EA034742B1 - Anti-fap antibodies, polynucleotide, vector and cell for production thereof and uses thereof - Google Patents

Abstract

The object of the invention is an antibody that specifically binds to Fibroblast Activation Protein (FAP) and comprises a heavy chain variable region SEQ ID NO: 267 and a light chain variable region SEQ ID NO: 265. Also described herein are a polynucleotide encoding a heavy chain of an antibody and/or a light chain of this antibody, a composition for the expression of a heavy chain and a light chain thereof and a corresponding vector and a host cell comprising said polynucleotide. Furthermore, the invention relates to a method of producing an antibody that specifically binds Fibroblast Activation Protein (FAP) and the use thereof.

Description

FIELD OF THE INVENTION

The present invention relates to antibodies specific for fibroblast activation protein (FAP). In addition, the invention relates to polynucleotides encoding these antibodies, and to vectors and host cells containing these polynucleotides. The invention also relates to methods for producing antibodies and methods for their use for treating a disease.

BACKGROUND OF THE INVENTION

Fibroblast Activation Protein (FAP) and Antibodies to FAP Human fibroblast activation protein (FAP; GenBank, registration number AAC51668), also known as seprase, is a membrane-associated (integral membrane) serine peptidase with a molecular weight of 170 kDa (EC 3.4.21 .B28). Together with dipeptidyl peptidase IV (also known as CD26; GenBank, registration number P27487), a closely related enzyme located on the cell surface, and other FAP peptidases, it belongs to the dipeptidyl peptidase IV family (Yu et al., FEBS J 277, 2010, cc. 1126 -1144). It is a homodimer containing two N-glycosylated subunits with a large C-terminal extracellular domain in which the enzyme catalytic domain is located (Scanlan et al., Proc Natl Acad Sci USA 91, 1994, cc. 5657-5661). FAP in its glycosylated form has both post-prolyl dipeptidyl peptidase and gelatinase activity (Sun et al., Protein Expr Purif 24, 2002, cc. 274-281).

Human FAP was first identified in a fibroblast culture using monoclonal antibody (MAb) F19 (described in WO 93/05804, ATCC number HB 8269). Homologs of this protein have been found in several species, including mice (Niedermeyer et al., Int J Cancer 71, 1997, cc. 383-389), Niedermeyer et al., Eur J Biochem 254, 1998, cc. 650-654; GenBank, Registration Number AAH19190). FAP is characterized by a unique distribution in tissues: a high upregulation of its expression on reactive stromal fibroblasts was found in more than 90% of all cases of primary and metastatic epithelial tumors, including lung carcinomas, colorectal carcinomas, carcinomas of the bladder, ovary and mammary gland, while generally absent in healthy tissues of adult individuals (Rettig et al., Proc Natl Acad Sci USA 85, 1988, cc. 3110-3114; Garin-Chesa et al., Proc Natl Acad Sci USA 87, 1990, cc. 7235- 7239). More recent studies have found that FAP is expressed not only in stromal fibroblasts, but also in certain types of malignant cells of epithelial origin, and that FAP expression directly correlates with the malignant phenotype (Jin et al., Anticancer Res 23, 2003, cc. 3195 -3198).

Due to its expression in many common types of cancer and its limited expression in healthy tissues, FAP has been seen as a promising antigenic target for imaging, diagnosis and treatment of various carcinomas. Thus, many monoclonal antibodies to FAP have been obtained, which can be used for research, diagnostic and therapeutic purposes.

Sibrotuzumab / BIBH1 is a humanized version of the F19 antibody that specifically binds to human FAP (described in WO 99/57151), and other humanized or fully human antibodies to the FAP antigen with the epitope specificity characteristic of F19 have been developed (they are described by Mersmann et al., Int J Cancer 92, 2001, cc. 240-248; Schmidt et al., Eur J Biochem 268, 2001, cc. 1730-1738; WO 01/68708). The OS4 antibody is another humanized (with transplanted CDR) version of the F19 antibody (Wuest et al., J Biotech 92, 2001, cc. 159168), with scFv 33 and scFv 36 having binding specificity different from that specific to F19. and cross-react with the human and murine FAP protein (Brocks et al., Mol Med 7, 2001, cc. 461-469). Other mouse anti-FAP antibodies were subsequently developed, as well as their chimeric and humanized versions (WO 2007/077173, Ostermann et al., Clin Cancer Res 14, 2008, cc. 4584-4592).

Proteases in the stroma of the tumor through proteolytic cleavage of the components of the extracellular matrix (ECM) facilitate processes such as angiogenesis and / or migration of tumor cells. In addition, tumor stroma plays an important role in supplying tumors with nutrients and oxygen, as well as in tumor invasion and metastases. These important functions make it not only a diagnostic, but also a potential therapeutic target.

Data confirming the possibility of targeted action on the tumor stroma in vivo with anti-FAP antibodies were obtained in phase I of a clinical trial using ¹³¹ F-labeled F19 antibodies, which demonstrated specific enrichment of tumors with the antibody and the possibility of detecting metastases (Welt et al., J Clin Oncol 12, 1994, cc. 1193-1203). Similarly, in phase I of the sibrotuzumab test, specific accumulation of antibodies labeled with I was demonstrated in a tumor (Scott et al., Clin Cancer Res 9, 2003, cc. 1639-1647). However, the early phase II trial of unconjugated sibrotuzumab in patients with metastatic colorectal cancer was discontinued due to the lack of antibody effectiveness in inhibiting tumor development (Hofheinz et al., Onkologie 26, 2003, pp. 44-48). In addition, an anti-FAP antibody was later developed that did not show an in vivo antitumor effect when used in unconjugated form (WO 2007/077173).

Thus, there remains a need for improved therapeutic approaches, including the use of antibodies with increased efficacy for the treatment of various types of cancer, targeting FAP.

Glycosylation of antibodies

The oligosaccharide component can significantly affect properties related to the effectiveness of therapeutic glycoprotein, including physical stability, resistance to proteases, interactions with the immune system, pharmacokinetic parameters and specific biological activity. These properties may depend not only on the presence or absence of oligosaccharides, but also on their specific structures. Certain generalizations can be made regarding the relationship between the structure of the oligosaccharide and glycoprotein function. For example, some oligosaccharide structures mediate the rapid clearance of glycoprotein from the bloodstream as a result of interactions with specific carbohydrate-binding proteins, while others can bind to antibodies and trigger unwanted immune responses (Jenkins N. et al., Nature Biotechnol. 14, 1996, cc. 975-981. )

Sh-type antibodies, which are the most commonly used antibodies in anti-cancer immunotherapy, are glycoproteins that have a conserved N-linked glycosylation site on Asn 297 in each CH2 domain. Two complex biennial oligosaccharides attached to Asn297 are located between the CH2 domains, forming extensive contacts with the polypeptide backbone, and their presence is important for the antibody to perform effector functions such as antibody-dependent cell-dependent cytotoxicity (ADCC) (Lifely MR et al., Glycobiology 5, 1995, cc. 813-822; Jefferis R. et al., Immunol. Rev. 163, 1998, cc. 59-76; Wright A. and Morrison SL, Trends Biotechnol. 15, 1997, cc. 26-32).

Experiments on the construction of proteins have established that FcyR interact with the lower hinge region of the CH2 domain of IgG (Lund et al., J. Immunol. 157, 1996, cc. 4963-4969). However, the binding of FcyR also requires the presence of oligosaccharides covalently linked to conserved Asn 297 in the CH2 region. In the works of Lund et al., J. Immunol. 157. 1996, cc. 4963-4969 and Wright and Morrison, Trends Biotech. 15, 1997, cc. 26-31, it has been suggested that either the oligosaccharide and the polypeptide are both directly present on the binding site, or the oligosaccharide is required to maintain the active conformation of the CH2 polypeptide. Thus, as a means of increasing the affinity of the interaction between IgG1 and FcyR and to increase the ADCC activity of IgG1, a modification of the oligosaccharide structure can be used.

One way to achieve a significant increase in the effectiveness of monoclonal antibodies is to increase their natural cell-mediated effector functions by constructing their oligosaccharide component according to the method described by Umana et al., Nat Biotechnol 17, 1999, cc. 176-180 and in US No. 6602684 (WO 99/54342), the contents of which are fully incorporated into this description by reference. Umana et al. Demonstrated that overexpression of β (1,4) N-acetylglucosaminyl transferase III (GnTIII), i.e. glycosyltransferase, which catalyzes the formation of bisectional oligosaccharides in Chinese hamster ovary (CHO) cells, significantly increases the in vitro ADCC activity of antibodies produced in these cells. Overexpression of GnTIII in productive cell lines leads to the production of antibodies enriched in bisection oligosaccharides, which, as a rule, are non-fucosized and are of the hybrid type. If overexpression of mannosidase II (ManII) occurs in productive cell lines in addition to GnTIII, then antibodies are formed enriched with bisectional non-fucosylated complex oligosaccharides (Ferrara et al., Biotechn Bioeng 93, 2006, cc. 851-861). Both types of antibodies have significantly enhanced ADCC compared to antibodies with unmodified glycans, however, only antibodies in which most N-glycans are complex type have the ability to significantly increase complement dependent cytotoxicity (Ferrara et al., Biotechn Bioeng 93, 2006, cc. 851-861). Changes in the composition of the Asn 297-linked carbohydrate or its elimination also affect the binding of the Fc domain of the antibody to the Fcy receptor (FcyR) and the protein C1q of the complement system, which is important for ADCC and CDC, respectively (Umana et al., Nat Biotechnol 17, 1999, cc. 176-180; Davies et al., Biotechnol Bioeng 74, 2001, cc. 288-294; Mimura et al., J Biol Chem 276, 2001, cc. 4553945547; Radaev et al., J Biol Chem 276 , 2001, cc. 16478-16483; Shields et al., J Biol Chem 276, 2001, cc. 65916604; Shields et al., J Biol Chem 277, 2002, cc. 26733-26740; Simmons et al., J Immunol Methods 263, 2002, cc. 133-147).

SUMMARY OF THE INVENTION

The present invention relates to antibodies that specifically bind to a fibroblast activation protein (FAP) having high affinity and / or enhanced effector function.

One of the objects of the invention is an antibody that specifically binds to a fibroblast activation protein (FAP), which contains the variable region of the heavy chain of SEQ ID NO: 267, and the variable region of the light chain of SEQ ID NO: 265.

Said antibody may comprise an Fc region or region equivalent to the Fc region of immunoglo-lobulin, which is preferably the IgG Fc region.

In a preferred embodiment, the antibody is a full-length IgG class antibody.

It may comprise a constant region of a human antibody, or even in the most preferred embodiment of the invention, it is a human antibody.

Preferably, said antibody comprises an Fc region created by glycoengineering, said antibody having an increased relative content of unfucosylated oligosaccharides in the Fc region as compared to an antibody created without the use of glycoengineering. It is possible that at least about 20 to about 100% of the N-linked oligosaccharides in the indicated Fc region are unfucosylated.

In one embodiment, the antibody has an increased relative oligosaccharide content in said Fc region, which is bisectional due to Nacetylglucoseamine (GlcNAc), compared to an antibody created without glycoengineering. Moreover, at least from about 20 to about 100% of the N-linked oligosaccharides in said Fc region may be bisectional, more preferably from at least about 20 to about 50% of the N-linked oligosaccharides in said Fc region are bisected due to GlcNAc and unfucilated.

The specified antibody has an increased effector function and / or increased binding affinity for the Fc receptor, wherein said enhanced effector function is an increased ADCC.

Still further objects of the present invention are an isolated polynucleotide encoding an antibody heavy chain and / or a light chain of a subject antibody and a composition for expressing an antibody heavy chain and an antibody light chain that comprises a first isolated polynucleotide encoding an antibody heavy chain that contains the sequence of SEQ ID NO: 267 and a second isolated polynucleotide encoding an antibody light chain that contains the sequence of SEQ ID NO: 265.

The application also describes a vector for expression of an antibody heavy chain and / or antibody light chain containing said polynucleotides and a host cell for producing an antibody containing polynucleotides, composition or vector.

Moreover, in a preferred embodiment, the host cell further includes one or more polynucleotides containing a sequence that encodes a polypeptide having activity of b- (1,4) -Y-acetylglucosaminyl transferase III (GnTIII). Moreover, a polypeptide having GnTIII activity may be a fusion polypeptide that contains a GnTIII catalytic domain and a localization domain of mannosidase II (ManII) in the Golgi complex.

In a further preferred embodiment, said host cell may further comprise a polynucleotide that comprises a sequence encoding a polypeptide having manosidase II ManII activity.

In addition, the invention relates to methods for producing an antibody that specifically binds fibroblast activation protein (FAP), one of which involves culturing a host cell in a medium and under conditions that allow expression of the antibody and isolating the antibody, and the second culturing the host cell in the medium and under conditions that allow expression of the antibody, and modifying the oligosaccharides present in the Fc region of the antibody with a polypeptide that has GnTIII activity, and isolating the antibody.

The objects of the present invention are also an antibody that specifically binds to FAP obtained by the above methods and conjugate the antibody to a cytotoxic agent for treating cancer.

The invention proposed in the application relates to a pharmaceutical composition for treating a disease characterized by FAP expression comprising an antibody and a pharmaceutically acceptable carrier.

In a preferred embodiment, it also contains an anti-cancer agent.

In addition, the object of the invention described in this application is the use of an antibody for the preparation of a medicament for the treatment of a disease characterized by the expression of FAP, preferably cancer; the use of an antibody to prepare a medicament for inducing lysis of a tumor cell or stromal tumor cell, in a preferred embodiment, antibody-induced cell lysis depends on the cytotoxicity of the antibody.

Another object is a method of treating an individual suffering from a disease that is characterized by FAP expression, which comprises administering to the individual an effective amount of an antibody or pharmaceutical composition. Preferably, an additional drug is also administered to the individual, which is an anti-cancer agent. Moreover, this disease may be cancer.

- 3 034742

The invention described in the application also relates to a method for inducing cell lysis of a tumor cell or tumor stromal cell, which comprises contacting the tumor cell or stromal cell with an antibody.

Moreover, the specified cell lysis is preferably induced by antibody-dependent cytotoxicity of the antibody.

Finally, the last object of this invention is a method for diagnosing a cancer or inflammatory condition in an individual by determining a complex of a diagnostic agent and FAP. It includes administering to the individual in an effective amount of a diagnostic agent, wherein said diagnostic agent contains an antibody and a label that allows for the detection of a complex comprising a diagnostic agent and FAP.

Brief Description of the Drawings

The drawings show:

in FIG. 1 - results of kinetic characteristics analyzes obtained by surface plasmon resonance (SPR) for Fab fragments of antibodies to FAP with mature affinity. The processed kinetic data sets are presented for clone 19G1 binding to human (hu) FAP (A), mouse (mu) FAP (B), for clone 20G8 binding to hu FAP (C), mu FAP (G), and for clone 4B9 binding to hu FAP (D) and mu FAP (E). Smooth lines indicate the results of global approximation of the obtained data using a 1: 1 interaction model;

in FIG. 2 shows the results of kinetic characterization analyzes obtained using SPR for Fab fragments of anti-FAP antibodies with mature affinity. Presented are sets of processed kinetic data for clone 5B8 binding to hu FAP (A) and mu FAP (B), for clone 5F1 binding to hu FAP (B), mu FAP (G), and for clone 14B3 binding to hu FAP (D) and mu FAP (E). Smooth lines indicate the results of global approximation of the obtained data using a 1: 1 interaction model;

in FIG. 3 shows the results of kinetic characterization analyzes obtained using SPR for Fab fragments of anti-FAP antibodies with mature affinity. The processed kinetic data sets are presented for clone 16F1 binding to hu FAP (A) and mu FAP (B), for clone 16F8 binding to hu FAP (B), mu FAP (G), and for clone O3C9 binding to hu FAP (D) and mu FAP (E). Smooth lines indicate the results of global approximation of the obtained data using an interactive 1: 1 model;

in FIG. 4 shows the results of kinetic characterization analyzes obtained using SPR for Fab fragments of anti-FAP antibodies with mature affinity. Presents kinetic data sets for clone O2D7 binding to hu FAP (A) and mu FAP (B), clone 28H1 binding to hu FAP (C), mu FAP (G), cynomolgus monkey (cynomolgus cynomolgus) cyno FAP (D), and for clone 22A3 binding to hu FAP (E), mu FAP (G) and cyno FAP (3). Smooth lines indicate the results of global approximation of the obtained data using a 1: 1 interaction model;

in FIG. 5 shows the results of kinetic characterization analyzes obtained using SPR for Fab fragments of anti-FAP antibodies with mature affinity. Presented are sets of processed kinetic data for clone 29B11 binding to hu FAP (A), mu FAP (B), cyno FAP (C), and for clone 23C10 binding to hu FAP (G), mu FAP (D) and cyno FAP (E). Smooth lines indicate the results of global approximation of the obtained data using a 1: 1 interaction model;

in FIG. 6 shows the results of kinetic characteristics analyzes obtained using SPR for antibodies 3F2 (A), 4G8 (B) and 3D9 (C) against FAP in the form of Fab fragments that bind to FAPs of humans, mice, and cynomolgus monkeys. Sets of processed kinetic data are presented; smooth lines indicate the results of global approximation of the obtained data using a 1: 1 interaction model;

in FIG. 7 shows the results of kinetic characterization analyzes obtained using SPR for antibodies to FAP 3F2 (A), 4G8 (B) and 3D9 (C), binding as human IgG to FAPs of humans, mice, and cynomolgus monkeys. Sets of processed kinetic data are presented; smooth lines indicate the results of global approximation of the obtained data using a 1: 1 interaction model;

in FIG. 8 - representative images of non-small cell lung cancer (NSCLC) samples obtained from the human body after immunohistochemical staining for FAP using a mouse antibody 2F3 in the form of IgG2a, (B) colonic adenocarcinoma after immunohistochemical staining for detecting FAP using a mouse antibody 2F3 in the form of IgG2a, (B) colon adenocarcinoma after immunohistochemical staining to detect FAP using mouse antibody 3D9 in the form of IgG2a, and D) colon adenocarcinoma after immunohistochemistry female staining for the detection of FAP using a mouse antibody 4G8 in the form of IgG2a. FAP was detected in the stroma of the tumor in all samples and with all antibodies (left panels), while no staining was detected when using the antibody isotype used as control (right panels);

in FIG. 9 shows the results of the analysis of the binding of human antibodies to FAP in the form of IgG1 with HEK 293 expressing FAP cells stably transfected humanly (A) or murine (B)

FAPs obtained using FACS;

in FIG. 10 shows the results of an analysis of the binding of human antibodies to FAP in the form of IgG1 with DPPIV (CD26) or HER2 expressed by stably transfected HEK 293 cells obtained using FACS. The anti-HER2 antibody trastuzumab and the anti-CD26 antibody were used as positive controls. A secondary antibody, an IgG control, or an antibody-free variant (cells only) was used as negative controls;

in FIG. 11 shows the results of the analysis of the binding of human antibodies to FAP in the form of IgG1 with FAP on human fibroblasts (cell line GM05389) obtained using FACS. A secondary antibody or non-antibody variant was used as negative controls;

in FIG. 12 shows the results of the analysis of the binding of human antibodies to FAP in the form of IgG1 with human fibroblasts (cell line GM05389), various human tumor cell lines or HEK293 cells stably transfected with human FAP obtained using FACS;

in FIG. 13 (A) and (B) - levels of FAP expression on the surface of the pulmonary fibroblasts of the GM05389 line at various times after incubation with human anti-FAP antibodies in the form of IgG1 3F2 or 4G8 obtained using FACS. He found a significant decrease in FAP expression levels, indicating FAP internalization. Data are presented for a secondary antibody used as a negative control when used individually;

in FIG. 14 - representative immunofluorescence images of staining of the plasma membrane of lung fibroblasts of the GM05389 line, obtained after binding of the anti-FAP 4G8 antibody as IgG for 45 min at 4 ° C (A), for 20 min at 37 ° C (B), for 1 h at 37 ° C (V) or for 6 hours at 37 ° C (D). Background staining is shown, obtained using the anti-CD20 GA101 antibody isotype. EEA1 is a label for early endosomes. Persistent FAP staining on the surface of the plasma membrane was demonstrated up to 6 hours after binding to the anti-FAP 4G8 antibody;

in FIG. 15 shows the results of purification and analysis of wild-type human IgG 28H1.

A) The purification step by affinity chromatography on protein A. B) The purification step by gel filtration. C) Analytical SDS-PAGE. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 16 - the results of purification and analysis created using glycoengineering human IgG 28H1. A) Purification step by affinity chromatography on protein A. B) Purification step by gel filtration. C) Analytical SDS-PAGE. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 17 shows the results of purification and analysis of wild-type human IgG 29B11. A) The purification step by affinity chromatography on protein A. B) The purification step by gel filtration. C) Analytical DSNPAAG. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 18 shows the results of purification and analysis of human IgG 29B11 created by glycoengineering. A) Purification step by affinity chromatography on protein A. B) Purification step by gel filtration. C) Analytical SDS-PAGE. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 19 shows the results of purification and analysis of human wild type 3F2 IgG. A) The purification step by affinity chromatography on protein A. B) The purification step by gel filtration. C) Analytical DSNPAAG. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 20 shows the results of purification and analysis of human IgG 3F2 generated by glycoengineering. A) The purification step by affinity chromatography on protein A. B) The purification step by gel filtration. C) Analytical SDS-PAGE. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 21 - results of purification and analysis of human wild-type IgG 4G8. A) The purification step by affinity chromatography on protein A. B) The purification step by gel filtration. C) Analytical DSNPAAG. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 22 shows the results of purification and analysis of human IgG 4G8 created by glycoengineering. A) Purification step by affinity chromatography on protein A. B) Purification step by gel filtration. C) Analytical SDS-PAGE. D) Analytical gel filtration. The experimental procedure is described in example 1;

in FIG. 23 shows the results of an analysis of binding of an anti-FAP antibody with mature 28H1 affinity to human FAP on HEK293 cells in comparison with binding of the parent anti-FAP 4G8 antibody;

in FIG. 24 shows the results of an analysis of the release of LDH (lactate dehydrogenase) for evaluating ADCC due to antibodies to FAP IgG type 28H1 (with mature affinity) and 4G8, 3F8 (parent) as the wild type version (wt) and the version of the antibody created using glycoengineering ( ge) using HEK293-hFAP as target cells and PBMNC as effector cells (genotype F / F FcyRIIIa).

- 5,034,742

I. Definitions

A human acceptor framework region in the context of the present description refers to a framework region containing the amino acid sequence of the framework region of the variable region of the light chain (VL) or framework region of the variable region of the heavy chain (VH) derived from the framework of the human immunoglobulin or human consensus framework region indicated below. The human acceptor framework region derived from the framework region of a human immunoglobulin or human consensus framework region may contain the same amino acid sequence as these framework regions, or may carry substitutions in the amino acid sequence. The number of amino acid substitutions may be 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less or 2 or less. The human VL acceptor framework region is identical in sequence to the human immunoglobulin VL framework region sequence or the human consensus framework region sequence.

The concept of affinity refers to the total strength of all non-covalent interactions between an individual binding site of a molecule (e.g., an antibody) and its binding partner (e.g., antigen). Unless otherwise indicated, in the context of the present description, the concept of binding affinity refers to the inherent binding affinity of a binding pair (for example, an antibody and antigen) reflecting a 1: 1 type interaction. The affinity of the molecule X to its partner Y can, as a rule, be characterized using the dissociation constant (KD), which is the ratio of the dissociation and association reaction rate constants (k _off and k _on, respectively). So, equivalent affinities can correspond to different rate constants, if the ratio of the rate constants remains the same. Affinity can be evaluated by conventional methods known in the art, including those described herein. Specific exemplary binding affinity measurement options are described below.

The term affinity matured antibody refers to an antibody with one or more changes (e.g., amino acid mutations) in one or more of the hypervariable regions (HVR) (e.g., CDR), compared to a parent antibody that does not have these changes, while changes lead to an increase in the affinity of the antibody for antigen. Typically, an antibody with mature affinity binds to the same epitope as the parent antibody.

An antibody to FAP and an antibody that binds to a fibroblast activation protein (FAP) refers to an antibody that has the ability to bind to FAP with sufficient affinity, which allows the antibody to be used as a diagnostic and / or therapeutic agent targeted by FAP. The binding of an anti-FAP antibody to an unrelated non-FAP protein is less than about 10% of the degree of antibody binding to FAP, according to data obtained, for example, by radioimmunoassay (RIA) or flow cytometry (FACS). The degree of binding of the described anti-FAP antibody to DPPIV, a protein closely related to FAP (also referred to as CD26; GenBank, registration number P27487), is less than about 15%, about 10 or 5% of the degree of antibody binding to FAP according to FACS. An antibody that binds to FAP is characterized by a dissociation constant (K _D ) of <1 μM, <100 nM, <10 nM, <1 nM, <0.1 nM, <0.01 nM or <0.001 nM (e.g. 10 ^-8 M or less, for example, from 10 ^-8 M to 10 ^-13 M, for example, from 10 ^-9 M to 10 ^-13 M). An anti-FAP antibody can bind to a FAP epitope that is conserved for various types of FAP.

In the context of the present description, the term antibody is used in its broadest sense and refers to various structures of antibodies, including (but not limited to) monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies and antibody fragments, provided that they possess the required antigen-binding activity and also refers to antibody fragments including the Fc region and fusion proteins that contain a region equivalent to the immunoglobulin Fc region. An e-fragment of an antibody refers to a molecule other than an intact antibody that contains a portion of the intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments are, but are not limited to, Fv, Fab, Fab ', Fab' -SH, F (ab ') ₂ , single chain antibody molecules (e.g. scFv), dimeric and multispecific antibodies derived from antibody fragments.

The concept of an antibody that binds to the same epitope as a reference antibody refers to an antibody that blocks the binding of a reference antibody to its antigen according to analysis in a competitive format by 50% or more, and vice versa, a reference antibody blocks the binding of an antibody with its antigen according to analysis in a competitive format of 50% or more. An example of competition analysis is presented in the present description.

In the context of the present description, the term "antigen binding center" refers to the part of the antigen binding molecule, which contains a region that specifically binds and is

- 6,034,742 complementary parts of the antigen or the full antigen. If the antigen is large, then the antigen-binding molecule can only bind to a specific part of the antigen, which is called the epitope. The antigen binding site may be, for example, one or more variable domains of an antibody (also called variable regions of an antibody). Preferably, the antigen binding site comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH).

The term chimeric antibody refers to an antibody in which a portion of the heavy and / or light chain is derived from a specific source or specific species, and the remainder of the heavy and / or light chain is derived from another source or other species. For example, in chimeric antibodies, non-binding antigen components can be obtained from antibodies of a wide variety of species, including primates, such as chimpanzees, and humans. Humanized antibodies are the most preferred form of chimeric antibodies.

The term antibody class refers to the type of constant domain or constant region of an antibody heavy chain. There are five main classes of antibodies: IgA, IgD, IgE, IgG and IgM, and some of them can be further subdivided into subclasses (isotypes), for example, IgG ,. IgG ₂ , IgG ₃ , IgG ₄ , IgA, and IgA ₂ . The constant domains of heavy chains corresponding to different classes of immunoglobulins are denoted as α, δ, ε, γ and μ, respectively.

In the context of the present description, the term cytotoxic agent refers to a substance that inhibits or interferes with cell function and / or causes cell death or destruction. Cytotoxic agents include, but are not limited to, radioactive isotopes (e.g., At ²¹¹ , I ¹³¹ , I ¹²⁵ , Y ⁹⁰ , Re ¹⁸ , Re ¹⁸ , Sm ¹⁵ , Bi ²¹² , P ³² , Pb ²¹² and radioactive isotopes Lu) ; chemotherapeutic agents or drugs (e.g. methotrexate, adriamycin, vinca alkaloids (vincristine, vnblastin, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents); growth inhibitory agents; enzymes and fragments thereof, such as nucleolytic enzymes; antibiotics toxins, such as low molecular weight toxins or enzymatic activity toxins of bacterial, fungal, vegetable or animal origin, including fragments and / or variants thereof; and various antitumor or anticancer agents indicated below.

In the context of the present description, the term effector function refers to the types of biological activity inherent in the Fc region, which varies depending on the isotype of the antibody. Examples of antibody effector functions are the ability to bind to C1q and complement dependent cytotoxicity (CDC), the ability to bind to the Fc receptor, antibody-dependent cell-dependent cytotoxicity (ADCC), antibody-based cell-dependent phagocytosis (ADCP), cytokine secretion, antigen-mediated antigen-absorption absorption cells, downregulating cell surface receptors (e.g., B cell receptor); and B cell activation.

The term effective amount of an agent, for example, a pharmaceutical composition, refers to an amount effective when used in doses and for the periods of time necessary to achieve the desired therapeutic or prophylactic result.

In the context of the present description, the concept of the Fc region refers to the C-terminal region of the immunoglobulin heavy chain, which contains at least part of the constant region. The term refers to a native sequence of Fc regions and variants of Fc regions. The Fc region of the heavy chain of human IgG can extend from Cys226 or from Pro230 to the carboxyl end of the heavy chain. However, the C-terminal lysine (Lys447) of the Fc region may or may not be present. Unless specifically indicated otherwise, the numbering of amino acid residues in the Fc region or constant region corresponds to the EU numbering system, also called the EU index, which is described by Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Ed. - Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

In the context of the present description, it is understood that the concept of the region equivalent to the Fc region of the immunoglobulin refers to naturally occurring allelic variants of the Fc region of the immunoglobulin, as well as variants having changes that result from substitutions, additions or deletions, but which do not significantly reduce the ability of immunoglobulin to mediate effector functions (such as antibody-mediated cell-dependent cytotoxicity). For example, one or more amino acids can be removed by deletions from the N-terminus or C-terminus of the immunoglobulin Fc region without significantly reducing biological function. Such variants can be selected according to the general rules that are known in the art, so as to have a minimal effect on activity (see, for example, Bowie J. U. et al., Science 247, 1990, cc. 1306-1310).

Frame sections or FR '' sections are regions of variable regions other than residues of hypervariable regions (HVR) (or CDR). Variable region FRs are typically represented by four FR domains: FR1, FR2, FR3, and FR4. Thus, the HVR and FR sequences are typically located in VH (or VL) in the following order: FR1-H1 (L1) -FR2-H2 (L2) - 7 034742

FR3-H3 (L3) -FR4.

As used herein, a full-length antibody, an intact antibody, and a full antibody are used interchangeably and refer to an antibody having a structure substantially similar to that of a native antibody or having heavy chains that contain the Fc region as described herein.

In the context of the present description, the terms cell, cell line, and cell culture are used interchangeably and refer to cells into which exogenous nucleic acid is introduced, including the progeny of these cells. Thus, the concepts of transformants and transformed cells of the host cell include the primary cells under consideration, as well as cultures derived from them, regardless of the number of transfers. Offspring may not be strictly identical to the parent cell in nucleic acid composition, but may carry mutations.

Mutant offspring that has the same function or biological activity as the original transformed cell selected by screening or selection falls under this concept. A host cell can be designed to produce an antibody with modified oligosaccharides using it. For this, host cells were subjected to additional manipulations to express elevated levels of one or more polypeptides with activity in (1,4) -H-acetylglucosaminyl transferase III (GnTIII). Host cells are, but are not limited to, cultured cells, for example, cultured mammalian cells, such as CHO cells, BHK cells, NSO cells, SP2 / 0 cells, YO line myeloma cells, mouse line myeloma cells P3X63, PER cells, PER.C6 cells or hybridoma cells, yeast cells, insect cells and plant cells, as well as cells found in a transgenic animal, transgenic plant or cultivated plant or animal tissue.

A human antibody is an antibody that carries an amino acid sequence corresponding to the sequence of an antibody produced in the human body or in a human cell, or obtained from a source other than a human, in which human antibody populations or other sequences encoding human antibodies are produced. From the indicated concept of a human antibody, a humanized antibody containing non-human antigen binding residues is specifically excluded.

The human consensus framework region is a framework region that includes the most common amino acid residues in selected sequences of immunoglobulin VL or VH framework regions. Typically, the selection of VL or VH sequences of human immunoglobulin is carried out from a subgroup of variable domain sequences. A subgroup of sequences is a subgroup described by Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., NIH Publication 91-3242, Bethesda MD, i.e. 1-3, 1991. Regarding the VL, the subgroup may be a subgroup of kappa I according to Kabat et al. Above, and regarding the VH subgroup may be a subgroup III according to Kabat et al. Above.

The term “humanized antibody” refers to a chimeric antibody comprising amino acid residues from non-human HVR and amino acid residues from human FR. A humanized antibody should contain almost all of at least one and, as a rule, two variable domains in which all or almost all HVRs (e.g. CDRs) correspond to regions of a non-human antibody, and all or almost all of FRs correspond to regions of a human antibodies. A humanized antibody may optionally contain at least a portion of a constant region of an antibody derived from a human antibody. The concept of humanizing a form of an antibody, for example a non-human antibody, refers to an antibody that has been humanized.

The concept of a hypervariable region or HVR in the context of the present description refers to each of the regions of the variable domain of an antibody, the sequence of which is hypervariable, and / or which form structures in the form of loops (hypervariable loops). Typically, native four chain antibodies contain six HVRs; three in VH (H1, H2, H3) and three in VL (L1, L2, L3). HVRs, as a rule, contain amino acid residues from hypervariable loops and / or from complementarity determining regions (CDRs), the latter differ in the most pronounced sequence variability and / or are involved in antigen recognition. In addition to CDR1, VH CDRs typically contain amino acid residues that form hypervariable loops. The concept of hypervariable regions (HVR) also refers to complementarity determining regions (CDRs), and these concepts are used interchangeably with respect to the positions of the variable region that form the antigen-binding centers. This particular area is described by Kabat et al., U.S. Dept. of Health and Human Services, Sequences of Proteins of Immunological Interest, 1983 and Chothia et al., J. Mol. Biol. 196, 1987, cc. 901-917, moreover, these definitions refer to overlapping amino acid residues or subsets of amino acid residues when compared with each other. However, in the context of the present description implies the possibility of using any definition of the CDR of an antibody or its variants. The corresponding amino acid residues that make up the CDR, as defined in each of the references cited above, are presented in comparison below in table. 1. The exact residue numbers that make up a particular CDR should vary depending on

- 8,034,742 of the sequence and size of the CDR. Specialists in this field based on the amino acid sequence data of the variable region of the antibody can easily determine which residues are included in a particular CDR.

Table 1. CDR Definitions

Cab off Hotia Abm ² V _H CDR1 31-35 26-32 26-35 V _H CDR2 50-65 52-58 50-58 V _H CDR3 95-102 95-102 95-102 V _L CDR1 24-34 26-32 24-32 V _L CDR2 50-56 50-52 50-56 V _L CDR3 89-97 91-96 89-97

The numbering of all residues included in the CDR in the table. 1 is given in accordance with the nomenclature proposed by Cabot et al. (See below).

The AbM designation with an uppercase letter b, used in the table. 1 relates to CDRs as defined by the Oxford Molecular Group AbM antibody modeling program.

Cabot et al also proposed a numbering system (nomenclature) of sequences of variable regions, which can be used for any antibody. An ordinary person skilled in the art can unambiguously apply this Cabot numbering system to any sequence in a variable region without any experimental data other than information about the sequence itself. In the context of the present description, the concept of Cabot numbering refers to the numbering system described by Kabat et al., Sequence of Proteins of Immunological Interest, published by U.S. Dept. of Health and Human Services, 1983. Unless otherwise indicated, references to the numbering of the positions of specific amino acid residues in the variable region of the antibody are given in accordance with the Cabot numbering system.

CDRs also contain specificity-determining residues or SDRs, which are residues in contact with the antigen. SDRs are in the CDR region designated as truncated CDR or a-CDR. In general, only 1/5 to 1/3 of the residues in a given CDR are involved in antigen binding. The specificity-determining residues in a particular CDR can be identified, for example, by computer-assisted processing of interatomic contacts in three-dimensional modeling and determination of sequence variability at a given position of the residue using methods described by Padlan et al., FASEB J. 9 (1), 1995, cc. 133-139. Exemplary a-CDRs (a-CDR-L1, a-CDR-L2, a-CDR-L3, a-CDR-H1, a-CDR-H2 and a-CDR-H3) are on amino acid residues 31- 34 in L1, 50-55 in L2, 89-96 in L3, 31-35V in H1, 50-58 in H2 and 95-102 in H3 (see Almagro and Fransson, Front. Biosci 13, 2008, cp. 1619 -1633).

An antibody conjugate is an antibody conjugated to a cytotoxic agent.

The individual or subject is a mammal. A mammal is, but is not limited to, domesticated animals (e.g., cows, sheep, cats, dogs and horses), primates (e.g., humans and primates other than humans, such as monkeys), rabbits and rodents (e.g., mice and rats).

An isolated antibody is an antibody that is separated from the components of its natural environment and can be purified to a purity level exceeding 95 or 99% according to data obtained, for example, using electrophoretic methods (e.g. SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic methods (e.g., ion-exchange HPLC or reverse phase HPLC). For a review of methods for evaluating antibody purity, see, for example, Flatman et al., J. Chromatogr. In 848, 2007, cc. 79-87.

An isolated polynucleotide means a polynucleotide molecule that is separated from the components of its natural environment. An isolated polynucleotide is a polynucleotide molecule located in a cell, which usually contains a polynucleotide molecule, but the polynucleotide molecule is present outside the chromosome or is located on the chromosome at a locus different from the locus of its localization in the chromosome in vivo.

The term “isolated polynucleotide encoding an anti-FAP antibody” refers to one or more polynucleotide molecules encoding the antibody heavy and light chains (or fragments thereof), including the indicated polynucleotide molecule (s) that is (are) located in one vector or in different vectors, and the indicated polynucleotide molecule (s) (s) are present in one or more regions in the host cell.

The term monoclonal antibody in the context of the present description refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e. individual antibodies in the population are identical and / or bind to the same epitope, with the exception of possible antibody variants, for example, those containing naturally occurring mutations or occurring during the production of a monoclonal antibody preparation, these variants are usually present in minor amounts. Unlike polyclonal antibody preparations, which, like

- 9,034,742 as a rule, include different antibodies to different determinants (epitopes), each monoclonal antibody from the preparation of a monoclonal antibody is directed against one antigen determinant. Thus, the monoclonal adjective determines the specificity of the antibody, characterizing it as obtained from an almost homogeneous population of antibodies, and not designed in accordance with the requirements for obtaining antibodies using any particular method. For example, monoclonal antibodies can be created using various technologies, including (but not limited to) the hybridoma method, recombinant DNA methods, phage display methods, and transgenic animal methods that contain all or part of the immunoglobulin loci, these methods, and others. exemplary methods for the preparation of monoclonal antibodies are provided herein.

The term “bare antibody” refers to an antibody that is not conjugated to a heterologous fragment (eg, a cytotoxic fragment) or a radioactive label. The bare antibody may be present in the pharmaceutical composition.

The concept of native antibodies refers to naturally occurring immunoglobulin molecules with various structures. For example, native IgG antibodies are heterotetrameric glycoproteins weighing approximately 150,000 Da, consisting of two identical light chains and two identical heavy chains connected by disulfide bridges. Each heavy chain in the direction from the N- to C-terminus contains a variable region (VH), which is also called the variable heavy domain or the variable domain of the heavy chain, behind which there are three constant domains (CH1, CH2 and CH3), which are also called the constant region heavy chain. Similarly, each light chain in the direction from the N- to the C-terminus contains a variable region (VL), which is also called the variable light domain or variable domain of the light chain, behind which is located the constant light (CL) domain, which is also called the constant region of the light chain . The light chain may be one of two types, designated as kappa (k) or lambda (λ), based on the amino acid sequence of its constant domain.

The concept does not have significant cross-reactivity means that a molecule (eg, an antibody) does not recognize or bind specifically to an antigen other than the actual target antigen of the molecule (eg, an antigen closely related to the target antigen), primarily compared to the target antigen . For example, the level of binding of an antibody to an antigen other than the actual target antigen may be from less than about 10% to less than about 5%, or the level of binding to said antigen other than the actual antigen of the target may be less than about 10 , 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5, 0.2, or 0.1%, preferably less than about 2, 1, or 0.5%, and most preferably the level of binding to the antigen other than the actual target antigen may be less than about 0.2 or 0.1%.

The concept of a package leaflet refers to instructions that are usually found in commercial packages of therapeutic products that contain information about the indications, use, dose, route of administration, combination therapy, contraindications and / or precautions for the use of these therapeutic products.

The term “parent antibody” refers to an antibody used as a starting material or as a basis for the production of a variant.

The percentage (%) of amino acid sequence identity with respect to the polypeptide reference sequence is defined as the percentage of amino acid residues in the candidate sequence that are identical to the amino acid residues in the polypeptide reference sequence, after alignment of the sequences and introduction of gaps if necessary to achieve the maximum percentage of sequence identity, while there are no conservative substitutions are taken into account when evaluating sequence identity her. Comparative analysis to determine the percent identity of amino acid sequences can be carried out in various ways that are within the competence of a person skilled in the art, for example, using publicly available computer programs such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR). Specialists in this field can determine the appropriate parameters for sequence alignment, including any algorithms necessary to achieve maximum alignment along the entire length of the compared sequences. However, for the purposes of the present invention, the% amino acid sequence identity value is obtained using the ALIGN-2 computer program for sequence comparison. The ALIGN-2 computer program for sequence comparison was developed by Genentech, Inc., and the source code was stored with the user documentation in U.S. Copyright Office, Washington D.C., 20559, where it is registered under registration number U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is a publicly available program from Genentech, Inc., Southern San Francisco, pc. California, or you can compile it from source code. ALIGN-2 can be compiled for use on a UNIX operating system, including the digital version of UNIX V4.0D. In a programme

- 10 034742

ALIGN-2 all parameters for comparing sequences are given and should not be changed.

In a situation where ALIGN-2 is used to compare amino acid sequences, the% amino acid sequence identity of a given amino acid sequence A is relative to or compared to a given amino acid sequence B (which in other words can be referred to as a given amino acid sequence A that has or differs in a certain% amino acid identity sequences relative to or compared to a given amino acid sequence B), the following m way:

100x quotient X / Y, where X denotes the number of amino acid residues evaluated by the ALIGN-2 sequence comparison program as identical when comparing sequences A and B using the indicated program, and where Y denotes the total number of amino acid residues in B. It should be obvious that when the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the% identity of amino acid sequence A relative to the amino acid sequence and B should not be equal to% identity of amino acid sequence B relative to amino acid sequence A. Unless specifically indicated otherwise, in the context of the present description, all values of% identity of amino acid sequences are obtained according to the procedure described in the last of the preceding paragraphs, using the computer program ALIGN- 2.

Similarly, a nucleotide acid or polynucleotide having / having a nucleotide sequence that, for example, is 95% identical to the nucleotide reference sequence of the present invention, means that the nucleotide sequence of the polynucleotide is identical to the reference sequence, except that the polynucleotide sequence may include up to up to 5 point mutations for every 100 nucleotides of the nucleotide reference sequence. In other words, upon receipt of a polynucleotide having a nucleotide sequence that is identical to at least 95% of the nucleotide reference sequence, up to 5% of the nucleotides in the reference sequence can be deleted by deletion or replaced by another nucleotide, or up to 5% of the nucleotides from the total number of nucleotides in the reference sequence can be embedded in the reference sequence. These changes in the reference sequence can take place at positions at the 5'- or 3'-end of the nucleotide reference sequence or at a different position between these end positions, which are inserted either individually between the residues in the reference sequence, or in one or more of the adjacent groups in reference sequence. In practice, the question of whether a particular polynucleotide or polypeptide is identical to at least 80, 85, 90, 95, 96, 97, 98, or 99% of the nucleotide sequence or polypeptide sequence of the present invention can usually be solved using known computer programs, for example, the above.

The concept of a pharmaceutical composition refers to a preparation that is in such a form that it provides the biological activity of the active ingredient included in it, which must be effective, and which does not contain additional components that have unacceptable toxicity to the individual to whom the composition should be administered.

A pharmaceutically acceptable carrier refers to an ingredient in a pharmaceutical composition other than the active substance that is non-toxic to the individual. Pharmaceutically acceptable carriers include, but are not limited to, a buffer, excipient, stabilizer, or preservative.

The term fibroblast activation protein (FAP) as used herein refers to any native FAP from any vertebrate animal, including mammals such as primates (e.g., human, see GenBank, registration number AAC51668) and rodents (e.g., mouse, see GenBank , registration number AAH19190), unless specifically indicated otherwise. The concept refers to full-sized unprocessed FAP, as well as to any form of FAP formed as a result of processing in the cell. The term also refers to naturally occurring FAP variants, for example, splicing variants or allelic variants. Preferably, the anti-FAP antibody binds to the extracellular domain of the FAP. The amino acid sequences of the ectodomains of the human, murine FAP and FAP monkey cynomolgus (with C-terminal polylysine and 6xHis tag) are given in SEQ ID NO: 317, SEQ ID NO: 319 and SEQ ID NO: 321, respectively.

In the context of the present description, the concept of treatment (and its grammatical variations, such as a treat or treatment process) refers to clinical intervention with the aim of changing the natural course of the disease in the individual to be treated, and it can be carried out either for prophylaxis or in the process of development of clinical pathology. The required treatment actions include (but are not limited to) preventing the occurrence or relapse of the disease, alleviating the symptoms, reducing any direct or indirect pathological effects of the disease, preventing metastases, reducing the rate of development of the disease, alleviating or temporarily weakening the disease, and remission or forecast improvement.

The term “variable region” or “variable domain” refers to a heavy or light chain domain of an antibody that is involved in the binding of an antibody to an antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of the native antibody, as a rule, have similar structures, with each domain containing 4 conserved frame sites (FR) and three hypervariable sites (HVR) (see, for example, Kindt and et al., Kuby Immunology, 6th ed., WH Freeman and Co., 2007, p. 91). A single VH or VL domain may be sufficient to ensure antigen binding specificity. In addition, antibodies that bind to a specific antigen can be isolated using the VH or VL domain of an antibody that binds to an antigen to screen a library of complementary VL or VH domains, respectively (see, for example, Portolano et al., J. Immunol. 150, 1993, cc. 880-887; Clarkson et al., Nature 352, 1991, cc. 624-628).

In the context of the present description, the term vector refers to a nucleic acid molecule that has the ability to amplify another nucleic acid with which it is associated. The term refers to a vector as a self-replicating structure containing a nucleic acid, as well as to a vector integrated into the genome of the host cell into which the vector is introduced. Some vectors have the ability to control the expression of nucleic acids with which they are functionally linked. Such vectors in the context of the present description are referred to as expression vectors.

In the context of the present description, the concept of a polypeptide having GnTIII activity refers to polypeptides that can catalyze the addition of an N-acetylglucosamine residue (GlcNAc) in the β-1-4 bond to the β-linked mannoside of the trimannosyl core of N-linked oligosaccharides. This process involves the fusion of polypeptides with enzymatic activity similar, but not necessarily identical, to the activity of (1,4) -H-acetylglucosaminyl transferase III, also known as β-1,4-mannosyl glycoprotein-4-beta-H-acetylglucosaminyl transferase (CF) 2.4.1.144) according to the nomenclature of the Nomenclature Committee of the International Union for Biochemistry and Molecular Biology (NC-IUBMB)), when evaluated using specific biological analysis, both in the case of dose-dependent and dose-independent. In the case where there is a dose-dependent relationship, the enzyme should not necessarily be identical to GnTIII, but rather, it should be practically similar to it in relation to the dose-dependent activity of this activity compared to GnTIII (i.e., the candidate polypeptide should have higher activity or not more than about 25 times reduced activity, preferably not more than about 10 times reduced activity, and even more preferably not more than about 3 times reduced activity compared to GnTIII).

In the context of the present description, the concept of a localization domain in the Golgi complex refers to the amino acid sequence of the polypeptide located in the Golgi complex, which is responsible for the anchoring of the polypeptide in the region inside the Golgi complex. Typically, localization domains contain amino-terminal tails of the enzyme.

In the context of the present description, the concept of engineering (creation), created using engineering, the process of creation using engineering, especially with the prefix glyco, as well as the concept of glycosylation engineering (glycoengineering, constructing a glycosylation scheme), refers to any manipulation that the glycosylation scheme encountered in vivo or recombinant polypeptide or its fragment. The construction of a glycosylation scheme involves the metabolic construction of a cell glycosylation mechanism, including genetic manipulations regarding oligosaccharide synthesis pathways, in order to obtain altered glycosylation of glycoproteins expressed in cells. In addition, glycosylation engineering includes the effects of mutations and the cellular environment on glycosylation. Glycosylation engineering can be performed to alter glycosyltransferase activity. It also allows changes in glucosaminyl transferase activity and / or fucosyl transferase activity.

As used herein, the term “Fc-mediated cell-dependent cytotoxicity” refers to antibody-mediated cell-dependent cytotoxicity (ADCC) and cell-dependent cytotoxicity mediated by a soluble Fc fusion protein that contains the human Fc region. This is an immunity mechanism leading to the lysis of labeled (antibody) cells by human immunocompetent effector cells.

The term human immunocompetent effector cells means a population of leukocytes carrying Fc receptors on the surface, with the help of which they bind to the Fc region of antibodies or to Fc proteins fused and perform effector functions. Such a population may include, but are not limited to, peripheral mononuclear cells (PBMCs) and / or natural killer cells (NKs).

In the context of the present description, the term labeled (with antibody) cells refers to cells with which antigen-binding molecules containing the Fc region (for example, antibodies or their fragments that contain the Fc region) or Fc fusion proteins specifically bind. Antigen-binding molecules or Fc-fused proteins bind to target cells via the N-terminal to the Fc region of the protein fragment.

In the context of the present description, the concept of increased Fc-mediated cell-dependent cytotoxicity refers to any increase in the number of labeled (antibody) cells subjected to lysis at a given time at a given concentration of antibody or Fc fusion protein in the environment surrounding the target cell using the above the mechanism of Fc-mediated cell-dependent cytotoxicity and / or a decrease in the concentration of the antibody or Fc-fused protein in the environment surrounding the target cell necessary for the lysis of a given amount of labeled (antibody) cells at a given time using the mechanism of Fc-mediated cell-dependent cytotoxicity. An increase in the level of Fc-mediated cell-dependent cytotoxicity is evaluated relative to the cell-dependent cytotoxicity mediated by the same antigen-binding molecule or the same Fc protein that is / which is produced in the same type of host cells using the same standard methods of preparation, purification, preparation compositions and storage (which are known to specialists in this field), but which / which was not produced / was produced by the host cell, designed so that it had from an altered glycosylation pattern (for example, such that expression of GnTIII glycosyltransferase or other glycosyltransferases occurs therein) using the methods described herein.

By antibody having enhanced antibody-dependent cell-dependent cytotoxicity (ADCC) is meant an antibody, as defined above, having ADCC as determined by any suitable method known to those of ordinary skill in the art. One acceptable method for in vitro ADCC analysis is that:

1) target cells are used for analysis, for which it is known that they express an antigen target recognized by the antigen-binding center of the antibody;

2) for analysis, human peripheral blood mononuclear cells (PBMCs) isolated from the blood of randomly selected healthy donors are used as effector cells;

3) the analysis is carried out using the following protocol:

I) PBMCs are isolated using standard density gradient centrifugation methods and 5x 10 ⁶ cells / ml are suspended in RPMI medium for cell culture;

Ii) target cells are grown using standard tissue culture techniques, harvested at an exponential growth phase when the viability is over 90%, washed in RPMI medium for cell culture labeled with 100 μCi ⁵¹ Cr, washed twice with cell culture medium, and resuspended in cell culture medium with a density of 10 ⁵ cells / ml;

III) transfer 100 μl of the above final suspension of target cells to each well of a 96 well microtiter plate;

Iv) serial dilutions are prepared with an antibody concentration of 4000 to 0.04 ng / ml in a cell culture medium and 50 μl of the obtained antibody solutions are added to the target cells in a 96-well microtiter plate, evaluating in triplicate the various antibody concentrations in all of this higher concentration range;

V) to create controls with maximum release (MR) use 3 additional wells in a plate that contain labeled target cells, with the addition of 50 μl of a 2 vol.% Aqueous solution of a nonionic detergent (Nonidet, Sigma, St. Louis), instead of a solution antibodies (specified in paragraph IV, above);

VI) to create spontaneous release (SR) controls, use 3 additional wells in a plate that contain labeled target cells, with the addition of 50 μl of RPMI medium for cell culture instead of the antibody solution (specified in paragraph IV, above);

VII) then a 96-well microtiter plate is centrifuged at 50xg for 1 min and incubated for 1 h at 4 ° C;

VIII) add to each well 50 μl of a suspension of PBMC (indicated in paragraph I, above), obtaining a ratio of effector cells: target cells of 25: 1, and the tablets are placed in an incubator in an atmosphere containing 5% CO ₂ and kept at 37 ° C for 4 hours;

IX) cell-free supernatant is collected from each well and the radioactivity (ER) extracted during the experiment is quantified using a gamma ray counter;

X) calculate the percentage of specific lysis for each antibody concentration according to the formula (ER-MR) / (MR-SR) x100, where ER is the average radioactivity calculated (see H.IX.above) for the indicated antibody concentration, MR is the average radioactivity calculated (see PTX, above) for MR controls (see paragraph V, above), and SR means the average radioactivity calculated (see paragraph IX, above) for SR controls (see paragraph VI. higher);

4) increased ADCC is defined either as an increase in the maximum percentage of specific lysis detected using the above range of antibody concentrations, and / or as a decrease in the concentration of antibody necessary to achieve half the maximum percentage of specific lysis detected using the above range of concentration

- 13 034742 tractions of antibody. The increase in ADCC is evaluated relative to that measured using the above analysis of ADCC mediated by the same antibody that was produced in the same type of host cell using the same standard methods for preparation, purification, preparation of compositions and storage as are known to those skilled in the art. in this area, but which was not produced by the host cell, designed for overexpression of GnTIII.

II. Compositions and Methods

Fibroblast activation protein (FAP) is expressed in most tumors, but is practically absent in healthy tissues of adult individuals, therefore, antibodies targeted by this antigen have great therapeutic potential. The present invention provides antibodies that bind to FAP, in particular antibodies with high affinity and strong effector functions. The antibodies of the invention can be used, for example, to diagnose or treat diseases characterized by FAP expression, such as cancer.

A. Examples of antibodies to FAP

The present invention provides antibodies that specifically bind to fibroblast activation protein (FAP). In particular, the present invention provides antibodies that specifically bind to FAP, where antibodies are generated by glycoengineering so that they have enhanced effector function.

1. The affinity of antibodies

The antibody described herein has a dissociation constant (K _D ) of <1 μM, <100 nM, <10 nM, <1 nM, <0.1 nM, <0.01 nM, or <0.001 nM (e.g. 10 ^-8 M or less, for example, from 10 ^-8 M to 10 ^-13 M, for example, from 10 ^-9 M to 10 ^-13 M). Preferably, the binding of the antibodies described herein to a fibroblast activation protein (FAP), in particular to human FAP, is characterized by a K _D value of less than 1nM as determined by surface plasmon resonance (SPR).

K _{D is} measured in particular using the surface plasmon resonance method. This analysis can be performed, for example, using a BIACORE®-'n00 device (GE Healthcare) at 25 ° C, using CM5 chips to immobilize the antigen. In general, the method is as follows: biosensor chips with carboxymethylated dextran (CM5, GE Healthcare) are activated with P-ethyl-S '- (3-dimethylaminopropyl) carbodiimide (EDC) hydrochloride and N-hydroxysuccinimide (NHS) according to the supplier's instructions. Antibody to His (Penta His, Qiagen) is diluted in 10 mM sodium acetate, pH 5, to a concentration of 40 μg / ml before injection at a flow rate of 10 μl / min until approximately 9,000 units of a cross-linked protein response are reached. After injection, anti-His antibodies are injected with 1M ethanolamine in order to block unreacted groups. Then, His-labeled antigen is injected at a rate of 10 μl / min at a concentration of 10 nM for 20 s (for evaluating Fab fragments) or at a concentration of 20 nM for 25 s (for evaluating antibodies such as IgG) and captured through its His label using immobilized antibodies to His. The protein and DNA sequences of acceptable FAP antigen constructs are presented in SEQ ID NO: 317-322. For kinetic measurements, serial dilutions of the antibody (two-fold dilutions in the range of 6.25 to 200 nM for Fab fragments or five-fold dilutions in the range of 3.2 pM to 10 nM for IgG) in 10 mM HEPES, 150 mM NaCl, 3 mM EDTA , 0.05% surfactant P20, pH 7.4 is injected at 25 ° C with a flow rate of 90 μl / min. The following parameters are used: the duration of the association reaction is 180 s, the duration of the dissociation reaction is 300 s (for Fab) or 900 s (for IgG), regeneration with 10 mM glycine, pH 2 for 60 s between each cycle. Association reaction rate constants (k _on ) and dissociation reaction rate constants (k _off ) are calculated using a simple 1: 1 Langmuir binding model (BIACORE® T100 evaluation program) by simultaneously approximating the association and dissociation sensograms. The equilibrium constant of the dissociation reaction (K _D ) is calculated as the ratio k _off / k _on (see, for example, Chen et al., J. Mol. Biol. 293, 1999, cc. 865-881).

2. Fragments of antibodies

Antibody fragments are (but not limited to) Fab-, Fab'-, Fab'-SH-, F (ab ') ₂ -, Fv- and scFv-fragments and other fragments described below. For a review of specific antibody fragments, see Hudson et al., Nat. Med. 9, 2003, cc. 129-134 or Carter, Nat. Rev. Immunol. 6, 2006, cc. 343-357.

Single chain Fv or scFv fragments contain a VH domain and a VL domain as a single chain polypeptide chain. Typically, the VH and VL domains are linked by a linker sequence. For a review of scFv fragments, see, for example, Pluckthun in: The Pharmacology of Monoclonal Antibodies, ed. Rosenburg and Moore (Springer-Verlag, New York), T. 113, 1994, cc. 269-315; see also WO 93/16185 and US No. 5571894 and 5587458. For a discussion of Fab and F (ab ') ₂ fragments containing residues of the epitope that binds to the rescue receptor and having an extended in vivo half-life, see US No. 5869046.

Dimeric antibodies (diabody) are fragments of antibodies with two antigen-binding centers, which can be divalent or unispecific (see, for example, EP 404097; WO 1993/01161; Hudson et al., Nat. Med. 9, 2003, cc. 129 -134 and Hollinger et al., Proc. Natl. Acad.

- 14 034742

Sci. USA 90, 1993, cc. 6444-6448). Trimeric antibodies (triabody) and tetrameric antibodies (tetrabody) are also described by Hudson et al. Nat. Med. 9, 2003, cc. 129-134.

The mini-body is a divalent homodimeric scFv derivative that contains a constant region, typically the CH3 domain of an immunoglobulin, preferably an IgG type, more preferably IgG1, as a dimerization region. Typically, the constant region is linked to scFv through the hinge region and / or linker region. Examples of mini-body proteins are presented by Hu et al., Cancer Res. 56, 1996, cc. 3055-3061.

Single chain antibodies are antibody fragments that contain all or part of the variable domain of the heavy chain or all or part of the variable domain of the light chain of an antibody (Domantis, Inc., Waltam, Mass., See, for example, US No. 6248516 B1).

Antibody fragments can be obtained by various methods, including (but not limited to) proteolytic cleavage of the intact antibody, and also obtained using recombinant host cells (e.g., E. coli or phage), as described herein.

3. Chimeric and humanized antibodies

Some chimeric antibodies are described, for example, in US No. 4816567 and Morrison and others, Proc. Natl. Acad. Sci. USA, 81, 1984, cc. 6851-6855. For example, a chimeric antibody contains a non-human variable region (for example, a variable region from an antibody of mice, rats, hamsters, rabbits or primates other than humans, such as monkeys) and a human constant region. In another example, a chimeric antibody is an antibody of a switched class, the class or subclass of which is changed compared to the parent antibody. Chimeric antibodies also include their antigen binding fragments.

Typically, a non-human antibody is humanized to reduce immunogenicity in humans while maintaining the specificity and affinity of the parent non-human antibody. Typically, a humanized antibody contains one or more variable domains in which HVRs, for example, CDRs (or fragments thereof) are derived from a non-human antibody, and FRs (or fragments thereof) are derived from human antibody sequences. A humanized antibody may optionally also contain at least a portion of the human constant region. In some embodiments, some FR residues in the humanized antibody are replaced with corresponding residues from a non-human antibody (eg, an antibody from which HVR residues are derived), for example, to maintain or increase the specificity or affinity of the antibody. Various methods can be used for humanization, including (but not limited to) (a) transplanting complete non-human variable domains into human constant regions to produce chimeric antibodies, (b) transplanting only non-human (e.g., from a donor antibody) CDR into human (e.g., recipient antibodies) the framework region and constant regions with or without conservation of crucial residues of the framework region (e.g., residues important for maintaining high binding affinity I antigen or antibody functions), (c) transplantation of only non-human specificity determining sites (SDR or a-CDR; residues crucial for antibody-antigen interaction) to human framework or constant regions, or (d) transplantation of complete non-human variable domains but “masking” them with a human-like segment by replacing surface residues. Humanized antibodies and methods for their preparation are summarized, for example, by Almagro and Fransson, Front. Biosci. 13, 2008, cc. 1619-1633, and they are also described, for example, in Riechmann et al., Nature 332, 1988, cc. 323-329; Queen et al., Proc. Nat'l Acad. Sci. USA 86, 1989, cc. 10029-10033; US No. 5821337, 7527791, 6982321 and 7087409; Jones et al., Nature 321, 1986, cc. 522-525; Morrison et al., Proc. Natl. Acad. Sci. 81, 1984, cc. 68516855; Morrison and Oi, Adv. Immunol. 44, 1988, cc. 65-92; Verhoeyen et al., Science 239, 1988, cc. 1534-1536; Padlan, Molec. Immun. 31 (3), 1994, cc. 169-217; Kashmiri et al., Methods 36, 2005, cc. 25-34 (SDR transplantation description (a-CDR)); Padlan, Mol. Immunol. 28, 1991, cc. 489-498 (description of applying a new coating); Dall'Acqua et al., Methods 36, 2005, cc. 43-60 (description of permutation FR) and Osbourn et al., Methods 36, 2005, cc. 61-68 and Klimka et al., Br. J. Cancer 83, 2000, cc. 252-260 (description of the approach based on targeted selection for permutation FR).

Human framework regions that can be used for humanization include, but are not limited to: framework regions selected based on the best fit method (see, for example, Sims et al., J. Immunol. 151, 1993, p. 2296); frame sections derived from the consensus sequence of human antibodies of a particular subgroup of variable regions of light or heavy chains (see, for example, Carter and others, Proc. Natl. Acad. Sci. USA, 89, 1992, S. 4285 and Presta and others J. Immunol. 151, 1993, p. 2623); human mature (somatic mutated) framework regions or framework regions of the human germline (see, for example, Almagro and Fransson, Front. Biosci. 13, 2008, cc. 1619-1633); and frame sections obtained by screening FR libraries (see, for example, Vasa et al., J. Biol. Chem. 272, 1997, cc. 10678-10684) and Rosok et al., J. Biol. Chem. 271, 1996, cc. 22611-22618).

4. Human antibodies

Human antibodies can be obtained by various methods known in this field. Human antibodies are described generally by van Dijk and van de Winkel, Curr. Opin. Pharmacol 5, 2001, cc. 36874 and Lonberg, Curr. Opin. Immunol. 20, 2008, cc. 450-459.

Human antibodies can be obtained by administering an immunogen to a transgenic animal that is modified to produce intact human antibodies or intact antibodies with human variable regions in response to a challenge with an antigen. These animals, as a rule, contain all or part of the loci of the human immunoglobulin, which replaced the endogenous immunoglobulin loci, or which are present outside the chromosomes or integrated arbitrarily into the chromosomes of the animal. In such transgenic mice, endogenous immunoglobulin loci are generally inactivated. For a review of methods for producing human antibodies in transgenic animals, see Lonberg, Nat. Biotech 23, 2005, cc. 1117-1125. They are also described, for example, in US Nos. 6075181 and 6,150,584, which describe XENOMOUSE ™ technology; US No. 5770429, which describes the technology of HUMAB®; US 7041870, which describes the K-M MOUSE® technology and in the publication of US patent application No. 2007/0061900, which describes the VELOCIMOUSE® technology. The human variable regions of intact antibodies obtained in such animals can be further modified, for example, by combining with the human constant region from another antibody.

Human antibodies can also be obtained using methods based on the use of hybridomas. Cell lines of human myeloma and mouse-human heteromyeloma are described which are intended to produce human monoclonal antibodies (see, e.g., Kozbor, J. Immunol., 133, 1984, p. 3001; Brodeur et al., Monoclonal Antibody Production Techniques and Applications, 1987, cc. 51-63 (Marcel Dekker, Inc., New York); and Boerner et al., J. Immunol., 147, 1991, c. 86). Human antibodies created using technology based on the use of human B-cell hybridomas are also described by Li et al., Proc. Nail. Acad. Sci. USA, 103, 2006, cc. 3557-3562. Additional methods are those described, for example, in US No. 7189826 (a description of the preparation of monoclonal human antibodies such as IgM from hybridoma cell lines) and Ni, Xiandai Mianyixue, 26 (4), 2006, cc. 265-268 (description of human-human hybridomas). Human hybridoma technology (Trioma technology) is also described by Vollmers and Brandlein, Histology and Histopathology, 20 (3), 2005, cc. 927-937 and Vollmers and Brandlein, Methods and Findings in Experimental and Clinical Pharmacology, 27 (3), 2005, cc. 185-191.

Human antibodies can also be created by isolating sequences of the variable domains of the Fv clone selected from phage display libraries, which were used to create human antibodies. The indicated variable domain sequences can then be combined with the desired human constant domain. Techniques for selecting human antibodies from antibody libraries are described below.

5. Obtained from antibody libraries

Antibodies can be isolated by screening combinatorial antibody libraries with the desired activity or activity. For example, a variety of methods are known in the art for creating phage display libraries and screening for libraries with antibodies having the desired binding characteristics. These methods are summarized, for example, by Hoogenboom et al., In Methods in Molecular Biology, ed. O'Brien et al., Publishing House, Human Press, Totowa, NJ, 178, 2001, cc. 1-37 and are also described, for example, in McCafferty et al., Nature 348, cc. 552-554; Clackson et al., Nature 352, 1991, cc. 624-628; Marks et al., J. Mol. Biol. 222, 1992, cc. 581-597); Marks and Bradbury, in: Methods in Molecular Biology, ed. Lo et al., Human Press, Totowa, NJ, 248, 2003, cc. 161-175; Sidhu et al., J. Mol. Biol. 338 (2), 2004, cc. 299-310; Lee et al., J. Mol. Biol. 340 (5), 2004, cc. 1073-1093; Fellouse, Proc. Natl. Acad. Sci. USA 101 (34), 2004, cc. 12467-12472; and Lee et al., J. Immunol. Methods 284 (1-2), 2004, cc. 119-132.

In some phage display methods, populations of VH and VL genes are cloned individually by polymerase chain reaction (PCR) and randomly recombined in phage libraries, which are then screened for antigen binding phage according to the method described by Winter et al., Ann . Rev. Immunol., 12, 1994, cc. 433-455. The phage typically exposes antibody fragments either as single chain Fv fragments (scFv) or as Fab fragments. Libraries obtained from immunized sources include antibodies with high affinity for the immunogen, with no need for hybridomas. Alternatively, you can clone an untreated (naive) population (for example, from the human body), obtaining one source of antibodies to a wide range of strangers, as well as their antigens, without any immunization, as described by Griffiths et al., EMBO J, 12, 1993, cc. 725-734. And finally, untreated (naive) libraries can also be obtained by synthesis methods by cloning non-rearranged V-gene segments from stem cells and using PCR primers containing a random sequence to encode the hypervariable CDR3 sites and to perform in vitro rearrangement according to the method, described by Hoogenboom and Winter, J. Mol. Biol., 227, 1992, cc. 381-388.

- 16 034742

Phage libraries of human antibodies are described, for example, in the following patent publications: US No. 5750373 and publication of patent applications US No. 2005/0079574, 2005/0119455,

2005/0266000, 2007/0117126, 2007/0160598, 2007/0237764, 2007/0292936 and 2009/0002360.

Antibodies or antibody fragments isolated from human antibody libraries are considered as human antibodies or fragments of human antibodies.

6. Multispecific antibodies

Multispecific antibodies are monoclonal antibodies that have the ability to specifically bind to at least two different sites. One of the binding specificities binds to FAP, and the other to any other antigen. Bespecific antibodies can bind to two different FAP epitopes. Bespecifically antibodies can also be used to localize cytotoxic agents in cells expressing FAP. Bespecifically antibodies can be obtained in the form of full-sized antibodies or fragments of antibodies.

Methods for creating multispecific antibodies include, but are not limited to, recombinant coexpression of two immunoglobulin heavy chain-light chain pairs that have different specificities (see Milstein and Cuello, Nature 305, 1983, p. 537, WO 93/08829 and Traunecker et al., EMBO J. 10, 1991, p. 3655), and design based on knob-in-hole technology (protrusion-cavity interaction) (see, for example, US No. 5731168). Multispecific antibodies can also be obtained by creating electrostatic effects to create antibody molecules with a heterodimeric Fc region (WO 2009 / 089004A1); by crosslinking two or more antibodies or fragments thereof (see, US No. 4676980 and Brennan et al., Science 229, 1985, p. 81); using leucine zippers to produce bispecific antibodies (see, for example, Kostelny et al., J. Immunol. 148 (5), 1992, cc. 1547-1553); using diabody technology (dimeric antibodies) to create fragments of bispecific antibodies (see, for example, Hollinger et al., Proc. Natl. Acad. Sci. USA, 90, 1993, cc. 6444-6448); and using single chain Fv dimers (scFvs) (see, for example, Gruber et al., J. Immunol., 152, 1994, p. 5368); by preparing trispecific antibodies according to the method described, for example, by Tutt et al., J. Immunol. 147, 1991, p. 60.

Antibodies with three or more antigen binding sites include octopus antibodies (see, for example, US 2006/0025576A1).

An antibody or fragment thereof may also include a double-acting Fab or DAF, which contain an antigen binding site that binds to the FAP, as well as to a different antigen (see, for example, US 2008/0069820).

7. Antibody variants

Particular embodiments of the invention are variants of the amino acid sequences of antibodies. For example, an increase in binding affinity and / or other biological properties of an antibody may be required. Variants of the amino acid sequences of antibodies can be obtained by introducing appropriate modifications into the nucleotide sequence encoding the antibody, or by peptide synthesis. These modifications include, for example, deletions and / or insertions and / or substitutions of residues in the amino acid sequences of antibodies. Any combination of deletions, insertions, and substitutions can be used to obtain the final construct, provided that the final construct has the required characteristics, for example, the ability to bind antigen.

a) Obtained by replacement, insertion and deletion options

Of interest sites for substitutional mutagenesis are HVR and FR.

Amino acid substitutions can lead to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties, for example, conservative amino acid substitutions. "Conservative" amino acid substitutions can be created on the basis of similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic nature of the residues used for this purpose. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine; positively charged (basic) amino acids include arginine, lysine and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Conservative substitutions are presented in table. 2 under the heading of preferred substitutions. More important replacements are presented in table. 2 under the heading are exemplary substitutions, and as further described below, with reference to amino acid side chain classes. Amino acid substitutions can be introduced into the antibody of interest and the products are screened for the desired activity, for example, maintaining / increasing antigen binding ability, decreased immunogenicity, or improved ADCC or CDC.

- 17 034742

table 2

Original balance Cited as an example replacements Preferred replacements Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gin; Asn Lys Asn (n) Gin; His; Asp, Lys; Arg Gin Asp (D) Glu; Asn Glu Cys (c) Ser; Ala Ser Gin (q) Asn; Glu Asn Glu (E) Asp; Gin Asp Gly (G) Ala Ala His (H) Asn; Gin; Lys; Arg Arg He (I) Leu; Val; Met; Ala; Phe; norleucine Leu Leu (L) Norleucine; lie; Val; Met; Ala; Phe lie Lys (K) Arg; Gin; Asn Arg Met (M) Leu; Phe; lie Leu Phe (f) Trp; Leu; Val; lie; Ala; Tyr Tyr Pro (P) Ala Ala Ser (S) Thr Thr Thr (t) Val; Ser Ser Trp (w) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) lie; Leu; Met; Phe; Ala; norleucine Leu

Amino acids can be grouped based on the general properties of the side chains as follows:

(1) hydrophobic: norleucine, Met, Ala, Val, Leu, Ile;

(2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln;

(3) acidic: Asp, Glu;

(4) basic: His, Lys, Arg;

(5) residues that affect chain orientation: Gly, Pro;

(6) aromatic: Trp, Tyr, Phe.

By non-conservative substitutions is meant the replacement of a representative of one of these classes with a representative from another class. For example, amino acid substitutions can also lead to the replacement of one amino acid with another amino acid having different structural and / or chemical properties, for example, the replacement of an amino acid from one group (e.g., polar) with another amino acid from another group (e.g., basic). The acceptability of the variation can be determined experimentally by systemically performing insertions, deletions or substitutions of amino acids in the polypeptide molecule using recombinant DNA methods and evaluating the activity of the resulting recombinant variants.

One type of substitutional variant involves the replacement of one or more residues in the hypervariable region of the parent antibody (e.g., a humanized or human antibody). As a rule, the resulting variant (s) selected for further study should (s) have modifications (e.g., improvements) of certain biological properties (e.g., increased affinity, decreased immunogenicity) relative to the parent antibody and / or should (s) practically preserve certain biological properties of the parent antibody. An example of a substitutional variant is an antibody with mature affinity, which can be easily obtained, for example, using phage display affinity maturation methods as described herein. In general, the method consists in the following: one or more HVR residues are mutated, and antibody variants are displayed on the phage and screened for a specific biological activity (e.g., binding affinity).

Changes (e.g., substitutions) can be made in HVR, for example, to increase the affinity of an antibody. These changes can be made in hot spots in the HVR, i.e. residues encoded by codons that mutate with high frequency during somatic mutagenesis (see, for example, Chowdhury, Methods Mol. Biol. 207, 2008, cc. 179-196), and / or SDR (a-CDR), by evaluating the resulting VH or VL variant with respect to binding affinity. The maturation of affinity by creating and reseeding secondary libraries is described, for example, by Hoogenboom et al., In: Methods in Molecular Biology, ed. O'Brien et al., Publishing House, Human Press, Totowa, NJ, 178, 2001, cc. 1-37). In some maturation variants, affinities introduce diversity into the genes of the variable regions selected for maturation using any of a variety of methods (such as, for example, low-precision PCR, chain permutation, or site-directed mutagenesis using oligonucleotides). Then create a secondary library. The library is then screened to identify any antibody variants with the desired affinity. Another method of introducing diversity involves approaches related to HVR, in the implementation of which randomize several residues in the HVR (for example, 4-6 residues simultaneously). Specific HVR residues involved in antigen binding can be identified, for example, by alanine scanning mutagenesis or by modeling. In particular, targets are often CDR-H3 and CDR-L3.

Substitutions, insertions, or deletions may occur in one or more HVRs, if indicated

- 18,034,742 changes do not significantly reduce the ability of an antibody to bind to an antigen. For example, conservative changes can be made in HVR (for example, conservative substitutions described herein) that do not result in a significant decrease in binding affinity. These changes may be located outside of the hot (active) HVR or SDR points. VH and VL sequence variants of each HVR may be unchanged, or contain no more than one, two or three amino acid substitutions.

A valuable method for identifying residues or regions of an antibody that can be mutagenized is the method called alanine scanning mutagenesis, which is described by Cunningham and Wells, Science, 244, 1989, cc. 1081-1085. In this method, a residue or group of target residues is identified (e.g., charged residues, such as Arg, Asp, His, Lys and Glu) and replaced with a neutral or negatively charged amino acid (e.g., alanine or polyalanine) to determine such a substitution affects the interaction of the antibody with the antigen. Additional amino acid substitutions can be introduced into amino acid positions for which functional sensitivity to initial substitutions has been demonstrated. In an alternative or additional embodiment, it may be valuable to analyze the crystal structure of the antigen-antibody complex to identify contact points between the antibody and antigen. Said contact residues and adjacent residues can be considered as targets or excluded from consideration as candidates for replacement. Options can be screened to determine if they have the desired properties.

Insertions of amino acid sequences include amino and / or carboxy-terminal fusions ranging in length from one residue to polypeptides containing one hundred or more residues, as well as insertions of one or more amino acid residues into the sequence. An example of a terminal insertion result is an antibody with an N-terminal methionyl residue. Other insertion variants of the antibody molecule include the fusion of the N- or C-terminus of the antibody with an enzyme (as, for example, in the case of ADEPT (antibody-directed enzyme of prodrug therapy) or with a polypeptide that lengthens the half-life of the antibody in serum.

b) Glycosylation Options

Modifications of the oligosaccharide in the antibody can also be made to create antibody variants with certain improved properties.

Glycoforms of antibodies to FAP may have enhanced effector function, including antibody-dependent cell-dependent cytotoxicity. The engineering of glycosylation of antibodies has been described previously (see, for example, US No. 6602684, incorporated herein by reference in its entirety). Methods for producing antibodies to FAP using host cells that have altered the activity of genes involved in glycosylation are also described in detail in the present description (see the section entitled Recombination Methods and Compositions below).

The IgG molecule carries two N-linked oligosaccharides in the Fc region, one on each heavy chain. Like any glycoprotein, an antibody is produced as a population of glycoforms that have the same polypeptide framework, but different oligosaccharides attached to glycosylation sites. Oligosaccharides, which are normally present in the Fc region of serum IgG, are of a complex biennial type (Wormald et al., Biochemistry 36, 1997, cc. 130-138) with a low content of terminal sialic acid and bi-dissecting N-acetylglucosamine (GlcNAc) and c different levels of terminal galactosylation and cortical fucosylation (fucose attached to the GlcNAc residue in the “stem” of the bi-antenna oligosaccharide structure). Some studies have suggested that a minimal carbohydrate structure is required for binding to FcyR within the oligosaccharide core (Lund et al., J. Immunol. 157, 1996, cc. 4963-4969).

In mouse or hamster cell lines, which are used in industry and scientific research to obtain antibodies, as a rule, the required oligosaccharide determinants are attached to Fc sites. However, the IgG expressed by these cell lines does not contain bi-dissecting GlcNAc found in small amounts in serum IgG (Lifely et al., Glycobiology 318, 1995, cc. 813-822). In the N-linked glycosylation pathway, bisected GlcNAc is added using GnTIII (Schachter, Biochem. Cell Biol. 64, 1986, cc. 163-168).

Umana et al. Used one antibody producing the CHO cell line, which was previously created for expression under the influence of external regulation of various levels of the cloned gene of the GnTIII enzyme (Umana P. et al., Nature Biotechnol. 17, 1999, cc. 176-180). This approach was used primarily to prove a strong correlation between the expression of glycosyl transferase (e.g., GnTIII) and the ADCC activity of the modified antibody. FAP antibodies containing an Fc region or a region equivalent to the Fc region can be prepared with altered glycosylation as a result of a change in the level of expression of the glycosyltransferase gene in the host antibody-producing cell. A change in the level of gene expression is an increase in GnTIII activity. Increased GnTIII activity leads to an increase in the percentage of bisectional oligosaccharides, as well as to a decrease in the percentage of fucosylated oligosaccharides in the Fc region of the antibody. This antibody or fragment thereof has increased binding affinity for Fc

- 19 034742 receptor and increased effector function.

Antibodies with bisectional oligosaccharides are obtained, for example, antibodies in which a bi-antenna oligosaccharide attached to the Fc region of an antibody is bisected with GlcNAc. Such antibodies may have reduced fucosylation and / or hanging ADCC function. Examples of these antibody variants are described, for example, in WO 2003/011878 (in the name of Jean-Mairet et al); US No. 6602684 (in the name of Umana with co-authors) and US 2005/0123546 (in the name of Umana and co-authors).

Antibodies to FAP may have an increased relative content of bisectional oligosaccharides in the Fc region as a result of the modification of their oligosaccharides. The percentage of bisectional N-linked oligosaccharides in the Fc region of anti-FAP antibodies can be at least about 10 to about 100%, in particular at least about 50%, more preferably at least about 60%, at least about 70 %, at least about 80%, or at least about 90-95% of the total content of oligosaccharides. Bisectional oligosaccharides can be of a hybrid or complex type.

Antibodies to FAP may also have an increased relative content of unfucosylated oligosaccharides in the Fc region as a result of the modification of their oligosaccharides. Moreover, the percentage of non-fucosylated oligosaccharides may be from at least about 20 to about 100%, in particular at least about 50%, preferably from at least about 60 to about 70%, and most preferably at least 75%. Unfucosylated oligosaccharides can be of a hybrid or complex type.

The amount of fucose is determined by calculating the average amount of fucose in the sugar chain on Asn297, relative to the sum of all glycostructures attached to Asn 297 (for example, complex, hybrid structures and structures with a high mannose content), performing measurements using MALDI-TOF mass spectrometry according to the method described in WO 2008/077546). Asn297 denotes an asparagine residue localized at position 297 in the Fc region (according to the EU numbering of the residues in Fc); however, Asn297 can be localized within approximately ± 3 amino acids in the reverse or forward direction relative to position 297, i.e. between positions 294 and 300, which is associated with minor variations in the sequence of antibodies. The relative amount of fucose is the percentage of fucose containing structures relative to all glycostructures identified in the sample treated with N-glycosidase F (e.g., complex, hybrid structures and structures with a high mannose content), which is measured using MALDI-TOF-MC. These fucosylation options may have increased ADCC.

The glycoengineering methodology that can be used for anti-FAP antibodies is described in detail in US No. 6602684, published US patent application No. 2004/0241817 A1, published US patent application 2003/0175884 A1, provisional patent application US No. 60/441307 and WO 2004/065540, the entire contents of each document is incorporated into this description by reference. Antibodies to FAP can be glycoengineered so that they have a reduced amount of fucose residues in the Fc region, using the techniques described in published patent application US No. 2003/0157108 (in the name of Genentech) or EP 1176195 A1, WO 03 / 084570, WO 03/085119 and published US patent applications No. 2003/0115614, 2004/093621, 2004/110282, 2004/110704, 2004/132140, Niwa et al., J Immunol Methods 306, 2006, cc. 151-160, in US No. 6946292 (in the name of Kyowa). Glycoengineered anti-FAP antibodies can also be obtained in expression systems that produce modified glycoproteins, such as those described in published US patent application No. 60/344169 and WO 03/056914 (in the name of GlycoFi, Inc.) or WO 2004 / 057002 and WO 2004/024927 (in the name of Greenovation).

Further examples of publications regarding defucosylated antibody variants or fucose deficient antibody variants are WO 2000/61739; WO 2001/29246; US2002 / 0164328; US 2004/0109865; WO 2005/035586; WO 2005/035778; WO2005 / 053742; WO2002 / 031140; Okazaki et al., J. Mol. Biol. 336, 2004, cc. 1239-1249 (2004); Yamane-Ohnuki et al., Biotech. Bioeng. 87, 2004, p. 614). Examples of cell lines that have the ability to produce defucosylated antibodies are Lec13 protein fucosylated deficient CHO cells (Ripka et al., Arch. Biochem. Biophys. 249, 1986, cc. 533-545; US Patent Application No. US 2003 / 0157108 A1, in the name of Presta L; and WO 2004/056312 A1, in the name of Adams et al, primarily in Example 11), and cell lines with the gene turned off, for example, CHO cells with the alpha 1,6 1,6fucosyl transferase gene turned off, FUT8 (see, for example, Yamane-Ohnuki et al., Biotech. Bioeng. 87, 2004, p. 614); Kanda Y. et al. Biotechnol. Bioeng., 94 (4), 2006, cc. 680-688; and WO 2003/085107).

Antibodies to FAP may have an increased relative content of bisectional non-fucosylated oligosaccharides in the Fc region. Bisectional non-fucosylated oligosaccharides can be either hybrid or complex. In particular, anti-FAP antibodies can be prepared in which at least about 10 to about 100%, preferably at least about 15%, more preferably at least about 20 to about 25%, and most preferably at least about 30 to about 35% of the oligosaccharides in the Fc region of the antigen binding molecule are bisected, non-fucosylated. Antibodies to FAP may also contain an Fc-20 034742 region in which at least about 10 to about 100%, preferably at least about 15%, more preferably at least about 20 to about 25%, and most preferably from at least about 30 to about 35% of the oligosaccharides in the Fc region of the antibody are bisectional hybrid non-fucosylated.

The antibody can be modified to increase or decrease the degree of glycosylation of the antibody. Addition or deletion of glycosylation sites in an antibody is conveniently accomplished by changing the amino acid sequence so that one or more glycosylation sites are created or deleted.

Antibody variants are also known with at least one galactose residue in the oligosaccharide attached to the Fc region. These antibody variants may region of increased CDC function. These antibody variants are described, for example, in WO 1997/30087 (in the name of Patel et al); WO 1998/58964 (in the name of Raju S.) and WO 1999/22764 (in the name of Raju S.).

To increase ADCC or other effector functions of anti-FAP antibodies, the affinity of the antigen-binding molecule to FAP can also be increased, for example, by maturation of affinity or other methods for increasing affinity (see, Tang et al., J. Immunol. 179, 2007, cc. 2815 -2823) or using amino acid modifications in the Fc region described below. Combinations of these approaches can also be used according to the present invention.

c) Variants of the Fc region

One or more amino acid modifications can be introduced into the Fc region of the antibody, thereby creating a variant of the Fc region. An Fc region variant may comprise a sequence of a human Fc region (e.g., the Fc region of human IgG1, IgG2, IgG3 or IgG4) comprising an amino acid modification (e.g., substitution) at one or more amino acid positions.

An antibody variant may have some, but not all, effector functions, making it a promising candidate for routes of application for which the in-vivo half-life of an antibody is important, but some effector functions (such as those associated with complement and ADCC) are unnecessary or harmful . In vitro and / or in vivo cytotoxicity assays can be performed to confirm a decrease / depletion of CDC and / or ADCC activity. For example, Fc receptor (FcR) binding assays can be performed to ensure that the antibody lacks the ability to bind to FcyR (and therefore probably does not have ADCC activity), but retains the ability to bind to FcRn. Primary cells mediating ADCC, i.e. NK cells express FcyRIII only, while monocytes express FcyRI, FcyRII and FcyRIII. Data on the expression of FcR on hematopoietic cells are summarized in table. 3 on p. 464 from Ravetch and Kinet, Annu. Rev. Immunol. 9, 1991, cc. 457-492. Examples of in vitro assays (but not limited to) ADCC activity of the molecule of interest are described in US No. 5500362 (see, for example, Hellstrom I. et al., Proc. Nat'l Acad. Sci. USA 83, 1986, cc. 7059-7063 and Hellstrom I. et al., Proc. Nat'l Acad. Sci. USA 82, 1985, cc. 1499-1502); No. 5821337 (see, Bruggemann M. et al., J. Exp. Med. 166, 1987, cc. 1351-1361). Alternatively, non-radioactive methods can be used (see, for example, non-radioactive analysis of ACTI ™ cytotoxicity based on flow cytometry (CellTechnology, Inc. Mountain View, Calif.); And non-radioactive cytotoxicity analysis CytoTox 96® (Promega, Madison, pc. Wisconsin) Effective cells suitable for such assays are peripheral blood mononuclear cells (PBMCs) and natural killer cells (NKs). Alternatively or additionally, the ADCC activity of the molecule of interest can be evaluated in vivo, for example, in an animal model, for example, as described by Clynes et al., Proc. Nat'l Acad. Sci. USA 95, 1998, cc. 652-656). C1q binding assays can also be performed to confirm that the antibody cannot bind C1q and therefore lacks CDC activity (see, for example, the ELISA for evaluating C1q and C3c binding in WO 2006/029879 and WO 2005/100402). To assess complement activation, a CDC assay can be performed (see, e.g., Gazzano-Santoro et al., J. Immunol. Methods 202, 1996, p. 163; Cragg MS et al., Blood 101, 2003, cc. 1045- 1052; and Cragg MS and MJ Glennie, Blood 103, 2004, cc. 2738-2743). In vivo determination of FcRn binding and in vivo clearance / half-life can also be carried out using methods known in the art (see, for example, Petkova SB et al., Int'l. Immunol. 18 (12), 2006, cc. 1759 -1769).

Antibodies with reduced effector function include antibodies with the substitution of one or more of the following residues in the Fc region: 238, 265, 269, 270, 297, 327 and 329 (US No. 6737056). These Fc mutants include Fc mutants with substitutions in two or more amino acids at positions 265, 269, 270, 297 and 327, including the so-called DANA mutant of the Fc region, carrying the substitution of residues 265 and 297 for alanine (US No. 7332581).

Some variants of antibodies with increased or decreased ability to bind to FcR are described (see, for example, US No. 6737056; WO 2004/056312 and Shields et al., J. Biol. Chem. 9 (2), 2001, cc. 65916604).

- 21 034742

An antibody variant may contain an Fc region with one or more amino acid substitutions that increase ADCC, for example, substitutions at positions 298, 333, and / or 334 of the Fc region (EU numbering of residues).

Changes are also made in the Fc region that result in an altered (i.e., either increased or decreased) ability to bind C1q and / or complement dependent cytotoxicity (CDC), as described, for example, in US No. 6194551, WO 99/51642 and Idusogie et al., J. Immunol. 164, 2000, cc. 4178-4184.

Antibodies with an extended half-life and increased ability to bind to the neonatal Fc receptor (FcRn), which is responsible for the transfer of maternal IgG to the embryo (Guyer et al., J. Immunol. 117, 1976, p. 587 and Kim et al., J . Immunol. 24, 1994, p. 249), are described in US No. 2005/0014934A1 (addressed to Hinton et al.). These antibodies contain an Fc region with one or more substitutions that increase the binding of the Fc region to FcRn. These Fc variants include variants with substitutions of one or more of the following residues of the Fc region: 238, 256, 265, 272, 286, 303, 305 , 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 or 434, for example, replacing residue 434 in the Fc region (US No. 7371826).

Further examples regarding Fc region variants are also described in US Patent Application Nos. 60/439498; 60/456041; 60/514549 or in WO 2004/063351 (a variant of Fc regions with increased binding affinity as a result of amino acid modification); or in US patent application No. 10 / 672,280 or in WO 2004/099249 (Fc variants with altered binding ability to FcyR as a result of amino acid modification), Duncan and Winter, Nature 322, 1988, cc. 738-740; in US No. 5648260; US No. 5624821 and WO 94/29351.

d) Cysteine-engineered antibody variants

Sometimes it is desirable to construct an antibody using cysteine, for example, “thioMAT”, in which one or more residues in the antibody are replaced by cysteine residues. Substituted residues are typically present at accessible antibody sites. By replacing these residues with cysteine, reactive thiol groups are introduced into accessible antibody sites and can be used to conjugate the antibody to other fragments, such as drug fragments or drug linker fragments, to create an antibody conjugate. Any one or more of the following residues may be substituted for cysteine: V205 (Cabot numbering) light chain; A118 (EU numbering) of the heavy chain; and S400 (EU numbering) of the heavy chain Fc region. Engineered using cysteine antibodies can be created, for example, according to the method described in US No. 7521541.

d) Derivatives of antibodies

The antibody is further modified so that it contains additional non-protein fragments known in the art and readily available. Fragments suitable for derivatization of an antibody include, but are not limited to, water soluble polymers. Examples of water-soluble polymers are (but not limited to) polyethylene glycol (PEG), ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxolane, poly-1,3,6-trioxane, ethylene / maleic anhydride, polyamino acids (either homopolymers or random copolymers) and dextran or poly (n-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymers, propylene oxide / ethylene oxide copolymers, polyoxyethylene polyols (e.g. glycerin), polyvinyl alcohol and mixtures thereof. Polyethylene glycol propionaldehyde may have an advantage in production due to its stability in water. The polymer may have any molecular weight and may be branched or unbranched. The number of polymers attached to the antibody can vary, and if more than one polymer is attached, they can be the same or different molecules. In general, the number and / or type of polymers used for derivatization can be determined taking into account such features (but not limited to them), such as specific properties or functions of the antibody to be improved, whether the use of an antibody derivative is intended for therapy under certain conditions, etc.

The conjugates of the antibody and non-protein fragment can be selectively heated by exposing it to radiation. Moreover, the non-protein fragment may be a carbon nanotube (Kam et al., Proc. Natl. Acad. Sci. USA 102, 2005, cc. 11600-11605). Radiation can have any wavelength and includes (but not limited to) wavelengths that do not damage ordinary cells, but which heat the non-protein fragment to a temperature at which the cells closest to the conjugate: the antibody-non-protein fragment, are destroyed.

B. Recombination Methods and Compositions

Antibodies can be obtained using recombination methods and compositions, for example, described in US No. 4816567. One embodiment of the invention is an isolated polynucleotide encoding an anti-FAP antibody. Said polynucleotide may encode an amino acid sequence containing a VL and / or an amino acid sequence containing a VH antibody (e.g., light and / or heavy chain of an antibody). One or more vectors (for example, cloning vectors or expression vectors) may contain the specified polynucleotide. A host cell 22 034742 containing said polynucleotide or said vector includes (for example, is transformed with said vectors): (1) a vector comprising a polynucleotide that encodes an amino acid sequence containing a VL antibody and an amino acid sequence containing a VH antibody ( for example, a polycistronic vector), or (2) a first vector comprising a polynucleotide that encodes an amino acid sequence containing a VL antibody, and a second vector comprising a polynucleotide that iruet amino acid sequence comprising an antibody VH. It can be a eukaryotic cell, first of all, a mammalian cell, for example, a Chinese hamster ovary (CHO) cell, a hamster baby kidney (KNK) cell, or a lymphoid cell (for example, a Y0, NS0, Sp20 cell). The method for producing an anti-FAP antibody involves culturing a host cell containing a polynucleotide that encodes the antibody under conditions suitable for expression of the antibody, and optionally isolating the antibody from the host cell (or culture medium of the host cell).

For recombinant production of an anti-FAP antibody, one or more polynucleotides (s) that encodes (s) the antibody, for example, described above, are isolated and inserted into one or more vectors for further cloning and / or expression in the host cell. Methods well known to those skilled in the art can be used to construct expression vectors containing the coding sequence of an anti-FAP antibody along with appropriate transcriptional / translational control signals. These methods include in vitro recombinant DNA techniques, synthesis techniques, and in vivo recombination / genetic recombination techniques (see, for example, techniques described by Maniatis et al., Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, NY, 1989; and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, NY, 1989).

One or more polynucleotides encoding an anti-FAP antibody can be expressed under the control of a constitutive promoter or, alternatively, in a regulated expression system. Suitable regulated expression systems include, but are not limited to, a tetracycline-regulated expression system, an ecdysone-induced expression system, a lac-regulated expression system, a glucocorticoid-induced expression system, a system including a temperature-induced promoter, and a metal-induced metallothionein expression system. If several different polynucleotides that encode the antibody enter the host cell system, some of them can be expressed under the control of the constitutive promoter, and others under the control of a regulated promoter.

Suitable host cells for cloning or expression of antibody-encoding vectors are prokaryotic or eukaryotic cells as described herein. For example, antibodies can be obtained in bacteria, in particular when glycosylation and Fc-related effector function are not required. Data regarding the expression of antibody fragments and polypeptides in bacteria are given, for example, in US Nos. 5648237, 5789199 and 5840523 (see also Charlton, Methods in Molecular Biology, ed. BKC Lo, published by Humana Press, Totowa, NJ, T. 248, 2003, cc. 245-254, description of the expression of antibody fragments in E. coli.) After expression, the antibody can be isolated from the paste of bacterial cells as a soluble fraction and can be further purified.

In addition to prokaryotic organisms, eukaryotic microorganisms such as filamentous fungi or yeast, including fungal and yeast strains whose glycosylation pathways were humanized, can be used as hosts for the cloning or expression of vectors that encode antibodies, which allows the production of an antibody with a partially or fully human pattern glycosylation (see Gerngross, Nat. Biotech. 22, 2004, cc. 1409-1414 and Li et al., Nat. Biotech. 24, 2006, cc. 210-215). These expression systems are also proposed in US patent application No. 60/344169 and WO 03/056914 (methods for producing resembling human glycoprotein in a non-human eukaryotic host cell).

Host cells that can be used to express a glycosylated antibody are also obtained from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells are insect cells, and plant cells can also be used. Numerous baculovirus strains and corresponding insect cells suitable for them as hosts have been identified, especially for transfection of Spodoptera frugiperda cells. Plant cell cultures can also be used as hosts (see, for example, US Nos. 5959177, 6040498, 6420548, 7125978 and 6417429 (description of PLANTIBODIES ™ technology for producing antibodies in transgenic plants).

Vertebrate cells can also be used as hosts. For example, mammalian cell lines that are adapted for growth in suspension can be used. Other examples of acceptable mammalian host cell lines are monkey monkey kidney cell line CV1 transformed with OB40 (C0S-7); a human embryonic kidney cell line (293 or 293 cell line subcloned for growth in suspension culture, Graham et al., J. Gen. Virol., 36, 1977, p. 59); Hamster Baby Kidney Cells (HSC); mouse Sertoli cells (TM4 cells described, for example, in Mather, Biol. Reprod., 23, 1980, cc. 243-251); monkey kidney cells (CV1); africa kidney cells

- 23 034742 Canary green monkey (VERO-76,); human cervical carcinoma cells (HELA); dog kidney cells (MDCK); bovine rat liver cells (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse breast tumor cells (MMT 060562); TRI cells described, for example, in Mather et al., Annals NY Acad. Sci., 383, 1982, cc. 44-68); MRC 5 cells and FS4 cells. Other valuable mammalian host cell lines are Chinese Hamster Ovary (CHO) cells, including DHFR ^- CHO cells (Urlaub et al., Proc. Natl. Acad. Sci. USA, 77, 1980, p. 4216); and myeloma cell lines such as Y0, NS0, and Sp2 / 0. For a review of specific mammalian host cell lines that can be used to produce antibodies, see, for example, Yazaki and Wu, in: Methods in Molecular Biology, ed. BKC Lo, Humana Press, Totowa, NJ, T. 248, 2003, cc. 255-268.

Stable expression, as a rule, is more preferable than short-term expression, since with its help, as a rule, more reproducible results are obtained, and also it is more suitable for large-scale production; however, the competence of a person skilled in the art is to decide when short-term expression is more suitable for a particular situation.

A method for modifying the glycosylation profile of anti-FAP antibodies that are produced by the host cell, as a rule, is to express in the host cell one or more polynucleotides (s) encoding their anti-FAP antibody and one or more polynucleotides encoding (their ) a polypeptide that has glycosyltransferase activity, or a vector containing these polynucleotides. Typically, any type of cultured cell line, including the cell lines described above, can be used to create cell lines for the production of anti-FAP antibodies with a modified glycosylation pattern. Preferred cell lines are CHO cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells and other mammalian cells. Polypeptides with glycosyl transferase activity include (1,4) -H-acetylglucosaminyl transferase III (GnTII), α-mannosidase II (ManII), (1,4) -galactosyltransferase (GalT), and (1,2) -L-acetylglucosaminyl transferase I (GnTI) and in (1,2) -L-acetylglucosaminyl transferase II (GnTII). In the host cell, a combination of polynucleotides encoding glycosyltransferase activity (e.g., GnTIII and Man II) or one or more polynucleotides (s) that encode (s) an anti-FAP antibody in which the glycosyltransferase gene is destroyed or otherwise can be expressed deactivated (for example, in a host cell in which the activity of the gene encoding core α1-6 fucosyl transferase is turned off). Antibodies to FAP can be obtained in a host cell, in which expression of a polynucleotide encoding a polypeptide having GnTIII activity also occurs in order to modify the glycosylation pattern of these antibodies. A polypeptide having GnTIII activity is typically a fusion polypeptide that contains a localization domain in the Golgi complex of a heterologous polypeptide present in the Golgi complex. Expression of the anti-FAP antibody can be carried out in a host cell in which the expression of a polynucleotide encoding a polypeptide having GnTIII activity occurs, which leads to the formation of anti-FAP antibodies that have increased binding affinity for the Fc receptor and / or increased effector function. So, the host cell may contain (a) one or more isolated polynucleotide (s) containing (s) a sequence that encodes a polypeptide having GnTIII activity; and (b) one or more isolated polynucleotide (s) that (s) encode (s) an anti-FAP antibody. Moreover, a polypeptide having GnTIII activity may be a fusion polypeptide that contains a GnTIII catalytic domain and a localization domain in the Golgi complex of the polypeptide present in the Golgi complex. Preferably, the localization domain in the Golgi complex is a localization domain in the Golgi complex of mannosidase II. Methods for creating these fusion polypeptides and their use for producing antibodies with enhanced effector functions are described in WO 2004/065540, in provisional application for US patent No. 60/495142 and in published patent application US 2004/0241817, the full contents of which are included in the present description as a reference. The host cell may further comprise an isolated polynucleotide containing a sequence that encodes a polypeptide having mannosidase II (MAP) activity.

Polynucleotide (s) encoding the polypeptide (s), such as polynucleotide (s) encoding the anti-FAP antibody, can be expressed under the control of a constitutive promoter or, alternatively, in a regulated expression system. These systems are well known in the art and include the systems described above.

Host cells that contain the coding sequence of an anti-FAP antibody and / or the coding sequence of polypeptides having glycosyltransferase activity and which express biologically active gene products can be determined, for example, by DNA-DNA or DNA-RNA hybridization; by the presence or absence of the functions of certain marker genes; by assessing the level of transcription, as measured by expression of the corresponding mRNA transcripts in the host cell; or by identifying a gene product using an immunoassay

- 24,034,742 per or according to its biological activity - i.e. methods well known in the art. The activity of GnTIII or Man II can be determined, for example, by using a lectin that binds to the biosynthesis products of GnTIII or ManII, respectively. An example of said lectin is E ₄ -PHA lectin, which binds preferentially to oligosaccharides containing bisected GlcNAc. Biosynthesis products (i.e., specific oligosaccharide structures) of polypeptides with GnTIII or ManII activity can also be detected by mass spectrometric analysis of oligosaccharides released from glycoproteins that are produced by cells expressing these polypeptides. Alternatively, a functional assay can be used that measures the increased ability to bind to the Fc receptor or the increased effector function mediated by antibodies produced by cells created using a polynucleotide that encodes a polypeptide having GnTIII activity.

A method for producing an anti-FAP antibody that has modified oligosaccharides is that (a) cultivating a host cell designed to express at least one polynucleotide that encodes a polypeptide having glycosyl transferase activity under conditions that provide for obtaining an anti-FAP antibody wherein said polypeptide having glycosyl transferase activity is expressed in an amount sufficient to modify the oligosaccharides in the Fc region of said anti-FAP antibody produced by said host cell; and (b) an anti-FAP antibody is isolated. A polypeptide having glycosyltransferase activity is GnTIII. The presence of two polypeptides with glycosyltransferase activity is possible. Two peptides having glycosyltransferase activity are GnTIII and ManII. A polypeptide having glycosyl transferase activity may be a fusion polypeptide that contains a GnTIII catalytic domain. A fusion polypeptide may further comprise a localization domain in the Golgi complex of the polypeptide present in the Golgi complex. In particular, the localization domain in the Golgi complex is the localization domain of mannosidase II or GnTI, most preferably the localization domain of mannosidase II. Alternatively, the localization domain in the Golgi complex is selected from the group consisting of: the mannosidase I localization domain, the GnTII localization domain, and the core localization domain of α1-6 fucosyl transferase.

A modified anti-FAP antibody produced by a host cell or prepared using the method described above may comprise an IgG constant region or fragment thereof containing an Fc region, or be a humanized or human antibody or a fragment thereof containing an Fc region.

An anti-FAP antibody with a modified glycosylation pattern produced by the host cell or obtained using the method described above is typically characterized by increased binding affinity of the Fc receptor and / or increased effector function as a result of cell host modification (e.g., expression of the glycosyltransferase gene) . Preferably, the increased binding affinity of the Fc receptor is increased binding to an activating Fc receptor, most preferably to an FcyRIIIa receptor. Increased effector function is preferably an increase in one or more of the following functions: increased antibody-mediated cell-dependent cytotoxicity, increased antibody-mediated cell-dependent phagocytosis (ADCP), increased secretion of cytokines, increased immune complex mediated antigen uptake by antigen-presenting cells, increased NK binding, increased binding to NK with macrophages, increased binding to polymorphonuclear cells (PMNC), increased binding ue to monocytes, increased crosslinking of target-related antibodies, increased direct signaling inducing apoptosis, increased dendritic cell maturation, and increased T cell priming.

B. Assays

Antibodies to FAP can be identified, screened, or their physical / chemical properties and / or types of biological activity characterized by various assays known in the art.

1. Binding Assays and Other Assays

An antibody can be tested for its antigen binding activity, for example, using known methods such as ELISA, Western blotting, etc.

Competitive format assays can also be used to identify an antibody that competes with another specific anti-FAP antibody for binding to FAP. Such a competing antibody binds to the same epitope (e.g., a linear or conformational epitope) to which another specific anti-FAP antibody binds. A detailed description of examples of epitope mapping techniques that an antibody binds to is provided by Morris, Epitope Mapping Protocols, in: Methods in Molecular Biology, Humana Press, Totowa, NJ, T. 66, 1996.

For example, when performing competitive analysis, the immobilized FAP incubi

- 25,034,742 were tested in a solution containing the first labeled antibody that binds to FAP (for example, the 3F2 antibody described in the examples) and the second unlabeled antibody, which assesses the ability to compete with the first antibody for binding to FAP. A second antibody may be present in the hybrid supernatant. As a control, immobilized FAPs are incubated in a solution containing the first labeled antibody but not containing the second unlabeled antibody. After incubation under conditions ensuring the binding of the first antibody to FAP, the excess of unbound antibody is removed and the amount of label associated with immobilized FAP is measured. If the amount of label associated with immobilized FAP is significantly reduced in the test sample compared to the control sample, this indicates that the second antibody competes with the first antibody for binding to FAP (see Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, chap. 14, 1988).

2. Activity assays

These assay methods are designed to identify anti-FAP antibodies with biological activity. Biological activity may be, for example, lysis of target cells, antibody-mediated cell-dependent cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), or induction of apoptosis.

The antibody is tested for the indicated biological activity. Examples of assays designed to test ADCC are described above (see, for example, the section Definitions: Antibodies with Increased ADCC) and Example 11. Assays designed to evaluate cell lysis (for example, based on an assessment of LDH release) or apoptosis (for example using TUNEL analysis) are well known in the art. Assays intended for measuring ADCC or CDC are also described in WO 2004/065540 (see Example 1 in said application), the entire contents of which are incorporated herein by reference.

D. Antibody Conjugates

Conjugates comprise an anti-FAP antibody conjugated to one or more cytotoxic agents, such as chemotherapeutic or medicinal products, growth inhibitors, toxins (e.g., protein toxins with enzymatic activity, toxins of bacteria, fungi, plants or animals or fragments thereof) or radioactive isotopes.

In an antibody-drug conjugate (ADC), an antibody is conjugated to one or more drugs, including but not limited to maytansinoid (see US Patent Nos. 5208020, 5416064 and European Patent EP 0425235 B1); auristatin, such as a drug based on monomethylauristatin with fragments DE and DF (MMAE (maleimidocaproyl monomethylauristatin E) and MMAF (monomethylauristatin F)) (see US No. 5635483, 5780588 and 7498298); dolastatin; calicheamicin or its derivatives (see US No. 5712374, 5714586, 5739116, 5767285, 5770701, 5770710, 5773001 and 5877296; Hinman et al., Cancer Res. 53, 1993, cc. 3336-3342; and Lode et al., Cancer Res. 58, 1998, cc. 2925-2928); anthracycline, such as daunomycin or doxorubicin (see 1 <ha1x et al., Current Med. Chem. 13, 2006, cc. 477-523; Jeffrey et al., Bioorganic & Med. Chem. Letters 16, 2006, cc. 358-362; Torgov et al., Bioconj. Chem. 16, 2005, cc. 717-721; Nagy et al., Proc. Natl. Acad. Sci. USA 97, 2000, cc. 829-834; Dubowchik et al. ., Bioorg. & Med. Chem. Letters 12, 2002, cc. 1529-1532; King et al., J. Med. Chem. 45, 2002, cc. 4336-4343 and US No. 6630579); methotrexate; vindesine; taxane, such as docetaxel, paclitaxel, larotaxel, tesetaxel and ortataxel; Trichothecene and CC1065.

An antibody conjugate may comprise an antibody conjugated to an enzymatic toxin or fragment thereof, including, but not limited to, diphtheria toxin chain A, non-binding active fragments of diphtheria toxin, exotoxin chain A (from Pseudomonas aeruginosa), ricin chain A, chain A abrine, modetscin chain A, alpha-sarcinol, Aleurites fordii proteins, diantin proteins, Phytolaca americana proteins (PAPI, PAPII and PAP-S), an inhibitor from Momordica charantia, curcin, crotin, an inhibitor from Sapaonaria officinalis, gelonin, mitogelin, mitogelin , phenomycin, enomycin and trick tetseny.

It is possible that the conjugate of the antibody contains an antibody conjugated to a radioactive atom to form a radioconjugate. A wide variety of radioactive isotopes can be used to produce radio conjugates. Examples thereof are At ²¹¹ , I ¹³¹ , I ¹²⁵ , Y ⁹⁰ , Re ¹⁸ , Re ¹⁸ , Sm ¹⁵ , Bi ²¹² , P ³² , Pb ²¹² and the radioactive isotopes Lu. When a radioconjugate is used for detection purposes, it may contain a radioactive atom for scintigraphic studies, such as tc99m or I123, or a spin tag for imaging by nuclear magnetic resonance (NMR) (also called magnetic resonance imaging, MRI), for example, iodine -123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.

Conjugates comprising an antibody and a cytotoxic agent can be created using a variety of bifunctional protein binding agents, such as No. succinimidyl-3- (2pyridyldithiol) propionate (SPDP), No. succinimidyl-4- (No. maleimidomethyl) cyclogensan-1-carboxylate (SMCC) ), iminothiolan (IT), bifunctional derivatives of imido esters (such as dimethyl adipimidate-HCl), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bisazido compounds (such as bis (para-azido-benzenoyl) d

26,034,742 bisdiazonium (such as bis (para-diazoniumbenzoyl) ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate) and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxin can be prepared according to the method described by Vitetta et al., Science, 238, 1987, p. 1098. labeling with C ^{14 January-isothiocyanatobenzyl-3-methyldiethylene} triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody (see. WO 94/11026). The linker may be a cleavable liquor that facilitates the release of a cytotoxic drug in the cell. For example, an acid-unstable linker, a peptidase-sensitive linker, a photolabile linker, a dimethyl linker or a disulfide-containing linker can be used (Chari et al., Cancer Res. 52, 1992, cc. 127-131; US No. 5208020).

Antibody conjugates are primarily (but not limited to) conjugates obtained using cross-linking agents, including (but not limited to) BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA , SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC and sulfo-SMPB, and SVSB (succinimidyl- (4-vinylsulfone) benzoate), which come for sale (e.g., from Pierce Biotechnology, Inc., Rockford, Ill., USA).

D. Methods and compositions for diagnosis and detection

Any of the anti-FAP antibodies can be used to detect the presence of FAP in a biological sample. The concept of identification in the context of the present description provides a quantitative or qualitative definition. A biological sample is a cell or tissue, for example, cells or tissues from the brain, breast, colon, kidney, liver, lung, ovary, pancreas, prostate, skeletal muscle, skin, small intestine, stomach or uterus, including also cells or tissues of tumors of these organs.

A biological sample, optionally in combination with a control sample, is contacted with an anti-FAP antibody under conditions suitable for binding of the anti-FAP antibody to FAP, and complex formation between the anti-FAP antibody and FAP is detected. The method may be an in vitro or in vivo method. The anti-FAP antibody is also used to select individuals that can be treated with the FAP antibody, for example, if the FAP is a biomarker for patient selection.

Examples of disorders that can be diagnosed with an antibody of the invention are disorders associated with FAP expression, such as cancer and certain inflammatory conditions.

A method for diagnosing a disease in an individual, as a rule, consists in administering to the indicated individual in an effective amount a diagnostic agent, wherein the diagnostic agent contains an anti-FAP antibody and a label is an imaging agent, which makes it possible to identify a complex of diagnostic agent and FAP.

Antibodies to FAP can be labeled. Labels are, but are not limited to, labels or fragments that reveal directly (such as fluorescent, chromophore, electron-dense, chemiluminescent and radioactive labels), as well as fragments, such as enzymes or legends, that are detected indirectly, for example, through an enzymatic reaction or molecular interaction. Examples of labels are (but not limited to) the radioisotopes P, C, I, H and I, fluorophores such as rare earth metal chelates or fluorescein and its derivatives, rhodamine and its derivatives, dansil, umbelliferone, luciferase, for example firefly luciferase and bacterial luciferase (US No. 4,737,456), luciferin, 2,3-dihydrophthalazinediones, horseradish peroxidase (HRP), alkaline phosphatase, β-galactosidase, glucoamylase, lysozyme, saccharin oxidase, for example, glucose oxidase, glucose oxidase, and 6-glucose oxidase compounds such as urekase and xanthine oxidase, enzyme complexes that use hydrogen peroxide to oxidize a dye precursor, such as HRP, lactoperoxidase or microperoxidase, biotin / avidin, spinmetics, bacteriophages as labels, stable free radicals, etc. P.

E. Pharmaceutical Compositions

Pharmaceutical compositions of an anti-FAP antibody are prepared by mixing an antibody of the required purity with one or more optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences, ed. A. Osol, 1980) in the form of lyophilized compositions or aqueous solutions. Pharmaceutically acceptable carriers are generally non-toxic to recipients at the dosages and concentrations used, they include, but are not limited to, buffers such as phosphate, citrate, acetate buffers, as well as buffers based on other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol; butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol and meta) low molecular weight polypeptides (containing less than about 10 residues); proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers

- 27 034742 ry, such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates, including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt forming counterions, such as sodium; metal-containing complexes (for example, Zn-protein complexes); and / or nonionic surfactants such as polyethylene glycol (PEG).

In the context of the present description, pharmaceutically acceptable carriers also include dispersing agents of interstitial drugs, such as soluble neutral active glycoproteins of hyaluronidases (sHASEGP), for example, human soluble glycoproteins of hyaluronidases PH-20, such as rHuPH20, Inc. of BYLENEX International, Inc. .). Some examples of sHASEGP and methods for their use, including rHuPH20, are described in US Patent Publications Nos. 2005/0260186 and 2006/0104968. sHASEGP can be combined with one or more additional glycosaminoglycanases, such as chondroitinases.

Examples of lyophilized antibody compositions are described in US No. 6267958. Aqueous antibody compositions include those described in US No. 6171586 and WO 2006/044908, the latter compositions include histidine acetate buffer.

The composition may also contain more than one active substance, if necessary for a particular indication to be treated, preferably substances with additional types of activity that do not adversely affect each other. For example, if the disease to be treated is cancer, then it may be desirable to additionally use one or more anti-cancer agents, for example, a chemotherapeutic agent, a tumor cell proliferation inhibitor, or a cancer cell apoptosis activator. Such active substances must be present in combination in amounts effective to solve the problem.

The active substances can also be included in microcapsules, for example, obtained using coacervation or interfacial polymerization methods, for example, hydroxypropylmethyl cellulose or gelatin microcapsules and poly (methyl methacrylate) microcapsules, respectively, in colloidal drug administration systems (for example, in liposomes, albumin microspheres, microspheres, and nanocapsules) or in a macroemulsion. Such methods are described in Remington's Pharmaceutical Sciences, ed. A. Osol, 1980.

Slow release formulations may be prepared. Suitable examples of sustained release formulations are semipermeable matrices of solid hydrophobic polymers including an antibody, such matrices are articles of a particular shape, such as films or microcapsules.

Compositions intended for in vivo use must be sterile. This can easily be done by filtration through sterile filter membranes.

Antibodies provided herein can be formulated in various forms of drugs, including but not limited to liquid solutions or suspensions, tablets, pills, powders, suppositories, polymer microcapsules or microbubbles, liposomes and injectable or infused solutions. The preferred form depends on the route of administration and therapeutic use, but, as a rule, they are solutions that can be administered by injection or infusion.

G. Methods and compositions for therapeutic use

Any anti-FAP antibodies or pharmaceutical compositions containing anti-FAP antibodies can be used in therapeutic methods.

Antibodies to FAP can be used to treat diseases characterized by FAP expression, especially abnormal expression (e.g., overexpression or another expression pattern in the cell) of FAP compared to healthy tissue from cells of the same type. Abnormal expression of FAP (e.g., overexpression) is characteristic of many human tumors compared to non-tumor tissue from cells of the same type. Thus, antibodies to FAP can be used to prevent the formation of tumors, kill tumors and inhibit the growth of tumors or metastases. FAP antibodies can be used to treat any tumor expressing FAP. Particular malignant diseases that can be treated with the anti-FAP antibodies described herein are, for example, lung cancer, colon cancer, stomach cancer, breast cancer, head and neck cancer, skin cancer, liver cancer, kidney cancer, prostate cancer, pancreatic cancer, brain cancer, skeletal muscle cancer.

FAP antibodies can be used to inhibit tumor growth or kill tumor cells. For example, anti-FAP antibodies can bind to a FAP that resides on the membrane or cell surface of cancer cells (tumor cells or tumor stromal cells) and cause, for example, ADCC or other effector-mediated cancer cell killing.

Alternatively, antibodies to FAP can be used to block the function of FAP, primarily by physically interfering with its binding to another compound. For example, antigen-binding molecules can be used to block FAP enzymatic activity (for example, serine peptidase, gelatinase, collagenase activity), FAP mediated cleavage of extracellular matrix (ECM) components and / or FAP mediated cell invasion or migration.

Antibodies to FAP can be used in a method of treating an individual suffering from a disease characterized by the expression of FAP, which consists in administering to the individual an effective amount of an anti-FAP antibody. The individual may also be administered in an effective amount of at least one additional therapeutic agent, for example, described below. The anti-FAP antibody can be used to induce cell lysis, i.e. in a method for inducing cell lysis in an individual, which comprises administering to the individual an effective amount of an anti-FAP antibody to induce cell lysis. The individual in the context of the invention is preferably a human. A disease characterized by FAP expression in the context of this invention is preferably cancer, most preferably cancer selected from the group consisting of lung cancer, colon cancer, stomach cancer, breast cancer, head and neck cancer, skin cancer, liver cancer, cancer kidneys, prostate cancer, pancreatic cancer, brain cancer, skeletal muscle cancer. A cell is preferably a cell present in a tumor, for example a tumor cell or a tumor stromal cell, most preferably a tumor cell. Expression of the FAP is preferably an abnormal expression, for example, overexpression or another expression pattern in the cell, compared with healthy tissue from cells of the same type.

Antibodies to FAP are used for the manufacture or preparation of a medicament. This drug is intended for the treatment of a disease characterized by FAP expression, or for use in a method of treating a disease characterized by FAP expression, which consists in administering to a person who suffers a disease characterized by FAP expression a drug in an effective amount. The method also consists in administering to the individual in an effective amount at least one additional therapeutic agent, for example, described below. This medicament is intended for inducing cell lysis or for use in a method for inducing cell lysis in an individual, which comprises administering to the individual an effective amount of an anti-FAP antibody to induce cell lysis. The individual is preferably a human. The disease characterized by FAP expression is preferably cancer, most preferably cancer selected from the group consisting of lung cancer, colon cancer, stomach cancer, breast cancer, head and neck cancer, skin cancer, liver cancer, kidney cancer, prostate cancer , pancreatic cancer, brain cancer, skeletal muscle cancer. A cell is preferably a cell present in a tumor, for example a tumor cell or a tumor stromal cell, most preferably a tumor cell. Expression of the FAP is preferably an abnormal expression, for example, overexpression or another expression pattern in a cell, compared to healthy tissue from cells of the same type.

A method of treating a disease characterized by FAP expression is that an effective amount of an anti-FAP antibody is administered to an individual who suffers from said disease characterized by FAP expression. It also lies in the fact that the individual is additionally administered in an effective amount of at least one therapeutic agent, for example, described below. A method of inducing cell lysis in an individual is that an anti-FAP antibody is administered to the individual in an effective amount to induce cell lysis. An individual may be a person. The disease characterized by FAP expression is preferably cancer, most preferably cancer selected from the group consisting of lung cancer, colon cancer, stomach cancer, breast cancer, head and neck cancer, skin cancer, liver cancer, kidney cancer, prostate cancer , pancreatic cancer, brain cancer, skeletal muscle cancer. A cell is preferably a cell present in a tumor, for example a tumor cell or a tumor stromal cell, most preferably a tumor cell. FAP expression is abnormal expression, for example, overexpression or another expression pattern in a cell, compared with healthy tissue from cells of the same type.

Pharmaceutical compositions containing an anti-FAP antibody are used in any of the above therapeutic methods. It contains any of the antibodies to FAP, and one or more pharmaceutically acceptable carriers. It may also contain any of the anti-FAP antibodies and at least one additional therapeutic agent, for example, described below.

Antibodies for treatment can be used either individually or in combination with other agents. For example, an antibody can be co-administered with at least one additional therapeutic agent. An additional therapeutic agent is an anticancer agent, for example, a chemotherapeutic agent, a tumor cell proliferation inhibitor, or an tumor cell apoptosis activator.

Such combination therapies indicated above provide for co-administration (when

- 29 034742 two or more therapeutic agents are included in the same or different compositions) and separate administration, in each case, the introduction of antibodies can be carried out before, simultaneously and / or after administration of an additional therapeutic agent or adjuvant. Antibodies can also be used in combination with radiation therapy.

An antibody (and any additional therapeutic agent) can be administered by any suitable route, including parenteral, intrapulmonary and intranasal and, if necessary, be used for topical treatment, administration to damage. Parenteral administration includes intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous administration. Intravenous administration is generally preferred. However, apparently, the intraperitoneal route should be most preferred, for example, in the treatment of colorectal tumors. Dosing can be carried out in any suitable way, for example, by injection, such as intravenous or subcutaneous injection, depending, inter alia, on whether the treatment is short-term or chronic. Various dosing regimens may be used, including (but not limited to) single or multiple administrations at various time points, bolus administration, and pulsating infusion.

Antibodies can be formulated, dosed and administered in accordance with good clinical practice. Factors contemplated in this context include the particular disease to be treated, the specific mammal to be treated, the clinical condition of the individual patient, the cause of the disease, the area of administration of the agent, method of administration, route of administration, and other factors known to medical practitioners. An antibody can, but is not required, be included in the composition in combination with one or more other agents that are currently used to treat the disease in question. An effective amount of these other agents depends on the amount of antibody present in the composition, the type of disorder or treatment, and other factors mentioned above. They are usually used in the same doses and using the same routes of administration as indicated in the present description, or in an amount of 1 to 99% of the dose indicated in the present description, or in any dose and with any a path that is empirically / clinically evaluated is appropriate.

To prevent or treat a disease, an acceptable dose of the antibody (when used individually or in combination with one or more other additional therapeutic agents) should depend on the type of disease to be treated, the type of antibody, the severity and course of the disease, whether the antibody is used for preventive or therapeutic goals, prior therapy, patient history and response to the antibody, as well as the prescription of the attending physician. An antibody can be administered to a patient once or as a series of treatments. Depending on the type and severity of the disease, from about 1 μg / kg to 15 mg / kg (e.g. 0.1-10 mg / kg), the antibody may be the initial possible dose for administration to a patient, for example, using one or more separate treatments or by continuous infusion. One example of typical daily doses may be from about 1 μg / kg to 100 mg / kg or more, depending on the above factors. When using repeated administrations for several days or a longer period of time, depending on the condition, treatment should usually be continued until the suppression of the symptoms of the disease is achieved. One example of an antibody dose is a dose of about 0.05 to about 10 mg / kg. Thus, one or more of the following doses may be administered to a patient: approximately 0.5, 2.0, 4.0 or 10 mg / kg (or any combination thereof). The indicated doses may be administered fractionally, for example, every week or every three weeks (for example, so that the patient receives from about two to about twenty, for example, about six doses of the antibody). You can apply the initial increased loading dose, followed by the introduction of one or more lower doses. However, other dosage regimens may be used. Using generally accepted methods and analyzes, it is easy to monitor the effects of this therapy.

Obviously, any of the above combinations or therapeutic methods can be used using an antibody conjugate instead of or in addition to an anti-FAP antibody.

3. Products

An article that contains products used to treat, prevent, and / or diagnose the aforementioned violations is a container and a label or package insert that is placed on or enclosed in the container. Suitable containers are, for example, cans, vials, syringes, bags for intravenous solution, etc. Containers can be made from various materials, such as glass or plastic. The container contains a composition that, alone or in combination with another composition, is effective for treating, preventing and / or diagnosing a condition, and may have a sterile access port (for example, the container may be an intravenous solution bag or vial equipped with a plug that can be punctured using a hypodermic needle). At least one active ingredient in the composition is an antibody. On the label or leaflet in the package indicates that the composition is used to treat the selected condition. In addition, the product may include (a) a first container with a composition in it, where the composition

- 30,034,742 contains an antibody; and (b) a second container with a composition therein, wherein the composition comprises an additional cytotoxic or other therapeutic agent. According to this, the product may contain a leaflet in the package, which contains information that the composition can be used to treat a particular condition. In an alternative or additional embodiment, the product may further include a second (or third) container with a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BSVI), phosphate buffered saline, Ringer's solution, and dextrose solution. In addition, it may include other products necessary from a commercial point of view and from a consumer point of view, in particular other buffers, diluents, filters, needles and syringes.

As should be apparent, any of the above products may include an antibody conjugate in place of or in addition to an anti-FAP antibody.

III. Examples

The following are examples of methods and compositions of the invention. As should be apparent, various other embodiments of the invention may be practiced in light of the foregoing description of the invention as a whole.

Example 1. Recombinant DNA Methods

For DNA manipulations, standard methods described by Sambrook J. et al., Molecular cloning: A laboratory manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. Molecular biology reagents were used according to manufacturers instructions. DNA sequences were determined by sequencing two strands. In some cases, the required gene segments were created at Geneart AG (Regensburg, Germany) from synthetic oligonucleotides and PCR products through automatic gene synthesis. Gene segments flanked by single sites recognized by restrictase enzymes were cloned into pGA18 (ampR) plasmids. Plasmid DNA was purified from transformed bacteria and the concentration was determined using UV spectroscopy. The DNA sequence of the subcloned gene fragments was confirmed by DNA sequencing. Gene segments were created with the desired restriction sites, allowing subcloning them in the corresponding expression vectors.

For general information regarding the nucleotide sequences of the light and heavy chains of human immunoglobulins, see: Kabat E.A. et al., Sequences of Proteins of Immunological Interest, 5th ed., NIH publ. publication No. 91-3242, 1991. For expression, all constructs were designated starting from the 5'-terminal DNA sequence encoding a leader peptide, which gives proteins the ability to secrete in eukaryotic cells. SEQ ID NO: 323-331 provides examples of leader peptides and polynucleotide sequences encoding them.

Obtaining (created using glycoengineering) antibodies

The DNA sequences of the heavy and light chains of a full-length antibody were obtained by subcloning the variable regions in the reading frame either with the constant region of the heavy chain or the constant region of the light chain previously integrated into the corresponding mammalian expression vector (recipient vector). Expression was controlled by the MPSV promoter, and the vector carried a synthetic poly-A-tail signal sequence at the 3'-end of the CDS. In addition, each vector contained the OriP sequence of EBV.

Antibodies were obtained by cotransfection of HEK293-EBNA cells with mammalian expression vectors for expression of antibodies using calcium phosphate-mediated transfection. HEK293-EBNA cells at the exponential growth phase were transfected using a method using calcium phosphate. In another embodiment, HEK293 cells grown as a suspension culture were transfected with polyethyleneimine (PEI). To obtain an unmodified, non-glycoengineered antibody, cells were transfected with only 1: 1 antibody heavy and light chain expression vectors.

To obtain glycoengineered antibodies, the cells were co-transfected with two additional plasmids, one of which is intended for expression of a fusion polypeptide having GnTIII activity (GnT-III expression vector), and the second is for expression of mannosidase II (Golgi complex expression vector mannosidase II) in a ratio of 4: 4: 1: 1, respectively. Cells were grown as attached monolayer cultures in T-flasks using DMEM culture medium supplemented with 10% FCS and transfected with a confluency of 50 to 80%. For transfection, 24 hours before transfection, 15 million cells were seeded in 25 ml of FCEM supplemented DMEM culture medium (final concentration of 10 vol%) in a T150 flask, and the cells were kept at 37 ° C overnight in an incubator in a 5% atmosphere CO ₂ . For transfection of each T150 flask, a solution containing DNA, CaCl ₂ and water was prepared by mixing 94 μg of the total plasmid DNA of a vector taken equally from light and heavy chain expression vectors, water to a final volume of 469 μl and 469 μl of a solution of 1M CaCl ₂ . To this solution was added a solution containing 938 μl of 50 mM HEPES, 280 mM NaCl, 1.5 mM Na ₂ HPO ₄ , pH 7.05, immediately stirred for 10 s and allowed to stand at room temperature for 20 s. The suspension was diluted with 10 ml of medium.

- 31 034742

DMEM supplemented with 2% FCS and added to the T150 flask instead of the medium present. Then an additional 13 ml of transfection medium was added. Cells were incubated at 37 ° C, 5% CO ₂ for about 17-20 hours, then the medium was replaced with 25 ml of DMEM, 10% FCS. The conditioned medium was collected approximately 7 days after changing the medium by centrifugation for 15 minutes at 210xg, the solution was sterilized by filtration (0.22 μm filter) and sodium azide was added at a final concentration of 0.01% (w / v) and kept at 4 ° C.

Wild-type or afucosylated secreted antibodies created by glycoengineering were purified from cell culture supernatants by protein A affinity chromatography (HiTrap ProtA, GE Healthcare). In general, the method was as follows: the column was equilibrated with 20 mM sodium phosphate, 20 mM sodium citrate, pH 7.5, the supernatant of the cells was added, then the first washing was carried out using 20 mM sodium phosphate, 20 mM sodium citrate, pH 7.5 and the second washing using 13.3 mM sodium phosphate, 20 mM sodium citrate, 500 mM sodium chloride pH 5.45. Antibodies were eluted with 20 mM sodium citrate, 100 mM sodium chloride, 100 mM glycine, pH 3. In the next gel filtration step on a HiLoad Superdex 200 column (GE Healthcare), the buffer was replaced with a solution containing 25 mM potassium phosphate, 125 mM sodium chloride, 100 mM glycine, pH 6.7, or alternatively onto a buffer containing 140 mM sodium chloride, 20 mM histidine, pH 6.0, and pure monomeric antibodies of the IgG1 type were collected. If necessary, between the two standard purification steps, an additional cation exchange chromatography step was carried out.

Protein concentration in purified protein samples was determined by measuring the optical density (OD) at 280 nm using a molar extinction coefficient calculated on the basis of the amino acid sequence. The purity and molecular weight of the antibodies were analyzed using SDS-PAGE in the presence and without a reducing agent (5 mM 1,4-dithiothreitol) and Coomassie staining (SimpleBlue ™ SafeStain from Invitrogen) was performed. The NuPAGE® Pre-Cast gel system (Invitrogen, USA) was used according to the manufacturer's instructions (4-20% Tris-glycine gels or 3-12% Bis-Tris). The content of aggregates in antibody samples was analyzed using a Superdex200 10 / 300GL gel filtration analytical column (GE Healthcare, Sweden) and 2mM MOPS, 150mM NaCl, 0.02% NaN ₃ , pH 7.3 mobile buffer at 7.3 ° C. The integrity of the amino acid framework of the reduced light and heavy chains of the antibody was confirmed by mass spectrometry using a nanoelectrospray (NanoElectrospray Q-TOF) after removal of N-glycans by treatment with peptide-N glycosidase F enzyme (Roche Molecular Biochemicals).

The results of the purification and analysis of wild type antibodies and glycoengineered human IgG antibodies of type 28H1, 29B11, 3F2 and 4G8 are shown in FIG. 15-22. The exit data is shown in the following table: _____________________________________________

Yield [mg / L] Wild type Created with glyco engineering 28H1 hu IgG 46 40 29B11 hu IgG 10 14 3F2 hu IgG 144 7 4G8 hu IgG 55 12.6

Oligosaccharides associated with the Fc region of antibodies were analyzed using the MALDI TOF-MC method described below. Oligosaccharides were released from antibodies by PNGase F enzyme digestion. The resulting digest solution containing the released oligosaccharides was either directly prepared for analysis using MALDI TOF-MC or further digested with EndoH glycosidase before preparing a sample for analysis using MALDI TOF-MC.

Analysis of glycostructure (created by glycoengineering) of antibodies To determine the relative ratios of fucose-containing and fucose-free (afukosilated) oligosaccharide structures, the released glycans of purified antibody samples were analyzed using MALDI-Tof mass spectrometry. An antibody sample (approximately 50 μg) was incubated overnight at 37 ° C with 5 honey. N-glycosidase F (QAbio; PNG-aza F: E-PNG01) in 2 mM Tris, pH 7.0 to release the oligosaccharide from the protein framework. For deamination of glycans, acetic acid was added to a final concentration of 150 mM and incubated for 1 h at 37 ° C. For analysis using MALDI TOF mass spectrometry, 2 μl of the sample was mixed on a MALDI target with 2 μl of a DHB matrix solution (2,5-dihydrobenzoic acid (Bruker Daltonics, No. 201346) dissolved in a mixture of 50% ethanol / 5 mM NaCl at 4 mg / ml) and analyzed using an Autoflex II MALDI TOF mass spectrometer (Bruker Daltonics). As a rule, in one experiment, 50-300 images were obtained and summarized. The spectra obtained were evaluated using a flex analysis program (Bruker Daltonics) and masses were determined for each peak detected. The peaks were then evaluated for fucose-containing and fucose-free (unfocused) structures by comparing the calculated masses and theoretically expected masses for the corresponding structures (for example, complex, hybrid 32343442 structures and oligomannous or high mannose structures, respectively, with fucose and without fucose )

To determine the relative content of hybrid structures, antibody samples were digested simultaneously with N-glycosidase F and endoglycosidase H (QAbio; EndoH: E-EH02). N-glycosidase F provides the release of all N-linked structures of glycans (complex, hybrid structures and oligomannous or high mannose structures) from the protein framework, and endoglycosidase H cleaves all hybrid types of glycans in addition between the two Nacetylglucosamine (GlcNAc) residues at the reducing end of the glycan. This cleavage product was then processed and analyzed using MALDI TOF mass spectrometry as described above to cleave the sample with N-glycosidase F. By comparing the scheme obtained by cleaving N-glycosidase F and cleaving with a combination of N-glycosidase F / Endo H, the level of signal reduction of a particular carbohydrate structure was used to determine the relative content of hybrid structures. The relative content of each carbohydrate structure was calculated from the ratio of the peak height of the individual structure and the sum of the peak heights of all detected oligosaccharides. The amount of fucose was determined as the percentage of fucose containing structures relative to all carbohydrate structures identified in the sample treated with N-glycosidase F (for example, complex, hybrid structures and oligomannose or high mannose structures, respectively). The number of non-fucosylated structures was determined as the percentage of structures in which fucose was absent relative to all carbohydrate structures identified in the sample treated with N-glycosidase F (for example, complex, hybrid structures and oligomannous or high mannose structures, respectively).

The levels of non-fucosylated structures of various wild-type antibodies and created by glycoengineering antibodies to FAP are presented in the following table: ________________

Unfucosylated structures [%]

Wild type

2,4

3.8

Antibody Hu IgG 28H1 Neither IgG 29B11 Neither IgG 3F2 (YS) nor IgG 4G8

Created with glycoengineering

Example 2. Construction of characteristic for a specific class of Fab libraries

Libraries characteristic of a specific class of antibodies in the Fab format were constructed on the basis of human germ line genes using the following V-region pairing variants: Vk3_20 light Kappa chain with VH3_23 heavy chain for library DP47-3 and Vk1_17 light Kappa chain with VH1_69 heavy chain for the DP88-3 library (see SEQ ID NO: 1 and 2).

Both libraries were randomized to light chain CDR3 (L3) and heavy chain CDR3 (H3) and assembled using 3 fragments per library using splicing using overlapping extension segments (SOE). Fragment 1 contained the 5 ′ end of the antibody gene, including randomized L3, fragment 2 was a central constant fragment extending from L3 to H3, and fragment 3 contained a randomized H3 and 3 ′ region of the antibody gene.

The following primer combinations were used to create fragments included in the library for the DP47-3 library: fragment 1 (LMB3-LibL1b_new), fragment 2 (MS63 - MS64), fragment 3 (Lib2Hfdseqlong) (see Table 3). The following primer combinations were used to create fragments included in the library for the DP88-3 library: fragment 1 (LMB3-RJH_LIB3), fragment 2 (RJH31-RJH32) and fragment 3 (LIB88_2 - fdseqlong) (see table 4).

Table 3

Primers used to create the DP47-3 library SEQ ID NO LMB3 CAGGAAACAGCTATGACCATGATTAC 332 Libllbnew CACTTTGGTCCCCTGGCCGAACGTMNNGGGMNNMNNMNNACC CTGCTGACAGTAATACACTGC 333 Ms63 TTTCGCACAGTAATATACGGCCGTGTCC 334 Ms64 ACGTTCGGCCAGGGGACCAAAGTGG 335 Lib2h GGCCGTATATTACTGTGCGAAANNKNNKNNKNNKNNKTTTGAC TACTGGGGCCAAGGAAC 336 fdseqlong GACGTTAGTAAATGAATTTTCTGTATGAGG 337

- 33,034,742

Table 4

Primers used to create the DP88-3 library SEQ ID NO Primers used to create the DP88-3 library SEQ ID NO 332 338 339 340 341 LMB3 RJHLIB3 RJH31 Rjh32 LIB882 CAGGAAACAGCTATGACCATGATTAC GACTTTGGTGCCCTGGCCAAACGT MNN GGG MNN MNN ACC MNN CTGCAAGCAGTAATAGGTGGCAAAATC ACGTTTGGCCAGGGCACCAAAGTCGAG TCTCGCACAGTAATACACGGCGGTGTCC GGACACCGCCGTGTATTACTGTGCGAGA - [(33% GAC Asp; 26% GGT Gly; 10% GAA Glu; 9% CGT Arg; 7% Lys; 6% GTT Val; 5% TCT Ser; 4 % CTG Leu) l - (23% GGT Gly; 17% TAC Tyr; 16% TCT Ser; 11% GCT Ala; 9% CGT Arg; 7% AAC Asn; 6% ACT Thr; 6% GTT Val; 5% CCGPro ) 8] TTTGACTACTGGGGCCAAGGGACCACCGTGACCGTCTCC fdseqlong GACGTTAGTAAATGAATTTTCTGTATGAGG 337

The PCR protocol for obtaining fragments included in the library included: initial denaturation for 5 min at 94 ° C; 25 cycles of 1 min at 94 ° C, 1 min at 58 ° C and 1 min at 72 ° C and final elongation for 10 min at 72 ° C. For PCR assembly, the equimolar ratios of the three fragments were used as a matrix. The PCR assembly protocol included initial denaturation for 3 min at 94 ° C and 5 cycles of 30 s at 94 ° C, 1 min at 58 ° C, and 2 min at 72 ° C. At this stage, primers complementary to the sequence located outside fragments 1-3 were added and an additional 20 cycles were performed before final extension for 10 minutes at 72 ° C.

After assembly to obtain sufficient amounts of full-sized randomized Fab constructs, Fab constructs were digested with NcoI / NotI in the case of the DP47-3 library and with NcoI / NheI in the case of the DP88-3 library along with a similarly processed acceptor phagemid vector. In the case of the DP47-3 library, 22.8 μg Fab libraries were ligated with 16.2 μg phagemid vector. In the case of the DP88-3 library, 30.6 μg of the Fab library was ligated with 30.6 μg of the phagemid vector.

The purified ligation mixtures were used to carry out 68 transformations using the DP47-3 library and 64 transformations using the DP88-3 library, respectively, to obtain final library sizes of 4.2x10 ¹⁰ DP47-3 and 3.3x10 ⁹ DP88-3.

The phagemid particles presenting the Fab libraries were released (rescued) and purified using PEG / NaCl for use in breeding.

Example 3. Selection of clones of antibodies to FAP (primary selection)

Selection was made for the ectodomain of a human or mouse fibroblast activation protein (FAP), which was cloned against the course of transcription relative to the polylysine and 6x3L tags (see SEQ ID NOs: 317 and 319). Prior to selection, antigens sensitized tubes for immunoassays (immuno-tubes) at a concentration of either 10 or 5 μg / ml, depending on the selection cycle. Selection was carried out according to the following protocol: (I) the binding of ~ 10 phagemid particles of the library DP47-3 with immobilized human or mouse FAP for 2 hours; (Ii) washing the immunotubes using 5x5 ml PBS / Tween 20 and 5x5 ml PBS; (III) elution of phage particles by adding 1 ml of 100 mM TEA (triethylamine) for 10 min and neutralizing by adding 500 μl of 1M Tris / HCl, pH 7.4; and (IV) re-infecting the is-log phase cells. coli of the TG1 line, infection with the VCSM13 helper phage and subsequent precipitation with the PEG / NaCl phagemid particles used in subsequent breeding cycles.

Selection was carried out using three or four cycles, using decreasing concentrations, using human FAP as antigen, and in some cases using murine FAP at a concentration of 5 μg / ml in the final selection cycle. Specific binding agents were determined by the presence of signals 5 times the background signal and identified by ELISA. NUNC Maxisorp plates sensitized 10 μg / ml human or mouse FAP, followed by addition of Fab fragments containing bacterial supernatants, and the specific binding of Fab fragments was determined by their Flag tags using an anti-Flag / HRP antibody as a secondary antibody.

ELISA-positive clones were expressed in bacteria as 1 ml cultures in 96-well format and supernatants were screened for kinetic characteristics using a BIACORE T100 device.

K _D values were evaluated by surface plasmon resonance using a BIACORE® T100 device (GE Healthcare) at 25 ° C. using a human specific F (ab ') 2 fragment of a capture antibody (Jackson ImmunoResearch, No. 109-005 -006), immobilized by amine coupling on CM5 chips, and subsequent capture of Fab fragments from the bacterial supernatant or from preparations of purified Fab fragments. In general, the method consisted of the following: carboxymethylated dextran biosensor chips (CM5, GE Healthcare) were activated using ^ ethyl-N- (3-dimethylaminopropyl)) carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. Spe

- 34 034742, a digital capture antibody for the human P (ab ') 2 fragment, was diluted with 10 mM sodium acetate, pH 5.0, to a concentration of 50 μg / ml before injection at a flow rate of 10 μl / min until approximately 10,000 response units were obtained (RU) a crosslinked capture antibody. After injection of the capture antibody, 1M ethanolamine was injected in order to block unreacted groups. For kinetic measurements, Fab fragments from the bacterial supernatant or purified Fab fragments were injected at a flow rate of 10 μl / min for 300 s and dissociation was carried out for 300 s to stabilize the background capture. Capture levels were in the range of 100-500 RU. In the next step, human or murine FAP, which is an analyte, diluted in HBS-EP + (GE Healthcare, 10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% P20 surfactant, pH 7.4) was injected either in one concentration, or as a series of concentrations (depending on the affinity of the clone in the range from 100 nM to 250 pM) at 25 ° C with a flow rate of 50 μl / min. The duration of the association reaction was 120 or 180 s, the duration of the dissociation reaction was 300-600 s. The surface of the sensor chip was regenerated by injection of glycine, pH 1.5 for 30 s at a flow rate of 90 μl / min and subsequent injection of NaOH for 20 with the same flow rate Association reaction rate (k _on ) and dissociation reaction rate (k _off ) calculated using a simple (1: 1) Langmuir binding model (BIACORE ® T100 Evaluation program or Scrubber program (BioLogic)) by simultaneously approximating the association and dissociation sensograms. The equilibrium constant of the dissociation rate (K _D ) was calculated as the ratio k _off / k _on .

Example 4. Construction of a library for the maturation of the affinity of antibodies to FAP

Three libraries for affinity maturation were constructed based on pre-selected antibodies obtained from primary FAP antibody selection. More specifically, they were created on the basis of (I) clone 2D9 anti-FAP antibody (amFAP2D9 library) (see SEQ ID NO: 229 and 231), (II) clone 4B8 anti-FAP antibody (amFAP4B8 library) (see SEQ ID NO : 233 and 235) and (III) cross-reactive clones 7A1, 13B2, 13C2, 13E8, 14C10 and 17A11 (amFAPpool library) (see SEQ ID NO: 237 and 239 corresponding to the variable region sequences of clone 7A1; SEQ ID NO : 241 and 243 corresponding to the variable region sequences of clone 13C2; SEQ ID NO: 245 and 247 corresponding to the variable region sequences of clone 13E8; SEQ ID NO: 249 and 251 corresponding to the sequence the variable regions of clone 14C10; and SEQ ID NOs: 253 and 255, corresponding to the sequences of the variable regions of clone 17A11).

Each of these libraries consisted of two sub-libraries in which either light chain CDR1 and CDR2 (L1 / L2) or heavy chain CDR1 and CDR2 (H1 / H2), respectively, were randomized. These sub-libraries were combined during the transformation. Each of these sub-libraries was constructed using the four subsequent stages of amplification and assembly.

For the L1 / b2 library, the amplification and assembly protocol included: (I) amplification of fragment 1 (LMB3-DPK22_CDR1_rand_ba_opt) and fragment 2 (DPK22_CDR1_fo - DPK22_Ck_BsiWI_ba); (II) the assembly of fragments 1 and 2 using external primers LMB3 and DPK22_Ck_BsiWI_ba to create a matrix for fragment 3; (III) amplification of fragment 3 (LMB3-DPK22_CDR2_rand_ba) and fragment 4 (DPK22_CDR2_fo-DPK22_Ck_BsiWI_ba); and (IV) the final assembly of fragments 3 and 4 using the same external primers as described above (see table 5 of the sequence of primers).

Table 5

Primers used in 1L / L2 libraries for affinity maturation SEQ ID NO creating anti1 affinity matured FAP gel LMB3 CAGGAAACAGCTATGACCATGATTAC 332 DPK22_CDRl_rand_ba_opt CAGGTTTCTGCTGGTACCAGGCTAAGTAGCTGCT GCTAACACTCTGACTGGCCCTGCAAG 342 DPK22 CDR1 fo TTAGCCTGGTACCAGCAGAAACCTG 343. DPK22 Ck BVWI ba GGTGCAGCCACCGTACGTTTGATTTCC 344 DPK22_CDR2_rand_ba CTGTCTGGGATGCCAGTGGCCCTGCTGGAGGCG CCATAGATGAGGAGCCTGGGAGCCTG 345 DPK22 CDR2 fo AGGGCCACTGGCATCCCAGACAG 346

Bold: 60% of the bases are the original bases, and 40% of the bases are randomized as a mixture of M

Emphasized: 60% of the bases are the starting bases, and 40% of the bases are randomized as a mixture of N

For W / W libraries, the amplification and assembly protocol included: (I) amplification of fragment 1 (RJH53 - DP47_CDR1_rand_ba_opt) and fragment 2 (DP47_CDR1_fo - MS52); (Ii) assembling fragments 1 and 2 using external primers RJH53 and MS52 to create a matrix for fragment 3; (III) amplification of fragment 3 (RJH53 - DP47_CDR2_rand_ba) and fragment 4 (DP47_CDR2_fo - MS52); and (IV) the final assembly of fragments 3 and 4 using the same external primers as described above (see table 6, the sequence of primers).

- 35 034742

Table 6

Primers used in H1 / H2 libraries for affinity maturation SEQ ID NO creating anti! affinity matured FAP gel Rjh53 CATCAGGGCCTGAGCTCGCCCGTCAC 347 DP47_CDRl_rand_ba_opt GAGCCTGGCGGACCCAGCTCATGGCATAACTGCT AAAGGTGAATCCGGAGGC 348 DP47 CDR1 fo ATGAGCTGGGTCCGCCAGGCTC 349 Ms52 GAAGACCGATGGGCCTTTGGTGCTAG 350 DP47_CDR2_rand_ba CCTTCACGGAGTCTGCGTAGTATGTGCTACCACC ACTACCACTAATAGCTGAGACCCACTCCAGCCCC TTSSS 351 DP47 CDR2 fo ACATACTACGCAGACTCCGTGAAGG 352

Bold: 60% of the bases are the original bases, and 40% of the bases are randomized as a mixture of M

Emphasized: 60% of the bases are the starting bases, and 40% of the bases are randomized as a mixture of N

The products obtained after the final assembly were digested with NcoI / BsiWI in the case of the L1 / b2 sub-libraries amFAP2D9 and amFAP4B8, with Muni and Nhel in the case of the I1 / II sub-libraries amFAP2D9 and amFAP4B8, as well as with NcoI / BamHI in in the case of the bF2 amFAPpool library and with BspEl / PstI in the case of the I1 / I2 amFAPpool libraries, respectively, along with acceptor vectors processed in a similar way, based on preparations of plasmids containing clones 2D9, 4B8 or an equimolar mixture of clones 7A1, 13B2, 13C2, 13E8, 14C10 and 17A11, respectively. In each case, the split randomized (partially) V regions and the split (s) acceptor vector (s) for the respective libraries (μg V region / μg vector) were ligated, taken in the amounts indicated below: amFAP2D9 Ш2 sub-library (5 , 7 / 21.5), amFAP2D9 I1 / I2 sub-library (4.1 / 15.5), amFAP4B8 L1 / b2-sub-library (6.5 / 24.5), amFAP4B8 I1 / I2 sub-library (5, 7 / 21.5), amFAPpool L1 / L2 sub-library (4.4 / 20), amFAPpool I1 / I2-sub-library (3.4 / 15.5).

The purified ligation sublibraries L1 / L2 and I1 / I2 were combined and used for 60 transformations using each of the three libraries for affinity maturation, obtaining the following final 9.9 library sizes: 6.2x10 in the case of amFAP2D9, 9.9x10 in the case of amFAP4B8 and 2.2x10 ⁹ in the case of amFAPpool.

The phagemid particles presenting these Fab libraries were released (rescued) and purified using PEG / NaCl for use in secondary breeding.

Construction of additional libraries for the maturation of the affinity of antibodies to FAP (based on clones 3F2. 3D9. 4G8. 4B3 and 2C6)

Created 4 additional libraries for affinity maturation based on pre-selected cross-reactive antibodies from the first group of antibodies with mature affinity for FAP, namely, clones 3F2, 3D9, 4G8, 4B3 and 2C6 (see SEQ ID NO: 195 and 197, which correspond to sequences of variable regions of clone 3F2; SEQ ID NO: 199 and 201, which correspond to sequences of variable regions of clone 3D9; SEQ ID NO: 205 and 207, which correspond to sequences of variable regions of clone 4G8; SEQ ID NO: 209 and 211, which correspond after the sequences of the variable regions of clone 4B3; SEQ ID NO: 217 and 219, which correspond to the sequences of the variable regions of clone 2C6). More specifically, the four libraries were based on 1) clones of antibodies to FAP 3F2, 4G8 and 4B3 (VH library with randomized CDRs 1 and 2 of the variable region of the heavy chain, i.e., I1 / I2 library), 2) clones of antibodies to FAP 3D9 and 2C6 (Hu library with randomized CDRs 1 and 2 of the variable region of the light chain, i.e. L1 / L2 library), 3) a clone of the anti-FAP antibody 3F2 ^ 3 library with weak randomization of CDR3 light chain, i.e. L3 library) and 4) an anti-FAP 3F2 antibody clone (I3 library with weak randomization of the heavy chain CDR3, i.e., I3 library). The first two libraries were designed exactly in accordance with the method described for the first group of antibodies to FAP with mature affinity, i.e. for L1 / L2- and I1 / I2 libraries, respectively. In contrast, for L3 and I3 libraries with mature affinity based on clone 3F2, two new primers were used for the introduction of weak randomization in L3 (AM_3F2_DPK22_L3_ba: CACTTTGGTCCCCTGGCCGAACGTCGGGGGGAAGCATAATACCCTGCTG% base 40% base mix. (a mixture of four nucleotides A, C, G and T)) and I3 (AM_3F2_DP47_I3_fo: GGCCGTATATTACTGTGCGAAAGGGTGGTTTGGTGGTTTTAACTACTGGGGGCCAAGGAAC, where 60% of the highlighted bases are the starting bases, and 40% of the bases are basic, e bases, and 40% of the bases are G, and from the underlined bases in italics, 60% of the bases are the indicated bases, and 40% of the bases are a mixture of K (a mixture of two nucleotides G and T) of the parent clone. Libraries had the following sizes: I1 / I2-library (1.13x 10 ¹⁰ ), L1 / L2-library (5.6x10), L3-library (2.3x10 ¹⁰ ) and I3-library (2.64x10 ¹⁰ ).

- 36,034,742

Example 5

Maturation of Antibody FAP Clones with Mature Affinity. Selection was performed for the ectodomain of a human or mouse fibroblast activation protein (FAP), which was cloned against the transcription relative to the polylysine and 6/1 tags (see SEQ ID NOs: 317 and 319). Prior to selection, antigens sensitized immunotubes at a concentration of either 10, 5, or 2 μg / ml, depending on the library and the selection cycle. The selection was carried out according to the following protocol: (I) the binding of ~ 10 ¹² phagemid particles of the amFAP2D9, amFAP4B8 or amFAPpool library with immobilized human or mouse FAP for 2 hours; (Ii) washing the immunotubes using 10-20 / 5 ml PBS / Tween 20 and 10-20 / 5 ml PBS (depending on the library and the selection cycle); (III) elution of phage particles by adding 1 ml of 100 mm TEA (triethylamine) for 10 min and neutralization by adding 500 μl of 1M Tris / HCl, pH 7.4; and (IV) re-infection of the log phase phase E. coli cells of the TG1 line, infection with the VCSM13 helper phage and subsequent precipitation of the phagemid particles by PEG / NaCl used in subsequent selection cycles.

Selection was carried out using two cycles and the conditions were regulated for each of the three libraries individually. In more detail, the selection parameters were as follows: amFAP2D9 (5 μg / ml human FAP and 20 washes in total for cycle 1, 1 μg / ml of human FAP and 30 washes in general for cycle 2), amFAP4B8 (1 μg / ml mouse FAP and 30 washes in total for cycle 1, 0.2 μg / ml of human FAP and 40 washes in general for cycle 2) and amFAPpool (5 μg / ml of human FAP and 30 washes in general for cycle 1.5 μg / ml mouse FAP and 30 washes in total for cycle 2). Specific binding agents were determined by the presence of signals 5 times the background signal and identified by ELISA. NUNC Maxisorp tablets sensitized 1 μg / ml or 0.2 μg / ml human or mouse FAP, followed by addition of Fab fragments containing bacterial supernatants, and specific binding of Fab fragments was determined by their Flag tags using Flag / HRP antibody as a secondary antibody .

ELISA-positive clones were expressed in bacteria as 1 ml cultures in 96-well format and supernatants were screened for kinetic characteristics using a BIACORE T100 device as described above (see Example 3).

Additional selection of clones of antibodies to FAP with mature affinity

Selection was made for the ectodomain of a human or mouse fibroblast activation protein (FAP), which was cloned against the transcription relative to the 6 / lysine and 6 / his tags (see SEQ ID NO: 317 and 319). Prior to selection, antigens sensitized immunotubes at a concentration of either 1, 0.2, or 0.02 μg / ml, depending on the library and the selection cycle. Selection and ELISA-based screening was performed according to the method described for the first group of antibodies to FAP with mature affinity. Secondary screening was performed using a ProteOn XPR36 biosensor (Biorad) and reaction rate constants and affinity were determined by analyzing Fab preparations with mature affinity using the same tool. K _D values were evaluated by surface plasmon resonance using a ProteOn XPR36 device (Biorad), at 25 ° C. using a human specific F (ab ') ₂ fragment of a capture antibody (Jackson ImmunoResearch, No. 109-005006), immobilized on GLM chips, and followed by capture of Fab fragments from the bacterial supernatant or from preparations of purified Fab fragments. In general, the method consisted of the following: biosensor GLM chips (Biorad company) were activated for 5 min using Nethyl-I '- (3-dimethylaminopropyl)) carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). A capture antibody specific for the human F (ab ') ₂ fragment was diluted with 10 mM sodium acetate, pH 5.0, to a concentration of 24 μg / ml before injection for 5 minutes to obtain up to about 10,000 units of a crosslinked capture response antibodies. After injection of the capture antibody, 1M ethanolamine was injected in order to block unreacted groups. For kinetic measurements, Fab fragments from the bacterial supernatant were injected at a flow rate of 30 μl / min for 100 s. Capture levels were within 250 RU. At the next stage, serial dilutions of human, mouse FAP or FAP cynomolgus monkeys were injected as an analyte (double dilution, the highest concentration of 25 nm), diluted in PBS / 0.005% Tween-20, at 25 ° C with a flow rate of 50 μl / min. The duration of the association reaction was 240 s, the duration of the dissociation reaction was 600-1800 s. The surface of the sensor chip was regenerated by injection of 0.85% H ₃ PO ₄ for 30 s at a flow rate of 100 μl / min, followed by injection of 50 mM NaOH for 30 at the same flow rate. The association reaction rate (k _on ) and the dissociation reaction rate (k _off ) were calculated using a simple (1: 1) Langmuir binding model (ProteOn manager program, version 2.1) by simultaneously approximating the association and dissociation sensograms. The equilibrium constant of the dissociation rate (K _D ) was calculated as the ratio k _off / k _on .

The following clones with matured affinity were identified: 19G1 (see SEQ ID NO: 257 and 259),

- 37 034742

20G8 (see SEQ ID NO: 281 and 263), 4B9 (see SEQ ID NO: 265 and 267), 5B8 (see SEQ ID NO: 269 and 271), 5F1 (see SEQ ID NO: 273 and 275 ), 14B3 (see SEQ ID NO: 277 and 279), 16F1 (see SEQ ID NO: 281 and 283), 16F8 (see SEQ ID NO: 285 and 287), O3C9 (see SEQ ID NO: 289 and 291), 22A3 (see SEQ ID NO: 301 and 303) and 29B11 (see SEQ ID NO: 305 and 307) (all these clones were selected from the W / W library and obtained from the parent clone 3F2), O2D7 ( see SEQ ID NO: 293 and 295) (selected from the E3 library, which is based on the parent clone 3F2) and 28H1 (see SEQ ID NO: 297 and 299) and 23C10 (see SEQ ID NO: 309 and 311 of Table 3) (these two clones were selected from the Sh / Sh library and obtained from the parent clone 4G8).

In FIG. Figures 1-5 show the sensograms obtained by the surface plasmon resonance method for selected Fab fragments with mature affinity that bind to immobilized FAP, and Table 7 shows the corresponding affinity values. The selected Fabs were characterized by affinity in a wide range from picomolar to nanomolar values and had cross-reactivity to the human (hu) and mouse (mu) FAP, as well as the FAP of the cynomolgus monkey (soup), according to the data obtained for the selected clones. For specificity analysis, mature affinity binding Fab fragments binding to FAP were converted to Fab-IL2-Fab format and IgG type antibodies. The presence of binding specificity was confirmed by the lack of binding to the DPPIV protein, a close FAP homolog, when expressed on HEK293 or CHO cells (see Example 9).

Table 7. Summary of data on kinetic equilibrium constants of reactions (K _D ) of antibodies to FAP with matured affinity in the form of Fab fragments (monovalent binding)

Antibody Affinity (ksch to hu FAP [PM] Affinity (KP to mu FAP [pM] Affinity (Ksch to soup FAP [PM] 19G1 76 2600 n.d. 20G8 69 2800 n.d. 4B9 157 3300 n.d. 5B8 690 3200 n.d. 5F1 243 4100 n.d. 14VZ 377 3800 n.d. 16F1 193 3400 n.d. 16F8 301 3800 n.d. OZS9 160 3700 n.d. O2d7 619 8300 n.d. 28H1 200 9 3600 22AZ 34 655 522 29B11 35 436 23 23C10 1600 125 990

Example 6. Conversion to IgG format of Fab fragments binding to FAP

Parent Fab fragments 3F2, 4G8 and 3D9 and Fab derivatives with mature affinity 3F2 and 4G8 were converted into human IgG1 format, mouse IgG2a format and human IgG1 format.

The DNA sequences of the heavy and light chains of full-length antibodies were obtained either by subcloning the variable regions in the reading frame with the corresponding constant region of the heavy chain and the constant region of the light chain, which were preliminarily inserted into various expression recipient vectors of mammals, or recombinantly by fusion of a short segment of the sequence homologous to the site embedding recipient vectors. Recombination was carried out in accordance with Invitrogen's In-Fusion Cloning System guidelines.

In all vectors, antibody expression was controlled by the MPSV promoter, and all vectors carried the synthetic poly-A-tail signal sequence at the 3'-end of the CDS. In addition, each vector contained the OriP sequence of EBV.

Example 7. Biacore analysis of antibodies to FAP type IgG

Then, the affinity of 3F2, 4G8, and 3D9 FAP-binding Fab fragments, as well as anti-FAP antibodies resulting from conversion to human IgG, was determined and compared with respect to human FAP, mice, and cynomolgus monkeys using surface plasmon resonance analysis ( SPR), which was carried out at 25 ° C using a BIACORE® T100 device (GE Healthcare). For this purpose, the extracellular domain of human, mouse, or monkey FAP cynomolgus (SEQ ID NO: 317-322) was captured using an immobilized anti-His antibody (Penta His, Qiagen, No. 34660), and the antibody was used as an analyte. To immobilize, carboxymethylated dextran biosensor chips (CM5, GE Healthcare) were activated using Noethyl-No- (3-dimethylaminopropyl)) carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. The Penta His antibody was diluted with 10 mM sodium acetate, pH 5.0, to a concentration of 40 μg / ml before injection at a flow rate of 10 μl / min until approximately 9,000 units of the cross-linked protein response were obtained. After ligand injection, 1M ethanolamine was injected in order to block unreacted groups.

For kinetic measurements, the extracellular domain of FAP in humans, mice, or monkeys was injected with cynomolgus at a rate of 10 μl / min at a concentration of 10 nM for 20 s (in the case of Fab fragments)

- 38,034742 or 20 nM for 25 s (in the case of IgG) and were captured through their His tag using an immobilized Penta His antibody. Serial dilutions of the antibody (two-fold dilutions of 6.25 to 200 nM in the case of Fab fragments or five-fold dilutions of 3.2 pM to 10 nM in the case of IgG) were injected into HBSEP + (GE Healthcare, 10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% surfactant P20, pH 7.4) at 25 ° C with a flow rate of 90 μl / min. The following parameters were used: association reaction duration 180 s, dissociation 300 s (in the case of Fab) or 900 s (in the case of IgG), 10 mM glycine regeneration, pH 2 for 60 s between each cycle. The association reaction rate (k _on ) and the dissociation reaction rate (k _off ) were calculated using a simple (1: 1) Langmuir binding model (BIACORE ® T100 program, version 1.1.1) by simultaneously approximating the association and dissociation sensograms (model parameters included local value of Rmax and RI = 0). The equilibrium constant of the dissociation rate (K _D ) was calculated as the ratio k _off / k _on .

Characteristic binding values of K _{D are} presented in table. 8. In FIG. 6A-E show the corresponding kinetic analysis results obtained by SPR for Fab fragments, FIG. 7A-E for IgG type antibodies.

Table 8. Summary of data on kinetic equilibrium constants of reactions (K _D ) of antibodies to FAP

3F2, 4G8 and 3D9 as Fab fragments and as IgG

Design Human fap Mouse fap Cyno fap IgG 3F2 Avidity: 39pM Avidity: 29pM Avidity: 42pM IgG 4G8 Avidity: 51pM Avidity: 1pM Avidity: 59pM IgG 3D9 Avidity: 93pM Avidity: 96pM Avidity: 96pM Fab Fragment 3F2 Affinity: 13nM Affinity: 14nM Affinity: PNM 4G8 Fab Affinity: 74nM Affinity: 7nM or less Affinity: 56nM 3D Fab Affinity: 133 pM Affinity: 32nM Affinity: 143nM

Example 8. The binding of antibodies to FAP 3F2, 4G8 and 3D9, studied on sections of tissue of human tumors

Experiments were performed to identify and compare FAP expression in freshly frozen tissues of human tumors (breast cancer tissue, colon adenocarcinoma and NSCLC) using antibody clones 3F2,4G8 and 3D9 in the form of mouse IgG2a.

One microarray of freshly frozen tissue (TMA) (AST 274) was used, which included samples of thirty different tumors, two spots for each, obtained from a Roche TRS Pathology & Tissue Biomarkers tumor bank. TMA included 10 invasive carcinomas of the ducts of the breast, 10 colorectal carcinomas, and 10 samples of non-small cell lung cancer obtained from Asterand Ltd, Royston, UK.

The following antibodies were used for immunohistochemical staining (IHC): monoclonal mouse antibody to human FAP, clone 3F2 (15.8 ng / ml, diluted in a diluent for antibodies from Ventana), monoclonal mouse antibody to human FAP, clone 4G8 (1000 ng / ml diluted in a diluent for antibodies from Ventana) and a monoclonal mouse antibody to human FAP, clone 3D9 (1000 ng / ml, diluted in a diluent for antibodies from Ventana). Polyclonal murine IgG2a, a concentration of 100 μg / ml (supplier: DAKO, X0943, lot No. 00058066) was used to control the isotype.

Staining was performed according to standard protocols on a Ventana Benchmark XT device using the Ventana Ultra-View Detection Kit with an HRP detection system (containing the HRP (Universal HRP Multimer) and DAB for staining). Contrast staining was carried out using hematoxylin II (Ventana, Mayer hematoxylin) and Blueing reagent (Ventana) for 8 minutes.

TMA was analyzed semi-quantitatively and the overall level of FAP expression (staining intensity), as well as the localization of FAP expression in the tumor tissue was evaluated.

When all three anti-FAP antibodies were used in all tumor tissue samples (breast cancer, colorectal cancer, and lung cancer) that could be assessed, a medium to high FAP staining signal intensity was detected in the stromal component of the tumor. It was possible to evaluate using antibodies at least 7 out of 10 samples of each tumor. The remaining samples could not be estimated, since the central mass of tissue included folded artifacts, including only healthy tissue, or was absent.

As expected, the FAP signal was localized differently in the stromal component of the tumors. A slight difference in signal intensity was found between clone 3F2 and clones 3D9 and 4G8. A slightly stronger signal was found when using clones 3D9 and 4G8, however, the difference was very small.

In FIG. 8D-D are representative micrographs of tissue samples of human tumors that were immunohistochemically stained for FAP using murine

- 39,034,742 antibodies to FAP type IgG2a clones 3F2, 3D9 or 4G8 or used as a control isotype of antibody.

Example 9. The binding of antibodies to FAP with FAP on cells

The binding of human IgG1 type antibodies of clones 3F2, 4B3 and 4G8 to human and mouse FAP expressed on stably transfected HEK293 cells was measured using FACS. In general, the method consisted of the following: 150,000 cells per well were incubated with antibodies to FAP 3F2, 4B3 and 4G8 taken at the indicated concentrations in a round-bottom 96-well plate for 30 min at 4 ° C and washed once with PBS / 0.1% BSA . The bound antibody was detected using an FITC-conjugated F (ab ') ₂ fragment of a goat anti-human antibody AffiniPure, F (ab') ₂ specific (Jackson Immuno Research Lab, No. 109-096-097, using the following working solution: diluted in the ratio 1:20 mixture PBS / 0.1% BSA, freshly prepared) after incubation for 30 min at 4 ° C using a FACS CantoII device (FACS Diva program). The results are shown in FIG. 9. Determined the values of the EC ₅₀ when binding, half the maximum, which characterized the binding of human or murine FAP, and they are presented in table. 9.

Table 9. The binding of antibodies to FAP with FAP on cells (EC ₅₀ values)

EC50 values on cells [nM] Human fap Mouse fap 3F2 IgG 4.8 1,0 4B3 IgG 5.5 1,6 4G8 IgG 5,0 1.7

The specificity of antibodies to FAP

To assess the binding specificity of antibodies derived from phage display, binding to HEK293 cells stably expressing DPPIV (a close FAP homolog that is expressed in healthy tissues) or HER2 was evaluated for FAP antibodies of type human IgG1 clones 3F2, 4B3 and 4G8. In general, the method was as follows: 200,000 cells per well (HEK293-DPPIV or, as a control, HEK293-HER2) were incubated with 30 μg / ml anti-FAP 3F2, 4B3 or 4G8 antibodies in a round bottom 96-well plate for 30 min at 4 ° C and washed once with PBS / 0.1% BSA. Trastuzumab (anti-HER2 antibody) or phycoerythrin (PE) conjugated anti-CD26 / DPPIV mouse anti-human antibody (CD26 = DPPIV, mouse IgG1, k, BD Biosciences, No. 555437, clone M-A261) was used as positive controls. The bound antibody was detected using an EPini-conjugated F (ab ') 2 fragment of a goat anti-human antibody AffiniPure type IgG, Fcyspecific (Jackson Immuno Research Lab, No. 109-116-170, using the following working solution: a 1:20 diluted mixture PBS / 0.1% BSA, freshly prepared) after incubation for 30 min at 4 ° C using a FACS CantoII device (FACS Diva program). The results of this experiment are shown in FIG. 10. None of the anti-FAP antibodies showed pronounced binding to DPPIV or HER2, their signals were in the range corresponding to the negative controls (only the secondary antibody used as an isotype control antibody or variant without antibody).

The binding of antibodies to FAP with FAP on human fibroblasts

The binding of human IgG1 type antibodies to human FAP expressed on the GM05389 human fibroblast cell line (obtained from the lung of a human fetus, National Institute of General Medical Sciences, Camden, NJ) was evaluated using FACS. In general, the method was as follows: 200,000 cells per well were incubated with 30 μg / ml anti-FAP 3F2 or 4G8 antibodies in a round bottom 96-well plate for 30 min at 4 ° C and washed once with PBS / 0.1% BSA. The bound antibody was detected using an FITC-conjugated F (ab ') 2 fragment of a goat anti-human AffiniPure IgG type Fcy-specific (Jackson Immuno Research Lab, No. 109096-098, using the following working solution: diluted 1:20 mixture PBS / 0.1% BSA, freshly prepared) after incubation for 30 min at 4 ° C using a FACS CantoII device (FACS Diva program). The results of this experiment are shown in FIG. 11. Both anti-FAP antibodies strongly bound to FAP expressed on human fibroblasts.

The binding of antibodies to FAP with FAP on human tumor cells

The binding of human IgG1 type antibodies to human FAP expressed on GM05389 human fibroblast cell line and stably transfected HEK293 cells was compared with FAP expression on human cancer cell lines ACHN, Colo205, MDA-MB231, MDAMB435 and KPL4 using FACS.

In general, the method was as follows: 200,000 cells per well were incubated with 10 μg / ml anti-FAP 3F2 or 4G8 antibodies in a round-bottom 96-well plate for 30 min at 4 ° C and washed once with PBS / 0.1% BSA. Bound antibody was detected using an FITC-conjugated F (ab ') ₂ fragment of a goat anti-human AffiniPure IgG type, F (ab') 2-specific (Jackson Immuno Research Lab, No. 109-096-097, using the following working solution: diluted in a ratio of 1:20 a mixture of PBS / 0.1% BSA, freshly prepared) after incubation for 30 min at 4 ° C,

- 40,034,742 using the FACS CantoII device (FACS Diva program). The results of this experiment are shown in FIG. 12. Data indicate that antibodies 3F2 and 4G8 bind specifically to FAP, which is characterized by pronounced overexpression on fibroblasts, and on stably transfected HEK293 cells; however, only weak binding can be detected using the human tumor cell lines ACHN, Colo205, MDA-MB231, MDA-MB435 and KPL4.

Example 10. Analysis using FACS FAP internalization upon binding to an anti-FAP antibody

The ability to induce binding of FAP internalization to several FAP antibodies known in the art is described (e.g., described by Baum et al., J Drug Target 15, 2007, cc. 399-406; Bauer et al., Journal of Clinical Oncology, 2010 , proceedings of the annual ASCO conference (publication after the conference), vol. 28 (supplement of May 20), abstract No. 13062 (2010); Ostermann et al., Clin Cancer Res 14, 2008, cc. 4584-4592).

Therefore, when creating the invention, the ability to induce the internalization of the antibodies of the invention was analyzed. In general, the method consisted of the following: cells of the GM05389 line (human lung fibroblasts), which were cultured in EMEM + 15% FCS, were separated, washed, counted, viability was assessed and plated at a density of 0.2 million cells / well in 12-well plates. The next day, antibodies to FAP 4G8 and 3F2 (Fig. 13A) or only 4G8 (Fig. 13B) were diluted to a concentration of 10 μg / ml in cold medium, the cells were cooled on ice, and diluted antibodies (0.5 ml / well) were respectively added. or only Wednesday. Then the cells were incubated for 30 min in a cold room with a gentle shaking, after which 0.5 ml of warm medium was added and the cells were further incubated at 37 ° C for the indicated periods of time. At various time intervals, the cells were transferred to ice, washed once with cold PBS and incubated with 0.4 ml of secondary antibody (goat anti-human IgG conjugated with Alexa Fluor 633, Molecular Probes, No. A-21091, 2 mg / ml, for use dilution 1 : 500) for 30 min at 4 ° C. Then the cells were washed twice with PBS / 0.1% BSA, transferred to a 96-well plate, centrifuged for 4 min at 4 ° C, 400xg, and the cell debris was resuspended by vigorous stirring. Cells were fixed with 100 μl of 2% PFA (paraformaldehyde). For evaluation using FACS, the cells were resuspended in 200 μl / PBS / 0.1% BSA and quantitatively analyzed using the plate protocol on a FACS CantoII device (FACS Diva program). The results of these experiments are shown in FIG. 13A and B, and they demonstrate that antibodies to FAP 4G8 and 3F2 do not induce FAP internalization on fibroblasts.

FAP internalization assay for binding to anti-FAP antibody by immunofluorescence

Cells of the GM05389 line (human lung fibroblasts) were grown on glass coverslips in EMEM + 15% FCS. Before treatment, cells were washed three times with PBS and grown in minimal EMEM + 0.1% BSA for 2 hours. Antibody to FAP (4G8 as IgG) or anti-CD20 antibody (GA101, used as an isotype control) was diluted in cold EMEM to a final concentration of 10 μg / ml. After keeping in minimal medium, the cells were cooled on ice, washed twice with cold PBS and incubated with diluted antibodies (0.5 ml / well) for 45 min at 4 ° C with constant stirring, allowing contact with the surface. Then the cells were washed twice with cold PBS and either fixed with cold PFA (TO, paraformaldehyde, 4% in PBS, pH 7.4), or additionally incubated at 37 ° C for 20 min, 1, 3, and 6 h in EMEM + 10 medium % FCS. At each indicated time point, the cells were washed twice with cold PBS and PFA was fixed for 20 min on ice. After fixation, cells were washed 4 times with cold PBS, permeability was increased with 0.03% Triton, and incubated with anti-EEA1 antibody (early endosome marker) for 45 min at room temperature in blocking buffer (PBS + 10% FCS). Then, the cells were washed three times with PBS and incubated with fluorescently labeled secondary antibodies (donkey anti-mouse antibody conjugated to Alexa Fluor 594 and goat anti-human antibody conjugated to Alexa Fluor 488) at room temperature for another 45 minutes. The cells were finally washed and preparations were prepared on glass slides using an Immuno Mount fill medium.

In FIG. 14A-T are representative immunofluorescence images showing FAP staining of plasma membranes on light line fibroblasts GM05389 obtained after binding of anti-FAP 4G8 antibody as IgG for 45 min at 4 ° C (A) for 20 min at 37 ° C ( B), for 1 h at 37 ° C (C) or for 6 h at 37 ° C (D). For antibody to CD20 GA101, which was used as an isotype control, background staining was detected. EEA1 marks early endosomes. It should be noted that the staining of the FAP surface of the plasma membrane remains up to 6 hours after binding to the anti-FAP 4G8 antibody.

Example 11. Biacore analysis of antibodies to FAP type IgG with mature affinity

Antibodies to FAP in the form of affinity matured Fab fragments derived from 3F2 and 4G8 were converted to rabbit antibodies as IgG. The affinity for FAPs converted from antibodies with matured affinities 3F2 and 4G8 of rabbit antibodies to FAP type IgG1 was then evaluated and cynomolgus was studied for human, mouse and monkey FAPs using an SPR analysis at 25 ° C. (Biacore analysis). For this

- 41 034742 targets, the extracellular domain of human, mouse and monkey FAP cynomolgus (SEQ ID NO: 317-322) was captured using an immobilized anti-His antibody (Penta His, Qiagen, No. 34660) and the antibodies were used as the analyzed substances. IgG was diluted in a ratio of 1: 5, starting from a concentration of 10 nM, to a concentration of 3.2 pM. The following parameters were used: association reaction duration 180 s, dissociation reaction duration 900 s, flow rate 90 μl / min. Regeneration with 10 mM glycine, pH 2 for 60 s. The curves were approximated using a 1: 1 model, obtaining K _D values (local value Rmax, RI = 0).

Example 12. The binding of antibodies to FAP with mature affinity with FAP on cells

The binding of a human antibody with a matured affinity of type IgG1, such as 28H1, labeled with Alexa-647 (1.89 mg / ml, 1.83 mol of dye / mol of protein), which was obtained from the parent antibody 4G8, with human FAP expressed on stably transfected HEK293 cells were quantified using FACS. In general, the method consisted of the following: 200,000 cells per well were incubated with 2 and 10 μg / ml parent antibody 4G8 and an anti-FAP antibody with matured 28H1 affinity in a round bottom 96-well plate, incubated for 30 min at 4 ° C and washed once PBS / 0.1% BSA. Bound antibody was detected after incubation for 30 min at 4 ° C using a FACS CantoII device (FACS Diva program). The results obtained demonstrate that both antibodies are characterized by strong binding to HEK293 cells transfected with human FAP (Fig. 23).

Example 13. The binding of antibodies to FAP with mature affinity with FAP on human fibroblasts

The binding of antibodies with matured IgG1 affinity derived from 3F2 to human FAP expressed on the human fibroblast cell line GM05389 (obtained from the lung of a human fetus, National Institute of General Medical Sciences, Camden, NJ) was evaluated using FACS . In general, the method consisted of the following: 200,000 cells per well were incubated with 30 μg / ml anti-FAP antibody with matured 3F2 affinity in a round-bottom 96-well plate for 30 min at 4 ° C and washed once with PBS / 0.1% BSA. Bound antibody was detected using an FITC-conjugated F (ab ') ₂ fragment of a goat anti-human antibody AffiniPure type IgG, Fcy-specific (Jackson Immuno Research Lab, No. 109-096-098, using the following working solution: diluted 1:20 mixture PBS / 0.1% BSA, freshly prepared) after incubation for 30 min at 4 ° C using a FACS CantoII device (FACS Diva program). The EC ₅₀ values were determined at half-maximum binding, which characterized binding to human and murine FAP.

Example 14. Antibody-mediated cell-dependent cytotoxicity associated with created using glycoengineering antibodies to FAP type IgG1

Human IgG1 type anti-FAP antibodies derived from 4G8 or 3F2 were created by glycoengineering by cotransfection with plasmids encoding GnTIII and ManII according to the method described in Example 1. Then, parental 4G8 and 3F2 antibodies and a mature antibody with 28H1 affinity were created using glycoengineering human IgG1 was compared by ADCC analysis with respect to their ability to mediate increased antibody-dependent cell-dependent cytotoxicity compared to their wild-type non-glycoengineered versions.

In general, the method consisted of the following: HEK293 cells stably transfected with human FAP were collected as target cells, washed and resuspended in culture medium, stained with freshly prepared calcein AM (Molecular Probes) for 30 min, washed three times , the number of cells was counted and diluted to 300,000 cells / ml. This suspension was transferred to a round bottom 96-well plate (= 30,000 cells / ml), dilution of the corresponding antibody was added, and incubated for 10 min to facilitate the binding of the test antibody to the cells before contact with effector cells. The ratio of effector cells and target cells was 25: 1 in the case of PBMC. Joint incubation was carried out for 4 hours. As a result, the release of lactate dehydrogenase (LDH) in the supernatant after cleavage of the attacked cells was determined. LDH from the co-culture supernatant was collected and analyzed using an LDH detection kit (Roche Applied Science). Substrate conversion using the LDH enzyme was measured using an ELISA absorption reader (SoftMaxPro program, reference wavelengths: 490 nm, 650 nm). As shown in FIG. 24, all FAP test antibodies tested were capable of inducing ADCC against HEK293-hFAP cells. The glycoengineered versions (ge) were always more pronounced than the corresponding non-glycoengineered version of the wild type (wt).

Although the invention has been described above in sufficient detail using the illustrations and examples cited for purposes of better understanding, the description and examples should not be construed as limiting the scope of the invention. All cited in the present description of patent and scientific publications are fully incorporated into it by reference.

Claims (38)

1. An antibody that specifically binds to a fibroblast activation protein (FAP), wherein said antibody comprises a heavy chain variable region of SEQ ID NO: 267 and a light chain variable region of SEQ ID NO: 265. 2. The antibody according to claim 1, where the specified antibody contains an Fc region. 3. The antibody of claim 2, wherein said Fc region is an IgG Fc region. 4. The antibody according to any one of claims 1 to 3, where the specified antibody is a full-length antibody of the IgG class. 5. The antibody according to any one of claims 1 to 4, where the specified antibody contains a constant region of a human antibody. 6. The antibody according to any one of claims 1 to 5, where the specified antibody is a human antibody. 7. The antibody according to any one of claims 1 to 6, wherein said antibody contains an Fc region created by glycoengineering, said antibody having an increased content of unfucosylated oligosaccharides in the Fc region compared to an antibody created without the use of glycoengineering. 8. The antibody of claim 7, wherein at least about 20 to about 100% of the N-linked oligosaccharides in the indicated Fc region are unfucosylated. 9. The antibody according to claim 7 or 8, where the specified antibody has an increased content of oligosaccharides in the specified Fc region, which are bisectional due to N-acetylglucoseamine (GlcNAc), compared with an antibody created without the use of glycoengineering. 10. The antibody of claim 9, wherein at least about 20 to about 100% of the N-linked oligosaccharides in said Fc region are bisected due to GlcNAc. 11. The antibody of claim 9 or 10, wherein at least about 20 to about 50% of the N-linked oligosaccharides in the indicated Fc region are bisectional and non-fucosylated. 12. The antibody according to any one of claims 1 to 11, where the specified antibody has an increased effector function and / or increased binding affinity for the Fc receptor. 13. The antibody of claim 12, wherein said enhanced effector function is increased ADCC. 14. The selected polynucleotide encoding the antibody heavy chain and antibody light chain according to any one of claims 1 to 13. 15. The composition for expression of the antibody heavy chain and antibody light chain according to any one of paragraphs 113, comprising a first isolated polynucleotide encoding an antibody heavy chain that contains the sequence of SEQ ID NO: 267, and a second isolated polynucleotide encoding an antibody light chain that contains the sequence of SEQ ID NO: 265. 16. A vector for expression of the antibody heavy chain and antibody light chain, comprising the polynucleotide of claim 14. 17. A host cell for producing an antibody that specifically binds to the FAP according to any one of claims 1 to 13, containing the polynucleotide of claim 14, the composition of claim 15, or the vector of claim 16. 18. The host cell according to claim 17, wherein said host cell further comprises one or more polynucleotides containing a sequence that encodes a polypeptide having activity of b- (1,4) -H-acetylglucosaminyl transferase III (GnTIII). 19. The host cell according to claim 18, wherein said polypeptide having GnTIII activity is a fusion polypeptide that contains a GnTIII catalytic domain and a localization domain of mannosidase II (ManII) in the Golgi complex. 20. The host cell according to claim 18 or 19, wherein said host cell further comprises a polynucleotide that contains a sequence encoding a polypeptide having manosidase II ManII activity. 21. A method for producing an antibody that specifically binds FAP according to any one of claims 1 to 13, wherein said method comprises: a) culturing the host cell according to 17 in a medium and under conditions that allow expression of the antibody, and b) isolation of antibodies. 22. A method of producing an antibody that specifically binds FAP according to any one of claims 1 to 13, where the specified method includes: a) culturing the host cell according to any one of claims 18-20 in a medium and under conditions that ensure expression of the antibody, and modifying the oligosaccharides present in the Fc region of the antibody with a polypeptide that has GnTIII activity, and b) isolation of antibodies. 23. An antibody that specifically binds to FAP, where the specified antibody is obtained by the method according to item 21 or 22. 24. The conjugate of an antibody for the treatment of cancer, containing the antibody according to one of claims 1 to 13 and cytotoxic - 43,034,742 chemical agent. 25. A pharmaceutical composition for treating a disease characterized by FAP expression, comprising an antibody according to any one of claims 1 to 13 and a pharmaceutically acceptable carrier. 26. The pharmaceutical composition according A.25, also containing an anti-cancer agent. 27. The use of an antibody according to any one of claims 1 to 13 for the preparation of a medicament for the treatment of a disease characterized by FAP expression. 28. The use of claim 27, wherein said disease is cancer. 29. The use of antibodies according to any one of claims 1 to 13 for the preparation of a medicinal product intended for the induction of lysis of tumor cells. 30. The use of antibodies according to any one of claims 1 to 13 for the preparation of a medicinal product intended for the induction of lysis of stromal tumor cells. 31. The application of clause 29 or 30, where the antibody-induced cell lysis depends on the cytotoxicity of the antibody. 32. A method of treating an individual suffering from a disease that is characterized by FAP expression, comprising administering to the individual an effective amount of an antibody according to one of claims 1 to 13 or a pharmaceutical composition according to claim 25 or 26. 33. The method according to p, in which the individual is also administered an additional drug, where this additional drug is an anti-cancer agent. 34. The method of claim 32 or 33, wherein said disease is cancer. 35. A method for inducing cell lysis of a tumor cell, wherein said method comprises contacting said tumor cell with an antibody according to any one of claims 1 to 13. 36. A method for inducing cell lysis of a stromal tumor cell, wherein said method comprises contacting said stromal cell with an antibody according to any one of claims 1 to 13. 37. The method of claim 35 or 36, wherein said cell lysis is induced by antibody-dependent cytotoxicity of the antibody. 38. A method for diagnosing cancer or an inflammatory condition in an individual by determining a complex of a diagnostic agent and FAP, wherein said method comprises administering to an individual in an effective amount of a diagnostic agent, wherein said diagnostic agent contains an antibody according to one of claims 1 to 13 and a label that can detect complex comprising a diagnostic agent and FAP.