DK175551B1 - Poly:peptide with granulocyte colony stimulating factor activity - obtd. by recombinant DNA procedures for treating haematopoietic disorders - Google Patents

Abstract

Purified and isolated polypeptide (I) having at least part of the primary structural conformation and a biological property (ies) of naturally occurring pluripotent granulocyte colony stimulating factor (hpG-CSF) is new when the (I) is the prod. of procaryotic or eucaryotic expression of an exogenous DNA sequence. DNA sequence for use in securing expression of (I) in a procaryotic or eucaryotic host cell is new. The DNA sequence is either a defined sequence of its complementary strands, or a sequence that hybridises to such sequences or their fragments, or a sequence that, but for the degeneracy of the genetic code, would hydridise to any of these other sequences.

Description

DK 175551 B1

The invention relates to an isolated polypeptide having the hematopoietic biological properties of naturally occurring pluripotent granulocyte colony-stimulating factor (hpG-CSF), the polypeptide having the amino acid sequence listed in Table VII 1-174. In this connection, the invention relates to a DNA sequence which, when expressed in a prokaryotic or eukaryotic host cell, encodes a polypeptide, possesses at least a portion of the primary structure and hematopoietic properties of naturally occurring pluripotent granulocyte colony-stimulating factor; a biologically functional plasmid or viral DNA vector; a prokaryotic or eukaryotic host cell; a method for producing isolated polypeptides having the hematologic properties of naturally occurring pluripotent granulocyte colony-stimulating factor (pG-CSF), wherein the polypeptide has the amino acid sequence shown in Table VII 1-174; a pharmaceutical composition and use of such a polypeptide for the preparation of a drug.

The blood-forming (hematopoietic) system in humans destroys a variety of white blood cells (including neutrophils, macrophages and basophils / mast cells), 25 red blood cells (erythrocytes) and clotting-promoting cells (megakaryocytes / platelets). It has been estimated that 'the hematopoietic system of an average male person produces approx. 4.5 x 1011 granulocytes and erythrocytes each year, which corresponds to a renewal of

I DK 175551 B1 I

I I

In the whole body weight. Dexter et al., BioEssays, 2, 154 - I

In 15Θ (1985). IN

It is believed that small amounts of certain hematopoietic I

In growth factors, a small number of "stem I" causes

In 5 paternal cells "divide into a number of blood cell lines that I

In these, so widely and eventually diffuse

You are rented to fully developed blood cells. When the I

In hematopoietic growth factors are present in immense I

In small quantity, have provisions and identification of I

In 10 these factors rested on a number of trials, which up to now I

You only distinguish between the different factors based on I

In their stimulatory effect on cell cultures during culture

In rising circumstances. As a result, you have

You have produced a large number of names to denote an I

In 15 much smaller number of factors. As an example of the I

In the current confusion one can mention that the names I

In IL-3, BPA, multi-CSF, HCGF, MCGF and PSF are different I

In names that are now believed to all denote the same hematopoietic I

In happen growth factor in mice. Metcalf, Science, 229, 16-22 I

In 20 (1985). See also Burgess et al., J. Biol. Chem. 252, I

In 1988 (1977), Das, et al., Blood, 58, 600 (1980), Ihle, I

J. Immunol, 129, 2431 (1982), Nicola, et al., J.I.

In Biol. Chem., 258, 9017 (1983), Metcalf, et al., Int. J. I

In Cancer, 30, 773 (1982), and Burgess, et al., Int. J. I

In Cancer, 26, 647 (1980), concerning various growth regula- tions

In learning glycoproteins in mice. IN

The use of recombinant genetic engineering has brought an I

In order of this chaos. For example, you now know you

In the amino acid and DNA sequences of human erythropoietin, I

In 30 which stimulates the production of erythrocytes. (See Lin, I

In PCT Application No. 85/02510, published June 20, I

In 1985). Recombinant methods have also been used

In which to isolate cDNA for a human granulocyte I

DK 175551 B1 3 macrophage colony stimulating factor. See Lee, et al.,

Proc. Natl. Acad. Sci. (USA), 82, 4360-4364 (1985) and Wong, et al., Science, 228, 810-814 (1985). See also Yo-kota, et al., Proc. Natl. Acad. Sci. (USA), 81, 1070 (1984), Fung, et al., Nature, 307, 233 (1984), and Gough, et al., Nature, 309, 763 (1984) on the cloning of mouse genes, as well as Kawasaki, et al., Science, 230, 291 (1985) on human M-CSF.

A human hematopoietic growth factor, called human pluripotent colony-stimulating factor (hpCSF) or pluripoietin, has been found in the culture medium of a human bladder carcinoma cell line called 5637 and deposited under restrictive circumstances at American Type Culture Collection, Rockville, Mary. -15 countries like ATCC No. HTB-9. It has been stated that phCSF,. purified from this cell line will stimulate the proliferation and differentiation of pluripotent progenitor cells, thereby leading to production of all the important blood cell types in experiments using human bone marrow output cells. Walte et al., Proc. Natl. Acad.

Sci. In the purification of phCSF, precipitation was used: (NH 4) 2 SO 4; anion exchange chromatography (DEAE cellulose, DE 52); gel filtration (AcA54 column); and C18 reverse phase high capacity liquid chromatography * It was stated that a protein identified as phCSF and eluted in the second of two activity peaks in C18 reverse phase HPLC chromatography should have a molecular weight (MW) of 18,000, determined by means of sodium dodecyl sulfate (SDS) -polyacrylamide gel electrophoresis (PAGE) using silver staining. Previously, hpCSF was stated to have an isoelectric point of 5.5 [Welte, et al., J. Cell. Biochem., Supp. 9A, 116 (1985)] and a high differentiating activity for the myelomonocytic

I DK 175551 B1 I

I 4 I

In mouse leukemia cell line WEHI-3B D + [welte, et al., I

In UCLA Symposia on Molecular and Cellular Biology, Gale, I

Et al., Eds., New Series, 28 (1985)]. Previous Studies I

You suggest that the factor identified as phCSF is involved

In 5, there is predominantly granolyte colony-stimulating activity

In the first seven days, in a human CFU-GM trial. IN

Furthermore, from human bladder carcinoma I

In cell line 5637 isolated another factor, designated human I

In CSF-β, which is described as a competitor to 125 I-label I

In 10 ket granulocyte colony stimulating factor (G-CSF) from mouse I

I for binding to WEHI-3B D + cells in a dose-I

In response interaction that is identical to what you do

You find by unlabeled G-CSF from mice [Nicola, et al., I

In Nature, 314, 625-628 (1985)]. You have previously co- I

I shared that this dose-response relationship should

You must be unique to unlabeled G-CSF from mice, and not be

You present with such factors as M-CSF, GM-CSF or I

In multi-CSF [Nicola, et al., Proc. Natl. Acad. Sci. (USA), I

I 81, 3765-3769 (1984)]. Among CSFs, CSF-β and I occupy

In 20 G-CSF the special position that they are both very capable I

I to induce differentiation in WEHI-3B D + cells. IN

In Nicola, et al., Immunology Today, 5, 76-80 (1984). Do you know

At high concentrations, G-CSF stimulates mixed granulo-I

In cyt / macrophage colony forming cells (Nicola, et al., I

In 25 (1984) see above), which is consistent with previous results

In tater suggesting the presence of granulocytic I

In monocytic and mixed granulocytic / monocytic and I

In eosinophilic colonies (CFU-GEMMM) after 14 days of incubation

In ring of human bone marrow cultures with phCSF. You have

I also described CSF-β as a stimulant for the formation of I

In neutrophil granulocyte colonies in experiments using I

You have bone marrow cells from mice, a property that you have

I used to identify a factor as a G-CSF. IN

5 DK 175551 B1 Based on these similarities, human CSF-β has been identified with G-CSF (granulocyte colony stimulating factor).

Nicola et al., Nature, 314, 625-628 (1985).

In view of their common properties, it would appear that human CSF-β According to Ncola, et al., Supra, and hpCSF of Welte, et al., Supra, are the same factor which may conveniently be termed as a human pluripotent granulocyte colony-stimulating factor (hpG-CSF). It would be highly desirable to be able to characterize and recombinantly produce hpG-CSF based on the reported ability of G-CSF from mice to completely suppress the in vitro population of WEHI-3B D + leukemia cells at "completely normal concentrations", and in Considering that it has been reported that unpurified 15 preparations of G-CSF from mice can suppress existing transplanted myeloid leukemias in mice. Metcalf, Science, 229, 16-22 (1985). See also Sachs, Scientific American, 284 (1), 40-47 (1986).

If hpG-CSF were found to be therapeutically important and it became necessary to produce it in commercial quantities, isolation from the cell culture would hardly be able to provide the necessary amount of material. For example, it should be noted that there appear to be restrictions on commercial utilization of Human Tumor Bank cells, such as human bladder cancer cell line 5637 (ATCC HTB9), cited as a source of natural hpCSF-ter the preparations; Welte, et al. (1985), see above).

The above isolated polypeptide of the invention is characterized by being non-naturally occurring and being a product of prokaryotic or eukaryotic expression of an exogenous DNA sequence.

Such sequences may include: incorporated "companies".

I DK 175551 B1 I

I 6 I

In drawn codons for expression by selected non-pat

In mammalian host cells, provision of intersection I

In sites of endo-nuclease restriction enzymes; and provide

To provide additional DNA sequences placed before, I

I within or following said sequence which makes construction I

In one of vectors that can be expressed immediately, I-

In re. In more detail, the DNA sequence of the invention is I

I peculiarly by encoding a polypeptide with an amino I

In acid sequence selected from the poly I listed in Table VII

In 10 peptide sequence and any allelic variant, I

In a derivative, a deletion analogue, substitution analogue or I

In the clay addition analogue thereof. IN

In such DNA sequences of the invention, I

In sequences useful to ensure expression in I

In 15 prokaryotic or eukaryotic host cells of polypeptide

In time products with at least part of the primary I

In structural conformation and one or more of the biological

In natural properties of naturally occurring pluripotent I

In granulocyte colony-stimulating factor. The DNA sequences I

In accordance with the invention, more detail may include:

In (a) the DNA sequences shown in Table VII; (b) and I.

In genomic DNA sequence encoding allelic variants, I

In derivatives and analogues of hpG-CSF. These DNA sequences I

You can incorporate codons that do translation of the mess

For 25 yeasts in microbeads lighter. Such manufactured I

I sequences may be prepared by the method of I

In Alton, et al., PCT application WO 83/04053. > I

In the context of the isolated polypeptides and those I

For such polypeptides of the invention, it is bio-I

In logically functional plasmid or the viral DNA vector I

According to the invention, peculiar by including an I

In DNA sequence according to the invention; and a prokaryotic or I

In the eukaryotic host cell of the invention, property is I

7 is similar in that it is transformed or transfected with a DNA sequence according to the invention in such a way that the host can express the polypeptide product concerned, preferably by being transformed or transfected with a DNA vector according to the invention.

The isolated polypeptide products of the invention are products of expression in prokaryotic or eukaryotic hosts (e.g., bacteria, yeast or cultured cells of plants, insects and mammals) of exogenous DNA sequences obtained by genomic or cDNA cloning or by synthesis of genes. The product from typical yeast cells (e.g., Saccaromyces cerevisiae) or prokaryotic host cells [e.g. Escherichia coli (E. coli)] is free from association with any mammalian protein. The product of microbe expression in vertebrate cells (eg mammals other than humans and birds) is free from association with any human protein. Depending on the host used, the polypeptides of the invention may be glycosylated with mammalian or other eukaryotic carbohydrates or may be non-glycosylated. Polypeptides of the invention may also contain a starting methionine amino acid residue (at position -1).

The inventive pharmaceutical compositions are useful in comprising effective amounts of polypeptide products of the invention or prepared according to the invention together with appropriate diluents, adjuvants and / or carriers usual in hpG-CSF therapy. Finally, the subject polypeptide of the invention is used to prepare a hematopoietic therapy drug in a mammal.

Polypeptide products of the invention can be labeled as associated with a detectable marker substance

I DK 175551 B1 I

I I

I (e.g., radiolabelled with 125l), thereby providing I

You bring in reagents useful in determining I

In the presence and amount of human hpG-CSF in tissue samples I

In and in liquid samples such as blood or urine. DNA-I

In 5 products according to the invention can also be labeled with detectable I

In straight markers such as radio markers and non-isotope mar- I

You run such as biotin) and are used in DNA hybridization I

In processes so that one can locate the position of human I

In the hpG-CSF gene and / or the position of one such as I

Preferably, related gene family in a chromosome map. They can

I and <5a are used to identify irregularities I

I regarding human hpG-CSF gene at the DNA level and utilize I

I theses as gene markers for identification of neighboring I

In 15 genes and their irregularities. IN

In polypeptide products of the invention, only I

I or in combination with other hematopoietic factors or I

In clay medications are useful in the treatment of hematoma

In poetic disorders, such as aplastic anemia. They can also- I

I 20 so be useful in treating hemapoietic deficiencies I

In caused by chemotherapy or by radiation therapy. Chan- I

In order for a bone marrow transplant to succeed, f. I

For example, if you add hpG-CSF, it is enhanced. Treatment I

I with healing of burns and treatment of bacterial form I

In 25 caused inflammation can also be enhanced by the application of I

In hpG-CSF. In addition, hpG-CSF may be useful in treating I

In leukemia, having been published in I

Able to differentiate leukemia cells. Welte, et I

In al., Proc. Natl. Acad. Sci. (USA), 82, 1526-1530 (1985) I

At 30 and Sachs, see above. IN

In the skilled person, by reading the following detailed I

In a description illustrating the embodiment of the invention, I

In the presently preferred embodiments, you can see

In several aspects and advantages of the invention. IN

DK 175551 B1 9

The drawing shows one partial restriction endonudase map of the hpG-CSF gene provided with arrows to elucidate the sequencing strategy used to obtain the genomic sequence.

According to the invention, DNA sequences encoding the entire polypeptide sequence in hpG-CSF or parts thereof have been isolated and characterized.

The following Examples are intended to illustrate the invention and are directed in particular to procedures performed prior to identification of hpG-CSF cDNA and genomic clones, procedures leading to such identification and to sequencing, development of cDNA expression systems, genomic and manufactured genes and confirmation of expression of hpG-CSF and similar products in such systems.

More in detail, Example 1 relates to amino acid sequencing of hpG-CSF. Example 2 relates to the preparation of a cDNA library for scanning for colony hydration. Example 3 relates to the preparation of hybridization probes. Example 4 relates to hybridization search, identification of positive clones, DNA sequencing of a positive cDNA clone and providing information on the primary structural conformation (amino acid sequence) of the polypeptide. Example 5 relates to the identification and sequencing of a genomic clone encoding hpG-CSF. Example 6 relates to the construction of a manufactured gene encoding hpG-CSF using codons belonging to E. coli.

Example 7 relates to methods for constructing an E. coli transformation vector containing DNA encoding hpG-CSF, using this vector for prokaryotic expression of hpG-CSF, and analyzing the properties of the recombinant products of the invention.

I DK 175551 B1 I

I 10 I

In a. Example 8 relates to processes for preparing I

In the analog of. hpG-CSF, in which cysteine residues are replaced

I with other suitable amino acid residues by means of mutagen-I

ese performed on DNA encoding hpG-CSF. Example 9 I

I 5 relates to methods for constructing a vector which I

I contains DNA encoding an analog for hpG-CSF, I

I derived from a positive cDNA clone, using the vector I

I for transfecting COS-1 cells and culturing the I

In transfected cells. Example 10 relates to physical and bio-I

In 10 logical properties of inventive and related recom-

In binary polypeptide products. IN

In Example 1 I

I (A) Sequencing performed by literature well-known I

In 15 ways. IN

I / A sample (3-4 pg, 85-90% pure SDS, silver staining- I

In PAGE) of hpG-CSF was obtained from Sloan Kettering Insti- I

In Tute, New York, New York, it was isolated and cleaned

In welte, et al., Proc. Natl. Acad. Sci. (USA), 82, I

In 1526-1530 (1985). IN

In the N-terminal amino acid sequence in this sample of I

In hpG-CSF was determined in a first experiment by microse I

In sequence analysis using an AB407A gas phase, se- I

In 25 Gender Divisions (Applied Biosystems, Foster City, Califor- I

I nia) to obtain the sequence shown in Table I ne- I

In it. Tables I-IV use single-letter code I

In there, "X" means a residue which could not be completely determined

In safe, and residues indicated in parentheses indicate the possibility

I 30 there. IN

DK 175551 B1 11

TABLE I

1 5 10 15

K-P-L-G-P-A-S-K-L-K-Q- {G, V, S) -G-L-X-X-X

5

In all parts of the experiment, the results of which are given in Table I, a high level of background noise was present, indicating that the sample contained many contaminating ingredients, probably chemical residues 10 arising from the purification. The sequence is given for reference purposes only.

In trial # 2, another sample (5-6 µg, about 95% pure) was used from Sloan Kettering as in trial no.

1, and the sequencing was performed as in Experiment # 1.

This sample was derived from the same material used to obtain FIG. 4 in Welte, et al., Proc.

Natl. Adac. Sci. (USA), 82, 1526-1530 (1985). The results are given in Table II.

TABLE II

15 10 15 20 T-P-L-G-P-A-S- (S) -L-P-Q- <S> -M- <L> -X-K- (R) -X-X- (R) - (L) -X- 1 2 3 4 5 6

Although in experiment # 2, several 2 residues were identified, a sufficiently long safe 3 sequence was not obtained, from which a 4 reasonable number of probes could be constructed for searching for 5 hpG-CSF DNA. It was calculated that at least 636 probes would be used if the sequence of Table II was to isolate cDNA. Again, contamination of the sample was likely to cause this.

Then, a third sample (3-5 µg, about 40% pure) was obtained from Sloan Kettering as above. Man up

I DK 175551 B1 I

I 12 I

You divided this sample by SDS-PAGE and subjected it to electronics

In troblot in an attempt at further purification. Sequence Analysis I

In light of this sample, no data provided. IN

Sequence breakdown by revised methods

I To obtain a sufficient quantity of pure ma

In terial on which to perform sufficiently accurate

In tig amino acid sequence analysis, cells I were obtained

I 10 from bladder carcinoma cell line 5737 (subclone 1A6), which I

You are manufactured at Sloan-Kettering, from Dr. E. Platzer. IN

The cells were first grown in Iscove's medium (GIBCO,

In Grand Island, New York) in small bottles until they collapsed. IN

Then the culture media was provided with trypsin and I

In 15, inoculated them into roller bottles (1½ small bottles / bottle), which you

In each, 25 ml of pre-treated Iscove's medium contained un- I

In which 5% CO 2 · Cells were grown overnight at 37 ° C

I and 0.3 rpm. IN

In Cytodex-1 Small Spheres (Pharmacia, Uppsala, Sweden) I

I 20 was washed and sterilized by the following procedure. IN

8 g of beads were placed in a bottle and 400 I added

In ml of PBS. The pellets were kept in suspension while holding

You shook gently for three hours. The pellets were dropped

In the trap, PBS poured off, cleaned the pellets in PBS and added

In 25 put new PBS. The beads were autoclaved for 15 minutes

I ter. Before use, wash the balls of Iscove's I

In medium plus 10% calf fetal serum (FCS) before adding in fresh medium plus 10% FCS to obtain treated

In small balls. IN

I 30 Culture medium was removed, except 30 ml of I

I from each roll bottle and added 30 ml of fresh medium plus I

In 10% FCS and 40 ml treated beads for the bottles. IN

The bottles were bubbled with 5% CO 2 and sucked

13 DK 175551 B1 all bubbles away. The bottles were placed in 1 roller at 3 rpm th hour before slowing to 0.3 rpm. After three hours, a small bottle of trypsin was added, and the contents were added to all the roll bottles containing beads.

Once the confluence had reached 40-50%, the culture in the roll bottles was washed with 50 ml of PBS and rolled on for 10 minutes before removing PBS. The cells were grown for 48 hours in medium Ά [iscove's medium containing 10% 0.2% PCS, 10 ”8M hydrocortisone, 2 mM glutamine, 100 units / ml penicillin and 100 µg / ml streptomycin]. The supernatant was then harvested from the culture, centrifuged at 3000 rpm for 15 minutes and stored at -70 ° C. Medium A 15 containing 10% PCS was added to the cultures and cultured for 48 hours. The culture medium was discarded, then the cells were washed with PDS as above and cultured for 48 hours in medium A.

The supernatant was again harvested and treated as previously described.

20 Concentrated approx. 30 l of medium containing 1A6 cells to ca. 2 1 on a Millipore Pellicon unit, provided with two cassettes with molecular weight cuts 10,000, filtering 200 ml per ml. minute and withheld approx. 1000 ml per minute. The concentrate 25 was diafiltered to ca. 10 1 50 mM Tris (pH 7.8) with the same apparatus and the same speeds. The diafiltered concentrate was taken at a rate of 40 ml per ml. per minute on a one liter DE cellulose column, equilibrated with 50 mM Tris (pH 7.8). After application, column 30 was washed at the same rate with one liter of 50 mM Tris (pH 7.8) and then with two liters of 50 mM Tris (pH 7.8) added 50 mM NaCl. The column was then sequentially eluted with six 1 liter portions of 50 mM Tris (pH 7.5) containing

I DK 175551 B1 I

I 14 I

You kept the following concentrations of NaCl: 75 mM; 100 mM; IN

I 125 mH; 150 mM; 200 mM; and 300 mM. Collections were collected

Iions (50 ml) and pooled the active fractions, I

I which was concentrated to 65 ml on an "Amicon ultra-I

In 5 filtration, the cell unit stared with a YM5 mem- I

On fire. This concentrate was applied to a 2 liter AcA54 gel-I

In filtration column, equilibrated with PBS. The passage I

You were 80 ml / hour and fractions of 10 ml were collected. IN

Active fractions were pooled and directly applied to an I

In IQ C4 "high performance liquid chromatography" (HPLC) I

In the pillar. IN

In Samples whose volume was 125-850 ml and contained

I kept 1-8 mg of protein, of which 10% was hpG-CSF, I was loaded

In the column with a flow rate of 1-4 ml / min. IN

I After application and a first wash with 0.1 M ammonium acetate

I tat (pH 6.0-7.0) in 80% 2-propanol with a flow I

In rate of lml / minute. One ml of fraction was collected

I tions and examined for protein content at 220 nm, 260 I

In nm and 280 nm. IN

In this purification, fractions containing I

In hpG-CSF clearly separated (as fractions 72 and 73 out of I

In 80) from other fractions containing protein. Man I

In isolated hpG-CSF (150-300 µg) of a purity of ca. 85 ± I.

In 5% and with a yield of approx. 50%. From this purified ma- I

In 25 terial, 9 µg was used in experiment # 4, an amino acid

In sequence analysis, applying the protein sample to an I

In TFA-activated fiberglass without polybrene. They performed

In the sequence analysis with an AB 470A sequence divider at forward I

In the method of Hewick, et al., J. Biol. Chem., 256, I

I 30 7990-7997 (1981) and Lai (Anal. Chem. Acta, 163, 243-248 I

In (1984). The results of Experiment # 4 are shown in Table I

I III. IN

15 DK 175551 B1

TABLE III

1 5 10

Thr- Pro - Leu - Gly - Pro - Ala - Ser - Ser - Leu -Pro-5 15 20

Gin-Ser - Phe - Leu - Leu - Lys - (Lys) - Leu - (Glu) -Glu- 30 10 Val-Arg - Lys - Ile - (Gin) - Gly - Val - Gly - Ala-Ala-

Leu -X - X - In Experiment # 4, no further significant information on the sequence of the sequence was obtained after 31 passes 15 (corresponding to residue 31 in Table III). To obtain a longer clear sequence in a fifth experiment, 14 µg of hpG-CSF purified from treated culture medium was reduced with 10 µl of β-mercaptoethanol for one hour at 45 ° C, then thoroughly dried under vacuum. The protein residue was redissolved in 5% formic acid and applied to a polybrene-treated fiberglass disc. The sequence breakdown analysis was performed as in Experiment # 4 above. The results of Experiment # 5 are given in Table IV:

I DK 175551 B1 I

I 16 I

I TABLE IV

II 5 10 I

I Thr- Pro - Leu - Gly - Pro - Ala - Ser - Ser - Leu- Pro- I

I I

I 15 20 I

I Gin-Ser - Phe - Leu - Leu - Lys - Cys - Leu - Glu- Gin- I

I 25 30 I

I Val-Arg - Light - Ile - Gin - Gly - Asp - Gly - Ala- Ala- I

I 35 40 I

I Leu-Gin - Phe - Lys - Leu - Gly - Ala - Thr - Tyr - Lys- I

I 15 45 I

I Val- Phe - Ser - Thr - (Arg) - (Phe) - (Met) - X- I

In the amino acid sequence of Table IV, sufficient I

In long (44 residues) and precisely determined that from there I

I could construct probes to obtain hpG-CSP cDNA as I

In described below. IN

In Example 2 I

Among standard methods for isolating I

In 25 relevant cDNA sequences there is a preparation of plasmid I

mid-based cDNA "libraries", derived from reverse trans- I

script of mRNA found in donor cells selected on I

On the basis of their expression of a selected gene. When you

knows significant portions of the amino acid sequence of a gene

In 00 tuned polypeptide, labeled single strand I can be used

In goat DNA probe sequences that duplicate a sequence such as I

It is believed to exist in the relevant cDNA by a DNA / DNA I

In the hybridization procedure performed on cloned co-I

17 DK 175551 B1 pier of cDNA which has been denatured to appear in single strand form. Weissman, et al., U.S. Patent No. 4,394,443; Wallace, et al., Nucleic Acids Res., 6, 3543-3557 (1979), and Reyes, et al., Proc. Natl. Acad.

5 Sci. (USA), 79, 3270-3274 (1982), and Jaye, et al.,

Nucleic Acids Res., 11, 2325-2335 (1983). See also U.S. Patent No. 4,358,535, Falkow, et al., On DNA / DNA hybridization procedure at diagnosis; and Davis, et al., "A Manual for Genetic Engineering, Advanced Bacterial 10 Genetics", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1980) pages 55-58 and 174-176 regarding the technique of colony and plaque hybridization.

All RNA was extracted from ca. 1 g of cells from a bladder carcinoma cell line 5637 (1A6) using 15 guanidinium thiocyanate to quantitatively isolate undamaged RNA. [Chirgwin, et al., Biochemistry, 18, 5294-5299 (1979)].

The sterile aqueous RNA solution contained all the RNA from the IA6 cells. To provide messenger 20 RNA alone from the total RNA solution, this solution was passed through a column containing oligodesoxy-thymidylate [oligo (dT)] (Collaborative Research, Inc., Waltham, Massachusetts). Poly-adenylated (poly-A +) terminals characteristic of messenger RNA are bound to the column, whereas ribosome RNA is eluted. As a result of this method, approx. 90 µg poly-adenylated messenger RNA (poly-A + mRNA). The isolated poly-A + messenger RNA was pretreated with methylmercury hydroxide (Alpha Ventron, Danvers, Massa chusetts) at a final concentration of 4 mM for five minutes at room temperature before use in a cDNA reaction. Methylmercury hydroxide treatment denatures interactions with messenger RNA, both internally

I DK 175551 B1 I

I I

With contaminant molecules that block transla- I

I tion. Payvar, et al., J. Biol. Chem., 258, 7636-7642 I

I (1979). IN

In the Okayama method [Okayama, et al ,, I

In Molecular & Cellular Biology, 2, 161-170 (1982)]

You set up a cDNA bank, using mRNA, up

In reached from IA6 cells. CDNA was transformed by

In incubated in a host microorganism E. coli K-12 strain I

In HB101 to increase the amount. IN

I 10 I

In Example 3 I

In Hybridization probes, constructed on the basis of the I

In the terminal amino acid sequence of hpG-CSP according to Table IV, I

You consisted of a set of 24 oligonucleotides, each with an I

In 15 lengths of 23 bases and with a content of three inosine re- I

I star. The probe oligonucleotides were prepared at 1

In the method According to Caruthers, et al., Genetic I

In Engineering, 4, 1-18 (1982) and labeled with γ-32P ATP, ID-I

In one they were kinated with polynucleotide kinase. Probe oil I

In the 20 gonucleotides corresponding to messenger RNA for re- I

In stars 23-30 of the sequence in Table IV, Table I is illustrated

I V: I

I TABLE V I

I 25 I

I hpG-CSF without I

I 5 'GC IGC ICC * TC ICC TTG GAT TTT3' I

I The assumption of neutrality for the I bases was base I

In Right to Published Works by Takahashi, et al., I

In Proc. Natl. Acad. Sci. (USA), 82, 1931-1935 (1985) and I

In Ohtsuka, et al., J. Biol. Chem., 260, 2605-2608 (1985). IN

19 DK 175551 B1

However, inosine can have a destabilizing effect if it is paired with G or T. In Takahashi, et al., Inosins appear to have a neutral effect because, as a group, they achieve on average neutrality 5 (e.g., if three advantageously pair with C, and two do not favor pair with T).

To test the effect of base pairing between I and G, control experiments were constructed using an N-myc gene sequence and clone. The sequence selected from the N-myc gene had the same total content of G and C at the first two positions in each codon that were determined for the hpG-rCSF probes. The N-myc test probes were of the same length, contained I in the same relative positions and potentially had the same mean value for Tm 15 (62-66 ° C, with the three or four inosine residues found not being counted) as the hpG-CSF probes .

Two groups of N-myc test probes were constructed by the method of Caruthers, et al., Supra.

Set I, as illustrated in Table VI, included: 1, a 20 23 mer with complete fit; 2, in which three third-position Cs were replaced by I'er to form the worst possible case by the addition of I; and 3, in which four third-position Cs were replaced by I's. The second group of test probes was constructed to represent a more random distribution of inosine base pairs, thereby obtaining a base pairing effect that was, on average, neutral. Set II, as illustrated in Table VI, included; 4, containing two I's which will form base pairs with C and I with G; and 5, 30 identical to 4, with an additional I: G base pair added.

I DK 175551 B1 I

I 20 I

I TABLE VI

I 1. 5 'CAC AAC TAT GCC GCC CCC TCC CC3' I

I 5 2. 5 'CAC AAC TAT GCI GCC CCI YCI CC3' I

I 3.5 * CAI AAC TAT GCI GCC CCI TCI CC3 'I

I 4.5 'AAC GAG CTG TGI GGC AGI CCI GC3' I

I 10 I

I 5. 5 'AAI GAG CTG TGI GGC AGI CCI GC3' I

I Five replica filters containing N-myc DNA se- I

In Chicken Growth Hormone I DNA Sequences and Sequences

In 15 (erase a negative control), was heated for two hours at 1

At 80 ° C in a vacuum oven before hybridization. All filters I

I was hybridized as described in Example 4 for hpG-CSF I

In the probes, except that the hybridization period I

In only six hours. Filters were washed three times at 1

At 20 room temperature and once at 45 ° C, 10 minutes each I

On it. The filters were checked with a Geiger counter. IN

In the Filter representing an N-myc probe 3, I

gave a very weak signal compared to the other four

filters with probes and were not washed further. After I

For 25 ten minutes washing at 50 ° C, the Geiger counter gave the following I

In percent signal, with probe 1 set to 100%; probe I.

I 20%; probe 3 (45 ° C), 2%; probe 4 92%; and probe 5 75%. IN

After washing at 55 ° C, the percentages were: probe 2 16%; IN

In probe 4 100%; and probe 5 80%. A final wash at I

30 ° C gave the following percentages: Probe 2 1.6%; probe 4 I

In 90%, and probe 5 70%. IN

Thus, in the presence of I

In three, as in probes 2 and 4, you saw up to 60 times

Significant difference in signal when approaching the theoretical value of Tm (I not included in the calculation) [based on the worst case for base pairing with I (probe 2) and a relatively neutral case with base pairing with I5 ( probe 4)].

The standardization information obtained from the N-myc sample hybridizations was used to wash and control the hpG-CFS hybridization as below to assess the extent to which one could have confidence in the results when using a less 'stringent' washing procedure.

Example 4

In the method of Hanahan, et al., J.

15 mol. Biol. 166, 557-580 (1983), bacteria containing recombinants with cDNA inserts as prepared in Example 2 of 24 nitrocellulose filters (Millipore, Bedford, Massachusetts) were spread onto agar plates. The plates were then incubated to obtain about 150,000 colonies replicated on 24 other nitrocellulose filters. The replica filters were incubated until separate colonies were obtained. The bacteria on the filters were lysed on Whatman 3 MM paper, which was almost saturated with sodium hydroxide (0.5 M) for ten minutes 25 and then stained with Tris (1M) for two minutes, then stained with Tris (0.5 M) containing NaCl (1.5 M) for ten minutes. When the filters were almost dry, they were allowed to warm for two hours at 80 ° C in a vacuum oven before hybridizing with nucleic acid. [Wahl, et al., Proc. Natl. Acad. Sci. (USA), 76, 3683-3687 (1979)]; and Maniatis, et al., Cell, 81, 163-182 (1976).

The filters were pre-hybridized for two hours at 65 ° C in 750 ml of 10 x Denhardt, 0.2% SDS and 6 x SSC. You

I DK 175551 B1 I

I 22 I

You cleaned the filters in 6 x SSC and placed them four together, I

Then hybridized for 14 hours in 6 x SSC and 10 x 1

In Denhardt. There were approx. 15 ml of solution in hybridization I

In the container containing 50 x 106 cpm of the 32P mark I

In 5 probes (oligonucleotides). IN

After hybridization, the filters were washed three times

At times in 6 x SSC (1 liter / wash) at room temperature, 10 l

For minutes every time. The filters were washed twice at 1

At 45 ° C for 15 minutes, once at 50 ° C for 15 minutes and one I

For 10 minutes at 55 ° C for 15 minutes, using 1 liter of I

In 6X SSC each time. The filters were autoradiographed at I

I -70'c for two hours using a reinforcing I

On screen and Kodak XAR-2 movie. On this autoradiograph you were

There are 40-50 positive signals, including five very powerful I

I 15 very signals. IN

The Area containing the strongest five signals I

I and another five positive signals were scraped from I

In the output plates and again plated for another through- I

search using the same probe mix and the same betin- I

In 20 gels. The washing varied, washing at high tem

Perature twice at 55 ° C for 15 minutes and once at I

At 60 ° C for 15 minutes. Based on the study of N-myc I

In the probe of Example 3, the washing temperature I was finally set

In the second crawl of the weather, combining

At 25 melting point for the 24 23-mer was $ 0-68 ° C, as in N-myc I

the probes. Immediately after the second wash at 55 ° C, I allowed

In the filters the autoradiographs in the moist state. And I

comparing this autoradiography with another auto- I

In radiography, recorded at the same time after the final wash at I

30 ° C, showed that only two of the ten clones tested did not suffer from I

a significant loss in signal strength when increasing temp

In the rate from 55-60eC. It could later be shown that these two I

The clones were of almost identical length and possessed almost you

The same pattern for restriction endonucleases. A clone, designated Ppo2, was selected for sequence breakdown.

Sequencing of the recombinant hpG-CSF cDNA clone Ppo2, obtained by the above procedure by the didesoxy method of Sanger, et al., Was performed.

Proc. Natl. Acad. Sci. (USA) 74, 5463-5467 (1977). The M-13 single stranded DNA strand was used as a cloning vector and provided single stranded DNA templates for the double stranded cDNA clones. Singer, et al.

The procedure gave the sequence shown in Table VII together with the corresponding amino acid sequence and a complementary strand in the polypeptide coding region.

1 '

I DK 175551 B1 I

I 24 I

I O Eh C COO 3ϋϋ ΟΟϋ W O O W <PH I

W O O M <Eh M C £ H klUO NC Eh JCCJO I

AOO OOO UUU AOO Eh Eh C Eh <E * I

I> iUU 0) 0 0 OUO «O O 300 0.0 0 I

M O O M M Eh C WOO> lOO UH <0) <S I

O O O m m C Eh A O O O Eh C kJ O O COO I

I 3 OO <1 0) 0 O 0) 00 UOO OIOO 300 I

S «> Eh C NC Eh m C E * 0) 0 0 4S Eh C 0) EH <

jf iJ O O kJ C Eh SOO W C E «A H« 2 * A ί * C

I δ ooo croo moo woo 3eh c woo I

Γ. WOO WOO NO O 0) 00 0) EH 3 42 0 0 I

zL A O O C C Eh U Eh C W C Eh kJ O O Eh C £

I S HWOO MOO 300 300 NOO OOO I

I g +4200 m Eh C 4) Eh C ft) H <HUU WOO I

I § EHHiEH> 00 hJOO kJOO OOO A O O I

I S <000 cceh moo 000 woo © nehc I

I g HOW © M C Eh O NC Eh OwOO O 0) O O OMOO I

I O -H <OOfMOOO HTJ * iEHVOAOOC0W * iEHHOOO

I R 3 <Eh 300 WOO m Eh C m Eh C 300 I

I g h2eh H <£ h NC E * MOO -H <Eh C) p 2 I

I g OOO OOO Eh Eh <COO SOO .J Eh C

I S COO 3 <EH WOO 0.0 0 300 3 00 I

S rn · - * <fH ft) EH <42 0 0 WOO ® Ε- »C m C Eh

> O OOO kJEH <Eh <Eh Eh Eh C JUO OOO

I S moo moo moo ooo c c eh ooo I

I, g to EH C NO O MOO WOO m 2 Eh woo I

> O> 00 O Eh 41 COO AOO OOO AOO I

I w R W <EH moo m £ H <OOO WOO wOO I

I m g 42 Ο O NC Eh NO Ο M Eh <OOO OOO I

I ®. g Eh C Eh iJ <Eh O Eh C H C Eh W <Eh CO Eh C I

I <52 0.0 0 300 300 NOO 300 OOO I

g WOO OEH «i O Eh <MOO O EH <M Eh 3 ** g Eh Eh <kJOO kJOO OOO kJEH <m C Eh

I $ 2 300 300 moo 300 moo now ο I

I Mg O EH <ft) Eh C NC Eh ft) Eh C> ιϋ O MOO I

Mg kJOO kJOO kJ C E · kJOO OEh <ooo

I όΗ (0 <Eh μ 0) ο O 300 h Eh 4 NO O 3 C E · I

C 3 MOOC 42 Eh C M <Eh 0) 0 0 MOO m 3 Eh

Mg COOm A Eh 3 OOO OT E · C OOO OOO

I y! W Eh <SI w u O COO mOO m C E * 300 I

3 0) 00 0) 00 MCE · μ <Εη μΟΟ ΦΕη · 4;

I 3 w C eh MCE * OOO SOO COO kJOO

I P omoo COO 300 NC EH 300 HQOO I

Γ Μ · Η <ΕΗ m C E · ft) Eh C MOO ft) Eh C moo I

I g ISOO OOO kJOO OOO kJOO coo

I 3 ao o ooo moo coo coo coo I

** · WOO OWOO OMOO o ft) EH c Ο m c Eh ο μ <Eh I

I EhEh <mAOO n <WO miJOO r ^ OOO <λ Ο Ο Ο I

I. 300 300 mCEn 300 300 300 I

m Μ Φ Eh C ft) Eh C MOO ft> Eh C 0) Eh 4 ft) Eh C

I m MkJOO kJOO COO kJOO kJOO iJ o o

I woo NO o MOO moo 300 I

In moo moo my moo v e · c

I W Eh 4 OOO> 00 COO kJOO

I WOO OiEh c 300 COO NO Ο I

moo W C Eh ft) Eh C m C Eh mOO I

w c eh coo kJoo ooo ooo I

I moo NO O 300 woo coo I

I MOO MOO MCEh 0) 00 m C Eh I COO OOO OOO UCEh ooo 25 DK 175551 B1>, tfti C U U kOO O O O o o o HUU π tf Ei> itf Ei f O tf tf O tf

OOO OOO Ei f tf tf O O tf U O

aoo α »oo huu f tf pooo ajtitf js η« i tuop Ei <<ooo .JUO 0. | h <CO £ i tf Ei O t · tf tf t · a tf t · «β e« tf πϋϋ tf tf pt ; o o nUO «f tf t · O Ei tf Ei E« ooo tfOO> 00 O O O tf tf o

3 C tt κ f tf 300 f tf O tf O O

H tf ti «00 r-l <f tf o p t« ta <C) o U »Eitf OOO O tf Ei O O o uoo to υ o apu u tf o o ti ei IV f <4S HUO tu ti tf U O O tf O tf

Stft · tfOO JOO f O t · E-t <E-i © COO ° ®OOotUUU 4! o o <u o rsrHtfti * · £ f tf »© £ titf U tf ti O O tf

«HUUO HOiEi <O O ti tf O O

COO (QUO KOO O 4: tf t · O 4! M ri 4! Ti rtuo <UOU OOOO ti o 5 OOO tfOO W 4! H t! Tf El O tf Ei n DlOU ooo C oo O tf ti 4: tf ti «2 KOO κ OO ri c El O <2 El ooo

Z ti f 4! 0.00 OOO O f O O O O

QJOO u O O 3 0 0 O t! 4! O El O

H rH t · 4! 0> f tf Q> f <tf El P El O tf H s tf El JOO 2 tf t · O El o

^ κ O O {Q O O tfl t «tf O El O tf O O

£ 00 rtoo -H 4; El O tf El O O O

j f tf Ei 4: oO 0300 O O Ei O O ti

Μ KOO> it <KOO <ti El El El El O

£ O O rt O O {UOO AOU O tf O O O

OQ f tf f OOO 03 Ei <O t · <O O O 0 4!

iQ O O COO (O O O vOOO O O O O O

rt O O ntfEI n O O r * κ O O «£ t <O O O

^ 4300 OOO tfOO HftUU tf O Ei tf O

V ti tf KOO Ή t · tf COO Ei O tf O O

£ El tf £ O O (O Ei tf Π tf Ei f O O O f

O. El tf t * tf El> 00 OOO H El O O O

0.00 OOO 300 (OOO tf t · O O O

OJ tf f KOO 0) El tf rtoo Ei O t · t · O

tfOU P. O O J O O tf O O O O O O tf

(QUO COO rlOO 3 Ei tf El Ei O O O

ΠΟΟ n tf El tO El tf tU Ei tf O O El t · f

tfOO OOO> 00 JUO t · f O O O

O ri O O 0300 o> iO O O «OO tf O El tf O

rt (0 El tf m Cl El tf I / IHOO r * tf f Ei t * O O £ i

rl> OU HJOO rt O O O rlfflOO t »O O t« O

„0.0 0 (OOO PitfEi OOO tj El tj tf p 0) tf El ri O O rtoo KOO tf O O Ei Ei

tfOO tfOO OOO tf O O H O O O O

300 Oftf (O tf Ei = * «C tj tf 03 tf tf O

0) Ei tf KOO rtOO Φ Ei tf tf O u tf Ei O

JUO Λ O O tf O O J O O Ei tf CO tf t · O

COO (OOO OO O rt Ei tf Ei O tf tf O

ri tf H rtoo KOO IQ El tf El O tf El tf

OOO tfOO tfOO> 00 tf O O Ei O

3 00 UOO O'O O OOO El O tf El El tU Ei tf at t <tf KOO KOO o o o tf o JUO £ tf El tfOO tfOO El tf El El El «

I DK 175551 B1 I

I 26 '"I

I H 4 H 4 O O I

Η P 4 O 4 4 I

o h 4 4 o o

I 000400 I

η h o o 4 h I

o o 4 o o o I

I - · o o o o o o I

o o o o o h η η o η o h

I O E * H O O O I

H O O 4 O O

4 o o o h o I

I o o o η o h I

O O O Η O H

O Η Η Η O H I

I 0 4 0 0 0 4 I

Η O ϋ O H O I

- η o o h o 4 I

I <o o h o 4 o o I

æ H o o o 4 o I

* J O O H 4 O H I

I o 4 U 4 O 4 O I

«W O O O O O O

o o o o o o I

I 4 O O Η O H I

· Η O O <H O O I

H 4 O O Η H O

I> 4 4 O H O 4 I

400000

j Eh 4 H 4 O O

I u h o o o o o I

I H o O 4 H 4 I

ffl 4 H 4 4 O O I

I 4 Η O O H O O I

4 4 4 H O O

Η 4 O O O H O I

I Η O O H O O I

Η O O Η H 4 I

Η O O O Η H I

I 04HHHH I

H U O Η Η H

O Η O Η Η H

I O O 4 Η O Η I

O O O Η Η O I

H O 4 O O H

In 400,000 I

4 Eh o Η H 4 I

404000 I

I O H 4 Η Η H I

I 400400. IN

4444 HH

I 000 000 I

4 HOO O 4 I

O O H O 4 O I

I 400000 I

00OHO4 I

000000

I O 4 O O 4 H I

HOOHOO I

OOOHHO I

i

27 DK 175551 B1 <o <Eh <u o <eh o o o

Eh E-i o o eη o o o

Eh u o h o o OM E- ·

0 3 O

xi <W <u o <^

Eh U U ^ ~ o <o °

* <fr- o S

2 o υ o 1 u e · <o “o <υ e- * £ <o eh Λ o o o 13 H <O Eh.

> 0.00 {i

O <<S

J <u <§ o Eh 2 Λ 'M <Eh Eh O 7 «S ^ $ 7 7Γ« 5 s S ss. * · Ssgsi O o O% ooo <Λ' 2 O EH o 5 <o EH ** 5 OO EH> · 2 OOO no

Eh O <m U

O Eh o X M

* »* S M

<Eh O Λ>

8 S 5 g S

, O O EH 7 e> O O O Λ

Eh Eh £ h S Ih O O Eh C? "S *

O <O

O <<

o o O

O o EH

I DK 175551 B1 I

I 28 I

I The following characteristics of the sequence in Table I

I VII should be noted. At the 5 'end of the sequence, bases, I

In line with what one finds in a poly G cDNA together- I

You tie. Then there are approx. five bases (designated "N"),

I 5 whose sequence could not be determined exactly by Sanger, I

In et al. the procedure due to the long G sequence, .1 in which immediately precedes. The sequence that follows

You exhibit a series of 12 codons encoding part of I

In an assumed leader sequence for the polypeptide. On the basis of I

In correspondence with the terminal amino acid sequence of na- I

In heparately isolated hpCSF, described in Example 1, it is I

In the first threonine residue in the assumed "finished" form of

In hpG-CSF denoted by +1. Then it is seen that you finished

In hpG-CSF, 174 amino acid residues, as shown. After I

In the 15 "stop" codon (OP codon, TGA), approximately 856 occurs

In bases belonging to an untranslated 3 'sequence and I

In a number of A's in the poly A "tail". Unique HgiAi and Apal I restriction endonuclease sites, as well as two Stool I sites (discussed below in conjunction with construction

In 20 of a procaryotic and eucaryotic expression system) I

You are also shown in Table VII. As no asparagine re- I

In steres of the polypeptide, there is apparently no positive

In tions where one can N-glycosylate. They emphasized you

In six bases near the end of the 3 'untranslated

In sequence, a possible polyadenylation site represents. IN

In One should note that both the two additional cDNA

In clones identified by the hybridization procedure I

As described above out of a total of 450,000 clones, not in-

You included DNA encoding the entire leader sequence from 'I

At the transcription initiation site and forward. All three

In hpG-CSF clones, the 5 'region actually terminated at exactly ag I

In the same place, a sign that the secondary structure of I

In the transcribed mRNA severely inhibits the formation of I

29 DK 175551 B1 late of cdna beyond this place. In practice, therefore, a cDNA expression screening, as described by Okayama, et al., Mol. and Cell. Biol., 3, 280-289 (1983) and used to isolate GM-CSF by Wong, et al., Science, 228, 810-814 (1985) have not been used for isolation of hpCSF DNA, since such isolation systems are generally dependent on the presence of full-length transcribed cDNA in the clones being examined.

The above-mentioned sequence is not directly capable of ensuring direct expression of hpG-CSF in a microcirculator. To achieve such expression, the hpG-CSF coding region must be provided with an initial ATG codon and the sequence must be placed in a transformation vector at a position where it is controlled by an appropriate promoter / regulator DNA sequence.

Example 5 In this Example, cDNA encoding 20 for hpG-CSF as isolated in the previous Example was used to search a genomic clone. A phag λ human fetal liver genomic library [prepared by the method of Lawn, et al., Cell, 15, 1157-1174 (1978) and obtained from T. Maniatis] was searched by a 25 notch-translated probe consisting of two hpG-CSF fragments isolated by digestion with HgiAI and Stul (HgiAI to Stul, 649 base pairs; Stul to Stul, 639 base pairs).

Total approx. 500,000 phages were plated on 12 (15 cm) petri dishes, and the resulting spots were removed and 30 probe hybridized using the Benton / Davison method [Benton, et al., Science, 196, 180 (1977)]. A total of 12 positive clones were observed. Three clones (1-3) that gave the strongest signal by autoradiography in one

I DK 175551 B1 I

I 30 I

In the second search, were grown in 1 liter cultures and I

I depicted by digestion with restriction enzymes and Sou-I

I simply use a radiolabelled 24-mer I

In oligonucleotide (kinase with γ-32p ATP) I

I 5 5 * CTGCACTGTCCAGAGTGCACTGTG31. The imaging results vi- I

Assuming that isolates 1 and 3 were identical and 2 contained I

In 2000 additional bases 5 'provided for the hpG-CSF gene. There- I

In for, clone 2 was used for further characterization. IN

In DNA, clone 2 was digested with RI to release an I

In 10,8500 bp fragment containing hpG-CSF, this became I

I after the subclone of pBR322 and further subjected to I

In formation by digestion with restriction endonuclease

In leases, Southern Blot, Ml3 subcloning and sequence splitting-I

I ing. The sequence obtained is shown in Table VIII. IN

31 DK 175551 B1 O O O O o o o o o o o o o o η «Ν« * i «in io r * U U U Η X 4 H J u U O U O O U U 3 p U 4 U O u U H« p e «υ u o o. U P j c j

P O 4 O u U O CO

u o 4 ε * οι o - u h 4 4 O U 4 «4 u o o U p U U CO U« O 3 p u P § «u h 4 u h« g «

POÉ-IH O O Η I iJ U

P Q P U u U 4 <0 o

O O P U C. O O HU

Ο Η H O E «4 O O

4 υ P o <open <UUH <HU Q u Η OHU 4 PP u UOUU on uo 4 4 OU w UO oou 4 h eu uol · * O El u U> 1 <oo OH 4 UH o O Et 5 S ii: 3 g S g 4 o υ η ho <o

0 0 0 4 4 0 U O

4 O U 4 o JJ O 4 U

O O H E «« »H o u

O O Η O I X 4 P U

O E * P o u p o 4 U U 4 U P 4 O H 4 u u o p

4 U 4 U 4 p P

M O 4 4 U o P U

Γ1 4 CJ 4 O 4 U U

□ u40o u o e «

0 4 4 0 U O U

> 4 4 U E-> O * 4 E *

O U H O 4 O P

4 E-t E «U U O P

υ η h e * u o 4

U O 4 O o 4 O

ω P E «4 4 U O O

w P O U H O O 4

mUH4H 4 p U

“E <E« U U U P 4 .OOUU U 4 4 «« 4 E «H O U U p

4 U H 4 O O O

E-IU044 4 O O

O 4 P E «U H 4

U U 4 U O O M

U E «O 4 H U O

U H 4 H U U O

U O U E- U O E-i

U E <H 4 O H O

SH 4 e 4 U O

HUE «O U 4

U U O O O O O

4 U 4 4 - U U E- ·

U O U 4 U U U

4 4 0 0 U O U

0 0 4 0 O 4 O

O H 4 O 4 O O

4 O 4 H U 4 O

4 O U U 4 O 4

4 O E «U 4 O O

U U O H 4 O 4

O O U 4 4 H O

0 4 4 4 U 4 U

O U O 4 U O U

O E-t O H U O U

4 4 0 4 U 4 U

O H O U O U E- «

4 U 4 O O U P

O H 4 H O U P

O O U Η H O O

4 O O H U O 4

4 0 0 4 O § * U

4 0 0 4 4 6 * U

U 4 O 4 O U U

U U O U 4 H 4

U U O U H O U

Η H 4 4 U Η P

4 E-t O U U O O

4 U H 4 U 4 4 O O E-t O U O 4 4 U H O U H 4 P O O E «O O E-t

P O 4 E «O 40 P

E- * E-t O U O co H O 4

UOOH 4 H <U H O

OUOO 4 1X4 O

O E-t 4 H 4 30 O

4 U 4 E-> Η «Η O

U O O 4 4 JO E-t 4 O O U E «oao 4 0440 O fs>, 4 4

O U O E «Η I J 4 O

O 4 O U 4 J-t O O

OUOU E-t »Et O

I DK 175551 B1 I

I 32 I

I o o o o I

o o o o o us O O O r-t fM ri

CO A H p4 Η Η I

I Q I

> U (9UHuau

O C <£ U U O O n O

y «« u u t · S

I yU «UU <OU

3y <UOUwU

> h <f <o u a u

I ου υυπυαυ I

? <o y o u <- · f

U t · O O O U> i O

»O <u <u η ϋ * o o o o« o o u t · o u <u s o · a u U H U U 0) p u <tio <owti

3U U <OU0> Oh

at · u u <o to ti uuuuo <au 3 0 U U t · O -w <

OJttUCUUWU I

In ουο3Ρ «>. <Au <. o u <^ u

£ t «<U UUOO

ft t · O U U U O 3 U

> - U u free U U man au o u o u u u -j W <<U U U 3 o

t, CU O U O U Φ H

I m * <U S <<O U

I °} uu e 3 3 u · ~ ι o I

-t- * OOU UUUU ro t · I H 14 U tr u u <> o

I 0 A U UUUU 3U

4-1 3 0 UUUOVt ·

I · - a H O H <U U U

J U U U «£ U 30 w, U <o 3 u ή <I μ„ ϊ U y «o t · u u I E» i t; <u <u 3 u I E -H pOO <r-l <.

r1 au ti ti o o u u I> w <ou «<ou

<0 U UCUUUU

I Ί u u u f <t ft u U <U t <U Eh u «u I O E * O 4 4 U" <4

H u U O O U 4 SI U

I ft u 4 u <u au I ta> i y o 4 u 4>, u n Ή O E-I El t * <U f

^ UU O f 4 4 3 O

<> au 4 4 U O a t ·

„Φ t · O t · O U» 4 U

E-I UU t! is U U O O u I o u u <«<o»>. * <uUu13UUU4U4

ftUmaif CUU MU

^ O U U O H O> 1 <+ .COaOUOOE * ti

t * 4: * 4 u 4 4 W.U.

I -lflUU <6-iUOjCU

I i u s u 4 o u t <4

I <Ur-l-iUUtl <eU

I 3 <UU <ti «C-4U

I -H4 eou4U40 υυ «-Η <υυ <ΌαΕ-ι

CU UU U U U ri> 1 U

I <- «4 3U4 0UUt · I oua> ti <ti <o I I-IUUUUUU 4

10 El O (0 o U O O U

I> O nrHU f O O U

I »- << uut'tu I x: yiQ <tiuuu I E-I <r-ι u U U U f I OtU <UUUU <'

I up> .UtiU * <U

I Eiti ^ O * C <iUU

I 3 u y u u u <t · I aE-iD.E-irfU <f I uym <iuuu

I <0 << UUUt * U

I r-ι u>, U U ti U E-I

I <UrHUUU <<

I ufUUUU <U

I a u c o o H u u 'I co <> h << uu <I ocnuuuu << u I rH - i <auuuo t · I i m u rn t- e c <; u I 0tUM <UUU <

I ^ UaU4U <U

I t »ti>, rf <2uuti

I 3UU <UUUU

I aHcroufUti

In JUuOE-iOUU

I 3h << cuc <I aE-ir-iuutiUu 33 DK 175551 B1 O O O O o

O O O o O

in vo r- oo H H r-t H r-l «2 c <4 o o uo U H <O Η ϋ O 3 4 SOU Η α H H« - * 3

now H> o 4 UU

See »U a U H Η x» u tn <m <o ™ α h u au 4 o Η H * 4

O α f> 3 0 O O

S · J H 01 ft H <au j u u u 4>) o co u 4 3 uh h <o u o >> u o u o u O H O 3 o o u 4 O O (UH u u O cm a 4 lJU U u

O r- p— <U n 4 O H

4 4 O £ O 4 H

o O H 4 y H

4 <au 4 u o u a 4 u o y <<o y 4 4 u 3 0 4 u 3 Η a H u 4 O U J H o u o f * n U O ft O O £ U O 4

Jj O Η H 4 H O

O U O U u H

S 4 ft now H U

® o u au h 4

t-> o O ©> t H 4 U

n 4 u o rH u u u O O Ur-too O 4 m Η H 3 0 O 4 - 4 H <D H H u

4 U »J H U U

H f ft 3 0 p U

H U U h 4 H o

Γ1 O 4 O O O O

ti 0 4 O O U O

> 4 f · nU H 4 4 U au O 4

ft U now O O

J 4 U 0 »U 4 4

O U tn H 3 U

M O U 0) U U ft

4 4 HH U U

to 3 U H 4 O 4

w 3 O> i O O U

^ O 4 η O H U

'. O U O O O U

, 4 O 3 4 O O

H U O h 4 O U

H 4 O O <4 O U 3 0 U 3

Η Η 0 »Η O H

O U J U O 4 4 h au o 3

O 4 HU Η H

Η H 4 0 H O

O O O C O O H

h 3 O U 0 \ H 4 Η H

and H 4 OU Η H

h) U O 3 0 u 4 oeu H aiH u u

P- H 4 U tJU O H

O U U 3 U 4 U

3 0 O β »H O U

0) H O | J U Η H

►YO O> 1 o O H

au o p — i o o c o h HU O O O CM H 4 4 40 H COHOU u CO U h 4 co o H 4 O O U h 4 4

OU 4 now OU U

now 3> 4 ao U

a o U HH np U

ID 4 U 3 U HH U

ου h and au u

now H JU HH O

au o au h 4 <au O £ H now u

> 1 O 4 aH £ U H

UH U 3 H H 4 O

now U and now H

a o H JO £ o u tn 4 U> .U H 4 o

now H HU au H

a o O O O HU 4

ID 4 H o now 40 U

30 4 coao and U

and u tn 4 £ η H

►j u u aH and o

oou U H 4 au H

vo n U U au «4 U

au u 3 u 4o u aH H aH au u pH u u J U hu o

I DK 175551 B1 I

I 34 I

I O O O O O O O O I

O O O O O O O O

I n

s-t M (M (NR N <NIM (S

I „i 4 Ei P P P £ i P t <I

I s u 4 p p 4 f 4 p I · - u e p P 4 p p h φ υ 4 P p p p 4 p I (At · 5 υ u <u <<<o p huu uuhu

In r P P free P 4 Not P P

I <p ti (J <p <U4 I <- · P <Ei u G υ ti p

itj ti ti P p p p P P

I> p p 4 p P P p p 3 G h u u o υ η G m

I »ti U ti Ei ο υ η G

I h3 O t * Η P '4 P H <

I r P P P P P P P P

I li Éi · ti O ti O P Ei P

I> p P4ppGp4 O>, U Ei O * t ti o u o

I m «- * p 4 free p P P Ei P

I ri O P Ei U Ei ti <U P

I> 4 p ti <p u f υ

I r P P P P P 4 4 P

I p G <f p <u <p I 10 <P 4 4 P O P fr *

I rip P P ti fr <P G P

I _ 4 P P P P 4 P G P

I 7? 0> P Eifri 4fr'4PP

I t, Ί u <P Ei P P ti p I <0 4P PPp4PPp I «σ> ρ u p P o p p p

I iJ ti P P free 4 4 P P P

I ti 4 P O Éi Ei P <Ei <I 0 c P Ei P P Ei P ti P; I «Μ ri 4 p p 4 ti h 4 4:

I w PP P free 4 P P 4 P

I <up ppppppp

In £ ti PEiPPPPP

I p »ti <p <<G <p I ti (Q Ei 4 fr · free P P P free I ti ri u p p 4 p p p p

I M 4 P P ti <P f P P

I> We free P P 4 P P ti P.

I 0) P <P Ei P <P G

I mtiotppppppppti I j {OP OEipP <tipp

In riPtrOP << PPPP

In M <Pr »MPPEiPPtiP

I w ootprio.pp <pppti I _ i? n ti cp pp pp pp I ffl ri Di Ei ri <P4Ei <Pti I _ (OPPPPEiPPPti I 4 ri u (QP <PP PPEi I <PriPPPPEi £ iti, I ti OP 4PP << Ei <ti

I. tiP SHPPPPPP

In eup®H «£ ptiPPti

I -UPJP ^ PPtiPP

I a) EiomuofiPP <p I X <t ^ ri <<PtiPPti

I (0PriXPP <PPPP

I riPOtPPPPEiPEi I <Pt.P <PEiPEip I> Éi <PPEiPti Pti I ri Ό. 34 4 0 0 4 0 0 I pp®ti3ppp <p I CO> 40000 004

I ri <riEiPPPP <P

I PP (0tipEi <PPP

In ten P> p <<p Ei P P

I jCPPPPPTitiP <I ti <tip <ppp pp I OP <PPPEitititi I tiPtiP <tiPPP <I AO> 14400 400 I OC0free4 0 0 0 4 4 I η h <tip Ei ti P P P 4 -

I ri P P »PtiPP << P

I 3PWtitiEi <PPP

I ȣ irip <pptfpp H

In PP IT] ti Ei P | i <<< P

In lOP> P4 Ei << 4ti

In riP3PPPPHPP

I <Pri <tiPPEi << I 0tippp <ptipp I ti P 3P P 4 ti 4 P ti I 0iP <UtiP4Ptititi I (0PPP4444PEi

I ri P ΟΦΡ 4 4 P 4 P P

In 4P vo JC ti ti P P ti P P

I -tjPri0ititi4PtiPti I ®ti tiPEiPPEip 4

I X <ft) P4EiEiPPP

I> i4P4tiP <ti44

I ride on CPP4 4PPP

In PPrH4tiPPPEiP

I 3 P pppppppp H

I »ti 3PEi <titititi I PP ®Ei4EiP <PEi I 34 PPtiP ,. ti 4 P 'ti I ri4mEititiP <Gti 35 DK 175551 B1 o o o o o OOOOt "oo σι o o r * γν cn m o

E * ta H H

P tf ta u 3 o tf

U 3 tf H

u ti ta u ta tf o u ta i p <

tf E · * tf U

u tf ta ta H O <<p o u ta

H tf U H

tf U 13 U

υ e * o h H H tf tf

tf U Ο H

3 <tf S

ta 3 ta h ta o o <<Eh O 6 «ta υ h tf g tf ta u <3 G <u h S o <ta tf ta. o t * 3 <4j tf e «p e ti υ <h h S o o o u ® tf tf ta o f * ta u p u ta ^ O E« Η H tf

O to O O E * O

* w <e «o <u

^ ta U tf U H

o <o e «υ H p u o H tf.

h S υ o <u tj ta. h ta u ta 5 H 'U H tf E «>> tf u u ta u ta υ ta η h _ o u o u tf ►3 t3 H 13 H 3

g O t3 u CJ

Μ Η H tf U CJ

o ta O η e «CQ tf tf U H tf w ta cj o ta u tf ta p ta tf tf ta tf e« 3 ta _ ta U u u tf

Εη Η E «tJ fr> U

tf u ta υ ta ta ta tf e * ta po ta h tf hu ta ta 3 υ uh tf u ta υ υ tf tf e «u ta 3 3 t * o tf ta ta υ tf υ ta ta ou υ« <ta ta e «h ta tf eh h ta ta uhu tf tf ta hh ta o tf tf uh ta uuyh tf tf tf tf u ta u ta oh ta tf ta u η ta ta E4 ho tf ta cj α ou ta ouhu ta ta υ υ l · * he * tf u ta u ta oe <ta ta ta HH tf Η tf ta tj ta ta u eh u ta tf ta o fr · tf 3 ta tf ta ta h tf uu ta u υ υ tf ta ta ο η u ta ta ta υ h e- · ta ta ta ta uh ta tf tf η u tf 3 o ta ta h ta o ta uh ta h tf tf Et <u ta ta e * 3 u ta tf ei 3 ta tf uu ta h ta ta

E-t Η E ·· ta H

u ta h ta ta tf E ·· ta ta e * ta ta h u u

I DK 175551 Bl I

I 36 I

I Bt restriction endonucleoase map (about 3.4 kb) for I

In genomic DNA containing the hpG-CSF gene is shown in de- I

In the waistband of FIG. 1. The restriction endonucleases of FIG. 1 I

You are: Ncol, N; PstI, P; BamHI, B; Apal, A; Xhol, X; and in

I 5 Kpn, K. The arrows below the map show the sequencing I

In strategy used to obtain the genomic sequence

In the quince. The framed regions are those found

In there, in the cdna clone and the punctured open framing, I-

You present a sequence not found in the cDNA clone, I

In 10 but is identified by only with mRNA probe. You go out

In it, the identification of the coding sequences leading to I

Reset to exon one by Northern blot analysis. A 24 more I

In oligonucleotide probe, 5'CAGCAGCTGCAGGGCCATCAGCTT3 ', which I

You excited about the assumed joining compounds I

I 15 for exons 1 and 2, was hybridized with hpG-CSF mRNA I

In Northern blot format. The resultant merely shows an I

In mRNA of the same size (about 1650 bp) as seen with I

In an exon 2 oligonucleotide probe. This result and the ability I

I to direct expression of hpG-CSF from pSVGM-I

In the 20 Ppol vector (Example 9) with Met initiation codon, I

As shown in Table VIII, the coding sequences defining I

You are in exon 1. Exons 2-5 are defined by the coding I

In sequences obtained in the cDNA clone (Ppo2) from hpG-I

In the CSF gene (Table Will). IN

I 25 I

In Example 6

In the example, preparation of a prepared I relates to

In a gene encoding hpG-CSF and comprising codons for E. I

In coli. I - I

In brief, the same procedure as I used was used

You are shown in PCT Publication W083 / 04053, Alton, et al. Gener- I

I ne was constructed, first assembling component I

In multiple duplex oligonucleotides, which were then assembled into three separate sections. These sections were constructed so that they could be readily amplified and, after removal from the amplification system, assembled in one order or by ligation of many fragments into an appropriate expression vector.

The structure of sections I, II and III is illustrated in Tables IX-XIV. In the construction of Section I, as illustrated in Tables IX and X, oligonucleotides 1-14 to 7 duplexes (1 and 8; 2 and 10 g. 30 µg; 4 and 11; 5 and 12; 6 and 13; 7 and 14).

The seven duplexes were then bonded to form Section I as shown in Table X. It should be noted in conjunction with Table X that Section I contains upstream an Xbal adhesive end and downstream a BamHI adhesive end useful for bonding with amplification. and expression vectors and for section II ligation.

I DK 175551 B1 I

I 38 I

I TABLE XX I

I 5 I

I EChpG-CSFDNA SECTION I

I CTAGAAAAAACCAAGGAGGTAATAAA 1 I

I TAATGACTCCATTAGGTCCTGCTTCTTCT 2 I

I 10 CTGCCGCAAAGCTTTCTGCTGAAATGTCTGG 3 I

I AACAGGTTCGTAAAATCCAGGGTGACGGT 4 I

I GCTGCACTGCAAGAAAAACTGTGCGCTA 5 I

I CTTACAAACTGTGCCATCCGGAAGAGC 6 I

I TGGTACTGCTGGGTCATTCTCTTGG 7 I

I 15 CATTATTTATTACCTCCTTGGTTTTTT 8 I

I GCAGAGAAGAAGCAGGACCTAATGGAGT 9 I

I TGTTCCAGACATTTCAGCAGAAAGCTTTGCG 10 I

I CAGCACCGTCACCCTGGATTTTACGAACC 11

I TAAGTAGCGCACAGTTTTTCTTGCAGTG 12 I

I 20 ACCAGCTCTTCCGGATGGCACAGTTTG 13 I

I GATCCCAAGAGAATGACCCAGCAGT 14 I

39 DK 175551 B1 O CJ O O O O o u o «u U rsi t tf coou t tf H O O HEh <α o o o o o t tf t tf tf t o o o o t tf t tf u υ o o t tf o o ου O O tf t Et <te o o o o

o t tf o t tf o O O

moo HOU r- tf t o o Huo hoo HC <M O O Hl tft O O tf t h | tf ti ni O O - »lo O O O H |

f tf O O tf> | U O

«Νίου t <o o o o tf t o o tf t! tf t t tf o Eh tf O tf E-ι o tf t

O tf E-I iflUO

tft H E-ι tf h O O

CJ O O CJ O O

CJ O O O t! tf

Eh tf Eh tf O CJ

x O O E-I tf t tf

tf E-ι O CJ CJ O

o cj o cj tf e a t tf tft tft ω © tft ouo otfE-1

η tf E-ι cn tf t m cj O

m t> tf tft Htft * tf e-ι υ υ t tf tf tf El O CJ t! tf

tf t And tf U O

ti E-ι tf U O tf E-i ^ tft Eh tf Eh tf tf e-i ου υ o

E-ι tf A tf O U

HH t I

σου o tf eh ουο o o as z <N o υ oo tf eh Η »ου o tf e O tf Eh tft« H ti tf H t <0 μ. o υ ου ου o one

Eh OUOOl titf Eh tf OO

υ tf Eh υο υ o ου W Hitf f ηίουοΙ tf EH EH tf W υο. t tf ΗI tf Eh CN Eh tf υο uo mitf f η υο tf tf Eh f tf tf Eh Eh tf

Z

Q O tf Eh o t tf O tf Eh O U O

Cm H tf £ h r- £ h tf η O O CJ \ t tf C / l tf Eh U O h tf Eh H Eh tf υ tfEn ου tfEn tfti I tfEHH tft OO OCjHfl

O O <0 tft OO Em tf ΗI

α tf Si tft Eh tf MOO

• C t x u o uo oo O O OO tft oo w υ o o o t tf

I DK 175551 B1 I

I 40 I

I As illustrated as in Tables XI and XII of Form I

In connection with the construction of section II, oil was collected

In gonucleotides 15-20 in 8 duplexes (15 and 23; 16 and 24; I

In 17 and 25; 18 and 26; 19 and 27; 20 and 28; 21 and 29; IN

In 5 and 22 and 30). Then these 8 duplexes were bonded together

I to obtain section II, as shown in Table XII. As in

In further shown in Table XII, section II has upstream I

At a BamHI adhesive end and downstream an EcoRI adhesive I

End that is useful for ligation to a multiplication I

In section 10 and for ligation to section I. Close to down-

At the stream end, section II also includes a downstream SstI I

In place which is useful in any connection of sec- I

In Tions II and III. IN

I TABLE XI I

I EChpG-CSFDNA SECTION II I

I 20 GATCCCGTGGGCTCCGCTGTCTTCT 15 I

I TGTCCATCTCAAGCTCTTCAGCTGGC 16 I

I TGGTTGTCTGTCTCAACTGCATTCTGGT 17 I

I CTGTTCCTGTATCAGGGTCTTCTG 18 I

I CAAGCTCTGGAAGGTATCTCTCCGGA 19 I

I 25 ACTGGGTCCGACTCTGGACACTCTGCA 20 I

I GCTAGATGTAGCTGACTTTGCTACTACT 21 I

I ATTTGGCAACAGATGGAAGAGCTCAAAG 22 I

I GACAAGAAGACAGCGGAGCCCACGG 23 I

I ACCAGCCAGCTGAAGAGCTTGAGATG 24 I

I 30 ACAGACCAGAATGCAGTTGAGACAGACA 25 I

I CTTGCAGAAGACCCTGATACAGGA 26 I

I CAGTTCCGGAGAGATACCTTCCAGAG 27 I

I TAGCTGCAGAGTGTCCAGAGTCGGACC .28 I

I ACCEPTED TAGCAAAGTCAGCTACATC 29 I

I AATTCTTTGAGCTCTTCCATCTGTTGCC 30 I

41 DK 175551 B1 o U O β <Ε <'VOH <Nh <® Eh <o u hold —t u o

H <O CJ M O O

Η 3 σ \ «£ Eh cm | Eh <«Λ (9 0 h | 3eh Eh3cn | eau oa hm eh <p a cn | u p a o ti <<h o a a o o a opu O Eh <O £ h <

in E-I <HUO Γ "U O

uo keep hold O O <Eh <i * <Eh 3 Eh Eh <u o ^ o o o a ^ voiE- · <cn | o a eh <h | Eh 3 Eh <<Eh o o a o o a E-I <Eh <- <f

M

ouo ote OB C K

• «r o a ouo«> u o o

<H H Eh <KEEP O

3 H 0U * 0 <Eh <W

UO COOUCM uo 3 H Eh <h | o U O y eh H UO <fH Eh <£ h

X EH <UO UO OU

<H Eh <Eh <<H

UO <Eh UO 3 Eh

M

OUO OEh <o <E-I O c EH

W n Eh <5 OOU iftUO Η U O m

_ OU Eh <H <£ h M Eh <JJ

ffl Eh 3 Up OU U O 01

Eh <UO OU® OU CO

<UO Eh tf Eh <«n | " 'Eh,

Eh Λ Eh 3 O U O, Ο O O

Eh Eh 3 OU <s | tH <Eh n | U O Eh <U O w | 3 Eh

M Eh <UO <Eh OU

* -H

oou o Eh <o O U oou Z <NEh <® O U htUO O Eh <

O U O OU HUO N <EH

m OUr »| Eh <Eh 3 OU

Eh iftlU O and U o OU <Eh U H U O Eh 2 O U Up ca eh 3 eh3 oy co uo <εη «λ eh 3 3 Eh OU r ^ lUOCN up uo

3 O U h | o U <EH O U

z

0 ow O Eh 3 O <EH OOU

b H EH 3 r * U O που «Λ §H <CO OU <Eh HOU H Eh 3 U UO 3 Eh UO ^ 3 1 UO UO UO 3 Eh O O M Eh 3 Eh 3 Eh 3

and EhSUO UO UO

C. 3 El H4 Eh <3 Eh U O IQ OU UO Eh <a «Εη <eh 3 u o

I DK 175551 B1 I

I 42 I

Finally, Section III was constructed as shown in I

In Tables XIII and XIV. For the purpose of this Constitution

In tion, oligonucleotides 31-42 were pooled into 6 duplexes I

I (31 and 37; 32 and 38; 33 and 39; 34 and 40; 35 and 41; I

In 5 and 36 and 42). The 6 duplexes I were then compared

I forming section III, as shown in Table XIV.

I As also shown in Table XIV, section III comprises upstream I

At a BamHI adhesive end and downstream an EcoRI adhesive

In the end, useful for ligation in a multiplication vector I

In 10 and, at least in the case of EcoRI, in an ec

In sprinkler vector. In addition, section II has an op- I

In stream Sstl site, useful for possible ligation of sec- I

In tions il and III. IN

I TABLE XIII I

In the ECHGpG-CSFDNA section III I

I GATCCAAAGAGCTCGGTATGGCACCAG 31 I

I 20 CTCTGCAACCGACTCAAGGTGCTATGCCG 32 I

I GCATTCGCTTCTGCATTCCAGCGTCGTGC 33 I

I AGGAGGTGTACTGGTTGCTTCTCATCTG 34 I

I CAATCTTTCCTGGAAGTATCTTACCGTGT 35 I

I TCTGCGTCATCTGGCTCAGCCGTAATAG 36 I

I AGAGCTGGTGCCATACCGAGCTCTTTG 37 I

I ATGCCGGCATAGCACCTTGAGTCGGTTGC 38 I

I TCCTGCACGACGCTGGAATGCAGAAGCGA 39 I

I ATTGCAGATGAGAAGCAACCAGTACACC 40 I

I CAGAACACGGTAAGATACTTCCAGGAAAG 41 I

I 30 I AATTCTATTACGGCTGAGCCAGATGACG 42 43 DK 175551 B1 0 <h o fri 4 ouu nuo

O O rH E-) <M

O O 4 fr · 06 O O 4 l · * o OO oo 4 o

O O O O 4 W

fr · 4 free 4 Eh 4 fr * o o eh

fr «4 fr! 4 O O

O O O O 4 fr <O 4 free inuu HUU fr · 4 EH 4 rH free <J Ol M 4 free O O O O «1 4 fr · OO® η * | Εη 4 free 4

NW fr n [COIEH 4 o O

n | 4 fr * O O O O

O O O O O O

fr · 4 free 4 O OPHl O O free 4 4 fr «* r \

o 4 free o O O o O O

FET ooo Ό Eh 4

O O rH free 4 HUO

O O O O O O

> 4 Eh 4 Eh O O

W 4 fr »Eh 4 vo Eh 4 X O O O O η | θΟ O O fr · 4 Eh 4 fr« 4 O O 4 fr «

1-4 O O O O O O

W OI free 4 o 4 fr · o EH 4

η | θ O «Λ O O in o O

CQ O O O O rH O O

^ 4 fr · 4 Eh O O

4 O O O O fr · 4

O O O O O O

Eh 4 fr · Eh 4 fr · 4 O O O O frH 4

M o O O O O O

M O O A 4 H 4

M

O free 4 OOO OOO

z «Μ 4 fr ·» OO H »00

O free 4 M O O HOO

m O O n | 4 Eh 4 fr «EH rH lo O UCSØil fr · 4 O nlo O nioonl Eh 4

W Eh 4 Μ n fr »4 O O

W OOJ- »Ih 4 fr · 4 O O« 4 fr · 4 fr · 4 4 fr · W O O fr · 4 55

O OOO OOO OOO

bi rH 4 H r- fri 4 n <fr W 4 fr · O O rH 4 fr · 0 4Eh Eh 4 OOrHj 1 O O Eh 4 O O "» 1 O O m o O rnlfri 4

O »Eh 33 O O n | o O

-c 4 ε υ o o o O O «0 free 4 Eh 4 W CQI free | 4 free 4

I DK 175551 B1 I

I A4 I

In the XbaI-BamHI fragment formed by section I, ligase I

I es in an M13mpll phag vector, opened with Xbal and BamHI. IN

Then, the vector reopens by digestion with BamHI I

I and EcoRI, then ligating with BamHI-EcoRI fragment

In the 5 ment, formed by section II. In this step, section I

In Nos. I and II have been linked together in the correct orientation

In the ring. Then you open another M13mpll vector at I

By digestion with BamHI and EcoRI, it ligates I

Then, with the BamHI-EcoRI fragment, formed by section I

I 10 m

The vector containing the sections I I is let

I and II, digest with Xbal and Sstl. Likewise, you let me

In the vector containing section III, digest with Sstl I

I and EcoRI. The smaller of the two fragments contained in both I

In 15 cases, digestion is formed, ligated into a plasmid I

In pCPM1156, previously opened with Xbal and EcoRI. Re- I

In the action product is an expression plasmid containing I

You maintain a continuous DNA sequence, as shown in Table XV, I

I and which encode the entire hpG-CSF polypeptide with an amino-I

In 20 terminal methionine codon (ATG) to initiate trans-I

In lation in E. coli. IN

45 DK 175551 B1 30 H (0 30 3 H 30 ttH <9 H>, <

V H OH 0) Η Φ H 0 »E-« (0 4 HU HO

YES 04 YES YES YES 40 4 0 O O

uH H> H <<9 H 3H 34 04 <0 4 Φ O UH <0 Η Η O β »EH Φ HUO hu UH OO> 0 40 JO JO Pi O 40 uh oa 30 C4> iH CO <0 4 0Ή ® O 4 «Φ Η h 4 HU rH <HU uo UH 04 JO OO OO OO 40 40

<0H H> i 30 UH CO 30 O OH

HO O <H H4 «Ο ή 4 Φ Η Φ H uo 40 OO OO UH OO JO S <40

OH OC 34 04 uH uH> iH C O

U O 4H rH 4 u o> i4 Æ O H O H <

Pi O OO OO Pi O HH H 4 OO OO

> ιΗ ΟΦ OO OH 30 aO 3 0 ΦΟ

rH o H rH u O> ιΟ Φ H (04 Φ H ÆH

OO 4M P | O OH JO 40 H O Pi H

34 4 a (0 H UH ΦΟ 30 30 <9 4

® H 4> i -h <φ O ÆH Φ Η H 4 HO

JH 4 J UO UH Pit · JO OO 40

0 4 Η O Φ O UH 30 uH 34 UH

u O O U> υ ΦΟ Φ H ÆO H 4 ΦΟ

Pi O 04 OH UH JO H4 OO UH

> HUH HH 30 30> <H OO -U O <9 H

b <+ Æ O H <0 Φ Η Φ H HO UO Φ H HO

H 4 0> JO JO OO Pi O S 4 40 • jhjjo o o C o <n 4 o o O ouH o> iH oco o ω o

I Φ H CN 4 H nr> i4 SO U o 00 Φ U OHO (NH4 '»ÆH

w S 4 OO J 4 Pi O UH HOO HOO H Pi η CQ 4 43 uo <0 H OH 30 C4 <9 4

H 4 H> i4 HO h 4 Φ Η H 4 HO

4 4 OO HH <90 UO JO OO 40

ti 4 os uh ao 3 0 3 4 ao O O

^ 4 Η Φ ÆO uo Φ Η H 4 U O U O

H OJ H 4 HH HO OO HH PiO

4 HO <9 H OO C4 OO ΦΗ jj O

4 O> i HO uo H 4 uo Hr * Φ H

H HO 40 Pi O OO Pi O S! 4

O 4 «n« Ο ΦΟ UH UH UH <9 H

O 4> i> iO HH ΦΟ ΦΟ ÆO HO

4 4 J OH M 4 UH UH H4 40

O 0 3 3 0 NO 3 0 ΦΟ uH> .H

O Η Φ Φ H HO Φ H HH ÆO HO

4 O Y O Y O Y m 4 H 4 O O

4 0 3 <0 4 3 Η m H> <H <9 H C4 O Η Φ> ι4 Φ H NO Η O Η O H 4

O OJ J 4 JO OH OO 40 OO

4 Η Φ 3 4 uH> iE <34 Φ H UH

4 HH H 4 ΦΟ HO h4 EH EH

4 H Pi OO UH OO OO Pi Η H4

4ouc4 <oh <oh30 ao OO

4 O Φ H 4 -H 4 HO Φ H 04 UO

4 4 U OO UO 40 JO 40 Pi O

O 4 C 3 0 NH 30 <9 H <9H C 4 4 4 H uh HO Φ H HO HO H 4

H OO JO OO JO 40 40 OO

O OOO o <9 4 030 OCO O C 4 OH4 030 H o u m rH o <τ »ΦΗ r ~ h 4 h 4 h <9 Η πφη

O Pi 40 JO OO OO H> O HJO

I DK 175551 B1 I

I 46 I

I Ofx I

I w o

I 4 u I

I 3 (9 I

I Φ Ex

I I

I Hfi I

In «Ex

I> o I

I I

claw

I <u I

I u u i>. <I ** h

I ki b I

I <u u I 05 E-t

I ^ · * <I

I £> o

I s ίί I

I o uo lu

I W 3 O I

I «Η

I% au I

O dl o vo jC Ex

I J Η ft H

I pq h EH

I «MEh

I <53 I

£ <OU £ x

I 3 0 Ex I

I Φ <I j o <!

WHO I

I · Η <<I 33 U e.g.

I w e- <<I

I φ u <W Ex Ex

I <β H «0 (9 I

I -HU f- u u

<(9 HPiO

I iH Ex G o I

I m Eh i-ι <H

I> o o u

I 30 * Ex I

® E · H O

I »j o <o I

I Hi 30 I

<B Ex φ Ex

> O J U

I O> iEx O O Ex I

ΙΛ iH U -H <

I Ή O O H EC U

47 DK 175551 B1

Although any suitable vector can be used to express this DNA, the expression plasmid pCFM1156 can be readily constructed from a plasmid pCFM836, the construction of which is described in EPO 5 published patent application No. 136 490. First, pCFM836 is intersected with Ndel and round off the ends with Poll so that both existing Ndel locations are destroyed. Then, the vector is digested with Clal and SacII to remove an existing polysaminer before ligation to a substitute polysaminer, as illustrated in Table XVI. This substitute can be polysubstituted by the method of Alton, et al., Supra. Expression in the expression plasmid pCFMH56 is controlled by a lambda PL promoter, which itself may be under the control of a Cl857 repressor gene (such as that provided in E. coli strain Ki2AHtrp).

I DK 175551 B1 I

I A8 I

I Ή

Eh tf «CEI Ol I o o o I o o w

IN

I b <o o p- o u o o

Eh tf

I Eh tf rH

3 ^ 31

Eh rH CM

o o s υι I O U 18

Eh tf σι W |

Eh tf co

OU σ \ U

oo * oo r- I t4 u o rH υ o> U O <U | Eh tf »I k tf Eh qJ <Eh cm I tf ej Si o o οι I Eh tf (JO £

I Eh tf »tf Eh X

I O O rH tf Eh

W O U rH E- * tf M

I «. Eh tf OJ O O £ 0

05 tf Eh cl tf Eh E

Eh tf * rt | tf Eh <fl |

tf tf £ h ffil Eh tf OQI

O O - tf Eh

Eh tf Eh t n> h tf Eh in tf Eh co tf Eh P '31 Eh tf Xi j Eh tf

Eh »Cfll tf Eh. -

Eh rH, OU rH

O O «Η O O O

οα ό ol ao λ I tf eh ζ | υ o a x oo z oo οασι αοΗ tf EH CN r ^> Eh tf 031 tf Eh in tf Eh> I o a - o a tfl

I <Ehih «.oO

Eh tf <0 H tf Eh O

a o -O ci o u r »I EH tf xloJ a o I Eh tf XI Eh tf» tf Eh cm Ο O ή

OUrHrHtfEHrH

I Eh tf and EH tf rH

I EH tf »-Hl EH tf Ό

I Ej tf H W aO C

I tf Eh ID SI O O «Η

In OUrH tfEHS

I a o alco tf eh

Eh tf tn o O ro

I tf Eh rH o U VO

I rH rH I

to 49 DK 175551 B1

Example 7

This Example relates to E. coli expression of an hpG-CSF polypeptide by a DNA sequence encoding [Met-1] hpCSP. The sequence used was partially synthetic and partially derived from cDNA. The synthetic sequence used codons suitable for E. coli.

Plasmid Ppo2 containing the hpG-CSF gene shown in Table III was digested with HgiAI and Stul to provide a ca. 645 base pair fragment containing the final hpCSF gene (as shown in Table VII) with seven of the leader sequence codons at the 5 'end and ca. 100 base pairs at the non-coding 3 'end. Digestion with HgiAI provides a 5 '4 base adhesive end that is identical to what one gets with PstI, and digestion with Chair 15 gives a straight end. This means that one can insert the fragment into Ml 3 mp8 (Rf) intersected with PstI and with the equilibrium restriction enzyme Hindi. After multiplication in Ml3, hpG-CSF DNA was excised by digestion with Apal and BamHl, which respectively cut at the Apal site containing the codons for residues +3 to +5 in hpCSF and by a BamHl. place "downstream" relative to Hindi site in the Ml3 mp8 restriction linker. In order to obtain E. coli expression of the hpG-CSF polypeptide, a synthetic fragment was prepared, as shown in Table XVII below.

I DK 175551 B1 I

I 50 I

I TABLE XVII I

I 5 '- C TAG AAA AAA CCA AGG AGG TAA TAA ΑΤΑ I

5 3 * - TTT TTT GGT TCC TCC ATT ATT TAT I

I Xbal I

I -l + i I

I With Thr Pro Leu I

ATG ACA CCT CTG GGC C - 5 'I

TAC TGT GGA GAC -3 * I

I. Apal I

I As can be seen by analysis of Table XVII, I-

the linker is an Apal adhesive end, codons that you

You encode the first three residues at the amino terminus of hpG-CSF I

15 (and which "recovers" the codons encoding Thr1, I

In Pro2 and Leu3, which were wiped out by Apal digestion

I of Ml3 DNA, described above, and using I

In codons, which are preferably expressed in E. coli), I

translational initiating ATG, a sequence of 24 base pairs, I

I 20 which provides a ribosome binding site and an Xba I

At the adhesive end. IN

The expression vector used for E. I

coli expression was the one described as pCFM536 in I

In Epo Patent Application No. 136,490, Morris, published I

In April 10, 1985. (See also A.T.C.C. 39934, E. coli JM103 I

I containing pCFM536). In short, you were digested

In plasmid pCFM536 with XbaI and BamHI. They were ligated

Iterate the hpG-CSF fragment (Apal / BamH1) and the binding I

(Xbal / Apal), described above, to form an I

In 30 plasmid designated p536Ppo2. IN

Plasmid p536Ppo2 was transformed into a phage I

In resistant variant of E. coli AM7 strain, as time- I

I had been transformed with the plasmid pMW1 I

51 DK 175551 B1 (A.T.C.C. No. 39933) containing a Cl857 gene. Transformation was monitored by the antibiotic resistance (amp) marker gene carried by the progenitor plasmid pCFM536. Cell cultures in I * B herb (ampicillin 5 50 µg 1 ml) were maintained at 28 ° C, and after growth of cells in the culture to Α600 = 0.5, hpCSF expression was induced, raising the temperature of the culture to 42 ° C for three hours. hours. The final O.D. of the culture was Ag00 = 1.2.

The level of expression of hpG-CSF was determined

of the transformed cells on an SDS-polyacrylamide gel stained with blue coomassi stain to be 3-5% of total cellular protein.

Cells were harvested by centrifugation at 3500 15 g for 10 minutes on a JS-4.2 rotor. Cells were crushed in water 25% (w / v), allowing the slurry to pass three times through a French pressure cell at 10,000 psi. The disrupted cell suspension was centrifuged at 10,000 g for 15 minutes in a JA-20 rotor. The precipitate 20 was again suspended in water and solubilized to a content of ca. 5 mg / ml total protein in 1% lauric acid, 50 mM Tris, pH 8.7. The solubilized material from the precipitate was centrifuged at 15,000 g for ten minutes and CuSo4 was added to a concentration of 20 mM to the supernatant. After one hour, this sample was charged with a C4 HPLC column for purification according to the procedure of Example 1 (B) with volume and concentration corrections.

A second purification process was developed for larger amounts of hpG-CSF formulated in a buffer containing non-organic material. This material is suitable for in vivo studies. 150 g of cell paste was suspended for approx. 600 ml of 1 mM DTT and allow it

I DK 175551 B1 I

I 52 I

I pass four times through a Manton Gualin homogenisa- I

In tor at approx. 7000 psi. The crushed cell suspension became I

Centrifuge at 10,000 g for 30 minutes and extract

I spent the precipitate in 400 ml of deoxycholate (DOC), 5 mM

In 5 EDTA, 5 mM DTT, and 50 mM Tris, pH 9. This suspension I

You were mixed for 30 minutes at room temperature and 1

I centrifuged at 10,000 g for 30 minutes. One suspects

Again, the precipitate settled for approx. 400 ml of water and centrifuge- I

Nest at 10,000 g for 30 minutes. The precipitate was solu- I

In 10 mobilized in 100 ml 2% sarcosyl and 50 mM at pH Θ. Man I

You added CuSO 4 up to 20 µm and kept the mixture under stirring for 16 hours at room temperature, then

You trifuged at 20,000 g for 30 minutes. For supernatant I

In tan, 300 ml of acetone was added. This mixture became I

I placed on ice for 20 minutes and then centrifuged

I at 5000 g for 30 minutes. The precipitate was dissolved in 250

In ml of 6 M guanidine and 40 mM sodium acetate at pH 4 and loaded I

In a 1200 ml G-25 column, equilibrated and powered with 20 L

In mM sodium acetate at pH 5.4. Fractions containing I

In 20 hpG-CSF (about 400 ml) was put together and a 15 ml I was applied

In CM cellulose column, equilibrated with 20 mM sodium I

In acetate at pH 5.4. After application, the column was washed

I with 60 ml of 20 mM sodium acetate at pH 5.4 and with 25 mM I

In sodium chloride and then the column was eluted with 200 L

In 25 ml of 20 mM sodium acetate at pH 5.4 and with 37 mM sodium

In chloride. 150 ml of this passage was concentrated I

I to 10 ml and loaded on a 300 ml G-75 column

Weighted and powered with 20 mM sodium acetate and 100 mM sodium I

In um chloride at pH 5.4. Fractions with relevant content

In 30 (35 ml) were pooled and filter sterilized. End I

In the concentration of phG-CSF was 1.5 mg / ml, it was more than 95% pure as determined by analysis on a gel and

You kept less than 0.5 ng of pyrogen per day. 0.5 mg hpG-CSF. IN

53 DK 175551 B1

The content of the pyrogen was determined using a Limulus Amebocyte Lysate (LAL) test equipment (M. A. Bio-products, Walkersville, Maryland).

Example 8

The example relates to the use of recombinant methods for preparing analogues to hpG-CSF, wherein the cysteine residues found at positions 17, 36, 42, 64 and 74 were individually replaced by a suitable amino acid residue.

Position-directed mutagenesis procedures were performed according to Souza, et al., PCT Application No. W085 / 00817, published February 28, 1985, on DNA from plasmid p536Ppo2 encoding [Met-1], described below using synthetic oligonucleotides of 20-23 bases in length, as shown in Table XVIII below.

With oligonucleotide # 1, one could form a gene encoding [Ser17] hpG-CSF, with oligonucleotide # 2, one could generate [Ser36] hpG-CSF, etc.

20

TABLE XVIII

Oligonucleotide: ..... Sequence__ 1. 1. 5 '-CTG CTC AAG TCC TTA GAG CAA GT-3' 2. 5'-GAG AAG CTG TCT GCC ACC TACA-3 * 3. S'-TAC AAG CTG TCC CAC CCC GAG-3 '\ 4. 5 * -TGA GCA GCT CCC CCA GCC AG-3' 5. 5'-CTG GCA GGC TCC TTG AGC CAA-3 * 30

The position-directing Cys to Ser mutagenesis restrictions were performed using M13 mp10 containing a XbaI-BamH1 hpG-CSF fragment isolated from p536Ppo2 as a template. DNA from each was processed

I DK 175551 B1 I

I 54 I

In the M13mp10 clone containing a Cys-Ser substitution with I

In Xbal and BamHI. The resulting fragment was cloned into I

In the expression vector pCFM746, expression was isolated

In breeding products as in Example 7, I

I You can construct plasmid pCFM746 by cleavage I

In a plasmid pCFM736 (the construction of this plasmid out I)

I from deposited and publicly available material

Written in PCT Application No. W085 / 00829, Morris, Public

I laid down Feb. 28, 1985) with Clal and BamHI to feather- I

i n I

Establishment of an existing polysaccharide and substitution

I tion of the following polysacchargers. IN

I TABLE XIX I

I 5 ^ I

I 5'cgatttgattctagaattcgttaacggtaccatggaa I

I 3 TAAACTAAGATCTTAAGCAATTGCCATGGTACCTT I

I GCTTACTCGAGGATCCGCGGATAAATAAGTAAC3 'I

I CGAATGAGCTCCTAGGCGCCTATTTATTCATTGCTAG5 'I

Sau3a I 1

By a purification procedure for Cys to Ser I

In 25 analogs of the invention, approx. 10-15 I

In g of cell paste in 40 ml of 1 mM DTT and allow to pass three times

In seres a French pressure cell at 10,000 psi. The broken up I

cell suspension was centrifuged at 1000 g for 30 ml

In nuts. The precipitate was suspended in 1% DOC, 5 mM I

In 30 EDTA, 5 mM DTT, 50 mM Tris, pH 9 and mixed 30 I

For minutes at room temperature. Centrifuged bian- I

Dissolve at 10,000 for 30 minutes, suspended in 40 ml of I

In h 2 O and centrifuged again at 10,000 g for 30 min. IN

55 DK 175551 B1

The precipitate was dissolved in 10 ml of 2% Sarkosyl, 50 mM DTT, 50 mM Tris, pH 8. After mixing for 1 hour, the mixture was prepared by centrifugation at 20,000 g for 30 minutes and then a 300 ml G-75 column was added. 5 le, equilibrated with and operated with 1% Sarkosyl, 50 mM Tris,. pH 8. Fractions containing the contents of the analogous compound were pooled and oxidized with air by standing with air access for at least one day. The final concentrations were 0.5 - 5 mg / ml.

10

Example 9 In this Example, a mammalian cell expression system was used to determine whether an active polypeptide product from phG-CSF DNA could be expressed in and secreted by mammalian cells (COS-1, A.T.C.C. CRL-1650). The system was designed to provide secretion of a polypeptide analogous to phGCSF by priming and secretion of a partially synthetic, partially cDNA-derived construct encoding [Ala1] hpG-CSF, where a leader was positioned in front. polypeptide having a sequence of amino acid residues assigned to human G-CSF according to Wong, et al., Sciense, 228, 810-815 (1985) and Lee, et al., Proc. Natl. Acad. Sci. (USA), 82, 4360-4364 (1985).

The expression vector used for preliminary studies on the expression of polypeptide products of the invention was a "shuttle" vector incorporating both pBR322 and SV40 DNA and which had been engineered for autonomous replication both in E. coli and in 30 mammalian cells, the expression in mammalian cells of inserted exogenous DNA was under the control of a viral pro mot or regulatory DNA sequence. This vector, designated pSVDM-19 in E. coli Hn 101, was deposited on August 23

I DK 175551 B1 I

I 56 I

In 1985 at the American Type Culture Collection, 12301 Par- I

In Clawn DRive, Rockville, Maryland, with No. A.T.C.C. IN

I 53241. I

I in constructing the expression vector performed. IN

In 5 man the following specific manipulations. One synthesized I

I prepared a leader DNA coding sequence as mentioned in I

In Table 20 below. IN

I TABLE XX I

I 10 I

I -17 I

I Hindlll With Trp I

I 5 * - A GCT TCC AAC ACC ATG TGG I

I 3 * - AGG TTG TGG TAC ACC I

I -10 I

I Leu Gin Ser Leu Leu Leu Leu Gly Thr Val I

I CTG CAG AGC CTG CTG CTC TTG GGC ACT GTG I

I 2Q GAC GTC TCG GAC GAC GAG AAC CCG TGA CAC I

I -1 41 I

I Ala Cys Ser Ile Ser Ala Pro Leu I

I GCC TGC AGC ATC TCT GCA CCC CTG GGC G.-3 'I

I CGG ACG TCG TAG AGA CGT GGG GAC -5 'I

H * · y I Apal I 1

As seen from Table XX, the sequence comprises Hin-I

I dill and Apal adhesive ends and codons for the 17 amino I

In acidic residues that are believed to belong to the "leader" of human I

In GM-CSF. Then follow codons for an alanine residue, an I

57 DK 175551 B1 proline residue and a leucine residue. The proline and leucine residues duplicate the amino acids found at positions +2 and +3 in hpG-CSF, whereas the alanine residue duplicates the first amino acid residue (+1) in GM-CSF rather than the first in hpG-CSF.

The exchange of threonine with alanine had been designed, thereby facilitating the removal of the GM-CSF leader peptide by cellular mechanisms, usually associated with secretion of 10 GM-CSF, by the current host cell.

Plasmid pSVDM-19 was digested with KpnI and filled to even ends with Klenow enzyme. Then, DNA is cut with HindIII. The resulting large fragment was combined and ligated with the HindIII / Pvull * 5 fragment shown in Table VII (isolated from plasmid Ppo2 as the second largest fragment after a HindIII digestion and a partial digestion with Pvull) to form plasmid psv-ppol. Then, the prepared GM-CSF leader sequence fragment was ligated in Table VIII 20 into psv-Ppol (after cleavage with HindIII and Apal) to obtain plasmid pSVGM-Ppol.

Calcium phosphate precipitates (1-5 µg) of plasmid pSVGM-Pol DNA were transformed into duplicate 60 mm plates of OOS-1 cells, essentially as described in Wigler, et al., Cell, 14, 725-731 (1978). As a control, plasmid pSVDM-19 was also transformed into COS-1 cells. The supernatant was harvested over the tissue culture five days after transfection and analyzed for hpG-CSF activity. The yield of [Ala ^ hpG-CSF from the culture supernatant was of the order of 1-2.5 µg / ml.

Following the positive expression of the plasmid pSVGM-Ppol encoding [Ala1] hpG-CSF in COS-1 cells, another vector was constructed which included the human

I DK 175551 B1 I

I 58 I

I had a GM-CSF leader sequence but had a codon for an I

In threonine residue (naturally occurring in position li I

In hpG-CSF), which replaced the codon for alanine by this I

In position. Briefly, an oligonucleotide I was synthesized

I 5 (5'CAGCATCTCTACACCTCTGGG) for position-directed mutagenesis I

I (SDM). The HindIII - BamH1 hpG-CSF fragment I was ligated

I in pSVGM-Ppol in Ml3mp10 for SDM. The new look ** I

In tetized hpG-CSF gene containing a Thr codon in po-I

In Session 1, was isolated by cleavage with HindIII and I

In EcoRI. Then, the fragment was cloned into pSVDM-19, I

Prepared by cleavage with the same two restriction I

In endonucleases. The resulting vector pSVGM-Ppo (Thr) I

I was transformed into COS cells and the yield of hpG-CSF I

In the culture supernatant measured in the range 1-5 I

In 15 µg / ml. IN

Finally, the genomic sequence was used if I

In isolation, Example 5 is described to form an example

In expression vector for expression of hpG-CSF in mammalian cell I

You laugh. More detailed, pSVDM-19 was digested with KpnI

I 20 and HindIII and used the large fragment in a quadruple

In belt alloy with a synthetic linker with HindIII

I and Ncol adhesive ends, as shown in Table XXI. One Ncol - I

In BamH1 fragment containing exon 1 isolated from pBR322 I

I (8500 hpG-CSF), a genomic subclone, and a BamH1 - Kpbl I

In 25 fragments containing exons 2-5, isolated from plasm I

In mid pBR322 (8599 hpG-CSF genomic subclone). It results

In mammalian expression vector for mammalian cells, I

In pSV / ghG-CSF, 1-2.5 µg / ml produced hpG-CSF from trans-I

In propagated COS cells. IN

DK 175551 B1 59

TABLE XXI

Hindlll 5'AGCTTCCAACAC

5 AGGTTGTGGTAC5 '

Nco

Example 10

The example relates to physical and biological properties 1.0 of inventive and related recombinant polypeptide products.

1. Molecular Guard

Recombinant hpG-CSF products from E. coli priming as in Example 7 had an apparent molecular weight of 18.8 kD, as determined by reducing SDS-PAGE (as would be expected from the indicated amino acids in Table Will). whereas natural isolates purified as 1 Example 1 have an apparent molecular guard of 20 19.6 kD. A theory of the presence of N-glycans, associated with the natural isolates, may be rejected as lacking asparagine residues in the primary sequence of hpG-CSF in Table VII, and as a result constructed but a method to determine whether O-glycans were responsible 25 for differences in molecular weight between the natural isolates and the non-glycosylated recombinant products. Approx. 5 µg of natural isolate with neuraminidase (Calbiochem, LaJolla, CA), a 0.5 µg sample was taken and the residue incubated with 4 mU O-glycansase (endo-xn-acetylgalactose aminidase, Genzyme, Boston, Massachusetts) at 37 ° C. Equal portions were taken after fc, 2 and 4 hours of incubation. These samples were subjected to SDS-PAGE side by side with the recombinant

I DK 175551 B1 I

I 60 I

In material, derived from E. coli. After treatment with I

In neuraminidase, the apparent molecular weight of I was altered

In the isolation from 19.6 kD, 19.2 kD vibrated, which could be due to I

In that, a "sailic acid" residue was removed. After two I

In 5 hours of treatment with O-glycanase, the molecular weight I changed

I to 18.8 kD - this value is identical to the apparent I

In the same molecular weight of the material, derived from E. coli. On I

Due to the sensitivity of the carbohydrate structure to neural I

In minidases and O-glycanase, the following I can be proposed

In the structure of the carbohydrate component: N-acetyl neuramine

In acid α (2-6) (galactose β (1-3) N-acetylgalactose-amine-R, I

I; wherein R is serine or threonine. IN

I 2. Recording of 3H-Thymldln I

In 15 Induction of growth by cell division I was investigated

In human bone marrow cells, based on growing incorporation

In the purification of 3H-thymidine. Human bone was subjected to I

In marrow from healthy donors a breakdown with regard to the I

In the site using Picoll-Hypague (1.077 g / ml, Pharma- I

In 20 cie) and suspended cells of low density in I

In Iscove's medium (GIBCO) containing 10% fetal calf- I

In serum and glutamine pen-strep. Then you incubated

In 2x104 human bone marrow cells with either control medium I

In or the recombinant E. coli material of Example 7 I

I 25 in 96-well flat bottom plates at 37 ° C, with I

In 5% CO 2 in the air for two days. Double analyzes were performed

I and let the concentration vary by a factor of 10,000. IN

The cultures were then kept under pulse for four I

For hours with 0.5 µ Ci / well 3H-thymidine (New England I

I 30 Nuclear, Boston, Massachusetts). The recording was measured - I

I of 3H-thymidine as described in Ventua, et al., Blood, I

I 61, 781 (1983). In this experiment, human hpG-CSF I

In isolates induce incorporation of 3H-thymidine into human I

61 DK 175551 B1 bone marrow cells 1 and ca. 4-10 times higher than when using control supernatants. The hpG-CSF material, derived from E. coli, of Example 6, had similar properties.

Another study on cell division of human bone marrow cells was used, using a culture medium from transfected COS-1 cells of Example 9, and obtained the same results, indicating that the encoded polypeptide product was in fact acting as Ten material was excreted in the culture medium.

3. Induction of Differentiation 1 WEHI-3B D *

The ability of recombinant material derived from E. coli to induce differentiation in the myelomonocytic leukemia cell line WEHI-3B D + from mice was investigated in a semi-solid agar medium, as described in Metcalf,

Int. J. Cancer, 25, 255 (1980). The recombinant hpG-CSF product and a control medium were incubated with ca.

60 WEHI-3B D + cells / well at 37 ° C with 5% CO 2 in the air for seven days. The samples were incubated in 24-well flat bottom plates and the concentration varied by a factor of 2000. The colonies were divided as non-differentiated, partially differentiated or completely differentiated, and cells were counted in the colonies under a microscope. It was found that the recombinant material from E. coli induced differentiation.

4. Analyzes for CFU-GM, BFU-E and CFU-GEMM It was found that natural isolates of pluripotent human G-CSF (hpG-CSF) and the recombinant pluripotent human G-CSF (rhpG-CSF) could have human bone marrow cells to undergo cell division and differentiate. These activities were measured by CFU-GM [Broxmeyer,

I DK 175551 B1 I

I 62 I

In et al., Exp. Hematol., 5, 87, (1971)] BFU-E and CFU-GEMM I

In assays [Lu, et al., Blood, 61, 250 (1983)] used

In the formation of noncontiguous, low I bone marrow cells

In density from healthy voluntary people. A comparison- I

In 5 CFU-GM, BFU-E and CFU-GEMM biological activities I

I using either 500 units of hpG-CSF or I

In rhpG-CSF is shown in Table XXII below. IN

All of the colony experiments were not performed together

In low-density hanging bone marrow cells. One under- I

In 10, human bone marrow cells threw a density distribution with I

In Ficoll-Hypaque (density 1.077 g / cm 3; Pharmacia). Man I

In, the low-density cells suspended in Iscove's mo- I

In Dulbecco's medium, containing calf fetuses, I

In serum and placed them on Falcon tissue culture dishes (No. I

I 15 3003, Becton Dickenson, Cockeysville, MD.) For 1½ hours I

I at 37 ° C. IN

I TABLE XXII I

I 20 CFU-GM BFU-E CFR-GEMM I

Control medium 0 ± 0 26 ± 1 0 ± 0 I

Natural hpG-CSF 83 ± 5.4 83 ± 6.7 4 ± 0 I

rhpG-CSF 87 ± 5 81 ± 0.1 6 ± 2 I

25 I

The control medium consisted of Iscove's modified Dul-I

becco medium plus 10% FCS, 0.2 mM hemin and 1 unit re- I

combinational erythropoietin. IN

In a CFU-GM assay, the I in question was plated

cells in a number of 1 x 10 5 in 1 ml of 0.3% agar culture I

medium that included Supplemental McCoy's 5A medium I

and 10% heat-inactivated fetal serum. You go through- I

searched the cultures for colonies (more than 40 cells per

63 DK 175551 B1 clustering) and examined the morphologist on the seventh day of culture. The number of colonies is shown as the mean ± standard deviation, determined from quadruple trials.

For BFU-E and CFU-GEMM assays, cells (1 x 10 5) were added to a 1 ml mixture of Iscove's modified Dul-becco medium (Gibco), 0.8% methylcellulose, 30% calf fetal serum, 0.05 nM 2 -mercaptoethanol, 0.2 mM hemin 10 and 1 unit of recombinant erythropoietin. The dishes were incubated in a humid atmosphere containing 5% CO 2 and 5% O 2. A low oxygen pressure was obtained using an oxygen reducer from Herning Bioinstruments (Syracuse, N.Y.).

Colonies were counted after 14 days of incubation. The number of 15 colonies is shown as mean ± standard deviation, determined by duplicate.

It was found that all colonies formed in the CFU-GM assay were positive for chloroacetate esterase and negative for non-specific esterase (α-naphthyl-acetate esterase), according to the colonies being granulocyte type. It was found that both natural hpG-CSF and rhpG-CSF had a specific activity of approx. 1 x 10® U / mg pure protein when tested by increasing dilution in a CFU-GM assay. BFU-E and CFU-GEMM 25 data in Table XXII are representative of three separate experiments and the results are similar to data previously reported for natural hpG-CSF. It is important to note that rhpG-CSF is exceedingly pure and free of other possible mammalian growth factors due to its production in E. coli. Thus, rhpG-CSF is capable of supporting mixed colony formation (CFU-GEMM) and BFU-E when added in the presence of recombinant erythropoietin.

I DK 175551 B1 I

I 64 I

I 5. Cell binding experiments I

It has been previously announced that WEHI-3B (D +) I

cells and human leukemia cells from freshly diagnosed I

In leukemia, 125l-labeled G-CSF from mice will bind and that I

I 5 may compete for this binding by Addition I

I of unlabeled G-CSF or human CSF-β. You were tested

In the ability of natural hpG-CSF and rhpG-CSF to compete

I on binding of 125 I-hpG-CSF to human leukemia cells

You guys and mice. High purified natural hpG-CSF I was iodinated

In 10 (> 95% pure, 1g) [Trejedor, et al., Anal. Biochem., 127, I

I 143 (1982)] and it was separated from the reactants at I

Using gel filtration and ion exchange chromatography. The I

In specific activity of the natural 125 I-hpG-CSF I was

In about yCi / yg protein. WEHI-3B (D +) I was tested

15 from mice and two preparations of peripheral myeloid leu- I

human blood germ cells (ANLL, one classified as I

M4, another like M5B) for their ability to bind I

l25I-hpG-CSF. IN

The mouse leukemia cells and the freshly collected human I

Twenty peripheral blood myeloid leukemia cells were washed

Three times with PBS / 1% BSA. WEHI-3B (D +) I was incubated

In cells (5 x 10 6) or fresh leukemia cells (3 x 10 6) in I

In duplicate experiments in PBS / 1% BSA (100 μΐ) in the absence or in the presence of different concentrations (volume: 10 μΐ) in 25 unlabeled hpG-CSF, rhpG-CSF or GM-CSF and in the presence of 125 I hpG-CSF (about 100,000 cpm or 1 L ng) at 0 ° C, for 90 minutes. (Total volume; 120 yl). The cells were resuspended and placed as a layer I over 200 μΐ of ice-cold FCS in 350 μΐ plastic centrifuge tubes and centrifuged for 30 μg (1000 g, 1 min). The precipitate was collected by cutting off the end of the tube and the precipitate and supernatant were individually counted in a gamma counter I (Packard). 1 in 65 DK 175551 B1

Specific binding (cpm) was determined as total binding in the absence of a competitor (average of two trials) minus the binding kid (cpm) in the presence of a 100-fold excess of unlabeled hpG-CSF (non-specific binding). The non-specific binding was a maximum of 2503 cpm for WEHI-3B (D +) cells, 1072 cpm for ANLL (M4) cells, and 1125 cpm for ANLL (M5B) cells. The first and second experiments were performed on separate days with the same preparation of 1 5 I-hpG-CSF, and experiments 10 showed intrinsic consistency with respect to the percentage of inhibition obtained for 2000 units of hpG-CSF. Data are given in Table XXIII below.

I DK 175551 B1 I

I 66 I

H

Λ I Ή

£ I O O

C

«-W

in I s #>

I j I

I 1-3

§ (S VO O

E CS »r * 0 <ή <n o æ I Ή I £ I m

C CD

-H

Ice

I - dP

I H J I

I H J

I HZ CO 't O

S <rH n O

EN <N

I W - m

I Λ ^ I

lu I

Ια I

I <I

I & s I

I £ ιο ^ · σ \ οΝΐη o co o I + c m vo © co φ I Q -.Η r-t

I n «» p I

I I

I H

I X co m n h o m o o co r-i U o oo m n co η .h rs * h I SE Ό Ό vo o i-ι η σ 'vo m

In CU

I U Η N H W CN Γ0

I "" o o o o o o o ooo I

I H o o o o o o o o I E OONCON o o I · · · ♦

I D OCaOCN rsj (N

I w o «-» I ^ 1

4J * · H

I c u u I 4> cn w u o> m I U ft O 10 -HU ·· I U i — 1 r-t I u N ι-t i u I s c u o i cuoca I. * · © 3 o «o · © 3 o« u.

I C © 0i +>, C 0 «æ cn Æ 1 I o x c ta r * c« s I bCHHC u u m z o 67 DK 175551 B1

As indicated in Table XXIII, 125 I-hpG-CSF showed binding to the WEHI-3B (D +) leukemia cells. The binding was dose dependent inhibited by unlabeled natural hpG-CSF or rhpG-CSF, but not by GM-CSF. In addition, binding of native hpG-CSF to human myeloid monocytic leukemia cells (ANLL, M4) was observed. The binding to these cells has a parallel in the response of liquid cultures to natural hpG-CSF, differentiating into fully developed macrophages, judged by morphology.

10 The failure to bind natural 125 I-hpG-CSF to monocytic leukemia cells from another patient (ANLL, M5B) may be due to the fact that some leukemia cells may differentiate differently or lack receptors for hpG-CSF. The ability of rhpG-CSF to compete with natural hpG-CSF for 15 binding to natural 125I-hpG-CSF is indicative of # that receptors recognize both forms equally.

These experiments demonstrating the binding of natural 125i-labeled hpG-CSF to leukemia cells have a parallel in the ability of natural hpG-CSF to induce 20 low-density granulocytic and monocytic differentiation of bone marrow cells obtained from a patient with acute promyelocytic leukemia ( M3) and another patient with acute myeloblastic leukemia (M2). Cells from the two patients were cultured for four days either in culture medium 25 alone or in the presence of 1 x 10 5 units of rhpG-CSF. Cells from the M3 control medium incubated here alone were still of the promyelocyte type; whereas cells grown in the presence of rhpG-CSF exhibited fully developed myeloid type cells, including a metamyelocyte, a giant band form, and segmented meutrophil and monocyte. For this patient, the division of 100 cells into the control group was 100% promyelocytes, and of rhpG-CSF treated cells 22% blast cells plus promyelocytes.

I DK 175551 B1 I

I 68 I

In loci, 7% myelocytes, 35% metamyelocytes, 20% band I

In forms plus segmented neutrophils, 14% monocytes and 2% I

In macrophages. An interesting fact is that one of I

In the polymorphonuclear granulocytes, I still contained one

In 5 dominant auer bodies, a sign that at least I

In this cell represented a differentiated cell which I

You belonged to the leukemia clone. Cells of the second patient I

I with myeloblastic leukemia (M2) was also grown four I

For days in the absence or presence of rhpG-CSP. IN

I 10 In review of M2 cells grown in medium I

In alone, large "blast-like" cells could be observed by I

In which some possessed cores. Certain of the M2 cells diffuse

I retained when treated with rhpG-CSF to I

In fully developed segmented neutrophils with the remainder of au- I

In 15 bodies in the center of the neutrophil, a sign that I

You were differentiated into a cell that belonged to you

In the leukemia clone. A breakdown of 100 cells that were un- I

In morphologically examined, the cells from control I showed

The group consisted of 100% blast cells. The cells that were I

20 treated with rhpG-CSP, consisted of 43% blast cells, 1% I

myelocytes, 15% metamyelocytes, 28% band forms plus I

segmented neutrophils, 2% promonocytes and 11% mono- I

cyter. Leukemia cells were also examined for the purpose I

on differentiation at four other concentrations of I

25 rhpG-CSF (5 x 103, 1 x 104, 2.5 x 104 and 5 x 104 U / ml, I)

data not shown). Even at the lowest tested concentrations

trations of rhpG-CSF (5 x 10 3 U / ml) were evident

differentiation (the cells differentiated longer than I

to myelocytes) of M3 (50%) and M2 (37%) of leukemia cell I

30 lerne. IN

DK 175551 B1 69 6. Immunoassay

To prepare polyclonal antibodies for use in immunoassay, as antigenic pluripotent G-CSF, purified from human bladder carcinoma cell line 5637 (ia6), as prepared in Example 1 (B), was used. On the basis of silver nitrate staining of polyacrylamide gels, the material was estimated to be 85% pure. Six-week-old Balb / C mice were immunized with many subcutaneous injections of the antigen. The antigen was suspended in PBs and emulsified with equal volumes of Freund's complete adjuvant.

The dose was 5-7 µg antigen per mouse per day. injection.

18 days later, immunization was enhanced by the same amount of antigen emulsified with an equal volume of 15-fold of Freund's incomplete adjuvant. Four days later, mouse serum was taken for testing for the content of the antibody specific to human pluripotent G-CSF.

Dynatech Immulon II Removawell 20 strips in holders (Dynateck Lab., Inc., Alexandria, Virginia) were coated with hpG-CSF 5 µg / ml in 50 mM carbonate-bicarbonate buffer, pH 9.2. Plates in sheets were coated with 0.25 µg in a volume of 50 µl. The antigen-coated plates were incubated for two hours at room temperature overnight at 4 ° C. The solution was decanted off and the plates incubated for 30 minutes with PBS containing 5% BSA to block the reactive surface. This solution was decanted off and either diluted pre-immune serum or serum added for testing to the wells 30 and incubated for two hours at room temperature. Sera were diluted with PBS, pH 7.0, containing 1% BSA. The serum solution was decanted off and the plates were washed three times with Wash Solution (KPL, Gaithersburg, Maryland). Added approx. 200,000 cpm iodized rabbit anti-mouse IgG (NEN,

I 1 DK 175551 B1 I

I 70 I

In Boston, Massachusetts) in 50 µl PBS, pH 7.0, with content I

I of 1% BSA for each recess. After incubation 1½ I

For one hour at room temperature, this solution was decanted off

Wash and wash the plates five times with Wash solution. IN

I 5 The grooves were removed from the holder and spoken in I

In a Beckman 5500 gamma counter. Highly active mouse serum I showed

In more than 12 times greater reactivity than the corresponding I

In prs immune serum at a dilution of 1: 100. IN

The immunological properties of E. I were determined

In 10 coli-derived hpG-CSF upon reactivity to highly active I

In mouse serum specific to mammalian cell of I

In led hpG-CSF. Xmmulon II Removawells were coated with I

In 0.25 µg 90% pure E. coli derived protein in a volume of I

I 50 μΐ and analyzed the mouse serum as described above

In 15 for. IN

In High-active mouse sera exhibited a 24-fold higher re- I

In activity against E. coli material than they correspond to

In pre-immune sera at a dilution of 1: 100. IN

I 7. Serial Analog Bloassays I

[Ser17] studied hpG-CSF, [Ser36] hpG-CSF, I

In [Ser42] hpG-CSF, [Ser64] hpG-CSF and [Ser74] hpG-CSF product I

Iter, prepared according to Example 9 for hpG-CSF activity I

I by uptake of 3H-thymidine, CFU-GM and WEHI 3B D + I

In 25 assays. In all assays, [Ser17] had analog and activity

This could be compared to the activity of the recom

In binant molecule with the natural structure. The other I

analogue possessed approx. 100 times less activity in experiments

I get uptake of 3H-thymidine, a 250 times less active

In 30 of the CFU-GM essay, and 500 times less activity I

I in the WEHI-3B D + assay. These data support the theory that you

In cysteine residues are required in positions 36, 42, 64 and I

I 74 to achieve full biological activity. IN

I I

71 DK 175551 B1 8. In vivo bloassay

Alzet osmotic pumps were connected (Aiset Corp.,

Palo Alto, CA; Model 2001) for permanent catheters in the right neck vein and implanted them under the skin of seven Syrian gold hamsters. Four of the pumps contained a buffer [20 mM sodium acetate (pH 5.4) and 37 mM sodium chloride] and 1.5 mg / ml E. coli-derived hpG-CSF, whereas 3 contained only buffer. The pump speed was set to be 1 μΐ / hour for up to seven days. Three days after the application of the pumps, the mean number of granulocytes in the four treated hamsters was six times higher than in the three control hamsters (buffer), and with the increased number of granulocytes there was a quadrupling in the total lymphocytes. The number of 15 erythrocytes was not altered during treatment. These results indicate that the recombinant material produces a specific enhancement of the production and / or release of granulocytes in a mammal.

The DNA sequences described herein, which encode 20 hpG-CSF-like polypeptides, may be useful in the information it provides about the mammalian protein amino acid sequence that was previously unavailable, despite assays on isolates of naturally occurring products. . The DNA sequences must also be considered valuable as products that can be used in large scale microbial synthesis of hpG-CSF by a number of recombinant methods. These DNA sequences may be suitable material for use as labeled probes in isolating hpG-CSF and related protein encoded by human genomic DNA, as well as cDNA and genomic DNA sequences from other mammalian species. The DNA sequences may also be useful in various other methods of protein synthesis (e.g., in insect cell lines).

I DK 175551 B1 I

I 72 I

In clay) or 1 genetic therapy in humans and other patients

In ted animals. It is expected that DNA sequences of the invention I

You are useful in developing transgenic mammalian species, I

You can serve as eukaryotic "hosts" in production

I ^ of hpG-CSF and hpG-CSF products in large quantities. See I

In this regard, Palmiter, et al., Science, 222 (4625), .1

In 809-814 (1983). IN

I With relevance to hpG-CSF derivatives and analogs I

In accordance with the invention, mention may be made of the immunologic I

In 10 activity of synthetic peptides, as in the liquid

In late, amino acid sequences duplicated in I

In naturally occurring proteins, glycoproteins I

I and nucleoproteins. In more detail, it has been shown that

In relatively low molecular weight polypeptides are included in the immune response

In 15 tions, which with respect to duration and prevalence lie- I

You stimulate the immune responses of physiologically significant proteins

In proteins such as viral antigens, polypeptide hormones and lig

I nende. Among the immune responses to such polypeptides I

You include the provocation of formation of specific

In 20 antibodies in immunologically active animals. See, e.g. Lerner, I.

Cell, 23, 309-310 (1981); Ross, et al., Nature, I

I 294, 654-656 (1981); Walter, et al., Proc. Natl. Acad. IN

In Sci. (USA), 77, 5197-520.0 (1980); Lerner, et al., Proc. IN

In Natl. Acad. Sci. (USA), 78, 3403-3407 (1981); Walter, I.

In 25 et al., Proc. Natl. Acad. Sci. (USA), 78, 4882-4886 I

I (1981); Wong, et al., Proc. Natl. Acad. Sci. (USA), I

I 78, 7412-7416 (1981); Green, et al., Cell, 28, 477-487 I

I (1982); Nigg, et al., Proc. Natl. Acad. Sci. (USA), 79, I

I 5322-5326 (1982); Baron, et al., Cell, 28, 395-404 I

I 30 (1982); Dreesman, et al., Nature, 295, 185-160 (1982); IN

I and Lerner, et al., Scientific American, 248, No. 2, I

In 66-74 (1983). See also Kaiser, et al., Science, 223, I

In 249-255 (1984) what. concerns biological and immunological I

73 DK 175551 B1 activities of synthetic peptides that approximate the secondary structure with peptide hormones, but may not have primary structural conformation in common with them.

Claims (17)

An isolated polypeptide having the hematopoietic II biological properties of naturally occurring pluri-II potent granulocyte colony-stimulating factor (hpG-CSF), wherein the polypeptide has the amino acid sequence listed in Table VII, characterized by II ke naturally occurring and being a product of prokaryotic or eukaryotic expression of an exogenous DNA II sequence. A polypeptide analog according to claim 1, characterized in that the exogenous DNA sequence is an I I cDNA sequence. IN A polypeptide analog according to claim 1, characterized in that the exogenous DNA sequence is a genomic sequence. IN The polypeptide analog of claim 1, characterized in that the exogenous DNA sequence is carried by I in an autonomously replicating DNA plasmid or viral vector. The polypeptide of claim 1, characterized by being covalently associated with a detectable I marker marker substance, especially a radioactive marker. IN A DNA sequence which, when expressed in a prokaryotic or eukaryotic host cell, encodes a poly (I) peptide product possessing at least a portion of it. In primary structure and the hematopoietic biological properties, I create naturally occurring pluripotent granulocyte colony stimulating factor, wherein the DNA sequence is characterized by encoding a polypeptide I I with the amino acid sequence listed in Table VII 1-1748. The cDNA sequence of claim 6. I The genomic DNA sequence of claim 6. I The DNA sequence of claim 6, characterized in that it is covalently associated with a detectable marker substance, especially a radioactive marker. The single stranded DNA sequence of claim 9. 11. Biologically functional plasmid or viral. DNA vector, characterized in that it includes a DNA sequence according to claim 6. A prokaryotic or eukaryotic host cell, characterized in that it is transformed or transfected with a DNA sequence according to claim 6 in such a way that the host cell can express the polypeptide product in question. Prokaryotic or eukaryotic host cell, characterized in that it is stably transformed or transfected with a DNA vector according to claim 15 11. Host cell according to claim 12 or 13, characterized in that the host is E. coli. Host cell according to claim 12 or 13, characterized in that the host is a mammalian cell. A method of producing isolated polypeptides having the hematopoietic properties of naturally occurring human granulocyte colony-stimulating factor, wherein the polypeptide has the amino acid sequence 1-174, characterized in that prokaryotic or especially eukaryotic cells are cultured under appropriate nutritional conditions. transformed or transfected with a DNA sequence according to claim 6 in such a way that they can express said polypeptide and isolate the desired polypeptide product from the expression of the DNA sequence. 1 Pharmaceutical composition, characterized in that it comprises an effective amount of polyethylene. 76 In the peptide of claim 1 and / or prepared according to claim I 16, and a pharmaceutically acceptable diluent, in adjuvant or carrier. Pharmaceutical composition according to claim 17, further characterized by being free from association with any human protein. IN Use of the polypeptide of claim 1 to I in the manufacture of a medicament for providing hematopoietic therapy to a mammal. IN 10 I