdV-9A4, as evidenced by rounding and separation of cells using a bright-field microscope. However, EGFP fluorescence from recFAdVs, such as FAdV-9A4-CAG-EGFP-WPRE, was observed using fluorescence microscopy;

in fig. Figure 20 shows the dynamics of EGFP expression in CH-SAH cells. CH-SAH cells were seeded in 35 mm dishes (1.8 x 10 ⁶ cells/dish) and infected with recFAdV-9s at an MOI of 5. At each time point, infected cells were collected, washed, and resuspended in PBS. After three freeze-thaw cycles, samples were centrifuged and the protein concentration of the collected supernatant was measured using Nanodrop. Absolute EGFP fluorescence from 50 μg of whole cell lysate was measured using a microplate reader at excitation and emission wavelengths of 480 and 528 nm, respectively. Uninfected (mock) or FAdV-9A4 infected cells did not show any EGFP fluorescence;

in fig. 21 shows Western immunoblotting of EGFP production over time. EGFP expression by recFAdV-9 in CH-SAH cells was compared at 48 hpi, along with FAdV-9A4 (negative control), uninfected mock (negative control), and pEGFP-N1 transfected CH-SAH cells (positive control). CH-SAH cells were seeded in 35 mm dishes (1.8 x 10 ⁶ cells/dish) and infected with recFAdV-9 at an MOI of 5. At each time point, whole cell lysates were collected and protein concentrations were determined by Bradford assay. 6 μg of each sample was loaded onto two gels, one probed with anti-EGFP antibody (1:1000), followed by secondary anti-mouse HRP-conjugated antibody (1:5000), the other gel probed with anti-actin antibody (1:200), followed by followed by a secondary anti-goat HRP-conjugated antibody (1:20,000). All bands that appeared were of the expected size (EGFP=27 kDa and actin=42 kDa) as determined by a molecular mass marker (not shown);

in fig. 22 shows polyvalent recombinant FadV-9 with H5, H7 and HN.

Detailed Description of the Invention

The inventors have found that recombinant FAdV-9 with deletions on the left and/or right side of the genome can be used as viral vectors.

In one embodiment, the recombinant FAdV-9 viral vector has a deletion at the left end of the genome. In one embodiment, the deletion at the left end of the genome comprises a deletion of one or more of ORF0, ORF1 and ORF2.

In one embodiment, the recombinant FAdV-9 viral vector has a deletion at the right end of the genome. In one embodiment, the deletion at the right end of the genome comprises a deletion of one or more of ORF19, TR2, ORF17, and ORF11.

In one additional embodiment, the recombinant FAdV-9 viral vector has deletions at both the left end and the right end of the genome. In one embodiment, the FAdV-9 viral vector has a deletion of ORF0, ORF1, ORF2, TR2, ORF17, and ORF11. In one embodiment, the recombinant FAdV-9 viral vector has a deletion of ORF1, ORF2, TR2, ORF17, and ORF11. In one embodiment, the FAdV-9 viral vector has a deletion of ORF1, ORF2, and ORF19. In one embodiment, the recombinant FAdV-9 viral vector has a deletion of ORF1, ORF2, and ORF19, TR2, or ORF11.

As shown in the Examples, recombinant FAdV-9 viral vectors with left-side and right-side deletions, including the TR2 deletion, are stable and can be used to drive transgene expression.

The FAdV viral vectors described herein provide many advantages. For example, in some embodiments, FAdV viral vectors enable the production of mono- and multivalent vaccines. The significance of a vector capable of expressing dual or even multivalent antigens is that only one vaccine is needed to protect against one or more diseases. In one embodiment, the vectors allow for the insertion of large segments of foreign DNA, optionally up to 7.7 kb. foreign DNA. In one embodiment, the vectors are stable and safe for use in animals, such as chickens. In one embodiment, viral vectors are easy to obtain and produce high viral titers. In one embodiment, there are different serotypes of FAdV. In one embodiment, viral vectors do not have pre-existing immunity in humans and can be used in human gene therapy.

In one embodiment, the FAdV-9 viral vectors described herein

- 6 043809 nii, may include one or more exogenous nucleotide sequences (also referred to herein as transgenes).

In one embodiment, the exogenous nucleotide sequence is selected from antigenic sequences against influenza, infectious laryngotracheitis, infectious bronchitis, bursa of Fabricius (Gumboro) infection, hepatitis, viral rhinotracheitis, infectious catarrh, Mycoplasma hyopneumonieae, pasteurellosis, porcine respiratory and reproductive syndrome (PRRS) , circovirus, bordetelliosis, parainfluenza or any other antigen, the size of which allows its insertion into the corresponding viral vector.

In another embodiment, the exogenous nucleotide sequence is selected from antigenic sequences against avian influenza, laryngotracheitis (LT), Newcastle disease (NDV), infectious anemia, inclusion bodies, infectious bronchitis (IB), metapneumovirus (MPV) or Gumboro.

In one preferred embodiment of the invention, the exogenous nucleotide sequence contains, consists essentially of, or consists of a sequence corresponding to at least one gene disclosed in table. 1, or its homologue. As used herein, the term gene homolog is intended to mean a gene with at least 85%, at least 90%, at least 98%, or at least 99% sequence identity with a gene having biological activity of the same nature. In one embodiment, the vector described herein contains 2, 3 or 4 sequences corresponding to the genes disclosed in table. 1, or their homologues. Optionally, exogenous sequences can be inserted into the vector at a single insertion site or at multiple different insertion sites.

Table 1

Disease Gene GEN BANK access Bird flu Hemagglutinin mexican bird influenza H5N2 strain 435 FJ864690.1 (SEQ ID no. 10) Avian influenza H7N3 Jalisco 2012 hemagglutinin JX397993.1 (SEQ ID no. eleven) Hemagglutinin avian influenza H7N3 Guanajuato 2015 KR821169 (SEQ ID No. 12) Laryngotracheitis (LT) Glycoprotein B laryngotracheitis, strain USDA EU104965.1 (SEQ ID No. 13) Glycoprotein D laryngotracheitis, strain USDA JN542534.1|:132317- 133621 (SEQ ID No. 14) Newcastle (NDV) HN gene, LaSota strain KC844235.1|:6412- 8145 (SE ID NO: 15) HN gene, disease virus strain isolate Newcastle Chicken/M083313/Mexico/2008 KF910962.1 (SEQ ID No. 16) Infectious anemia VP1 gene from chicken anemia virus strain isolate CAV-10 KJ872513.il:832-2181 (SEQ ID No. 17) VP2 gene from chicken anemia virus strain isolate CAV-10 AIV09094.1 (SEQ ID No. 18) Inclusion bodies Avian adenovirus 4 short fiber gene AY340863.1 (SEQ ID no. 19) Infectious bronchitis (IB) Gene derived from the infectious bronchitis virus strain ArkDPI EU359651.1 (SEQ ID No. 20) glycoprotein spinous process of commercial vaccine D Metapneumovirus (MPV) Isolate avian metapneumovirus 1T/Tu/A/259-01/03, gene G |JF424833.1|:2943- 45599 (SEQ ID No. 21) Gumborough Gumborough VP2

FAdV-9 viral vectors described herein can be produced using recombinant technologies, such as PCR amplification of the nucleotide sequence of interest by identifying antigenic sites, isolating the original pathogen, under

- 7 043809 lying further insertion, which is amplified in the viral vector. The insertion can be created using standard molecular biology techniques such as restriction enzymes and DNA ligases, among others. The infectious clone thus obtained is introduced into a suitable cell line to produce a recombinant virus. For example, in one embodiment, the methods necessary for constructing FAdV-9 viral vectors are described in the present examples and the procedures described for constructing FAdV-9 infectious clone (FAd-mids) (Ojkic, D. & Nagy, E. (2001 ), The long repeat region is dispensable for fowl adenovirus replication in vitro. Virology 283, 197-206). This procedure uses homologous recombination between viral genomic DNA and a linearized plasmid containing both ends of the genome flanking a scaffold vector (pWE-Amp with integrated Pad sites). The foreign gene of interest, with a promoter to drive its expression, is then inserted into suitable genomic regions of the infectious clone that are optional or nonessential (Corredor and Nagy, 2010a and 2010b) and introduced into a suitable cell line.

The viral vector of the present invention can be used, for example, to prepare and administer immunogenic compositions containing at least a viral vector as disclosed herein and an exogenous nucleotide sequence encoding at least one antigenic site of a disease of interest inserted therein . Optionally, the viral vector of the present invention is a dual delivery vector that can be used to direct the expression of two or more exogenous nucleotide sequences. In one embodiment, two or more exogenous nucleotide sequences are under the control of different promoters. In one embodiment, promoters are selected from the group consisting of CMV, CAG, EF1a,e-actin and L2R.

In one embodiment, an avian adenovirus described herein contains a nucleotide sequence with sequence identity to the sequence set forth in SEQ ID NO: 1 in which ORF0, ORF1, ORF2, TR2, ORF17, and ORF11 are deleted. SEQ ID No. 1 corresponds to the complete genomic sequence of avian adenovirus D (GenBank accession number AC_000013.1). In one embodiment, the FAdV-9 viral vector described herein contains or consists of a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequence presented in SEQ ID No. 1 in which ORF0, ORF1, ORF2, TR2, ORF17 and ORF11 are deleted in whole or in part. In a preferred embodiment, the avian adenovirus described herein contains a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1, in which ORF1, ORF2, TR2, ORF17 and ORF11 are completely or partially deleted. In one embodiment, the FAdV-9 viral vector described herein contains or consists of a nucleotide sequence of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequence presented in SEQ ID No. 1 in which ORF1, ORF2, TR2, ORF17 and ORF11 are deleted.

In another embodiment, an avian adenovirus described herein contains a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1 in which ORF1, ORF2 and ORF19 are deleted in whole or in part. In one embodiment, the FAdV-9 viral vector described herein contains or consists of a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequence presented in SEQ ID No. 1 in which ORF1, ORF2 and ORF19 are deleted in whole or in part.

In another embodiment, an avian adenovirus described herein contains a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1 in which ORF1, ORF2 and ORF19, TR2 or ORF11 are deleted in whole or in part. In one embodiment, the FAdV-9 viral vector described herein contains or consists of a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequence presented in SEQ ID No. 1 in which ORF1, ORF2 and ORF19, TR2 or ORF11 are deleted in whole or in part.

In another embodiment, an avian adenovirus described herein contains a nucleotide sequence with sequence identity to the sequence set forth in SEQ ID No. 1 in which nucleotides 575 to 2753 are deleted in whole or in part. This sequence (nucleotides 575 to 2753) contains ORF0, ORF1A, ORF1B, ORF1C and ORF2. In another embodiment, the FAdV-9 viral vector described herein contains or consists of a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99%, or 100% sequence identity to the sequence set forth in SEQ ID No. 1 in which nucleotides 575 to 2753 are deleted. In another embodiment, an avian adenovirus described herein contains a nucleotide sequence identical to

- 8 043809 sequences with the sequence presented in SEQ ID No. 1, in which nucleotides 847 to 2753 have been deleted in whole or in part. This nucleotide sequence (nucleotides 847 to 2753) contains ORF1A, ORF1B, ORF1C and ORF2. In another embodiment, the FAdV-9 viral vector described herein contains or consists of a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99% or 100% sequence identity with the sequence presented in SEQ ID No. 1, in which nucleotides 847 to 2753 are deleted in whole or in part.

In another embodiment, an avian adenovirus described herein contains a nucleotide sequence with sequence identity to the sequence set forth in SEQ ID No. 1 in which nucleotides 38807 to 42398 are deleted in whole or in part. This nucleotide sequence (nucleotides 38807 to 42398) contains TR-2, ORF17 and ORF11. In another embodiment, the FAdV-9 viral vector described herein contains or consists of a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99% or 100% sequence identity with the sequence presented in SEQ ID No. 1, in which nucleotides 38807 to 42398 are deleted in whole or in part.

In one embodiment, the viral vector contains or consists of a nucleotide sequence with sequence identity to the sequence containing or consisting of SEQ ID No. 1 in which at least 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000 have been deleted. 4500 or 5000 nucleotides corresponding in whole or in part to nucleotides 575 to 2753 and/or 38807 to 42398 in SEQ ID No. 1.

In one embodiment, the viral vector contains or consists of a nucleotide sequence with sequence identity to the sequence containing or consisting of SEQ ID No. 1 in which at least 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000 have been deleted. 4500 or 5000 nucleotides corresponding in whole or in part to nucleotides 847 to 2753 and/or 38807 to 42398 in SEQ ID No. 1.

In another embodiment, the viral vector contains or consists of a nucleotide sequence with sequence identity to the sequence containing or consisting of SEQ ID No. 1, in which at least 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500 have been deleted or 5000 nucleotides corresponding in whole or in part to nucleotides 847 to 2753 and 34220 to 36443.

In another embodiment, the viral vector contains or consists of a nucleotide sequence with sequence identity to the sequence containing or consisting of SEQ ID No. 1, in which at least 500, 1000, 1500, 2000, 250θ, 3000, 3500, 4000, 4500 have been deleted or 5000 nucleotides corresponding in whole or in part to nucleotides 847 to 2753, 34220 to 36443 and 38807 to 40561 or 41461 to 42398.

At least one exogenous nucleotide sequence is optionally inserted into the FAdV-9 viral vector described herein. Accordingly, in one embodiment, the FAdV-9 nucleotide sequence with the deletions described herein is not present in the vector as a single contiguous sequence, but rather includes pieces of contiguous sequences interrupted by at least one and optionally at least two, three or four, exogenous nucleotide sequences. Therefore, in one embodiment, the avian adenovirus described herein contains one or more nucleotide sequences with sequence identity to one or more sequences set forth in SEQ ID No. 1, in which at least one of ORF0, ORF1, ORF2 is deleted , TR2, ORF17 and ORF11, and the nucleotide sequence contains at least two, three, four or five contiguous sequences.

The number of nucleotides removed from FAdV-9 varies. In one embodiment, from 1000 to 7000 nucleotides, optionally divided between the left and right ends of the genome, are removed. In other embodiments, from 1500 to 6000 nucleotides are removed. In one embodiment, at least 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 5000 or 6000 nucleotides are removed.

The size of the exogenous nucleotide sequence(s) inserted into the viral vector described herein also varies. In one embodiment, based on the 105% adenovirus stability rule, the vector capacity is up to 7751 bp. In other embodiments, 1000 to 7000 nucleotides are inserted, optionally separated between the left and right ends of the genome. For example, one foreign gene may be inserted at the left end, and a second foreign gene may be inserted at the other end. In other embodiments, from 1500 to 6000 nucleotides are inserted. In one embodiment, at least 1000, 2000, 3000, 4000, 5000 or 6000 exogenous nucleotides are inserted.

In one embodiment, the FAdV-9 viral vector has a deletion at the left end of the genome of approximately 2291 base pairs, optionally between about 1900 and 2500 base pairs. In one embodiment, the FAdV-9 viral vector has a deletion on the right

- 9 043809 end of the genome at approximately 3591 base pairs. In one embodiment, the FAdV-9 viral vector has a deletion at the right end of the genome between approximately 3000 base pairs and 4000 base pairs.

Sequence identities are typically assessed using an advanced search with BLAST version 2.1 (standard default parameters; Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990) Basic local alignment search tool. J. Mol Biol 215:403_410). BLAST is a series of programs that are available online in the U.S. National Center for Biotechnology Information (National Library of Medicine Building 38 ABethesda, MD 20894). In Blast advanced search, default parameters are set. Blast program references include: Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215:403-410; Gish, W. & States, D.J. (1993) Identification of protein coding regions by database similarity search. Nature Genet. 3:266272.; Madden, T.L., Tatusov, R.L. & Zhang, J. (1996) Applications of network BLAST server Meth. Enzymol. 266:131-141; Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402); Zhang, J. & Madden, T.L. (1997) PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation. Genome Res. 7:649-656).

As used herein, a viral vector refers to a recombinant adenovirus that is capable of delivering an exogenous nucleotide sequence into a host cell. For example, in one embodiment, the viral vector contains restriction sites that are suitable for inserting an exogenous nucleotide sequence into the vector. In one embodiment, one or more nucleotide sequences that are not required for replication or transmission of FAdV-9 as described herein are removed from the nucleotide sequence of the viral vector. For example, in one embodiment, nucleotide sequences at the left and/or right end of the FAdV-9 genome are removed from the recombinant FAdV-9 viral vector. In one embodiment, nucleotide sequences corresponding to one or more of ORFs 0-2, ORF19, TR2, ORF17, and ORF11 are removed from the recombinant FAdV-9 viral vector. In one embodiment, the viral vector contains one or more exogenous control sequences, such as promoters or cloning sites, that can be used to control the expression of transgenes. In one embodiment, promoters are selected from the group consisting of CMV (SEQ ID No. 4), CAG (SEQ ID No. 5), EF1a (SEQ ID No. 6), β-actin (SEQ ID No. 8), and L2R (SEQ ID No. No. 7).

In one embodiment, the viral vector contains an exogenous nucleotide sequence encoding a polypeptide of interest. In one embodiment, the polypeptide of interest is an antigen of a disease of interest. For example, in one embodiment, the viral vector contains an exogenous nucleotide sequence encoding at least one antigenic site of a disease of interest. Exogenous nucleotide sequences encoding a polypeptide of interest can be readily obtained by methods known in the art, for example, by chemical synthesis, screening of suitable libraries, or by retrieval of the gene sequence using polymerase chain reaction (PCR).

With respect to the present disclosure, diseases of interest include, but are not limited to, influenza, infectious laryngotracheitis (ILT), infectious bronchitis (IB), infectious bursitis (Gumboro), hepatitis, viral rhinotracheitis, infectious catarrh, Mycoplasma hyopneumonieae, pasteurellosis, porcine respiratory and reproductive syndrome (PRRS), circovirus, bordetellosis, parainfluenza, avian influenza, Newcastle disease (NDV), infectious anemia, inclusion body hepatitis (IBH) and metapneumovirus (MPV).

In one embodiment, the viral vector is adapted to express an exogenous nucleotide sequence in a host cell. For example, in one embodiment, the viral vector contains control sequences capable of influencing the expression of an exogenous nucleotide sequence in the host. For example, viral vectors described herein may contain one or more control sequences, such as a transcriptional promoter, an enhancer, an optional operator sequence to direct transcription, a sequence encoding suitable mRNA ribosome binding sites, alternative splicing sites, translational sequences, or sequences , which control the termination of transcription and translation. Optionally, the viral vector contains different control sequences at the left end and right end of the vectors. In one embodiment, promoters are selected from the group consisting of CMV (SEQ ID No. 4), CAG (SEQ ID No. 5), EF1a (SEQ ID No. 6), β-actin (SEQ ID No. 8), and L2R (SEQ ID No. No. 7), and the enhancer may be WPRE (SEQ ID No. 9).

In one embodiment, the viral vector contains one or more exogenous nucleotide sequences operably linked to one or more control sequences.

- 10 043809 mi sequences. In one embodiment, the viral vector contains an insertion site adjacent to one or more control sequences such that when an exogenous nucleotide sequence is inserted into the vector, the exogenous nucleotide sequence is operably linked to the control sequences. As used herein, nucleotide sequences are operably linked when they are in a functional relationship to each other. For example, a promoter is operably linked to a coding sequence if it directs transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned to allow translation. Optionally, the sequences that are operably linked are contiguous sequences in the viral vector.

In one embodiment, the viral vector described herein contains a sequence suitable for biological selection of host organisms containing the viral vector, for example, a positive or negative selection gene.

Other methods known in the art, such as recombinant technologies, including but not limited to those disclosed in Sambrook et al. (Sambrook J et al. 2000. Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory Press) are also suitable for the preparation of nucleotide sequences and viral vectors as disclosed herein.

Optionally, the viral vectors and methods described herein can be used for gene therapy in animal patients in need thereof. For example, in one embodiment, viral vectors described herein can be used to deliver and express a therapeutic nucleotide sequence or a nucleotide encoding a therapeutic protein. In one embodiment, a method of gene therapy is provided, comprising administering to a patient in need thereof a viral vector or composition as disclosed herein, wherein the viral vector comprises an exogenous nucleotide sequence encoding a therapeutic nucleotide sequence or protein.

Another aspect of the present disclosure includes an immunogenic composition comprising a recombinant FAdV-9 viral vector as disclosed herein. In one embodiment, immunogenic compositions can be prepared by known methods for preparing compositions for administration to animals, including, but not limited to, humans, farm animals, poultry and/or fish. In one embodiment, an effective amount of a viral vector described herein is combined with a pharmaceutically acceptable carrier. Suitable carriers are described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA) or Handbook of Pharmaceutical Additives (compiled by Michael and Irene Ash, Gower Publishing Limited, Aldershot, England (1995). Based on of which, the compositions include, but are not limited to, solutions of the viral vectors described herein associated with one or more pharmaceutically acceptable carriers or diluents, and may be contained in buffer solutions of suitable pH and/or be isosmotic to physiological fluids. In embodiments, the immunogenic composition contains an adjuvant.

The new FAdV-9 viral vectors, associated methods and uses are more clearly illustrated in the following description of specific examples.

Example 1. Materials and methods.

1.1. Cell culture and viruses.

Chicken hepatoma cells (CH-SAH cell line) were maintained in Dulbecco's modified Eagle's medium/F-12 Ham (DMEM-F12) (Sigma) plus 200 mM L-glutamine and 100 U/ml penicillin-streptomycin (PenStrep , Sigma) with 10% non-heat-inactivated fetal bovine serum (FBS) as described (Alexander, H.S., Huber, P., Cao, J., Krell, P.J., Nagy, E. 1998. Growth Characteristics of Fowl Adenovirus Type 8 in a Chicken Hepatoma Cell Line. J. Virol. Methods. 74, 9-14.). Recombinant FAdVs were generated using the FAdV-9A4 deletion virus described in Corredor and Nagy (2010b) as a backbone. All viruses were propagated in CH-SAH cells as described by Alexander et al. (1998).

1.2. Basic DNA manipulation.

1.2.1. Bacterial Cultures and Plasmid Isolation Escherichia coli DH5a cells provided the bacterial host for all described plasmids, while E. coli BJ5183 cells were used for homologous recombination to generate recombinant FAd midids.

Bacterial cultures were grown on selective liquid or agar (16 mg/ml) Luria-Bertani (LB) growth medium containing ampicillin (100 μg/ml) at 37°C. Individual colonies of E. coli were collected and inoculated into 5 ml of LB medium supplemented with 0.1% ampicillin in order to select for growth bacteria containing the transformed plasmid with resistance to ampicillin. Incubation and growth took place for approximately 16 hours. Chemically (CaCl ₂ ) we obtained com

- 11 043809 potent E. coli DH5a and transformed them with either 10 μl of the ligation product or 1 μl of purified plasmid DNA (Sambrook, J., Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual, volume 1, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring, New York, USA). All plasmids were isolated using either the EZ-10 Spin Column Plasmid DNA Mini-prep kit (Bio Basic) or the PureLink HiPure Plasmid Midiprep kit (Invitrogen) (for plasmids larger than 40 kb or when high DNA concentrations are required) according to the manufacturer's protocol .

1.2.2. PCR and restriction enzyme digestion.

DNA was amplified by polymerase chain reaction (PCR) during cloning of all dual expression constructs and recombinant viruses. For all cloning, PCR amplification was performed using the Kod Hot Start Polymerase kit (Novagen). However, Taq polymerase was used in plasmid screening using PCR. Unless otherwise stated, PCR conditions for Kod and Taq polymerases are summarized in Table. 2. All PCR reactions were performed using Mastercycler Pro (Eppendorf).

Restriction enzyme (RE) digestions were performed for both Fast Digest enzymes (Fermentas) and enzymes from New England BioLabs (NEB). All reactions were carried out according to the manufacturer's protocol (for each enzyme). Digestion reactions were always performed at 37°C, and samples were heat inactivated in a Mastercycler Pro thermal cycler (Eppendorf).

Unless otherwise stated, all DNA samples were electrophoresed at 100 V on 0.8% agarose gels containing 1x RedSafe™ (iNtRON Biotechnology). For electrophoresis of DNA samples, 6x DNA loading buffer [0.25% (w/v) bromophenol blue, 40% sucrose (w/v) in water] and 1x Tris-acetate-EDTA (TAE) buffer were used.

1.2.3. Plasmid construction and transformation.

After RE digestion and gel purification, the PCR amplified DNA and plasmid were ligated together with T4 DNA ligase (Invitrogen). Unless otherwise stated, ligation was performed at a 1:1 insert to vector molar ratio overnight at 16°C. 50 μl of CaCl ₂ competent E. coli DH5a was mixed with 10 μl of ligation product or 1 μl of purified plasmid DNA. Competent cells and DNA were incubated on ice for 30 min, then heat shocked at 42°C for 1 min. Cells were recovered on ice for 3 min, and 500 μl of superoptimal broth with catabolite repression (SOC) medium was added to each microcentrifuge tube. Cells were incubated at 37°C for 1 h with shaking, then centrifuged and resuspended in 100 μl of LB broth. The entire volume was spread over an LB agar plate containing ampicillin.

Homologous recombination was performed in E. coli BJ5183 cells. 2 μg of both promoter cassettes and linear FAdV-9A4 DNA were mixed in 100 μl of chemically competent BJ5183 cells. The mixtures were left on ice for 15 min, followed by heat shock at 42°C for 1 min. Cells were allowed to recover on ice for 20 min, and 1 ml of SOC medium was added to each microcentrifuge tube and transferred to a 5 ml glass culture tube. Cells were incubated for 2 h at 37°C with shaking, then centrifuged and resuspended in 100 μl of LB broth. The entire volume of cells was spread on an LB agar plate containing ampicillin.

1.2.4. Sequencing.

All PCR products and plasmids were purified and sequenced using an ABI 3730 DNA sequencer (Laboratory Services Division, Guelph, ON). Sequence data were analyzed using SnapGene Viewer (GSL Biotech).

1.3. Promoter expression analysis.

1.3.1. Generation of dual expression plasmid constructs.

The activities of five promoters (CMV, CAG, EF1a, β-actin, and L2R) and one enhancer element (WPRE) were compared by measuring the expression of EGFP versus firefly luciferase driven by the SV40 promoter in transfected CH-SAH cells. Plasmids pCI-Neo (Promega), pCAG-Puro, and pEF1a-Puro were provided by Dr. Sarah Wootton (University of Guelph). Dual expression plasmids were created using the pCI-Neo plasmid as a backbone (Fig. 11), which contained the CMV promoter along with several unique RE sites. Both CAG and EF1a promoters were subcloned from pCAG-Puro and pEF1a-Puro, respectively, into pCI-Neo using SpeI and EcoRI. The presence of each promoter was confirmed by sequencing using the primer pCI-Neo-F (Table 3). EGFP was amplified by PCR from pEGFP-N1 (Clontech Laboratories, Inc) using primers EGFP-F and EGFP-R (Table 3) at an annealing temperature of 60°C. The resulting PCR product was gel extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega). Both the EGFP PCR product and the pCI-Neo-based plasmids (containing the CMV, CAG, or EF1a promoter) were double digested with EcoRI and NotI for 1 h at 37°C. The digested plasmid and PCR product were then gel separated and extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega) and ligated for

- 12 043809 nights at 4°C. After transformation into E. coli DH5a cells and growth on LB-ampicillin plates, colonies were screened by PCR for the presence of the EGFP Fragment using primers EGFP-F and EGFP-R. All positive colonies were confirmed by sequencing using primer EGFP-I-F (Table 3), resulting in plasmids pCMV-EGFP, pCAG-EGFP, and pEF1a-EGFP.

The β-actin promoter was amplified by PCR from pCAG-Puro using primers vactinF and vactin-R (Table 3) at an annealing temperature of 60°C. The resulting PCR product was gel extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega). The PCR product of β-actin and pCAG-EGFP was double digested with EcoRI and NotI for 1 h at 37°C. The digested plasmid and PCR product were then gel separated and extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega) and ligated overnight at 4°C. After transformation into E. coli DH5a cells and growth on LB-ampicillin plates, colonies were screened using RE for the presence of β-actin. All positive colonies were confirmed by sequencing using primers pCI-Neo-F and EGFP-I-F (Table 3), resulting in the vactin-EGFP plasmid.

The chickenpox virus L2R promoter was PCR amplified from pE68 (Zantinge, J.L., Krell, P.J., Derbyshire, J.B., Nagy, E. 1996. Partial transcriptional mapping of the fowlpox virus genome and analysis of the EcoRI L fragment. J. Gen. Virol. 77(4), 603-614) using primers L2R-F and L2R-R (Table 3) at an annealing temperature of 60°C. The resulting PCR product was gel extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega). The PCR product of L2R and pCMV-EGFP was double digested with EcoRI and NotI for 1 h at 37°C. The digested plasmid and PCR product were then gel separated and extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega) and ligated overnight at 4°C. After transformation into E. coli DH5a cells and growth on LB-ampicillin plates, colonies were screened using RE for the presence of L2R. All positive colonies were confirmed by sequencing using primers pCI-Neo-F and EGFP-I-F (Table 3), resulting in plasmid pL2R-EGFP.

Firefly luciferase PCR was amplified from pGL4.17 (Promega) using primers Luc-F and Luc-R (Table 3) at an annealing temperature of 55°C. The resulting PCR product (1.6 kb) was gel extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega). The luciferase PCR product and promoter plasmids were double digested with AvrII and BstBI for 1 h at 37°C. The digested plasmid and PCR product were then separated on a gel by removing the neomycin resistance (NeoR) cassette from each plasmid and extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega) and ligated overnight at 4°C. After transformation into E. coli DH5a cells and growth on LB-ampicillin plates, colonies were screened by PCR for the presence of luciferase. All positive colonies were confirmed by sequencing using the SV40-F primer (Table 3).

Five additional dual expression plasmids were created to include the WPRE enhancer element. The WPRE PCR element was amplified from pWPRE (Dr. Sarah Wootton, University of Guelph) using primers WPRE-F and WPRE-R (Table 2.2) at an annealing temperature of 55°C. The PCR product was gel extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega). The WPRE PCR product and promoter were digested with NotI for 1 h at 37°C. After digestion, plasmids were treated with alkaline phosphatase (calf intestinal, New England BioLabs) according to the manufacturer's protocol to prevent religation. The digested/dephosphorylated plasmid and PCR product were then separated in a gel and DNA was extracted using the Wizard Plus SV Miniprep DNA Purification kit (Promega) and ligated overnight at 4°C. After transformation into E. coli DH5a cells and growth on LB-ampicillin plates, colonies were screened by PCR for the presence of WPRE. All positive colonies were confirmed by sequencing using EGFP-I-F (Table 3). A list of all plasmids created in this study and their purposes is given in Table. 4.

1.3.2. Transfection of chicken hepatoma cells.

EGFP expression was measured by transfecting CH-SAH cells with dual expression plasmids. Cells were seeded in 35 mm dishes at a density of 1.2 x 106 cells/dish and incubated at 37°C with 5% CO ₂ . Lipofectamine 2000 (Invitrogen) was used to transfect all constructs according to the manufacturer's recommendations. Briefly, 2 μg of dual expression plasmid and 5 μl of Lipofectamine were incubated in separate 50 μl aliquots of Opti-Mem medium (Gibco) for 5 minutes, then mixed and incubated together for 20 minutes. During this period of time, the medium was removed from each dish and the cell monolayers were washed two times with phosphate-buffered saline (PBS). 2 ml DMEM-F12 (5% FBS) without antibiotics was added to each plate. After 20 minutes, the plasmid-lipofectamine mixtures were added to 35 mm dishes and incubated for 6 hours at 37°C in the presence of 5% CO2. This was repeated for all 10 dual expression plasmids.

- 13 043809

After 6 h, the medium was removed and fresh DMEM-F12 (5% FBS) was added. Every 12 hours post-transfection (h.p.t.), EGFP expression was confirmed by fluorescence microscopy and whole cell lysate was collected. Monolayers were washed with PBS, trypsin was added, and cells were resuspended in DMEM-F12 (10% FBS). The cells were then centrifuged in 15 ml conical tubes (Nunc®), the supernatant was removed and the cell pellet was resuspended in 500 µl PBS and frozen at -80°C. Samples of transfected cells, frozen at -80°C, were frozen and thawed three times. Cellular debris was pelleted by centrifugation at 12,000 rpm in a microcentrifuge for 10 minutes at 4°C. The supernatant was transferred to a fresh microcentrifuge tube and the protein concentration was determined at 280 nm using a Nanodrop 2000 (Thermo Scientific). All samples were adjusted to a protein concentration of 1 μg/μl.

1.3.3. Fluorescence microscopy.

Both transfected and infected CH-SAH cells were monitored by fluorescence microscopy using a Zeiss fluorescence microscope (Carl Zeiss) with FITC optics.

1.3.4. Measurement of reporter gene expression.

EGFP expression was quantified by spectrofluorometry using a GloMax®-Multi microplate reader (Promega). Briefly, 50 μg of protein lysate was added in triplicate to a flat-bottomed black 96-well plate (Corning). EGFP fluorescence was measured in a GloMax®-Multi microplate reader (Promega) at excitation wavelengths of 480 nm and emission wavelengths of 528 nm. For each sample, three readings were averaged to obtain one fluorescence value.

Luciferase expression was determined using the Pierce Firefly Luciferase Glow Assay kit (Thermo Fisher Scientific) according to the manufacturer's protocol. Briefly, 25 μg of protein lysate was added in triplicate to a flat-bottomed black 96-well plate (Corning). In each replicate, 50 μl of luciferase assay substrate was manually added, mixed well, and incubated for 15 min, protected from light, before luminescence was measured in a GloMax®-Multi microplate reader (Promega). For each sample, the readings were averaged to obtain one luminescence value.

1.3.5. Normalization of promoter expression.

Normalization of dual expression constructs was performed to remove sample-to-sample variability in transfection efficiency (Schagat, T., Paguio, A., Kopish, K. 2007. Normalizing Genetic Reporter Assays: Approaches and Considerations for Increasing Consistency and Statistical Significance. Cell Notes. 17, 9-12). The fold change in activity was determined between the promoter constructs and pCMV-EGFP-Luc. At the beginning, for each specific time point and repetition, the average fluorescence and luminescence values were determined for each plasmid construct, where the fluorescence to luminescence ratio (F/R) was calculated. The level of activity was compared to the CMV promoter currently used in recFAdV, therefore the F/R ratio for CMV was set to 1.0 (dividing the F/R ratio by itself). Each remaining construct F/R value was also divided by the CMV F/R value, resulting in a value representing the normalized fold change in activity (fold A). The average fold change between replicates was compared between all constructs at each time point.

1.4. Generation and characterization of recombinant viruses.

1.4.1. Design of intermediate structures.

Additional in vitro EGFP expression analysis was performed using recFAdVs containing CMV, CAG, and Ef1a-based expression cassettes. In previous studies, recFAdV was generated by homologous recombination between pFAdV-9A4 and a PCR-amplified expression cassette containing viral flanking regions isolated from the intermediate construct. Plasmid pleftA491-2,782 (pLA2.4) contains a Δ4 deletion site at the left end (Δ491-2,782 nt) of FAdV-9 with a SwaI RE site for blunt cloning of the transgene (Corredor and Nagy, 2010b). This study developed a new intermediate design system by cloning viral flanking regions directly into dual expression plasmids, thereby creating ready-to-recombineer (pHMR) plasmids. Viral genomic regions flanking the Δ4 deletion site in FAdV-9 were amplified by PCR from the pLΔ2.4 intermediate construct. The region to the left of the deletion site (VF1) was PCR amplified using 100 ng of pLΔ2.4 and primers VF1-F and VF1-R (Table 3) at an annealing temperature of 52°C. The resulting PCR product was gel extracted using the EZ-10 Spin Column Plasmid DNA Mini-prep kit (Bio Basic). The VF1 PCR product and all dual expression vectors were digested with SpeI for 1 h, followed by digestion with BglII. The digested plasmid and PCR product were then gel separated and extracted using the QIAEX II Gel Extraction kit (Qiagen) and ligated overnight at 16°C. After transformation into E. coli DH5a cells and growth on LB-ampicillin plates, colonies were screened by PCR for the presence of the VF1 fragment with

- 14 043809 using primers VF1-F and VF1-R. All positive colonies were confirmed by sequencing. The region to the right of the deletion site (VF2) was then PCR amplified using 100 ng of pLA2.4 and primers VF2-F and VF2-R (Table 3) at an annealing temperature of 52°C. The resulting PCR product was gel extracted using the EZ-10 Spin Column Plasmid DNA Mini-prep kit (Bio Basic). The VF2 PCR product and all dual expression vectors positive for the VF1 fragment were digested with KpnI for 1 h, followed by digestion with MfeI. The digested plasmid and PCR product were then gel separated and extracted using the QIAEX II Gel Extraction kit (Qiagen) and ligated overnight at 16°C. After transformation into E. coli DH5a cells and growth on LB-ampicillin plates, colonies were screened by PCR for the presence of the VF2 fragment using primers VF1-F and VF2-R (Table 3) at an annealing temperature of 52°C, at the expected size 2 t.o. plus the size of each EGFP expression cassette. A list of all six pHMR intermediate plasmids is given in Table. 4. 1.4.2 Generation of recombinant avian adenoviruses Recombinant FAdVs were generated to incorporate the CMV, CMV-WPRE, CAG, CAG-WPRE, EF1a and EF1a-WPRE expression cassettes using a modified method of Corredor and Nagy (2010b) (Fig. 12 ). The viral DNA flanked expression cassettes in the pHMR plasmids were recombined with pFAdV-9A4 to generate new recombinant FAdmids containing the promoter of interest and EGFP. To generate EGFP promoter cassettes flanked by viral DNA sequences, intermediate pHMR constructs were subjected to PCR or RE digestion with BglII/BamHI. Cassettes containing the CMV promoter (pHMR-CMV-EGFP and pHMR-CMV-EGFP-WPRE) and the EF1a promoter (pHMR-EF1a-EGFP and pHMR-EF1aEGFP-WPRE) were amplified by PCR. PCR was performed using 200 ng of plasmid and primers E1-F and E1-R (Table 3) at an annealing temperature of 52°C, and the resulting PCR product was gel extracted using the QIAEX II Gel Extraction kit (Qiagen). Cassettes containing the CAG promoter (pHMR-CAG-EGFP and pHMR-CAG-EGFP-WPRE) were double digested with BglII/BamHI. Briefly, 5 μg of plasmid was digested using both enzymes for 1 h at 37°C. Samples were separated by gel electrophoresis, and bands corresponding to the CAG cassette (4.5 kb) or CAG-WPRE cassette (5 kb) were extracted in the gel using the EZ-10 Spin Column DNA Gel Extraction kit ( Bio Basic). Then, 5 μg of pFAdV-9A4 was linearized using SwaI and precipitated with ethanol. The concentration of total DNA obtained by PCR and RE digestion products was measured using Nanodrop 2000 (Thermo Scientific). For each construct, 2 μg of the EGFP promoter cassette and 2 μg of SwaI-digested pFAdV-9A4 were cotransformed into E. coli BJ5183 cells. All resulting constructs were screened for recombination by NotI digestion, followed by transformation into E. coli DH5a. These constructs were grown in LB medium, isolated using the PureLink HiPure Plasmid Midiprep kit (Invitrogen), digested using Pad, and extracted by ethanol precipitation. CHSAH cells were seeded in 25 cm flasks at a density of 4.3 x 106 cells/flask. 5 μg of PacI-digested DNA was transfected into CH-SAH cells using 25 μl of Lipofectamine 2000 (Invitrogen). After 6 h of transfection, the mixture was removed and fresh DMEM-F12 (5% FBS) was added, and the cells were incubated at 37°C in 5% CO ₂ . Over the next week, cells were monitored for cytopathic effect (CPE). At this point, cell cultures were frozen and thawed three times, centrifuged, and the clarified supernatant containing recombinant FAdV-9A4 was stored as a stock P0 at -80°C. Subsequently, the virus was passaged three times to obtain a high titer P4 stock. The list of recFAdVs is given in table. 4.

1.4.3. Virus growth curves.

One-step growth curves for all viruses were prepared as described in Alexander et al. (1998). Briefly, a total of 1.8 x 106 CH-SAH cells were seeded in 35 mm dishes and incubated at 37°C with 5% CO ₂ . Cells were infected using recFAdV at a multiplicity of infection (MOI) of 5. After adsorption for 1 hour at room temperature, cells were washed three times in PBS and fresh DMEM-F12 (5% FBS) was added. Cell culture medium and cells were collected at 0, 12, 18, 24, 30, 36, 48, 60, and 72 hours postinfection (p.i.). The medium was removed and frozen at -80°C as extracellular virus, and the cells were washed three times in PBS, 1 ml of medium was placed on the monolayer and the dish was frozen at -80°C as intracellular virus. Extracellular virus was titrated at each time point. CH-SAH cells were seeded in 6-well plates at a density of 1.8 x 106 cells/well and incubated overnight. Extracellular virus at each time point was serially diluted (10 ^-1 -10' ⁷ ), and 100 μl of each aliquot was inoculated in duplicate and allowed to adsorb for 1 hour at room temperature. The inoculum was removed and the monolayer was washed in PBS. A 3 ml agar layer consisting of 0.6% SeaKem LE agarose (Lonza), DMEMF12 (5% FBS, L-glutamine and PenStrep) was added to each well and the plates were incubated at 37°C with 5% CO ₂ . After five days, 1.5 ml of neutral red (0.015%) was added to each well and plaques were counted after 24 hours.

- 15 043809

1.4.4. Detection of EGFP expression.

A total of 1.8 x 10 ⁶ CH-SAH cells were seeded in 35 mm dishes and incubated at 37°C with 5% CO2. Cells were infected using recFAdV at an MOI of 5. Uninfected and FAdV9Δ4-infected cells were negative controls, whereas cells transfected with 6 μg of pEGFP-N1 were positive controls. Cells were harvested at 0, 6, 12, 18, 24, 30, 36, and 48 h.p.i. and centrifuged them at 5000 rpm for 5 minutes. Each sample was resuspended in 500 μl PBS and divided into two 250 μl aliquots. The first aliquot was stored frozen at -80°C for further measurement by spectrofluorometry. The second aliquot was centrifuged again to wash out the FBS. The supernatant was removed and the cell pellet was resuspended in 200 μl of RIPA lysis buffer (50 mM Tris HCl pH 7.5, 150 mM NaCl, 1% Triton X100, 0.1% SDS, 10 mM EDTA, and 1% sodium deoxycholate). Samples were incubated on ice for 20 minutes and centrifuged again at 12,000 rpm at 4°C for 20 minutes. The supernatant was collected and stored at -80°C.

EGFP expression was measured by spectrofluorometry at each time point. Infected cell samples, frozen at -80°C, were frozen and thawed three times. Cellular debris was pelleted by centrifugation at 12,000 rpm for 10 minutes at 4°C. The supernatant was transferred to a fresh microcentrifuge tube and the protein concentration was determined at 280 nm using a Nanodrop 2000 (Thermo Scientific). All samples were adjusted to a protein concentration of 1 μg/μl. For each sample, 50 μg of protein extract was added in triplicate to a flat-bottomed black 96-well plate (Corning) and assayed using a GloMax®-Multi microplate reader (Promega) to detect EGFP fluorescence using excitation and emission wavelengths 480 and 528 nm, respectively.

1.4.5. Bradford and SDS-PAGE analysis.

Protein concentration was determined using the BioRad Protein Assay kit according to the manufacturer's protocol. Briefly, a 1:5 dilution of the concentrated staining reagent in distilled H2O was prepared. 10 μl of BSA protein standards ranging from 100 μg/ml to 1 mg/ml along with whole cell lysate samples (diluted 1:10) were pipetted into a 96-well plate in triplicate. 200 μL of diluted staining reagent was added to each sample and mixed, and after 5 min of incubation, absorbance was measured at 595 nm in a microplate reader (BioTek Powerwave XS2). A calibration curve was generated using the absorbance values of the BSA standards, and the trend line equation was used to extrapolate the concentrations of unknown cell lysates. The values for each sample were averaged to create an average total protein concentration, taking into account the dilution factor. All samples were diluted to a final concentration of 0.67 μg/μl in distilled H2O.

Proteins were separated via SDS-polyacrylamide gel electrophoresis (SDS-PAGE). 10% acrylamide gels were prepared according to recipes obtained from the Roche Lab FAQs Handbook (4th ed.). For all experiments, 15 μl of each cell lysate (0.67 μg/μl) was mixed with 4 μl of 4x SDSPAGE loading buffer (supplemented with 2-mercaptoethanol). Samples were incubated at 95°C for 10 minutes before loading onto gels. Individual lanes were loaded with a total of 10 μg per sample, as well as 5 μl of protein marker (Precision Plus Protein Dual Color, BioRad). Once all samples were loaded, gels were run at 100 V for approximately 1.5 h in running buffer (25 mM Tris, 190 mM glycine, 0.1% SDS, pH 8.3).

1.4.6. Western immunoblotting.

After SDS-PAGE, proteins were transferred to polyvinylidene difluoride (PVDF) membranes in a Mini Trans-Blot Electrophoretic Transfer Cell (BioRad) according to the manufacturer's protocol. Samples were run at 100 V for 1 hour in transfer buffer (25 mM Tris, 190 mM glycine, 20% methanol, pH 8.3). After transfer, membranes were rinsed in Tris-buffered saline supplemented with 0.1% Tween 20 (TBS-T) and blocked with 5% skim milk (in TBS-T) for 1 hour at room temperature with shaking. Primary antibody was added to the blocking solution and the membranes were incubated overnight at 4°C. For the EGFP assay, a mouse anti-GFP primary monoclonal antibody (Molecular Probes) was used at a dilution of 1:1000. For actin analysis, goat anti-actin primary polyclonal antibody (Santa Cruz Biotechnology) was used at a dilution of 1:1000. The next day, all blots were washed three times in TBS-T for 10 minutes each with shaking. The blots were then incubated in secondary antibody diluted in blocking solution for 1 hour with shaking. The following horseradish peroxidase (HRP)-conjugated polyclonal secondary antibodies were used: goat anti-mouse (Invitrogen, 1:5000 dilution) and donkey anti-goat (Jackson, 1:20,000 dilution). The blots were then washed three more times in TBS-T and incubated in Western reagent. Lightning Plus-ECL (Perkin Elmer Inc) for 5 minutes before developing using ChemiDoc XRS (BioRad).

- 16 043809

table 2

PCR conditions using Kod or Taq polymerase according to the manufacturer's protocol. Polymerase Kod

Stage Target size <500 bp 500-1000 p. 1000-3000 By. >3000 bp Activation 95°C for 2 min Denaturation 95°C for 20 s Annealing Tt°C of the smallest primer for 10 s Elongation 70°C in during 10 s/t. O. 70°C in during 15 s/t. O. 70°C in during 20 s/t. O. 70°C in during 25 s/t. O. Repeat stages 2-4 25 cycles

Taq polymerase

Stage Activation 95°C for 5 min Denaturation 95°C for 1 min Annealing Tsh°C of the smallest primer for 30 s Elongation 70°C for 1 min/t. O. Repeat stages 24 25 cycles

Table 3

Primers designed to generate dual expression and reFAdV constructs. Restriction enzymes built into each primer are underlined

Primer Sequence (5' to 3') Tm Restriction enzyme pCI-Neo- F GGCTCATGTCCAATATGACCGCCAT (SEQ ID No. 22) 61°C - EGFP-F AAAAAAGAATTCACCATGGTGAGCAAGGGCGAG (SEQ ID no. 23) 58°C EcoRI EGFP-R AAAAAAGCGGCCGCTTACTTGTACAGCTCGTCCATGCC (SEQ ID No. 24) 59°C Notl EGFP-I-F GAGAAGCGCGATCACATGGT (SEQ ID NO. 25) 58°C - Zaktin-E AAAAAAACTAGTTGGTCGAGGTGAGCCCCACGTT (SEQ ID No. 26) 65°C Spel Zaktin-R AAAAAAGAATTCGCCCGCCGCGCGCTTCGCTT (SEQ ID No. 27) 71°C EcoRI L2R-F AAAAAAACTAGTCATAGTAAATATGGGTAACTTCTTAA TAGCCA (SEQ ID No. 28) 55°C Spel L2R-R AAAAAAGAATTCATGGTTTGTTATTGGCAAATTTAAAT TAATGTT (SEQ ID No. 29) 55°C EcoRI Luc-F AAAAAACCTAGGTTGGCAATCCGGTACTGTTGGT (SEQ ID NO. 30) 59°C Avril Luc-R AAAAAATTCGAAGCCGCCCCGACTCTAG (SEQ ID No. 31) 58°C BstBI SV40-F GGCCTCTGAGCTATTCCAGA (SEQ ID No. 32) 56°C - WPRE-F AAAAAAGCGGCCGCCTCAACCTCTGGATTACAAAATTTG TGAA (SEQ ID No. 33) 56°C Notl WPRE-R AAAAAAGCGGCCGCGCCCAAAGGGAGATCCGAC (SEQ ID No. 34) 58°C Notl VF1-F AAAAAAAGATCTTACATGAATGACGCTGCTG (SEQ ID No. 35) 53°C Bglll VF1-R AAAAAAACTAGTAAATACACCGAGAAATACCACG (SEQ ID No. 36) 53°C Spel VF2-F AAAAAACAAT T GAAATAAAGACT CAGAAC GCAT T T T C C (SEQ ID No. 37) 54°C Mfel VF2-R AAAAAAGGTACCCCCCCGCAGAGAATTAAAA (SEQ ID No. 38) 53°C Kpnl El-F ACATGAATGACGCTGCTG (SEQ ID No. 39) 53°C - El-R CCCCCGCAGAGAATTAAAA (SEQ ID No. 40) 52°C -

- 17 043809

Table 4

Vectors and viruses in this study and their key features

pHMR-CAG-EGFP-WPRE 9484 Intermediate construct for homologous recombination with pFAdV-9A4 pHMR-EFla-EGFP 8766 Intermediate construct for homologous recombination with pFAdV-9A4 pHMR-EFla-EGFP-WPRE 9290 Intermediate construct for homologous recombination with pFAdV-9A4 pFAdV-9A4 44971 FAd-mid framework Δ491-2782 pFAdV-9A4-CMV-EGFP 46826 FAd-mid containing CMV-EGFP at the Δ4 site pFAdV-9A4-CMV-EGFP- W.P.R.E. 47350 FAd-mid containing CMV-EGFP-WPRE at the Δ4 site pFAdV-9A4-CAG-EGFP 47583 FAd-mid containing CAG-EGFP at the Δ4 site pFAdV-9A4-CAG-EGFP- W.P.R.E. 48107 FAd-mid containing CAG-EGFP-WPRE at the Δ4 site pFAdV-9A4-EFla-EGFP 47389 FAd-mid containing EFla-EGFP at site Δ4 pFAdV-9A4-EFla-EGFP- W.P.R.E. 47913 FAd-mid containing EFla -EGFP-WPRE site Δ4 Viruses Name Size P(n.o.) Description FAdV-9A4 42772 FAdV-9 deletion virus (Δ491-2782) FAdV-9A4-CMV-EGFP 44627 Recombinant CMV-EGFP virus FAdV-9A4-CMV-EGFP- W.P.R.E. 45151 Recombinant virus CMV-EGFP-WPRE FAdV-9A4-CAG-EGFP 45384 Recombinant CAG-EGFP virus FAdV-9A4-CAG-EGFP- W.P.R.E. 45908 Recombinant virus CAG-EGFP-WPRE FAdV-9A4-EFla-EGFP 45190 Recombinant EFla-EGFP virus FAdV-9A4-EFla-EGFP- W.P.R.E. 45714 Recombinant virus EFla-EGFP-WPRE

Example 2: Construction and characterization of FAdV-9 viral vectors.

As shown in FIG. 1-8, the inventors conducted experiments to create and characterize FAdV-9 viral vectors containing ORF0-ORF1ORF2 deletion viruses with an inserted mCherry coding sequence and using a native early promoter; TR2-ORF17-ORF11 deletion viruses with an inserted EGFP cassette, and a dual expression virus that can be used as a multivalent vector.

At the left end of the genome: from nucleotides 847 to 2753; 1906 nucleotides were removed. This deletion contains ORF1A, ORF1B, ORF1C and ORF2. At the right end of the genome: from nucleotides 38807 to 42398; 3591 nucleotides were removed. This deletion contains TR-2, ORF17, and ORF11. The complete deletion is 5497 bp; the size of the double deletion vector is 39567 bp. The foreign gene inserted at the left end is mCherry (SEQ ID No. 3711 bp). The foreign gene inserted at the right end is EGFP (SEQ ID No. 2, 1602 bp). Based on the adenovirus stability rule of 105%, the capacity of the double vector is up to 7751 bp, this can be in various configurations, for example, at the left end it is up to 4160 bp. and at the right end is up to 5844 bp.

As shown in FIG. 2 and 3A, at the left end of the genome: from nucleotides 575 to 2753: nucleotides 2178 bp were deleted. This deletion contains ORF0, ORF1A, ORF1B, ORF1C and ORF2, and the foreign gene inserted at the left end is mCherry (SEQ ID No. 3711 bp). Verification of FAd-mid and the corresponding viruses was carried out (Fig. 3B and 3D), which shows that the design was correct. On the other hand, CPE of the recombinant viruses was observed in CH-SAH cells, but the infected cells did not exhibit any mCherry fluorescence, indicating a lack of expression of the foreign gene, in this case mCherry (Fig. 3C).

As shown in FIG. 2 and 4A, at the left end of the genome: from nucleotides 847 to 2753; 1906 nucleotides were removed. This deletion contains ORF1A, ORF1B, ORF1C and ORF2. The foreign gene inserted at the left end is mCherry (SEQ ID No. 3711 bp). Verification of FAd-mid and the corresponding viruses was carried out (Fig. 4B and 4D), which shows that the design was correct. CH-SAH cells infected with the recombinant viruses exhibited mCherry fluorescence, indicating expression of a foreign gene, in this case mCherry (Fig. 4C).

As shown in FIG. 5 and 7A, at the right end of the genome: from nucleotides 38807 to 42398; 3591 nucleotides were removed. This deletion contains TR-2, ORF17, and ORF11. The foreign gene inserted at the left end is EGFP (SEQ ID No. 2 1602 bp). Verification of FAd-mid and the corresponding viruses was carried out (Fig. 7B and 7D), which shows that the design was correct. CHSAH cells infected with the recombinant viruses exhibited EGFP fluorescence, indicating expression of a foreign gene, in this case EGFP (Fig. 7C).

As shown in FIG. 8A, at the left end of the genome: from nucleotides 847 to 2753; 1906 nucleotides were removed. This deletion contains ORF1A, ORF1B, ORF1C and ORF2. At the right end of the genome: from the nucleotide

- 18 043809

38807 to 42398; 3591 nucleotides were removed. This deletion contains TR-2, ORF17, and ORF11. The foreign gene inserted at the left end is mCherry (SEQ ID No. 3711 bp). The foreign gene inserted at the right end is EGFP (SEQ ID No. 2, 1602 bp). Verification of FAd-mid and the corresponding viruses was carried out (Fig. 8B and 8D), which shows that the design was correct. CH-SAH cells infected with the recombinant viruses exhibited mCherry and EGFP fluorescence, indicating expression of foreign genes (Fig. 8C).

In fig. 6 presents an additional vector based on the ORF17 deletion located at the right end of the FAdV-9 genome as a logical and systematic development of the vector system.

In the above, it can be seen that when ORF0 is deleted, the native early promoter is not functional since foreign gene expression (eg m-Cherry) is not observed. However, expression of reporter genes occurs when an exogenous (foreign) promoter (CMV) is used (Corredor and Nagy, 2010b). When only ORF1 and ORF2 are deleted, the native promoter is functional and expression of the foreign reporter gene is observed.

In fig. Figure 9 shows recombinant viruses based on FadV-9 with reporter genes. In particular, in this FIG. provides a summary and linear representation for FIG. 4, 6, 7 and 8, where line pFAdV-9RED represents FIG. 4, line pFAdV-9-A17 represents FIG. 6, pFAdV-9-EGFP line represents FIG. 7, line pFAdV-9-Dual represents FIG. 8.

Accordingly, we successfully replaced ORF 0-2, ORF 1-2, and TR2-ORF 17-11 in FAdV-9 with reporter genes. It was observed that the early native promoter of the left end of FAdV can drive the expression of a foreign transgene. Additionally, a large right-terminal deletion in TR2 was demonstrated to be stable, contrary to previous studies. Therefore, FAdV-9 with left end and right end deletions of FAdV-9 can be used as multivalent recombinant FAdV-9 viruses, which may have applications for generating dual expression viruses suitable for vaccine vectors.

The primers used in this study are disclosed in Table. 5.

Table 5

Name Sequence (5'-3') Location no Target ORFl-2Ver-F gcacagtcccaatggctt (SEQ ID No. 42) Pei et al.,2015 ORFl-2Ver-F ORFl-2Ver-R aaattctggtccgttaccga (SEQ ID No. 43) Pei et al.,2015 TR2-17llVerF GCCTACTCCTCAGCCTATCAC (SEQ ID No. 44) 38163-38184 verification TR2-17llVerR CAGTCCTCTTAACGAGCACGC (SEQ ID No. 45) 43113-43133 verification CAT-F GTGTAGGCTGGAGCTGCTTC (SEQ ID No. 46) Verification ORFlCATSwal- F ggacgtgctttaggtaatttcctccg (SEQ ID No. 47) Ttctttttcccgtttaggtgaggag(SEQ ID No. 48) 796-846 ORF1 removed 1A, IB, IC, RF2 0 SwaI introduced

- 19 043809

AT T TAAATgtgtaggc tggagc tgc ttc (SEQ ID No. 49) ORF2CATSwaI- R gcgttctgagtctttattggtaa- (SEQ ID No. 50) actcgaaacacgcgtcacacgcgc- (SEQ ID No. 51) ATTTAAATcatatgaatatcctccttagtt c (SEQ ID No. 52) Pei et al.,2015 TR2-17- 11CAT-F ccccctggcggccgttggccgccactg (SEQ ID No. 53) Cacccgcgccggacttagtctct (SEQ ID no. 54) T T TAAATgtgtaggc tggagc tgc ttc (SEQ ID No. 55) 38757-38806 Removed TR2, ORF17, ORF11 SwaI introduced TR2-17- 11CAT-R agtagagattataggaagcggggatta (SEQ ID No. 56) Tagtggttttatttaaacgaga (SEQ ID No. 57) ATTTAAATcatatgaatatcctccttagtt c (SEQ ID No. 58) 42399-42448 ORF17CATSwaI -F tccccctggcggccgaggggccgcca (SEQ ID No. 59) Ctgcacccgcgccggacttagtctct (SEQ ID No. 60) AT T TAAATgtgtaggc tggagc tgc ttc (SEQ ID No. 61) 40511-40561 Delete ORF17 ORF17CATSwaI -R gatacgaagaaggataggagcagaat (SEQ ID No. 62) Cgaggatacggtagttgactcc (SEQ ID No. 63) ATATTTAAATcatatgaatatcctccttag ttc (SEQ ID No. 64) 41461-41502 EGFPcaSwal-F a gc t gcAT T TAAATatattaccgccatgca ttag (SEQ ID No. 65) Pei et al. , 2015 EGFPcaSwal-R agct gcAT T T AAAT ccacaactacfaatcfca ata (SEQ ID No. 66) Pei et al. , 2015 mCherry-F agctgcATTTAAATATGGTGAGCAAGGGCG AGGAGG (SEQ ID No. 67) amplify mCherry mCherry-R agctgcATTTAAATCTACTTGTACAGCTCG TCCATGCCG (SEQ ID No. 68) Coding sequence

SwaI sites are represented in capital letters.

Sequences in bold are specific to the chloramphenicol cassette.

The underlined sequences are specific to pN1-EGFP, location based on pEGFPN1.

Sequences in italics represent additional nucleotides for SwaI cleavage.

Example 3. Results.

3.1. Expression of EGFP in transfected CH-SAH cells.

3.1.1. Cloning of dual expression constructs.

A dual expression system was created using EGFP and firefly luciferase (expressed under the control of the SV40 promoter) in order to compare the effect of different promoter and enhancer elements on EGFP expression in vitro. The commercial plasmid pCI-Neo (Promega), containing the CMV promoter, provides a framework for a dual expression system. The CMV promoter (944 bp) was subsequently removed using RE digestion with SpeI and EcoRI. After gel purification, both the CAG (1701 bp) and EF1a (1507 bp) promoters were directionally subcloned into the pCI-Neo scaffold using SpeI and EcoRI. The lithiated product was transformed into competent bacterial cells and colonies were selected, screened by RE digestion (results not shown) and confirmed by sequencing. This process was repeated with both β-actin (285 bp) and L2R (120 bp) promoters. RE sites for SpeI and EcoRI were inserted into the primers, and both PCR promoters were amplified from plasmid DNA. The 730 bp band corresponding to EGFP was PCR amplified using primers containing EcoRI and NotI sites. The PCR product was specifically cloned into each promoter plasmid transformed into competent bacterial cells and confirmed by PCR (data not shown) and sequencing. Finally, firefly luciferase (1712 bp) was PCR amplified using primers containing the AvrII and BstBI RE sites. Plasmid DNA containing EGFP under the control of each promoter was then digested with AvrII and BstBI to remove the neomycin resistance gene, and luciferase was specifically cloned in its place. The presence of luciferase in each plasmid was confirmed by PCR (results not shown) and sequencing. This yielded dual expression plasmids: pCMV-EGFP-Luc, pCAGEGFP-Luc, pEF1a-EGFP-Luc, pactin-EGFP-Luc and pL2R-EGFP-Luc (Fig. 11). Created 5 additional

- 20 043809 new plasmids to include the WPRE enhancer element. The 543-bp band corresponding to the WPRE was PCR amplified using primers containing a NotI site. Each dual expression plasmid was linearized using NotI and the WPRE element was nondirectionally cloned into each. Screening for proper orientation was performed by PCR (data not shown) and plasmids were confirmed by sequencing, yielding dual expression plasmids: pCMV-EGFP-WPRE-Luc, pCAG-EGFP-WPRE-Luc, pEF1a-EGFP-WPRE-Luc, vactin- EGFPWPRE-Luc and pL2R-EGFP-WPRE-Luc (Fig. 13).

3.1.2. Promoter expression profiles observed by fluorescence microscopy.

CH-SAH cells were transfected with dual expression constructs to monitor EGFP expression profiles over 72 hpi by fluorescence microscopy (Fig. 14). The earliest expression of EGFP was observed at 12 h.p. using the CMV, CMV-WPRE, CAG, and CAG-WPRE plasmids, with expression levels increasing over time. Both EF1a and EF1a-WPRE constructs began to express EGFP between 24 and 36 hpi and robustly maintained expression over time. Constructs containing β-actin or L2R promoters expressed EGFP weakest in CH-SAH cells, with expression starting at 36 and 60 hpi, respectively. All constructs were compared to mock-transfected cells (negative control) and positive control pEGFP-N1-transfected cells (data not shown).

3.1.3. Normalized expression of promoter constructs.

Dual expression constructs were transfected into CH-SAH cells and transgene expression was measured at 72 h.p. EGFP fluorescence was measured by fluorometry at each time point, with luciferase luminescence measured using the Peirce Firefly Luciferase Glow Assay kit (Thermo Fisher Scientific) . To better analyze EGFP expression driven by each promoter/enhancer element and to minimize sample-to-sample variation, luciferase expression from each sample was used to normalize the results ( Schagat et al., 2007 ). Data were analyzed by calculating the fold change of each construct at each specific time point after transfection relative to the CMV promoter (Table 6). Normalized expression of each construct at 12-72 hpi is presented in FIG. 15. At 12 h p.t., a significant decrease in expression of the EF1a, EF1aWPRE, β-actin-WPRE, and L2R-WPRE constructs was observed compared to CMV. The CMV-WPRE and CAG constructs had increased expression at 12 hpi, but this was not significant. More pronounced differences in expression profiles were observed between 24 and 72 h.p.t. Overall, all constructs showed reduced activity over time compared to CMV controls. At 12 and 24 hpt, the CMV-WPRE construct exhibited an increased fold change of 1.047 relative to CMV alone, although the differences were not significant. Between 36 and 60 p.p.t., CMV-WPRE exhibited a slightly reduced fold change ranging from 0.851 to 0.922. The significant decrease in expression was removed at 72 p.p. when CMV-WPRE showed a lower level of activity of 64% compared to CMV control, and this difference was significant. For each of the remaining constructs, expression was significantly lower than CMV at all time points where P < 0.05. Constructs containing the CAG and CAGWPRE cassettes were consistently expressed at approximately 50% and 40%, respectively, of CMV from 24 p.p. Likewise, constructs containing the EF1a and EF1a-WPRE cassettes were found to have reduced levels of activity compared to CMV and are expressed in the range of about 20%. The remaining constructs containing the β-actin and L2R promoters had activity levels less than 10% of that of CMV.

3.2. Generation of recombinant FAdV-9A4.

3.2.1. Cloning of pHMR constructs.

In order to analyze promoter activity and WPRE activity in the context of FAdV replication, recombinant FAdVs containing the most efficient EGFP expression cassettes were generated following a modification of the method of Corredor and Nagy (2010b). Fragment 477 bp. (VF1) to the left of the FAdV-9A4 deletion site was PCR amplified and directionally cloned into pCMV-EGFPLuc, pCMV-EGFP-WPRE-Luc, pCAG-EGFP-Luc, pCAG-EGFP-WPRE-Luc, pEF1 α-EGFP-Luc and pEF1aEGFP -WPRE-Luc. Subsequently, a fragment of 1609 bp. (VF2) to the right of the FAdV-9A4 deletion site was PCR amplified and cloned into each plasmid, yielding intermediate plasmids: pHMR-CMVEGFP, pHMR-CMV-EGFP-WPRE, pHMR-CAG-EGFP, pHMR-CAG-EGFP-WPRE, pHMR -EF1 α-EGFP and pHMR-EF1 α-EGFP-WPRE (Fig. 16). Successful cloning was determined by PCR screening and sequencing.

Intermediate constructs were subjected to PCR or RE digestion with BglII/BamHI to isolate EGFP promoter cassettes flanked by viral DNA fragments for use in homologous recombination with pFAdV-9A4 (FAd-mid). Homologous recombination generated the final FAd-mids: pFAdV-9A4-CMV-EGFP, pFAdV-9A4-CMV-EGFPWPRE, pFAdV-9A4-CGA-EGFP, pFAdV-9A4-CAG-EGFP-WPRE, pFAdV-9A4-EF1 α- EGFP and pFAdV-9A4

- 21 043809

EF1a-EGFP-WPRE. Successful recombination was determined by sequencing and NotI digestion screening (FIG. 17). Digested pFAdV-9A4 gave bands at 4 kb, 5.1 kb, 13.7 kb. and 23.8 t.o. FAd-mids containing CMV cassettes were identified by a 2.2-kb diagnostic band corresponding to the CMV promoter plus the EGFP gene and the SV4 0 polyA tail. FAd-mids containing CAG cassettes were identified by a 2.9-kb diagnostic band ., and EF1a according to the diagnostic band is 2.7 t.o. Additional bands 550 bp. were present in FAd mids containing the WPRE element. These FAdmids were transfected into CH-SAH cells to generate the corresponding viruses.

3.2.2. Virus growth kinetics.

Viral growth kinetics were compared among the six recombinant viruses and the reference FAdV-9A4 to determine whether the addition of any EGFP promoter cassette affected viral replication and growth. Virus titer and growth for all recFAdVs appeared to follow a similar pattern to FAdV-9A4, except that FAdV-9A4-CAG-EGFP and FAdV-9A4-EF1a-EGFP grew to a titer half a log below the reference starting at 24 h.p.i. (Fig. 18). The viruses grew until the following titers; FAdV9A4=2.4x10 ⁸ PFU/ml, FAdV-9A4-CMV-EGFP=4, 8x108 PFU/ml, FAdV-9A4-CAG-EGFP=8.3x10 ⁷ PFU/ml, FAdV-9A4-EF1a-EGFP=8 , 2x10 ⁷ PFU/ml, FAdV-9A4-CMV-EGFP-WPRE=3.1x10 ⁸ PFU/ml, FAdV-9A4CAG-EGFP-WPRE=3.0x10 ⁸ PFU/ml and FAdV-9A4-EF1a-EGFP=3 .7x10 ⁸ PFU/ml. The appearance of CPE (Fig. 19) and plaque morphology (not shown) in recFAdV are similar to FAdV-9A4 in that the cells rounded and detached within 5-7 s. p.i. All recFAdVs expressed EGFP as seen by fluorescence microscopy.

3.3. Promoter activity during infection.

3.3.1. Measurement of EGFP by spectrofluorometry.

EGFP expression by recFAdV was measured between 0 and 48 hpi. in CH-SAH cells. Based on spectrofluorometry and fluorescence microscopy, EGFP expression for all recombinant viruses was low until 12 h.p.i. Strong EGFP expression was observed between 12 and 30 p.i., but decreased after 36-48 p.i. Maximum fluorescence readings were measured after 30 p.i. for all recFAdV (Fig. 20). Cells infected with FAdV-9A4-CAG-EGFP showed the most significant increase in EGFP expression compared with FAdV-9A4-CMV-EGFP at all time points, ranging from 12-fold (48 p.i.) to 29-fold (24 h.p.i.) increase in expression. FAdV-9A4-EF1a-EGFP infected cells also had increased expression compared to FAdV-9A4-CMV-EGFP at all time points, with a slightly lower range of 2-fold (12 h.p.i.) to 20-fold (24 h.i.). .p.i.) increase expression. Viruses that contained the WPRE element expressed EGFP at lower levels compared to their promoter counterparts. FAdV-9A4-CMV-EGFP-WPRE was the least efficient virus, with expression reduced from 2.4-fold (48 p.i.) to 17-fold (36 p.i.) compared to FAdV-9A4- CMV-EGFP. Although both FAdV-9A4-CAG-EGFP-WPRE and FAdV-9A4-EF1aEGFP-WPRE are less efficient than their promoter counterparts, both viruses on average expressed EGFP at a higher level than FAdV-9A4-CMV-EGFP. FAdV-9A4-CAG-EGFP-WPRE showed increased expression ranging from 1.3-fold (48 h.p.i.) to 4.3-fold (24 h.p.i.), whereas the expression of FAdV-9A4-EF1a -EGFP-WPRE ranged from a 2.5-fold decrease (12 p.i.) to a 3.6-fold increase (24 p.i.).

3.3.2. EGFP expression measured by Western blotting.

In addition to spectrofluorometry, viral expression of EGFP was also examined by Western immunoblotting. Whole cell lysates of infected cells were collected at 0, 6, 12, 18, 24, 30, 36, and 48 h.p.i. At each time point, 10 μg of total protein from each lysate was isolated by SDS-PAGE, used for blotting, and the blot was probed with an anti-EGFP antibody (Fig. 21). An EGFP molecular mass of 27 kDa was expected (Takebe, N., Xu, L., MacKenzie, K. L., Bertino, J. R., Moore, M. A. S. 2002. Long-term culture selection using methotrexate initiates cells after transduction of CD34+ cells with a retrovirus containing a mutant human dihydrofolate reductase gene. Cancer Gene Ther 9(3):308–320). At the initial moments of time 0 and 6 h.p.i. did not detect EGFP signal from any recFAdVs. After 12 hours p.i. detected a band corresponding to EGFP in the lysate collected after FAdV-9A4-CAG-EGFP infected cells, which was detected up to 48 h.p.i. Cell lysates collected after FAdV-9A4-EF1a-EGFP, FAdV-9A4CAG-EGFP-WPRE, and FAdV-9A4-EF1a-EGFP-WPRE also yielded a detectable EGFP band from 18 to 36 p.p. In contrast, no EGFP bands were observed for FAdV9A4-CMV-EGFP and FAdV-9A4-CMV-EGFP-WPRE-infected lysates at any time points. Negative controls, FAdV-9A4-infected lysate, and mock-infected lysate did not produce a signal for EGFP at all times. Transfected CH-SAH cells containing an EGFP positive plasmid driven by the CMV promoter, pEGFP-N1, gave a positive signal from 12 hpt onwards. At each time point, blots were probed with anti-actin antibody to show the relative levels of equal loading of all samples. Actin levels appeared similar at each time point, suggesting equal loading, but after 48 h.p.i. actin was not detected in virus-infected lysates.

- 22 043809

Table 6

Fold changes in promoter activity in transfected CH-SAH cells at different hours after transfection relative to the CMV promoter. Significant activity is determined by P-value <0.05

Point in time (h.p.t.) Promoter multiplicity Δ SD P-value 12 CMV 1.0 - - CMV-WPRE 1.047 0.245 0.7526 CAG 1.483 1.735 0.5506 CAG-WPRE 0.479 0.370 0.0717 EFla 0.610 0.184 0.0015 EFla-WPRE 0.313 0.117 0.0005 β-actin 0.772 0.418 0.2587 β-actin-WPRE 0.357 0.097 0.0003 L2R 0.566 0.528 0.1654 L2R-WPRE 0.134 0.095 0.0001 24 CMV 1.0 - - CMV-WPRE 1.047 0.116 0.5177 CAG 0.409 0.116 0.0001 CAG-WPRE 0.294 0.039 0.0001 EFla 0.156 0.076 0.0001 EFla-WPRE 0.087 0.018 0.0001 β-actin 0.074 0.042 0.0001 β-actin-WPRE 0.042 0.043 0.0001 L2R 0.028 0.016 0.0001 L2R-WPRE 0.010 0.002 0.0001 36 CMV 1.0 - - CMV-WPRE 0.894 0.156 0.3078 CAG 0.560 0.331 0.0180 CAG-WPRE 0.387 0.139 0.0016 EFla 0.196 0.057 0.0001 EFla-WPRE 0.124 0.063 0.0001 β-actin 0.056 0.037 0.0001 β-aKTHH-WPRE 0.015 0.007 0.0001 L2R 0.014 0.013 0.0001 L2R-WPRE 0.002 0.001 0.0001 48 CMV 1.0 - - CMV-WPRE 0.922 0.135 0.3758 CAG 0.431 0.036 0.0001 CAG-WPRE 0.303 0.050 0.0001 EFla 0.187 0.063 0.0001 EFla-WPRE 0.085 0.022 0.0001 β-actin 0.032 0.017 0.0001 β-aKTHH-WPRE 0.013 0.005 0.0001 L2R 0.015 0.014 0.0001 L2R-WPRE 0.001 0.001 0.0001 60 CMV 1.0 - - CMV-WPRE 0.851 0.123 0.1039 CAG 0.572 0.257 0.1423 CAG-WPRE 0.392 0.191 0.0053 EFla 0.254 0.054 0.0026 EFla-WPRE 0.124 0.021 0.0001 β-actin 0.033 0.007 0.0001 β-aKTHH-WPRE 0.015 0.004 0.0001 L2R 0.002 0.001 0.0001 L2R-WPRE 0.001 0.001 0.0001 72 CMV 1.0 - - CMV-WPRE 0.643 0.056 0.0004 CAG 0.591 0.137 0.0521 CAG-WPRE 0.434 0.164 0.0040 EFla 0.296 0.082 0.0067 EFla-WPRE 0.234 0.119 0.0004 β-actin 0.030 0.002 0.0001 β-aKTHH-WPRE 0.028 0.018 0.0001 L2R 0.002 0.001 0.0001 L2R-WPRE 0.003 0.003 0.0001

Example 4 Other embodiments of recombinant FAdV-9.

In fig. 22 shows other embodiments of recombinant FAdV-9 in which, at the left end of the genome, ORF1 and 2 are removed and replaced with HA from the H7 coding sequences, and in which, at the right end of the genome, ORF19, ORF11, or TR2 are removed and replaced with the HN cassette, HN-IRESHA from the H5 cassette or HA from the H5 cassette, where the IRES (internal ribosome entry site) allows translation to be initiated in the middle of a messenger RNA (mRNA) sequence as part of the more general process of protein synthesis. An IRES (SEQ ID No. 41) from a Canadian avian encephalomyelitis virus isolate (AEV-IRES) was used.

- 23 043809

Although the present disclosure has been described with reference to what are currently considered preferred examples, it should be understood that the disclosure is not limited to the disclosed examples. To the contrary, the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

All publications, sequences, patents and patent applications are incorporated herein by reference in their entirety to the same extent as if each individual publication, sequence, patent or patent application were specifically and individually incorporated by reference in their entirety.

Literature:

Huebner, R.J., Rower W.P., Schatten, W.E., Smith, R.R., & Thomas, L.B. (1956). Studies on the use of viruses in the treatment of carcinoma of the cervix. Cancer 9(6), 1211-1218;

Cody, J. J. & Douglas, J. T. (2009) . Armed replicating adenoviruses for cancer virotherapy. Cancer Gene Ther 16, 473488;

Yamamoto, M. & Curiel, D. T. (2010). Current issues and future directions of oncolytic adenoviruses. Mol Ther 18, 2432 50;

Lasaro, M. O. & Ertl, H. C. J. (2009) . New Insights on Adenovirus as Vaccine Vectors. Molecular Therapy 17, 1333-1339;

Buchbinder, S. P., Mehrotra, D. V., Duerr, A., Fitzgerald, D. W., Mogg, R., Li, D., Gilbert, P. B., Lama, J. R., Marmor, M. & other authors. (2008). Efficacy assessment of a cell-mediated immunity HIV-1 vaccine (the Step Study): a double-blind, randomized, placebo-controlled, test-of-concept trial. Lancet 372, 1881-1893;

McElrath, M. J., De Rosa, S. C., Moodie, Z., Dubey, S., Kierstead, L., Janes, H., Defawe, 0. D., Carter, D. K., Hural, J. & other authors. (2008). HIV-1 vaccine-induced immunity in the test-of-concept Step Study: a case-cohort analysis. Lancet 372, 1894-1905;

Cody & Douglas, 2009; Gallo, P., Dharmapuri, S., Cipriani, B. & Monaci, P. (2005) . Adenovirus as vehicle for anticancer genetic immunotherapy. Gene Ther 12, S84-S91;

Shashkova, E. V., Cherenova, L. V., Kazansky, D. B. & Doronin, K. (2005). Avian adenovirus vector CELO-TK displays anticancer activity in human cancer cells and suppresses established murine melanoma tumors. Cancer Gene Ther 12, 61762 6;

Barouch, D. H. (2008). Challenges in the development of an HIV-1 vaccine. Nature 455, 613-619;

Sharma, A., Tandon, M., Ahi, Y. S., Bangari, D. S., Vemulapalli, R. & Mittal, S. K. (2009). Evaluation of CrossReactive Humoral and Cell-Mediated Immune Responses among Human, Bovine and Porcine Adenoviruses. Molecular Therapy 17, 113;

Adair, B. & Fitzgerald, S. (2008). Group I Adenovirus

Infections. In Diseases of Poultry, 12th ed., pp. 252-266. Edited by Y. Saif, A. Fadly, J. Glisson, L. McDougald, L. Nolan & D.

Swayne. Hoboken, NJ: Wiley-Blackwell;

Benko, M., Harrach, B., Both, G., Russell, W., Adair, B.,

Adam, E., de Jong, J., Hess, M., Johnson, M. & other authors.

(2005). Family Adenoviridae. In Virus taxonomy Eighth report of

-

Claims (27)

the International Committee on the Taxonomy of Viruses, pp. 213228. Edited by C. Fauquet, M. Mayo, J. Maniloff, U. Desselberger & L. Ball. San Diego, CA: Elsevier Academic Press; Corredor, J. C. & Nagy, E. (2010b). The non-essential left end region of the fowl adenovirus 9 genome is suitable for foreign gene insertion/replacement. Virus Res 149, 167-174; Ojkic, D. & Nagy, E. (2003). Antibody response and virus tissue distribution in chickens inoculated with wild-type and recombinant fowl adenoviruses. Vaccine 22, 42-48; Francois, A., Chevalier, C., Delmas, B., Eterradossi, N., Toquin, D., Rivallan, G. H. & Langlois, P. (2004). Avian adenovirus CELO recombinants expressing VP2 of infectious bursal disease virus induce protection against bursal disease in chickens. Vaccine 22, 2351-2360; Sheppard, M., Werner, W., Tsatas, E., McCoy, R., Prowse, S., & Johnson, M. (1998). Fowl adenovirus recombinant expressing VP2 of infectious bursal disease virus induces protective immunity against bursal disease. Arch Virol 143, 915-930; Johnson, M. A., Pooley, C., Ignjatovic, J., & Tyack, S. G. (2003). A recombinant fowl adenovirus expressing the SI gene of infectious bronchitis virus protects against challenge with infectious bronchitis virus. Vaccine 21, 2730-2736; Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V. & Cotten, M. (1996) . The complete DNA sequence and genomic organization of the avian adenovirus CELO. J Virol 70, 2939-2949; Ojkic, D. & Nagy, E. (2000). The complete nucleotide sequence of fowl adenovirus type 8. J Gen Virol 81, 1833-1837; Corredor, J. C., Garceac, A., Kreil, P. J., & Nagy, E. (2008). Sequence comparison of the right end of fowl adenovirus genomes. Virus genes 36, 331-344; Corredor, J. C., Kreil, P. J., & Nagy, E. (2006). Sequence analysis of the left end of fowl adenovirus genomes. Virus genes 33, 95-106; Bangari, D. S. & Mittal, S. K. (2006). Development of nonhuman adenoviruses as vaccine vectors. Vaccine 24, 849-862; Ferreira, T. B., Alves, P. M., Aunins, J. G., & Carrondo, M. J. T. (2005). Use of adenoviral vectors as veterinary vaccines. Gene Ther 12, S73-S83; Corredor, J. C. & Nagy, E. (2010a) A region at the left end of the fowl adenovirus 9 genome that is non-essential in vitro has consequences in vivo. J Gen Virol 91(1), 51-58; CLAIM 1. A recombinant viral vector from avian adenovirus 9 (FAdV-9) that includes at least one deletion of a nonessential region selected from ORF19 and ORF17. 2. FAdV-9 vector according to claim 1, where the vector includes a deletion of OFR17. 3. FAdV-9 vector according to claim 1, where the vector includes a deletion of OFR19. 4. FAdV-9 vector according to claim 1, where the vector includes a deletion of OFR17 and OFR19. 5. FAdV-9 vector according to any one of claims 1-4, where the vector further includes a deletion of one or more of the following non-essential regions: ORF0, ORF1, ORF2, TR2 and ORF11. 6. FAdV-9 viral vector according to claim 5, where the vector contains a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1, in which nucleotides from 575 to 2753 and from 38807 to 42398 are deleted. 7. FAdV-9 viral vector according to claim 5, where the vector contains a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1, where nucleotides from 847 to 2753 and from 38807 to 42398 are deleted. 8. FAdV-9 viral vector according to claim 5, where the vector contains a nucleotide sequence with sequence identity to the sequence presented in SEQ ID No. 1, in which nucleotides 847 to 2753 and 34220 to 36443 are deleted. 9. FAdV-9 viral vector according to claim 5, where the vector contains a nucleotide sequence with sequence identity with the sequence presented in SEQ ID No. 1, in which - - 25 043809 nucleotides from 847 to 2753, from 34220 to 36443 and from 38807 to 40561 or in which nucleotides from 847 to 2753, from 34220 to 36443 and from 41461 to 42398 are deleted. 10. FAdV-9 viral vector according to any one of claims 1 to 9, containing one or more exogenous nucleotide sequences encoding one or more polypeptides of interest. 11. The FAdV-9 viral vector of claim 10, wherein the vector is a dual vector containing two exogenous nucleotide sequences encoding two polypeptides of interest. 12. FAdV-9 viral vector according to any one of claims 1 to 10, containing an exogenous nucleotide sequence encoding at least one antigen. 13. The FAdV-9 viral vector according to claim 12, wherein the exogenous nucleotide sequence encodes antigenic sequences against a disease selected from influenza, infectious laryngotracheitis, infectious bronchitis, infectious bursitis (Humboro), hepatitis, viral rhinotracheitis, infectious catarrh, Mycoplasma hyopneumonieae, pasteurellosis, porcine respiratory reproductive syndrome (PRRS), circovirus, bordetelliosis, parainfluenza and any other antigen that is large enough to be inserted into an appropriate viral vector. 14. The FAdV-9 viral vector of claim 13, wherein the exogenous nucleotide sequence encodes antigenic sequences against a disease selected from avian influenza, laryngotracheitis (LT), Newcastle disease (NDV), infectious anemia, inclusion body hepatitis, infectious bronchitis ( IB), metapneumovirus (MPV) and Gumboro. 15. The FAdV-9 viral vector according to claim 13, wherein the exogenous nucleotide sequence contains a sequence corresponding to at least one sequence selected from SEQ ID Nos. 10-21, or a homologue thereof. 16. The viral vector according to any one of claims 10-15, wherein the exogenous nucleotide sequence is operably linked to a control sequence. 17. The viral vector of claim 16, wherein the control sequence is a promoter sequence. 18. A host cell containing a viral vector according to any one of claims 1 to 17. 19. A method for producing a viral vector according to any one of claims 10-17, including the stages: a) inserting an exogenous nucleotide sequence into the viral vector according to claim 1 to obtain an infectious clone; b) introducing the infectious clone thus obtained into a suitable cell line; c) maintaining a suitable cell line for obtaining the viral vector. 20. The method of claim 19, further comprising amplifying the exogenous nucleotide sequence before inserting the exogenous nucleotide sequence into the viral vector. 21. The method according to claim 19 or 20, in which the exogenous nucleotide sequence encodes antigenic sequences against a disease selected from influenza, infectious laryngotracheitis, infectious bronchitis, infection of the bursa of Fabricius (Humboro), hepatitis, viral rhinotracheitis, infectious catarrh, Mycoplasma hyopneumonieae, pasteurellosis , porcine respiratory and reproductive syndrome (PRRS), circovirus, bordetelliosis, parainfluenza and any other antigen that is large enough to be inserted into an appropriate viral vector. 22. The method of claim 19 or 20, wherein the exogenous nucleotide sequence encodes antigenic sequences against a disease selected from avian influenza, laryngotracheitis (LT), Newcastle disease (NDV), infectious anemia, inclusion bodies, infectious bronchitis (IB), metapneumovirus (MPV) and Gumborough. 23. The method of claim 19 or 20, wherein the exogenous nucleotide contains a sequence corresponding to at least one sequence selected from SEQ ID Nos. 10-21, or a homologue thereof. 24. An immunogenic composition comprising at least a FAdV-9 viral vector according to any one of claims 1 to 17 with an exogenous nucleotide sequence encoding at least one antigen inserted therein. 25. The immunogenic composition according to claim 24, further comprising a pharmaceutically acceptable carrier. 26. Immunogenic composition according to claim 24 or 25, additionally containing an adjuvant. 27. Use of an immunogenic composition according to any one of claims 24-26 in creating an immunogenic response in a patient. -