DK157938B - DNA sequence for insulin precursors, vectors containing this sequence, yeast strains which are transformed with the vectors, and also a process for preparing the insulin precursors and a process for preparing human insulin - Google Patents
DNA sequence for insulin precursors, vectors containing this sequence, yeast strains which are transformed with the vectors, and also a process for preparing the insulin precursors and a process for preparing human insulin Download PDFInfo
- Publication number
- DK157938B DK157938B DK238585A DK238585A DK157938B DK 157938 B DK157938 B DK 157938B DK 238585 A DK238585 A DK 238585A DK 238585 A DK238585 A DK 238585A DK 157938 B DK157938 B DK 157938B
- Authority
- DK
- Denmark
- Prior art keywords
- insulin
- ala
- lys
- yeast
- human insulin
- Prior art date
Links
Description
DK 157938 BDK 157938 B
Den foreliggende opfindelse angår DNA-sekvenser, der koder for insulinprecursorer, vektorer# der indeholder sådanne sekvenser, gærstammer transformeret med disse vektorer samt en fremgangsmåde til fremstilling af sådanne insulinprecursorer og en fremgangsmåde til fremstilling af humaninsulin.The present invention relates to DNA sequences encoding insulin precursors, vectors containing such sequences, yeast strains transformed with these vectors, and a method for producing such insulin precursors and a method for producing human insulin.
2 DK 157938B2 DK 157938B
55
Insulin er tidligere blevet syntetiseret (fra syntetiske A- og B-kæder) eller re-syntetiseret (fra A- og B-kæder fra naturlige kilder) ved kombination af de to kæder i en oxidationsproces / hvorved de seks cysteinsulfhydrylgrupper i de reducerede 10 kæder (4 i A-kæden og 2 i B-kæden) omdannes til disulfidbroer.Insulin has previously been synthesized (from synthetic A and B chains) or re-synthesized (from A and B chains from natural sources) by combining the two chains in an oxidation process / whereby the six cysteine sulfhydryl groups in the reduced 10 chains (4 in the A chain and 2 in the B chain) are converted to disulfide bridges.
Ved denne metode dannes disulfidbroerne i vid udstrækning tilfældigt, hvilket betyder, at udbyttet af insulin med korrekt anbragte disulfidbroer mellem henholdsvis cysteinresterne A-6 og A-ll, A-7 og B-7 og A-20 og B-19 er meget lav.By this method, the disulfide bridges are formed largely randomly, which means that the yield of insulin with properly placed disulfide bridges between the cysteine residues A-6 and A-11, A-7 and B-7 and A-20 and B-19 is very low, respectively. .
15 Efter opdagelsen af proinsulin som en biologisk precur sor for insulin blev det observeret, at A- og B-polypeptidkæderne i det lineært-kædede, totalt reducerede proinsulin (hvilke kæder svarer henholdsvis til A- og B-kæderne i insulin) kunne kombineres oxidativt med meget mindre vilkårlighed af disulfidbroerne 20 til opnåelse af væsentligt højere udbytte af korrekt foldet proinsulin i sammenligning med kombinationen af frie A- og B-kæder (D.F. Steiner et al.: Proc.Nat.Acad.Sci. 60 (1968), 622). Skønt der kun blev opnået høje udbytter ved proinsulinkoncentrationer for lave til at gøre processen gennemførlig i en præparativ ska- '· 25 la, blev funktionen af C-(d.v.s. connecting peptid)-kæden i B-C-A-polypeptidsekvensen af proinsulin tydeligt demonstreret, nemlig den funktion at bringe de seks cysteinrester i rumligt favorable positioner til en korrekt oxidation til proinsulin.After the discovery of proinsulin as a biological precursor to insulin, it was observed that the A and B polypeptide chains of the linear-chain, totally reduced proinsulin (which correspond to the A and B chains of insulin, respectively) could be oxidatively combined with much less randomness of the disulfide bridges 20 to obtain substantially higher yields of properly folded proinsulin compared to the combination of free A and B chains (DF Steiner et al .: Proc.Nat.Acad.Sci. 60 (1968), 622 ). Although only high yields were obtained at proinsulin concentrations too low to make the process feasible in a preparative sequence, 25a, the function of the C (i.e. connecting peptide) chain in the BCA polypeptide sequence of proinsulin was clearly demonstrated, namely that function. to bring the six cysteine residues in spatially favorable positions to a proper oxidation to proinsulin.
Det dannede proinsulin kan fungere som en in vitro pre-30 cursor for insulin derved, at "connecting"-peptidet kan fjernes ad enzymatisk vej (W. Kemmler et al.: j.Biol.Chem 246 (1971), 6786).The proinsulin formed can act as an in vitro precursor for insulin in that the "connecting" peptide can be removed enzymatically (W. Kemmler et al., J. Biol. Chem. 246 (1971), 6786).
Det er siden blevet påvist, at proinsulinlignende forbindelser med kortere forbindende kæder end C-peptidet og flanke-' 35 ret ved begge ender af specifikke, enzymatiske eller kemiske spaltningssteder (de såkaldte miniproinsuliner (A. Wollmer et al., Hoppe-Seyler's Z. Physiol.Chem. 355 (11974), 1471 - 1476 og Dietrich Brandenburg et al., Hoppe-Seyler's Z.Physiol.Chem. 354 (1973), 1521 - 1524)) også kan tjene som insulinprecursorer.It has since been shown that proinsulin-like compounds with shorter binding chains than the C peptide and flanked at both ends by specific, enzymatic or chemical cleavage sites (the so-called miniproinsulins (A. Wollmer et al., Hoppe-Seyler's Z. Physiol. Chem. 355 (11974), 1471-1476, and Dietrich Brandenburg et al., Hoppe-Seyler's Z.Physiol. Chem. 354 (1973), 1521-1524) may also serve as insulin precursors.
JJ
Forsøg på at tilvejebringe biosyntetisk ^nsujli^J ^ insulin identisk med humaninsulin, har fulgt den samme strategi som til syntetisering af insulin. Insulin A- og B-kæderne er blevet udtrykt i separate værtsorganismer, isoleret derfra og 5 derpå kombineret som beskrevet ovenfor (R.E. Chance et al.: Diabetes Care 4 (1982), 147). Fremskaffelsen af A- og B-kæderne ved separate gæringsprocesser fulgt af en kombination af kæderne er ifølge sagens natur upraktisk.Attempts to provide biosynthetic ^ nsujli ^ J ^ insulin identical to human insulin have followed the same strategy as for the synthesis of insulin. Insulin A and B chains have been expressed in separate host organisms, isolated therefrom and then combined as described above (R.E. Chance et al .: Diabetes Care 4 (1982), 147). Obtaining the A and B chains by separate fermentation processes followed by a combination of the chains is by nature impractical.
De fordoblede gæringsomkostninger kan undgås ved at 10 vælge proinsulin- eller miniproinsulinstrategien.The doubled fermentation cost can be avoided by choosing the proinsulin or miniproinsulin strategy.
Ved de første forsøg blev E. coli transformeret med kloningsvektorer, der koder for præproinsulin eller proinsulin, der kan udskilles som sådan (W. Gilbert et al.: Europæisk patentansøgning nr. 6694) eller akkumuleres intracellulært som hybride 15 genprodukter (D.V. Goeddel et al.: Europæisk patentansøgning nr. 55945). Miniproinsulinruten er også blevet forsøgt i E. coli, jfr. D.V. Goeddel, supra, og europæisk patentpublikation nr.In the first experiments, E. coli was transformed with cloning vectors encoding preproinsulin or proinsulin that can be excreted as such (W. Gilbert et al: European Patent Application No. 6694) or accumulated intracellularly as hybrid gene products (DV Goeddel et al .: European Patent Application No. 55945). The miniproinsulin route has also been tried in E. coli, cf. D. V. Goeddel, supra, and European Patent Publication no.
' 68701, der foreslår fremstilling af modificerede proinsuliner med et mere eller mindre forkortet C-peptid.'68701, proposing the preparation of modified proinsulins with a more or less abbreviated C peptide.
20 Disse metoder lider imidlertid af adskillige ulemper, der hovedsageligt beror på det faktum, at E. coli anvendes som værtsorganisme. Således skal spaltning, foldning og etablering af disulfidbroer ske in vitro, idet E. coli ikke er i stand til at maturere det udtrykte produkt. Intracellulær akkumulering vil 25 desuden forøge risikoen for enzymatisk nedbrydning af det udtrykte produkt.However, these methods suffer from several disadvantages, which are mainly due to the fact that E. coli is used as a host organism. Thus, cleavage, folding, and establishment of disulfide bridges must occur in vitro, as E. coli is unable to mature the expressed product. In addition, intracellular accumulation will increase the risk of enzymatic degradation of the expressed product.
Det er ligeledes forsøgt at fremstille insulin i gær ved at indføre et præproinsulingen indsat i en egnet vektor. Tanken var, at gær skulle være i stand til at udtrykke præproinsu-30 lin, som herefter ligesom i de humane celler skulle spaltes til proinsulin, hvorpå disulfidbroerne dannes, og slutteligt C-pep-tidet fraspaltes proteolytisk ved spaltning ved de to par basiske aminosyrer, der flankerer C-peptidet til dannelse af modent insulin, jfr. europæisk patentpublikation nr. 121884.It has also been attempted to produce insulin in yeast by introducing a preproinsulant inserted into a suitable vector. The idea was that yeasts should be able to express preproinsulin, which then, like in the human cells, should be cleaved to proinsulin on which the disulfide bridges are formed, and finally the C-peptide is proteolytically cleaved by cleavage at the two pairs of basic amino acids. flanking the C-peptide to form mature insulin, cf. European Patent Publication No. 121884.
35 Det har imidlertid vist sig, at insulinprecursorer af35 However, it has been shown that insulin precursors of
proinsulintypen, i hvilke to basiske aminosyrer flankerer C-peptidet, er følsomme overfor enzymatisk nedbrydning i gær, hvorfor der ved denne fremstillingsmetode slet ikke eller kun i meget lave udbytter opnås udskilt proinsulin eller modent insulin. IThe pro-insulin type, in which two basic amino acids flank the C-peptide, is sensitive to enzymatic degradation in yeast, and thus, in this method of preparation, no proinsulin or mature insulin is obtained at all or only in very low yields. IN
4 gær er det blevet vist, at human proinsulin og proinsulinanaloger med et mere eller mindre forkortet C-peptid er særlS|£ fUps&ralnl 8 B overfor enzymatisk spaltning ved de to dibasiske sekvenser, der flankerer C-peptidregionen. Tilsyneladende sker disse spaltninger 5 før etableringen af S-S-broerne resulterende i dannelse af C-peptid, A-kæde og B-kæde.In 4 yeasts, human proinsulin and proinsulin analogs with a more or less abbreviated C peptide have been shown to be particularly S? £ fUps & ralnl 8 B against enzymatic cleavage at the two dibasic sequences flanking the C peptide region. Apparently, these cleavages 5 occur before the establishment of the S-S bridges resulting in the formation of C-peptide, A-chain and B-chain.
Det er formålet med den foreliggende opfindelse at overvinde disse ulemper ved at tilvejebringe biosyntetiske insu-linprecursorer, der genereres med i vid udstrækning korrekt an-10 bragte disulfidbroer mellem A- og B-kæderne og som yderligere er væsentligt mere modstandsdygtige mod proteolytisk nedbrydning end de hidtil kendte biosyntetiske insulinprecursorer.It is the object of the present invention to overcome these drawbacks by providing biosynthetic insulin precursors which are generated with widely correctly disulfide bridges between the A and B chains and which are furthermore more resistant to proteolytic degradation than the hitherto known biosynthetic insulin precursors.
En enkeltkædet insulinprecursor bestående af en forkor-Bi B29 tet insulin B-kæde fra Phe til Lys , som fortsætter i en 15 fuldstændig A-kæde fra Gly til AsnA , B (1-29)-A( 1-21) er kendt (Jan Markussen, "Proteolytic degradation of proinsulin and of the intermediate forms",: Proceedings of the Symposium on Proinsulin, Insulin and C-Peptide, Tokushima, 12 - 14. Juli, 1978, Udgivere: S. Baba et al.). Insulinprecursoren B(l-29)-A(l-21) fremstilles 20 ved en semisyntetisk proces ud fra svineinsulin. Først fremstilles insulin B(l-29)- og A(1-21)kæderne og kobles til et lineært peptid B(1-29)-A(l-21). Forbindelsen oxideres i den hexathiole form in vitro til dannelse af det enkeltkædede des-(B30)-insulinmolekyle.A single-chain insulin precursor consisting of a precursor Bi B29 tet insulin B chain from Phe to Lys, which proceeds in a complete A chain from Gly to AsnA, B (1-29) -A (1-21) is known ( Jan Markussen, "Proteolytic Degradation of Proinsulin and of the Intermediate Forms", Proceedings of the Symposium on Proinsulin, Insulin and C-Peptide, Tokushima, July 12-14, 1978, Publishers: S. Baba et al. The insulin precursor B (l-29) -A (l-21) is produced by a semi-synthetic process from porcine insulin. First, the insulin B (l-29) and A (1-21) chains are prepared and coupled to a linear peptide B (1-29) -A (l-21). The compound is oxidized in the hexathiole form in vitro to form the single-chain des- (B30) insulin molecule.
25 Den foreliggende opfindelse er baseret på den overras kende erkendelse, at den enkeltkædede insulinprecursor B(l-29)-A(l-21) og derivater deraf med en brokæde, der forbinder den C-terminale ende af B (1-29)-kæden med den N-terminale ende af A(l-21)-kæden udtrykkes i høje udbytter og med korrekt anbragte di-30 sulfidbroer ved dyrkning af gærstammer transformeret med DNA-sekvenser, der koder for sådanne insulinprecursorer. Beviset, for at de udtrykte insulinprecursorer har korrekt anbragte disulfidbroer, er, at precursorerne kan omdannes til et produkt, der er identisk med humaninsulin, jfr. de efterfølgende eksempler 14-18.The present invention is based on the surprising realization that the single-chain insulin precursor B (l-29) -A (l-21) and its derivatives with a bridge chain connecting the C-terminal end of B (1-29) The chain with the N-terminal end of the A (1-21) chain is expressed in high yields and with properly placed disulfide bridges in the cultivation of yeast strains transformed with DNA sequences encoding such insulin precursors. The proof that the expressed insulin precursors have properly disulfide bridges is that the precursors can be transformed into a product identical to human insulin, cf. the following Examples 14-18.
35 Ifølge sit første aspekt tilvejebringer den foreliggen de opfindelse en DNA-sekvens til brug i en gærvektor, hvilken sekvens består af en nukleotidkombination, som koder for en insulinprecursor med formlenIn its first aspect, the present invention provides a DNA sequence for use in a yeast vector which consists of a nucleotide combination encoding an insulin precursor of the formula
B(l-29)-(Xn-Y)m-A(l-21) IB (l-29) - (Xn-Y) m-A (l-21) I
55
DK 15 7 9 3 8 BDK 15 7 9 3 8 B
hvor er en peptidkæde med n aminosyrerester, Y er Lys ellerwhere is a peptide chain with n amino acid residues, Y is Lys or
Arg, n er et helt tal fra 0 til 33, m er 0 eller 1, B(l-29) er enArg, n is an integer from 0 to 33, m is 0 or 1, B (l-29) is one
Bl B29 forkortet B-kæde af human insulin fra Phe til Lys og A(1-21) er A-kæden af human insulin, idet dog peptidkæden -x -Y- ikke kan 5 indeholde to nabostillede basiske aminosyrerester (d.v.s. Lys eller Arg).B1 B29 shortened human insulin B chain from Phe to Lys and A (1-21) is the A chain of human insulin, however, the peptide chain -x -Y- cannot contain two adjacent basic amino acid residues (ie Lys or Arg) .
Foretrukne insulinprecursorer af formel I er B(l-29)-A(l-21), d.v.s. m=0 i formel I, og forbindelser med en relativt kort brokæde mellem B(1—29)— og A(1-21)-kæden.Preferred insulin precursors of formula I are B (l-29) -A (l-21), i.e. m = 0 in Formula I, and compounds having a relatively short bridge chain between the B (1-29) and A (1-21) chains.
10 Når m=l er n fortrinsvis 1-33, mere foretrukket 1-15, 1-8 eller 1-5 og mest foretrukket 1-3 eller 1-2. x udvælges fortrinsvis fra gruppen, der består af Ala, Ser og Thr, hvor de enkelte X'er er ens eller forskellige. Eksempler på sådanne foretrukne forbindelser er B(1-29)-Ser-Lys~A(1-21) og B(l-29)-Ala-15 Ala-Lys-A(l-21).When m = 1, n is preferably 1-33, more preferably 1-15, 1-8 or 1-5 and most preferably 1-3 or 1-2. x is preferably selected from the group consisting of Ala, Ser and Thr, where the individual Xs are the same or different. Examples of such preferred compounds are B (1-29) -Ser-Lys ~ A (1-21) and B (1-29) -Ala-Ala-Lys-A (1-21).
Ifølge sit andet aspekt tilvejebringer den foreliggende opfindelse en i gær replicerbar vektor, der er i stand til at udtrykke en DNA-sekvens, der koder for insulinprecursorer med formlen (I) .In its second aspect, the present invention provides a yeast replicable vector capable of expressing a DNA sequence encoding insulin precursors of formula (I).
20 Vektoren er et plasmid, der er i stand til at replice res i gær.The vector is a plasmid capable of replication in yeast.
Ifølge et tredje aspekt tilvejebringer den foreliggende opfindelse en fremgangsmåde til fremstilling af insulinprecursorer med formel I i"gær, ved hvilken en transformeret gærstamme, 25 der indeholder et plasmid, der er i stand til at udtrykke insulinpr ecur sorerne, dyrkes i et passende næringsmedium efterfulgt af isolering af insulinprecursorerne.According to a third aspect, the present invention provides a method for preparing insulin precursors of formula I in yeast, wherein a transformed yeast strain containing a plasmid capable of expressing the insulin precursors is grown in an appropriate nutrient medium followed by of isolation of the insulin precursors.
Ifølge et fjerde aspekt tilvejebringer den foreliggende opfindelse en gærstamme transformeret med en vektor, der er i 30 stand til at udtrykke en DNA-sekvens, der koder for insulinpre-cursorerne i gær.According to a fourth aspect, the present invention provides a yeast strain transformed with a vector capable of expressing a DNA sequence encoding the insulin precursors in yeast.
Insulinprecursorerne kan udtrykkes med yderligere protein forud for insulinprecursoren. Det yderligere protein kan have til funktion at beskytte insulinprecursoren mod f.eks. in 35 vivo nedbrydning med organismens egne enzymer eller kan have til funktion at tilvejebringe den nødvendige information til at transportere det ønskede protein ind i det periplasmiske hulrum og til slut over cellevæggen ud i mediet.The insulin precursors may be expressed with additional protein prior to the insulin precursor. The additional protein may function to protect the insulin precursor from e.g. in vivo degradation with the organism's own enzymes or may function to provide the necessary information to transport the desired protein into the periplasmic cavity and finally across the cell wall into the medium.
66
DK 157938BDK 157938B
Det yderligere protein indeholder et selektivt spaltningssted, der støder op til N-terminalen af B(1-29)-kæden af insulinprecursoren, hvorved der sikres en senere fraspaltning af det yderligere protein enten af mikroorganismen selv eller ved 5 senere enzymatisk eller kemisk spaltning.The additional protein contains a selective cleavage site adjacent to the N-terminus of the B (1-29) chain of the insulin precursor, thereby ensuring a subsequent cleavage of the additional protein either by the microorganism itself or by 5 later enzymatic or chemical cleavage.
Når insulinprecursorerne udtrykkes i gær , kan den yderligere aminosyresekvens indeholde to basiske aminosyrer (f.eks. Lys-Lys, Arg-Arg, Lys-Arg eller Arg-Lys) stødende op til N-terminalen af B(1-29)-kæden af insulinprecursoren, idet gær er 10 i stand til at spalte peptidbindingen mellem de basiske aminosyrer og precursoren. Også et Glu-Ala eller Asp-Ala-spaltnings-sted stødende op til det ønskede protein tilvejebringer en fra-skillelse af den yderligere aminosyresekvens ved hjælp af gæren selv ved hjælp af et dipeptidaseenzym, som produceres af gæren.When the insulin precursors are expressed in yeast, the additional amino acid sequence may contain two basic amino acids (e.g. Lys-Lys, Arg-Arg, Lys-Arg or Arg-Lys) adjacent to the N-terminus of the B (1-29) chain of the insulin precursor, with yeast being able to cleave the peptide bond between the basic amino acids and the precursor. Also, a Glu-Ala or Asp-Ala cleavage site adjacent to the desired protein provides a separation of the additional amino acid sequence by the yeast itself by a dipeptidase enzyme produced by the yeast.
15 Insulinprecursorerne kan udskilles med en aminosyrese kvens knyttet til B(1-29)-kæden af precursoren, forudsat at denne aminosyresekvens indeholder et selektivt spaltningssted stødende op til B(1-29)-kæden til senere fraspaltning af den overflødige aminosyresekvens. Da insulinprecursorerne ikke indeholder methio-20 nin, vil cyanogenbromidspaltning ved methionin stødende op til det ønskede protein være operativt. På samme måde tilvejebringer arginin- og lysin-spaltningssteder stødende op til det ønskede protein spaltning med trypsinlignende proteaser.The insulin precursors may be secreted by an amino acid sequence attached to the B (1-29) chain of the precursor, provided that this amino acid sequence contains a selective cleavage site adjacent to the B (1-29) chain for later cleavage of the excess amino acid sequence. Since the insulin precursors do not contain methionine, cyanogen bromide cleavage by methionine adjacent to the desired protein will be operative. Similarly, arginine and lysine cleavage sites provide adjacent to the desired protein cleavage with trypsin-like proteases.
For at tilvejebringe udskillelse kan DNA-sekvensen, der 25 koder for insulinprecursorerne, forbindes med en yderligere DNA-sekvens, der koder for et signalpeptid, signalpeptidet spaltes fra af den transformerede mikroorganisme under udskillelsen af det udtrykte proteinprodukt fra cellerne, hvorved der sikres en mere enkel isolering af det ønskede produkt. Det udskilte produkt 30 kan være insulinprecursoren eller kan indehold en yderligere N-terminal aminosyresekvens, der skal fjernes senere som forklaret ovenfor.To provide secretion, the DNA sequence encoding the insulin precursors can be associated with an additional DNA sequence encoding a signal peptide, the signal peptide being cleaved off by the transformed microorganism during the secretion of the expressed protein product from the cells, simple isolation of the desired product. The secreted product 30 may be the insulin precursor or may contain an additional N-terminal amino acid sequence to be removed later as explained above.
Udskillelse kan tilvejebringes ved i vektoren at indsætte gær MFal-leadersekvensen (Kurjan, J. og Herskowitz, I., 35 Cell 30, (1982), 933 - 943).Excretion can be achieved by inserting into the vector the yeast MFα1 leader sequence (Kurjan, J. and Herskowitz, I., 35 Cell 30, (1982), 933-943).
Udtrykkeisen af den ønskede DNA-sekvens vil være under kontrol af en promotorsekvens, der er korrekt anbragt i forhold til DNA-sekvensen, som koder for det ønskede proteinprodukt, hvorved det ønskede protein udtrykkes i værtsorganismen. Der kan 7The expression of the desired DNA sequence will be under the control of a promoter sequence correctly positioned relative to the DNA sequence encoding the desired protein product, whereby the desired protein is expressed in the host organism. There can 7
DK 157938 BDK 157938 B
fortrinsvis anvendes en promotor fra et gen, der er hjemmehørende i værtsorganismen. DNA-sekvensen af det ønskede protein vil være efterfulgt af en transscriptionsterminatorsekvens, fortrinsvis en terminatorsekvens fra et gen, der er hjemmehørende i værtsorga-5 nismen. Foretrukne promotor- og terminatorsekvenser er henholdsvis promotoren og terminatoren for triosephosphatisomerase (TPI)-genet.preferably a promoter of a gene resident in the host organism is used. The DNA sequence of the desired protein will be followed by a transcription terminator sequence, preferably a terminator sequence from a gene native to the host organism. Preferred promoter and terminator sequences are the promoter and terminator of the triosephosphate isomerase (TPI) gene, respectively.
Der kan også anvendes andre promotorer, såsom phospho-glyceratkinase (PGK1)- og MFal-promotoren.Other promoters such as phosphoglycerate kinase (PGK1) and MFα1 promoters may also be used.
10 Den foreliggende opfindelse tilvejebringer yderligere en fremgangsmåde til fremstilling af human insulin, ved hvilken en gærstamme transformeret med en replicerbar vektor, der indeholder en DNA-sekvens, der koder for insulinprecursorerne med den ovennævnte formel I, dyrkes i et egnet næringsmedium, insulin-15 precursorerne udvindes fra dyrkningsmediet og omdannes in vitro til human insulin.The present invention further provides a method for producing human insulin in which a yeast strain transformed with a replicable vector containing a DNA sequence encoding the insulin precursors of the above formula I is grown in a suitable nutrient medium, insulin-15. the precursors are recovered from the culture medium and converted into human insulin in vitro.
De ved fremgangsmåden fremstillede insulinprecursorer kan omdannes til humaninsulin ved transpeptidering med en L-threoninester i nærværelse af trypsin eller et trypsinderivat, 20 som beskrevet i beskrivelsen til dansk patentansøgning nr. 574/80 efterfulgt af omdannelse af threoninesteren af humaninsulin til humaninsulin på kendt måde.The insulin precursors of the process can be converted to human insulin by transpeptidation with an L-threonine ester in the presence of trypsin or a trypsin derivative, as described in the specification of Danish Patent Application No. 574/80, followed by conversion of the threonine ester of human insulin to human insulin in known manner.
Hvis insulinprecursorerne udskilles med en yderligere aminosyresekvens hæftet på N-terminalen af B(1-29)-kæden, bør en 25 sådan aminosyresekvens enten fjernes in vitro før transpeptideringen eller bør indeholde mindst en basisk aminosyre stødende op til N-terminalen af B( 1-29)-kæden, da trypsin vil spalte peptid-bindingen mellem den basiske aminosyre og aminogruppen i Phe under transpeptideringen.If the insulin precursors are secreted with an additional amino acid sequence attached to the N-terminus of the B (1-29) chain, such an amino acid sequence should either be removed in vitro prior to transpeptidation or should contain at least one basic amino acid adjacent to the N-terminus of B (1 -29) chain, since trypsin will cleave the peptide bond between the basic amino acid and the amino group of Phe during transpeptidation.
30 Opfindelsen skal forklares nærmere under henvisning til tegningen på hvilken 8 fig. 1 viser fremstillingen af plasmid ^ ® fig. 2 viser fremstillingen af plasmid pMT475, fig. 3 viser fremstillingen af plasmid pMT212, fig. 4 viser fremstillingen af plasmid pMT479r 5 fig. 5 viser fremstillingen af plasmid pMT319f fig. 6 viser fremstillingen af plasmid pMT598, fig. 7 viser fremstillingen af plasmid pMT610, fig. 8 viser fremstillingen af plasmid pT5 og fig. 9 viser fremstillingen af plasmid pMT639.The invention will be explained in more detail with reference to the drawing, in which: FIG. 1 shows the preparation of plasmid 2 shows the preparation of plasmid pMT475; FIG. 3 shows the preparation of plasmid pMT212; FIG. 4 shows the preparation of plasmid pMT479r 5 FIG. 5 shows the preparation of plasmid pMT319f FIG. 6 shows the preparation of plasmid pMT598; 7 shows the preparation of plasmid pMT610; FIG. 8 shows the preparation of plasmid pT5 and FIG. 9 shows the preparation of plasmid pMT639.
10 I tegningerne og i dele af den følgende beskrivelse an vendes udtrykket B' i stedet for B(l-29) og A i stedet for A(l-21). Udtrykket B'A er følgelig ækvivalent med udtrykket B(l-29)-A(l-21).In the drawings and in parts of the following description, the term B 'is used instead of B (l-29) and A instead of A (l-21). The term B'A is accordingly equivalent to the term B (1-29) -A (1-221).
15 1. Fremstilling af et gen, der koder for humanproinsulin B-C-A Helt oprenset RNA (Chirgwin, J.M. Przybyla, A.E., McDonald, R.J. & Rutter, W.J., Biochemistry 18, (1979) 5294 -5299) fra humanpancreas blev reverstransskriberet (Boel, E.,1. Preparation of a gene encoding human proinsulin BCA Fully purified RNA (Chirgwin, JM Przybyla, AE, McDonald, RJ & Rutter, WJ, Biochemistry 18, (1979) 5294-55299) from human pancreas was reverse-transcribed (Boel, E .,
Vuust, J., Norris, F., Norris, K., Wind, A., Rehfeld, J.F. & 20 Marcker, K.A., Proc.Natl.Acad.Sci. USA 80, (1983), 2866 - 2869) med AMV reverstransskriptase og d(GCTTTATTCCATCTCTC) som 1. strengsprimer. Efter præperativ urinstofpolyacrylamidgeloprens-ning af humanproinsulin-cDNA blev den anden streng syntetiseret på denne templat med DNA polymerase stort fragment og e 25 d(CAGATCACTGTCC) som andenstrengsprimer. Efter Si nucleasefor-døjelse blev humanproinsulin dobbeltstrenget cDNA oprenset ved polyacrylamidgelelektroforese, enden blev dannet med terminal transferase og dobbeltstrenget cDNA blev klonet i Pstl-stedet på pBR327 (Sorberon et al., Gene 9, (1980), 287 - 305) i E. coli. En 30 korrekt klon, der indeholder et plasmid, der koder for humanproinsulin blev identificeret blandt rekombinanterne ved hjælp af restriktionsendonucleaseanalyse og bekræftet ved nucleotidsekven-tering (Maxam, A., & Gilbert, W., Methods in Enzymology, 65 (1980), 499 - 560. Sanger, F., Nicklen, S. & Coulson, A.R., 35 Proc.Natl.Acad.Sci. USA 74, (1977), 5463 - 5467).Vuust, J., Norris, F., Norris, K., Wind, A., Rehfeld, J.F. & 20 Marcker, K.A., Proc.Natl.Acad.Sci. USA 80, (1983), 2866 - 2869) with AMV reverse transcriptase and d (GCTTTATTCCATCTCTC) as 1st strand primer. Following preparative urea polyacrylamide gel purification of human proinsulin cDNA, the second strand was synthesized on this template with DNA polymerase large fragment and e 25 d (CAGATCACTGTCC) as second strand primer. Following Si nuclease digestion, human proinsulin double-stranded cDNA was purified by polyacrylamide gel electrophoresis, the end formed with terminal transferase, and double-stranded cDNA was cloned at the Pst1 site of pBR327 (Sorberon et al., Gene 9, (1980), 287-305) in E. coli. A correct clone containing a plasmid encoding human proinsulin was identified among the recombinants by restriction endonuclease analysis and confirmed by nucleotide sequencing (Maxam, A., & Gilbert, W., Methods in Enzymology, 65 (1980), 499 560. Singer, F., Nicklen, S., & Coulson, A. R., Proc. Nat. Acad. Sci. U.S. 74, (1977), 5463-55467).
9 2. Fremstilling af gener, der koder for humaninsulQip^:ec^r^<^:^r^ ^9 2. Preparation of Genes Encoding Human InsulQip ^: ec ^ r ^ <^: ^ r ^^
Genet, der koder for B(1-29)-A(1-21) af humaninsulin blev fremstillet ved "site specific mutagenesis" af humanproinsu-linsekvensen med en 75bp i ramme deletion i den region, der koder 5 for C-peptidet, indsat i en cirkulær, enkeltstrenget M-13 bakte-riophag vektor. En modificeret fremgangsmåde (K. Norris et al., Nuel.Acids.Res. 11 (1983) 5103 - 5112) blev anvendt, ved hvilken en kemisk syntetiseret 19-mer deletionsprimer blev hybridiseret til M-13 templaten. Efter en kort enzymatisk forlængningsreaktion 10 blev der tilsat en "universal" 15-mer M-13 dideoxysekventerings-primer efterfulgt af enzymatisk forlængning og ligering. Et dobbeltstrenget restriktionsfragment (BamHl-Hind III) blev skåret ud af det delvist dobbeltstrengede cirkulære DNA og ligeret i pBR322, der var skåret med BamHI og Hind III.The gene encoding B (1-29) -A (1-21) of human insulin was produced by "site specific mutagenesis" of the human proinsulin sequence with a 75bp in frame deletion in the region encoding 5 for the C peptide, inserted into a circular, single-stranded M-13 baking riophage vector. A modified method (K. Norris et al., Nuel.Acids.Res. 11 (1983) 5103-5112) was used, in which a chemically synthesized 19-mer deletion primer was hybridized to the M-13 template. After a short enzymatic extension reaction 10, a "universal" 15-mer M-13 dideoxy sequencing primer was added followed by enzymatic extension and ligation. A double-stranded restriction fragment (BamH1-Hind III) was excised from the partially double-stranded circular DNA and ligated into pBR322 cut with BamHI and Hind III.
15 Den opnåede ligeringsblanding blev anvendt til at transformere E. coli, og transformanter indeholdende et plasmid pMT319 indeholdende genet kodende for B(1-29)-A(1-21) af humaninsulin blev identificeret.The resulting ligation mixture was used to transform E. coli, and transformants containing a plasmid pMT319 containing the gene encoding B (1-29) -A (1-21) of human insulin were identified.
Gener, der koder for B(1-29)-Ala-Ala-Lys-A(1-21) og 20 B(1-29)-Ser-Lys-A(1-21) blev fremstillet ved indsættelse af et fragment, der koder for MFal-B-C-A i M-13 bakteriophagen og site specific mutagenesis af den humane proinsulinsekvens med henholdsvis kemisk syntetiseret 30-mer og 27-mer deletionsprimere og den førnævnte "universelle" 15-mer M13 dideoxysekventerings-25 primer. Et dobbeltstrenget restriktionsfragment (Xbal-EcoRl) blev skåret ud af det delvist dobbeltstrengede cirkulære DNA og ligeret til henholdsvis pUCl3 og pT5. Ved transformering og retrans-formering af E. coli blev der identificeret transformanter med et plasmid pMT598 indeholdende genet, der koder for B(l-29)-Ala-30 Ala-Lys-A(l-21), og pMT630 indeholdende genet, der koder for B(1-29)-Ser-Lys-A(1-21) .Genes encoding B (1-29) -Ala-Ala-Lys-A (1-21) and 20 B (1-29) -Ser-Lys-A (1-21) were prepared by inserting a fragment coding for MFα1-BCA in the M-13 bacteriophage and site specific mutagenesis of the human proinsulin sequence with chemically synthesized 30-mer and 27-mer deletion primers and the aforementioned "universal" 15-mer M13 dideoxy sequencing 25 primer, respectively. A double stranded restriction fragment (XbaI-EcoR1) was excised from the partially double stranded circular DNA and ligated to pUC13 and pT5, respectively. Transforming and retransmitting E. coli, transformants were identified with a plasmid pMT598 containing the gene encoding B (l-29) -Ala-30 Ala-Lys-A (l-21) and pMT630 containing the gene. encoding B (1-29) -Ser-Lys-A (1-21).
Et gen, der koder' for B(l-29)-Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A(l-21) blev fremstillet på samme måde som ovenfor beskrevet ved indsættelse af et fragment, der koder for MFal-35 B(1-29)-A(l-21) i en M13 mpll bakteriophag og site specific mutagenesis af B(1-29)-A( 1-21)-sekvensen med en kemisk syntetiseret 46-mer deletionsprimer (5'-CACACCCAAGACTAAAGAAGCTGAAGACTTGCAAAGAGGCATTGTG-3') og den universelle primer. Ligeledes blev ved en lignende fremgangsmåde 10A gene encoding B (l-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A (l-21) was prepared in the same manner as described above by inserting a fragment encoding MFal-35 B (1-29) -A (1-21) in an M13 mpll bacteriophage and site specific mutagenesis of the B (1-29) -A (1-21) sequence with a chemically synthesized 46-mer deletion primer (5'-CACACCCAAGACTAAAGAAGCTGAAGACTTGCAAAGAGGCATTGTG-3 ') and the universal primer. Likewise, by a similar method 10
DK 157938 BDK 157938 B
fremstillet et gen, der koder for B(l-29)-Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Val-Gly-Gln-Val-Glu-Leu-Gly-Gly-Gly-Pro-Gly-Ala-Gly-Ser-Leu-Gln-Pro-Leu-Ala-Leu-Glu-Gly-Ser-Leu-Gln-Lys-A(l-21).prepared a gene encoding B (1-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Val-Gly-Gln-Val-Glu-Leu-Gly-Gly-Gly-Pro Gly-Ala-Gly-Ser-Leu-Gln-Pro-Leu-Ala-Leu-Glu-Gly-Ser-Leu-Gln-Lys-A (l-21).
5 3. Plasmidkonstruktioner5 3. Plasmid constructs
Genet kodende for B(1-29)-A(1-21) af humaninsulin (ΒΆ) blev isoleret som et restriktionsfragment fra pMT319 og kombineret med fragmenter kodende for TPI-promotoren (TPIp) (T. Alber og G. Kawasaki. "Nucleotide Sequence of the Triose Phosphate Isome-10 rase Gene of Saccharomyces cerevisiae." J.Mol.Applied Genet. 1 (1982) 419 - 434), MFal leader sekvensen (J. Kurjan and I. Herskowitz,. Structure of a Yeast Pheromone Gene (MFa): "A Putative α-Factor Precursor Contains four Tandem Copies of mature α-Factor," Cell 30 (1982) 933 - 943) og transskriptionstermine-15 ringssekvensen fra TPI fra S. cerevisiae (TPIT). Disse fragmenter tilvejebringer sekvenser til at sikre en høj hyppighed af transskription af det B'A-kodende gen og tilvejebringer også en præ- , sekvens, der kan bevirke lokalisering af B'A i sekretionsvejen og dens eventuelle udskillelse i vækstmediet. Denne udskillelses-20 enhed for ΒΆ (TPIp-MFal leader - ΒΆ - TPI^) blev derpå indsat i en plasmidvektor, der indeholder gær 2μ replikationsinitierings-sitet og en selekterbar markør, LEU 2, til dannelse af pMT344, en gærudtrykkeIsesvektor for B'A.The gene encoding B (1-29) -A (1-21) of human insulin (ΒΆ) was isolated as a restriction fragment from pMT319 and combined with fragments encoding the TPI promoter (TPIp) (T. Alber and G. Kawasaki. " Nucleotide Sequence of the Triose Phosphate Isome-10 Gene Gene of Saccharomyces cerevisiae. "J. Mol. Applied Genet. 1 (1982) 419 - 434), MFal leader sequences (J. Kurjan and I. Herskowitz, Structure of a Yeast Pheromone Gene (MFa): "A Putative α-Factor Precursor Contains Four Tandem Copies of Mature α-Factor," Cell 30 (1982) 933 - 943) and the transcription termination sequence of TPI from S. cerevisiae (TPIT). These fragments provide sequences to ensure a high frequency of transcription of the B'A coding gene and also provide a pre-sequence which may cause localization of B'A in the secretory pathway and its possible secretion into the growth medium. This secretion-20 unit for ΒΆ (TPIp-MFal leader - ΒΆ - TPI ^) was then inserted into a plasmid vector containing yeast 2μ replication initiation site and a selectable marker, LEU 2, to form pMT344, a yeast expression reading vector for B ' A.
Ved in vivo modning af α-faktor i gær fjernes de sidste 25 (C-terminale) seks aminosyrer af MFal leaderpeptidet (Lys-Arg-Glu-Ala-Glu-Ala) fra a-faktorprecursoren ved sekvensvis virkning af en endopeptidase, der genkender Lys-Arg sekvensen, og en aminodipeptidase, der fjerner Glu-Ala-aminosyreresten (Julius, D. et al. Cell 32 (1983) 839 - 852). For at eliminere behovet for 30 gæraminodipeptidasen, blev den sekvens, der koder for C-termina-len Glu-Ala-Glu-Ala i MFal-leaderen fjernet fra pMT344 via in vitro mutagenese. Det fremkomne gærudtrykkelsesplasmid, pMT475, indeholder en indsat del, der koder for TPIp-MFal-leader (minus Glu-Ala-Glu-Ala) -ΒΆ-ΤΡΙΤ.By in vivo maturation of α-factor in yeast, the last 25 (C-terminal) six amino acids of the MFα leader peptide (Lys-Arg-Glu-Ala-Glu-Ala) are removed from the α-factor precursor by sequential action of an endopeptidase recognizing The Lys-Arg sequence, and an amino dipeptidase that removes the Glu-Ala amino acid residue (Julius, D. et al. Cell 32 (1983) 839-852). To eliminate the need for the yeast aminodipeptidase, the sequence encoding the C-terminal Glu-Ala-Glu-Ala in the MFα1 leader was removed from pMT344 via in vitro mutagenesis. The resulting yeast expression plasmid, pMT475, contains an inserted portion encoding the TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -ΒΆ-ΤΡΙΤ.
35 I en foretrukket konstruktion blev den modificerede udtrykkelsesenhed overført til et stabilt, højkopitalsgærplasmid CPOT, (ATCC nr. 39685), der kan selekteres for udelukkende ved tilstedeværelsen af glucose i vækstmediet. Den fremkomne gærud-trykkelsesvektor for B'A blev benævnt pMT479.In a preferred construct, the modified expression unit was transferred to a stable, high-capital yeast plasmid CPOT, (ATCC No. 39685) selectable only for the presence of glucose in the growth medium. The resulting yeast expression vector for B'A was designated pMT479.
1111
DK 157 9 3 8 BDK 157 9 3 8 B
Fragmenter, der koder for MFal-leaderen (minus Glu-Ala-Glu-Ala)-B(1-29)-Ala-Ala-Lys-A(1-21) blev isoleret som et restriktionsfragment fra pMT598 og sat sammen med fragmenter, der koder for TPI-promotoren og TPI-terminatoren, og overført til det 5 før nævnte højkopitalsgærplasmid CPOT. Den fremkomne gærudtryk-kelsesvektor for B{1-29)-Ala-Ala-Lys-A(1-21) blev kaldt pMT610.Fragments encoding the MFα1 leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ala-Ala-Lys-A (1-21) were isolated as a restriction fragment from pMT598 and assembled with fragments , which encodes the TPI promoter and the TPI terminator, and transferred to the aforementioned high-capital yeast plasmid CPOT. The resulting yeast expression vector for B {1-29) -Ala-Ala-Lys-A (1-21) was called pMT610.
Fragmentet, der indeholder den indsatte TPIp-MFal-leader (minus Glu-Ala-Glu-Ala)-B(1-29)-Ser-Lys-A(1-21J-TPI^ blev isoleret som et restriktionsfragment fra pMT630 og overført til 10 CPOT. Den fremkomne gærudtrykkelsesvektor for B(l-29)-Ser-Lys-A(l-21) blev kaldt pMT639.The fragment containing the inserted TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ser-Lys-A (1-21J-TPII) was isolated as a restriction fragment from pMT630 and transferred to 10 CPOT The resulting yeast expression vector for B (l-29) -Ser-Lys-A (l-21) was called pMT639.
Fragmentet, der indeholder den indsatte sekvens TPIp-MFal-leader (minus Glu-Ala-Glu-Ala)-B(1-29)-Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A(l-21)-TPIT blev indsat i et højkopitalsgær-15 plasmid DPOT, som er et CPOT-derivat, indeholdende et Sphl-The fragment containing the inserted sequence TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A ( 1-21) -TPIT was inserted into a high-capital yeast plasmid DPOT, which is a CPOT derivative containing an
BamHI-fragment af pBR322 indsat i et SpHl-BamHI-fragment af CPOT. Den fremkomne gærudtrykkelsesvektor for B(l-29)-Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A(l-21) blev kaldt pll26.BamHI fragment of pBR322 inserted into a SpH1-BamHI fragment of CPOT. The resulting yeast expression vector for B (l-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A (l-21) was called pll26.
20 4. Transformering4. Transformation
Plasmiderne pMT344 og pMT475 blev transformeret i S. cerevisiae leu 2 mutanter ved hjælp af selektion for leucin-prototrofi som beskrevet af Hinnen et al. (A. Hinnen, J.B. Hicks 25 og G.R. Fink, "Transformation of Yeast", Proc.Nat.Aca.Sci. 75 (1978) 1929).The plasmids pMT344 and pMT475 were transformed into S. cerevisiae leu 2 mutants by selection for leucine prototrophy as described by Hinnen et al. (A. Hinnen, J.B. Hicks 25, and G.R. Fink, "Transformation of Yeast," Proc.Nat.Aca.Sci. 75 (1978) 1929).
Plasmidet pMT479, pMT610, pMT639 og pll26 blev transformeret i S. cerevisiae stammer, der har deletioner i TPI-genet, ved selektering for vækst på glucose. Sådanne stammer er normalt 30 ude af stand til at gro på glucose som den eneste kulstofkilde og gror meget langsomt på et galactoselactatmedium. Denne defekt skyldes en mutation i triosephosphatisomerasegenet, opnået ved en deletion og erstatning af en væsentlig del af dette gen med S. cerevisiae LEU 2 genet. På grund af vækstdefekten er der en stærk 35 selektering for et plasmid, der indeholder et gen, som koder for TPI. CPOT og DPOT indeholder Schizo.pombe TPI genet.Plasmid pMT479, pMT610, pMT639 and pll26 were transformed into S. cerevisiae strains having deletions in the TPI gene by selection for glucose growth. Such strains are usually unable to grow on glucose as the only carbon source and grow very slowly on a galactose lactate medium. This defect is due to a mutation in the triosephosphate isomerase gene, obtained by deletion and replacement of a substantial part of this gene by the S. cerevisiae LEU 2 gene. Due to the growth defect, there is a strong selection for a plasmid containing a gene encoding TPI. CPOT and DPOT contain the Schizo.pombe TPI gene.
DK 157938BDK 157938B
5. Udtrykkelse af humaninsulinprecursorer i gær5. Expression of human insulin precursors in yeast
Udtrykkelsesprodukterne af humaninsulintypen blev målt ved radioimmunoassay for insulin som beskrevet af Heding, L. (Diabetologia 8f 260 - 66, 1972) med den eneste undtagelse, at 5 den pågældende insulinprecursorstandard blev anvendt i stedet for en insulinstandard. Renheden af standarderne var ca. 98% bestemt ved HPLC, og den aktuelle koncentration af peptidet i standarden blev bestemt ved aminosyreanalyse. Udtrykkelsesmængderne af immunoreaktive humaninsulinprecursorer i de transformerede gær-10 stammer er angivet i tabel I.The human insulin-type expression products were measured by insulin radioimmunoassay as described by Heding, L. (Diabetologia 8f 260-66, 1972) with the sole exception that the insulin precursor standard in question was used instead of an insulin standard. The purity of the standards was approx. 98% determined by HPLC and the actual concentration of the peptide in the standard was determined by amino acid analysis. The expression amounts of immunoreactive human insulin precursors in the transformed yeast strains are given in Table I.
Tabel 1Table 1
Udtrykkelsesniveauer for immunoreaktive humaninsulinprecursorer i 15 gær__________Expression levels of immunoreactive human insulin precursors in 15 yeast __________
Immunoreaktive insulinprecur sorer Gærstamme Plasmid Konstruktion (nmol/liter _ supernatant)_ 20 MT 350 (DSM 2957) pMT 344 B(1-29)-A( 1-21) 100 MT 371 (DSM 2958) pMT 475 B(1-29)-A(1-21) 192 MT 519 (DSM 2959) pMT 479 B( 1-29 )-A( 1-21) 2900 MT 620 (DSM 3196) pMT 610 B(l-29)-Ala-Ala-Lys-A(l-21) 1200 - 1600 MT 649 (DSM 3197) pMT 639 B(1-29)-Ser-Lys-A( 1-21) 1600 25 ZA 426 p 1126 B (1-29) -Thr-Arg-Glu-Ala-Glu- 200Immunoreactive insulin precursors Yeast strain Plasmid Construction (nmol / liter _ supernatant) _ 20 MT 350 (DSM 2957) pMT 344 B (1-29) -A (1-21) 100 MT 371 (DSM 2958) pMT 475 B (1-29 ) -A (1-21) 192 MT 519 (DSM 2959) pMT 479 B (1-29) -A (1-21) 2900 MT 620 (DSM 3196) pMT 610 B (1-29) -Ala-Ala- Lys-A (l-21) 1200 - 1600 MT 649 (DSM 3197) pMT 639 B (1-29) -Ser-Lys-A (1-21) 1600 ZA 426 p 1126 B (1-29) -Thr -Arg-Glu-Ala-Glu- 200
Asp-Leu-Gln-Lys-A(1-21) B(1-29)-Gly-Ser-Lys-A( 1-21) 1260 B (1-29) -Thr-Leu-Lys-A (1-21) 670 B (1-29) -Asp-Thr-Lys-A (1-21) 2900 30 B( 1-29)-His-Thr-Lys-A( 1-21) 580 B (1-29) -Asp-Ala-Lys-A (1-21) 2500 B( 1-29 )-Asp-Gly-Lys-A( 1-21) 3340 B (1-29) -Ser-Ser-Glu-Asn-Thr- 620Asp-Leu-Gln-Lys-A (1-21) B (1-29) -Gly-Ser-Lys-A (1-21) 1260 B (1-29) -Thr-Leu-Lys-A (1 -21) 670 B (1-29) -Asp-Thr-Lys-A (1-21) 2900 B (1-29) -His-Thr-Lys-A (1-21) 580 B (1-29) ) -Asp-Ala-Lys-A (1-21) 2500 B (1-29) -Asp-Gly-Lys-A (1-21) 3340 B (1-29) -Ser-Ser-Glu-Asn- Thr- 620
Trp-Asp-Lys-A (1-21) 35 B (1-29) -Gly-Ala-Gly-Pro-Thr- 880Trp-Asp-Lys-A (1-21) B (1-29) -Gly-Ala-Gly-Pro-Thr-880
Pro-Gly-Lys-A( 1-21) B (1-29) -Val-Pro-Pro-Val-Thr- 560Pro-Gly-Lys-A (1-21) B (1-29) -Val-Pro-Pro-Val-Thr-560
Glu-Asp-Lys-A (1-21) * 13Glu-Asp-Lys-A (1-21) * 13
DK 157938 BDK 157938 B
Isoleringen og karakteriseringen af udtrykkelsesproduk-ter er angivet i eksemplerne 7 - 9 og 12 - 13.The isolation and characterization of expression products is given in Examples 7 - 9 and 12 - 13.
6. Omdannelse af humaninsulinprecursorerne til B30 estere af 5 humaninsulin6. Conversion of the human insulin precursors to B30 esters of 5 human insulin
Omdannelsen af humaninsulinprecursorerne til humaninsu-linestere kan følges kvantitativt ved HPLC (højtryksvæskekromatografi) på omvendt fase. En 4 x 300 mm '^Bondapak C18 kolonne" (Waters Ass.) blev anvendt, og elueringen blev udført med en 10 puffer, der indeholdt 0,2 M ammoniumsulphat (indstillet til en pH-værdi på 3,5 med svovlsyre) og indeholdende 26 - 50% aceto-nitril. Den optimale acetonitrilkoncentration afhænger af, hvilken ester man ønsker at fraskille fra insulinprecursoren. I tilfælde af humaninsulinmethylester opnås fraskillelsen i ca. 26% 15 (v/v) acetonitril.The conversion of the human insulin precursors to human insulin esters can be quantitatively monitored by reverse-phase HPLC (high pressure liquid chromatography). A 4 x 300 mm 3 Bondapak C18 column (Waters Ass.) Was used and the elution was performed with a buffer containing 0.2 M ammonium sulfate (adjusted to a pH of 3.5 with sulfuric acid) and Containing 26 - 50% acetonitrile The optimal acetonitrile concentration depends on which ester one wants to separate from the insulin precursor, in the case of human insulin methyl ester the separation is obtained in about 26% 15 (v / v) acetonitrile.
Før påføringen på HPLC kolonnen blev proteinerne i reaktionsblandingen udfældet ved tilsætning af 10 rumfang acetone. Bundfaldet blev isoleret ved centrifugering, tørret i vakuum og opløst i 1 M eddikesyre-.Prior to application to the HPLC column, the proteins in the reaction mixture were precipitated by the addition of 10 volumes of acetone. The precipitate was isolated by centrifugation, dried in vacuo and dissolved in 1 M acetic acid.
2020
Eksempel 1Example 1
Konstruktion af et gen, der koder for B(1-29)-A(1-21) insulin s' 25 Materialer og metoderConstruction of a gene encoding B (1-29) -A (1-21) insulin s' 25 Materials and Methods
Den "universelle" 15-mer M13 dideoxysekventeringsprimer d(TCCCAGTCACGACGT), T4 DNA-ligase og restriktionsenzymer blev opnået fra New England Biolabs. DNA-polymerase I "KlenowThe "universal" 15-mer M13 dideoxy sequencing primer d (TCCCAGTCACGACGT), T4 DNA ligase, and restriction enzymes were obtained from New England Biolabs. DNA Polymerase I ”Klenow
fragment" og T4-polynucleotidkinase, blev købt hos P-Lfragment "and T4 polynucleotide kinase, were purchased from P-L
32 30 Biochemicals. (γ- P)-ATP (7500 Ci/nmol) blev opnået fra New32 30 Biochemicals. (γ-P) -ATP (7500 Ci / nmol) was obtained from New
England Nuclear. Supporten for oligonucleotidsyntesen var 5'-0- 2 dimethoxytrityl-N -isobutyryldeoxyguanosin bundet via en 3'-0-succinylgruppe til aminomethyleret 1% tværbundne polystyrenpiller fra Bachem.England Nuclear. The support for oligonucleotide synthesis was 5'-0-2 dimethoxytrityl-N-isobutyryldeoxyguanosine linked via a 3'-0-succinyl group to Bachem aminomethylated 1% cross-linked polystyrene pellets.
35 1435 14
Konstruktion af M13 mplO insHX^Pst fag DK 157938 BConstruction of M13 mplO insHX ^ Pst phage DK 157938 B
Den M13 mplO afledte fag mplO insHX blev konstrueret ved kloning af det 284 bp store proinsulinkodende Hind III-XbaI-fragment, isoleret fra p285, i Hind III-XbaI skåret M13 mplO RF.The M13 mp10 derived phage mp10 insHX was constructed by cloning the 284 bp proinsulin-coding Hind III-XbaI fragment, isolated from p285, into Hind III-XbaI cut M13 mp10 RF.
5 M13 mplO RF kan fås fra P-L Biochemicals, Inc. Milwaukee, Wis. (Katalog nr. 1541).5 M13 mp10 RF is available from P-L Biochemicals, Inc. Milwaukee, Wis. (Catalog No. 1541).
M13 mplO insHX^Pst blev konstrueret fra mplO insHX, RF ved fuldstændig Pstl-fordøjelse efterfulgt af ligering og transformering af E. coli JM103. Den resulterende fag indeholder den -10 humanproinsulinkodende sekvens, med en 75 bp i ramme deletion i den C-peptidkodende del. Enkeltstrengede fag blev fremstillet som beskrevet af Messing.J. og Vieira, J., (1982), Gene 19, 269 -276).M13 mplO insHX ^ Pst was constructed from mplO insHX, RF by complete Pstl digestion followed by ligation and transformation of E. coli JM103. The resulting phage contains the -10 human proinsulin coding sequence, with a 75 bp in frame deletion in the C-peptide coding portion. Single stranded phages were prepared as described by Messing.J. and Vieira, J., (1982), Gene 19, 269-276).
15 Oligodeoxyribonukleotidsyntese 19-mer deletionsprimeren d(CACACCCAAGGGCATTGTG) blev syntetiseret ved triestermetoden på en 1% tværbundet polystyrensupport (Ito, H., Ike, Y., Ikuta, S. og Itakura, K. (1982) j''Oligodeoxyribonucleotide Synthesis The 19-mer deletion primer d (CACACCCAAGGGCATTGTG) was synthesized by the triester method on a 1% cross-linked polystyrene support (Ito, H., Ike, Y., Ikuta, S. and Itakura, K. (1982)).
Nucl.Acids Res. 10, 1755 - 1769). Polymeren blev pakket i en kort 20 kolonne, og opløsningsmidler og reagenser blev leveret semi- automatisk ved hjælp af en HPLC-pumpe og et kontrolmodul. Oligo-nucleotidet blev oprenset efter deprotektion ved HPLC på en LiChrosorb RP18 kolonne (Chrompack (Fritz, H.-J., Belagaje, R., Brown, E.L., Fritz, R.H., Jones, R.A., Lees, R.G. og Khorana, 25 H.G. (1978) Biochemistry 17, 1257 - 1267)).Nucl.Acids Res. 10, 1755 - 1769). The polymer was packed in a short 20 column and solvents and reagents were supplied semi-automatically by an HPLC pump and a control module. The oligo nucleotide was purified after deprotection by HPLC on a LiChrosorb RP18 column (Chrompack (Fritz, H.-J., Belagaje, R., Brown, EL, Fritz, R.H., Jones, R.A., Lees, R.G. and Khorana, 25HG (1978) Biochemistry 17, 1257-1267).
DK 157938BDK 157938B
Til kolonihybridisering blev oligonukleotidet mærket uden tilsætning af "kold" ATP som beskrevet (Boel, E., Vuust, J., Norris, F., Norris, K., Wind, A., rehfeld, J. og Marcker, K.For colony hybridization, the oligonucleotide was labeled without the addition of "cold" ATP as described (Boel, E., Vuust, J., Norris, F., Norris, K., Wind, A., rehfeld, J. and Marcker, K.
(1983) Proc.Natl.Acad.Sci. USA 80, 2866 - 2869).(1983) Proc.Natl.Acad.Sci. USA 80, 2866 - 2869).
55
Oligodeoxyribonukleotid- "pr imed"-DNA-synteseOligodeoxyribonucleotide "pr imed" DNA synthesis
Enkeltstrenget M13 mplO insHXAPst (0,4 pmol) blev 32The single-stranded M13 mp10 insHXAPst (0.4 pmol) was 32
inkuberet med den 19-mer 5'—( P)-mærkede oligodeoxyribonukleo-tidprimer (10 pmol) i 20 μΐ 50 mM NaCl, 20 mM Tris-HCl pH 7,5, 10 10 mM MgCl2 og 1 mM DDT i 5 min. ved 55°C og opvarmet i 30 minutter ved 11°C. Derpå blev 9 μΐ d-NTP-blanding bestående af 2,2 mM af hver dATP, dCTP, dGTP, dTTP, 20 mM Tris-HCl, pH 7,5, 10 mM MgCl2, 50 mM NaCl, 1 mM DDT tilsat efterfulgt af 7 enheder E. coli DNA-polymerase I (Klenow). Blandingen blev holdt ved 11 °C i 30 minut-15 ter og opvarmet til 65°C i 10 minutter. Den universelle 15-mer primer for dideoxysekventering (4 pmol) blev tilsat, og blandingen blev opvarmet til 65°C i yderligere ét minut. Efter afkøling til 11°C blev der tilsat 26 μΐ af en opløsning indeholdende 20 mMincubated with the 19-mer 5 '- (P) -labeled oligodeoxyribonucleotide primer (10 pmol) in 20 μΐ 50 mM NaCl, 20 mM Tris-HCl pH 7.5, 10 10 mM MgCl 2 and 1 mM DDT for 5 min. at 55 ° C and heated for 30 minutes at 11 ° C. Then, 9 μΐ d-NTP mixture consisting of 2.2 mM of each dATP, dCTP, dGTP, dTTP, 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 50 mM NaCl, 1 mM DDT was added followed by 7 units of E. coli DNA polymerase I (Klenow). The mixture was kept at 11 ° C for 30 minutes and heated to 65 ° C for 10 minutes. The universal 15-mer primer for dideoxy sequencing (4 pmol) was added and the mixture was heated to 65 ° C for one more minute. After cooling to 11 ° C, 26 μΐ of a solution containing 20 mM was added
Tris-HCl pH 7,5, 10 mM MgCl-, 10 .mM DTT, 0,8 mM af hver dATP, 1 3 20 dCTP, dGTP, dTTP, 2,4 mM ATP og 10 enheder T4 ligase efterfulgt af 9,5 enheder E. ooli DNA-polymerase I (Klenow). Slutrumfanget af blandingen var 64 μΐ. Efter inkubering i 3 timer ved 11°C blev der tilsat 20 μΐ 4M natriumacetat, og rumfanget blev indstillet til 200 μ I·* med TE-puffer (10 mM Tris-HCl pH 8,0, 1 mM 25 EDTA).Tris-HCl pH 7.5, 10 mM MgCl-, 10 mM DTT, 0.8 mM of each dATP, 1 3 dCTP, dGTP, dTTP, 2.4 mM ATP, and 10 units of T4 ligase followed by 9.5 units of E. ooli DNA polymerase I (Klenow). The final volume of the mixture was 64 μΐ. After incubation for 3 hours at 11 ° C, 20 μΐ of 4M sodium acetate was added and the volume was adjusted to 200 μL · with TE buffer (10 mM Tris-HCl pH 8.0, 1 mM 25 EDTA).
Blandingen blev ekstraheret to gange med phenol/chloro-form. 0,9 μg (0,3 pmol) af det oprensede store fragment af pBR322 spaltet med BamHI og Hind III blev tilsat som bærer-DNA. Efter æterekstraktion af den vandige fase blev DNA isoleret ved 30 ethanoludfældning.The mixture was extracted twice with phenol / chloroform. 0.9 µg (0.3 pmol) of the purified large fragment of pBR322 digested with BamHI and Hind III was added as carrier DNA. After ether extraction of the aqueous phase, DNA was isolated by ethanol precipitation.
Endonukleasefordøjelseendonuclease digestion
DNA, fremstillet som beskrevet ovenfor, blev fordøjet henholdsvis med 16 og 20 enheder af restriktionsendonukleaserne 35 BamHI og Hind III i et totalt rumfang af 22 μΐ puffer (50 mMDNA, prepared as described above, was digested with 16 and 20 units, respectively, of the restriction endonucleases 35 BamHI and Hind III in a total volume of 22 μ (buffer (50 mM
NaCl, 10 mM Tris-HCl, pH 7,5, 10 mM MgCl2# 1 mM DDT, 4 mM spermi-din). Blandingen blev ekstraheret med fenol/chloroform efterfulgt 16 at æter, og DNA blev isoleret ved ethanoludfældninP^NaCl, 10 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 # 1 mM DDT, 4 mM spermidine). The mixture was extracted with phenol / chloroform followed by 16 ether and DNA was isolated by ethanol precipitation
løst i 12 μΐ H20. 2 μΐ blev anvendt til elektroforese på en 7 Mdissolved in 12 μΐ H2 O. 2 μΐ was used for electrophoresis on a 7 M
urinstof 6% polyacrylamid gel.urea 6% polyacrylamide gel.
5 Ligering5 Ligation
Til en del af DNA (5 μΐ) blev der sat en ny portion af det oprensede store fragment af pBR322 skåret med BamHI og Hind III (0,38 μg) og 400 enheder T4 DNA ligase i et totalt rumfang på 41 μΐ indeholdende 66 mM Tris-HCl, pH 7,4, 10 mM MgCl2, 1 mM ATP, 10 10 mM DDT, 40 μg/ml gelatine. Ligeringen blev udført ved 16°C i 16 timer.To a portion of DNA (5 μΐ) was added a new portion of the purified large fragment of pBR322 cut with BamHI and Hind III (0.38 μg) and 400 units of T4 DNA ligase in a total volume of 41 μΐ containing 66 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 1 mM ATP, 10 10 mM DDT, 40 μg / ml gelatin. The ligation was performed at 16 ° C for 16 hours.
Transformering 20,5 μΐ af ligeringsblandingen blev anvendt til at 15 transformere CaCl2 behandlet E.coli MC 1000 (r , m+). Bakterierne blev udspredt på LB-agarplader og selekteret for resistens mod ampicillin (100 μg/ml). Der blev opnået 2,6 x 10^ kolonier pr. pmol M13 mplO insHX Pst.Transforming 20.5 μΐ of the ligation mixture was used to transform CaCl2 treated E.coli MC 1000 (r, m +). The bacteria were spread on LB agar plates and selected for resistance to ampicillin (100 μg / ml). 2.6 x 10 6 colonies per pmol M13 mplO insHX Pst.
20 Kolonihybridisering 123 transformerede kolonier blev overført til friske ampicillinplader og dyrket natten over ved 37°C. Kolonierne blev overført til Whatman 540 filtrerpapir og fikseret (Gergen, J.P.,Colony Hybridization 123 transformed colonies were transferred to fresh ampicillin plates and grown overnight at 37 ° C. The colonies were transferred to Whatman 540 filter paper and fixed (Gergen, J.P.,
Stern, R.H. og Wensink, P.C. (1979), Nucl.Acids Res. 7, 2115 - 25 2136). En præhybridisering blev udført i en lukket plastikpose med 6 ml 0,9 M NaCl, 0,09 M Tris-HCl pH 7,5 0,006 M EDTA, 0,2%Stern, R.H. and Wensink, P.C. (1979), Nucl.Acids Res. 7, 2115 - 2136). A prehybridization was carried out in a sealed plastic bag with 6 ml of 0.9 M NaCl, 0.09 M Tris-HCl pH 7.5 0.006 M EDTA, 0.2%
Ficoll, 0,2% polyvinylpyrrolidon, 0,2% okseserumalbumin, 0,1% SDSFicoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, 0.1% SDS
og 50 μg/ml laksesperm DNA i to timer ved 65°C. Derpå blev der 6 32 tilsat 8,5 x 10 cpm P-mærket 19-mer, og hybridiseringen blev 30 udført natten over ved 45°C. Filtratet blev vasket 3 gange ved 0°C i 5 minutter med 0,9 M NaCl, 0,09 M natriumcitrat og blev derpå autoradiograferet og vasket en gang ved 45°C i et minut og autoradiograferet igen. Efter vask ved 45°C blev der identificeret 3 kolonier, der indeholdt muterede plasmider.and 50 μg / ml salmon sperm DNA for two hours at 65 ° C. Then 6 32 were added 8.5 x 10 cpm P-labeled 19-mer, and the hybridization was carried out overnight at 45 ° C. The filtrate was washed 3 times at 0 ° C for 5 minutes with 0.9 M NaCl, 0.09 M sodium citrate and then autoradiographed and washed once at 45 ° C for one minute and autoradiographed again. After washing at 45 ° C, 3 colonies containing mutated plasmids were identified.
3535
Endonukleaseanalyse af muterede plasmiderEndonuclease analysis of mutated plasmids
Plasmider fra de formodede muterede kolonier blev fremstillet ved rapidmetoder (Ish-Horowicz, D. og Burke, J.F. (1981), Nucl.Acids Res. 9, 2989 - 2998) fordøjet med en blanding af BamHIPlasmids from the putative mutated colonies were prepared by rapid methods (Ish-Horowicz, D. and Burke, J.F. (1981), Nucl.Acids Res. 9, 2989-2998) digested with a mixture of BamHI
DK 157938BDK 157938B
og Hind III og derpå analyseret ved elektroforese på en 2% agarosegel. Tilstedeværelsen af et 179 bp fragment bekræftede, at de 3 kolonier indeholdt muteret plasmid.and Hind III and then analyzed by electrophoresis on a 2% agarose gel. The presence of a 179 bp fragment confirmed that the 3 colonies contained mutated plasmid.
5 Retransformering5 Retransformation
Kolonierne identificeret som "mutant"-holdige plasmider er afkommet af en heteroduplex. Rene mutanter kunne opnås ved retransformering af CaC^-behandlet E. coli MC1000 (r , m+) med plasmid fra 2 af mutantkolonierne. Fra hver plade blev der isole-10 ret 5 ampicillinresistente kloner, plasmid-DNA blev fremstillet og analyseret ved endonucleasespaltning som nævnt ovenfor. Henholdsvis 3 ud af 5 og 5 ud af 5 påvistes at være rene mutanter.The colonies identified as "mutant" -containing plasmids are descended from a heteroduplex. Pure mutants could be obtained by retransformation of CaCl3-treated E. coli MC1000 (r, m +) with plasmid from 2 of the mutant colonies. From each plate, 5 ampicillin resistant clones were isolated, plasmid DNA was prepared and analyzed by endonuclease cleavage as mentioned above. 3 out of 5 and 5 out of 5, respectively, were shown to be pure mutants.
Et plasmid pMT319 blev udvalgt til videre anvendelse.A plasmid pMT319 was selected for further use.
15 DNA-sekvensanalyse 5 μg pMT319 blev spaltet med BamHI under standardbetingelser, ekstraheret med fenol og udfældet med ethanol. Udfyldning af de BamHI-cohæsive ender blev udført med Klenow DNA-polymerase 32 I, dCTP, dGTP, dTTP og a- P-dATP.· 20 Efter ekstraktion med fenol og udfældning med ethanol 32 blev DNA fordøjet med EcoRI. Det -P mærkede fragment med deletionen blev oprenset ved elektroforese på en 2% agarosegel og sekventeret ved Maxam-Gilbertmetoden (Maxam, A. og Gilbert, W (1980) Methods in Enzymology 65, 499 - 560) 25DNA sequence analysis 5 μg of pMT319 was digested with BamHI under standard conditions, extracted with phenol and precipitated with ethanol. Filling of the BamHI cohesive ends was performed with Klenow DNA polymerase 32 I, dCTP, dGTP, dTTP and α-β-dATP. · 20 After extraction with phenol and precipitation with ethanol 32, DNA was digested with EcoRI. The -P labeled fragment with the deletion was purified by electrophoresis on a 2% agarose gel and sequenced by the Maxam-Gilbert method (Maxam, A. and Gilbert, W (1980) Methods in Enzymology 65, 499-560).
Eksempel 2Example 2
Konstruktion af et gærplasmid pMT344 til udtrykkelse af B(l-29)-A(l-21) af humaninsulin (B'A) 30 Plasmid pMT319, der indeholder genet kodende for B'A og er konstrueret som beskrevet ovenfor, blev skåret med restriktionsenzymerne Hind III og Xbal, og et 0,18 kb fragment blev isoleret (T. Maniatis, E.F. Fritsch og J. Sambrook, Molecular Cloning, Cold Spring Harbor Press 1982) fra en 2% agarose gel. På 35 lignende måde blev et fragment (6,5 kb Xhol - Hind III) indeholdende S. cerevisiae TPI-promotoren (TPlp) (T. Alber og G.Construction of a yeast plasmid pMT344 to express B (l-29) -A (l-21) of human insulin (B'A) 30 Plasmid pMT319 containing the gene encoding B'A and constructed as described above was cut with the restriction enzymes Hind III and Xbal, and a 0.18 kb fragment was isolated (T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning, Cold Spring Harbor Press 1982) from a 2% agarose gel. Similarly, a fragment (6.5 kb XhoI - Hind III) containing the S. cerevisiae TPI promoter (TPlp) (T. Alber and G.
Kawasaki, "Nucleotide Sequence of the Triose Phosphate Isomerase Gene of Saccharomyces cerevisiae", J.Mol. Applied Genet. 1 (1982) 419 - 434) og MFal-leadersekvensen (J. Kurjan og I. Herskowitz, 18Kawasaki, "Nucleotide Sequence of the Triose Phosphate Isomerase Gene of Saccharomyces cerevisiae", J.Mol. Applied Genet. 1 (1982) 419 - 434) and the MFal leader sequence (J. Kurjan and I. Herskowitz, 18
DK 157938BDK 157938B
"Structure of a Yeast Pheromone Gene (MFa): A Putative a-Factor Precursor Contains four Tandem Copies of Mature α-Factor", Cell 30 (1982) 933 - 943) isoleret fra plasmid p285. p285 indeholder den indsatte sekvens TPIp-MFal-leader-B-C-A- TPI^, og er deponeret 5 i gærstamme Z33 (ATCC nr. 20681). Et fragment (0,7 kb Xbal -BamHI) indeholdende TPI-transskriptionstermineringssekvenserne (TPIT) (T. Alber og G. Kawasaki, "Nucleotide Sequence of the Triose Phosphate Isomerase Gene of Saccharomyces cerevisiae", J. Mol. Applied Genet. 1 (1982) 419 - 434) blev også isoleret fra· 10 p285. Endelig blev et 5,4 kb Xhol - BamHI fragment isoleret fra gærvektoren YEP13 (J.R. Broach, "Construction of High Copy Yeast Vectors Using 2 μιη Circle Sequences", Methods Enzymology 101 (1983) 307 - 325). De ovennævnte fire fragmenter blev ligeret (T. Maniatis, E.F. Fritsch, og J. Sambrook, "Molecular Cloning," Cold 15 Spring Harbor Press 1982) og transformeret i E. coli (T."Structure of a Yeast Pheromone Gene (MFa): A Putative α-Factor Precursor Contains Four Tandem Copies of Mature α-Factor", Cell 30 (1982) 933 - 943) isolated from plasmid p285. p285 contains the inserted sequence TPIp-MFal leader-B-C-A-TPI ^, and is deposited 5 in yeast strain Z33 (ATCC No. 20681). A fragment (0.7 kb XbaI-BamHI) containing the TPI transcription termination sequences (TPIT) (T. Alber and G. Kawasaki, "Nucleotide Sequence of the Triose Phosphate Isomerase Gene of Saccharomyces cerevisiae", J. Mol. Applied Genet. 1 ( 1982) 419 - 434) were also isolated from · 10 p285. Finally, a 5.4 kb Xhol - BamHI fragment was isolated from the yeast vector YEP13 (J.R. Broach, "Construction of High Copy Yeast Vectors Using 2 μιη Circle Sequences", Methods Enzymology 101 (1983) 307 - 325). The above four fragments were ligated (T. Maniatis, E.F. Fritsch, and J. Sambrook, "Molecular Cloning," Cold 15 Spring Harbor Press 1982) and transformed into E. coli (T.
Maniatis, E.F. Fritsch og J. Sambrook, "Molecular Cloning ", Cold Spring Harbor Press 1982), idet der blev selekteret for ampicillin resistens. Plasmider blev isoleret fra transformanter-ne, og strukturen af en af disse, pMT344, blev verificeret ved 20 hjælp af restriktionsmapning. Fremstillingen og de væsentlige egenskaber af pMT344 er beskrevet i fig. 1.Maniatis, E.F. Fritsch and J. Sambrook, "Molecular Cloning," Cold Spring Harbor Press 1982), selecting for ampicillin resistance. Plasmids were isolated from the transformants and the structure of one of them, pMT344, was verified by restriction mapping. The preparation and essential properties of pMT344 are described in FIG. First
Eksempel 3 25 Konstruktion af et gærplasmid pMT475 til udtrykkelse af B(l-29)-A(l-21) af humaninsulin (B'A) efter en modificeret MFal-leader.Example 3 Construction of a yeast plasmid pMT475 to express B (l-29) -A (l-21) of human insulin (B'A) following a modified MFal leader.
Til konstruktion af et plasmid til udtrykkelse af B'A efter en MFal-leader (J. Kurjan og I. Herskowitz, "Structure of a Yeast Pheromone Gene (MFa): A Putative α-Factor Precursor 30 Contains four Tandem Copies of Mature α-Factor", Cell 30 (1982) 933 - 943), der mangler sine sidste fire aminosyrer (Glu Ala Glu Ala), blev 0,14 kb Xbal - EcoRII-fragmentet indeholdende A- og en del af B'-sekvensen isoleret fra pMT319. På samme måde blev den 5' proximale del af B'-genet isoleret fra et 0,36 kb EcoRI -35 EcoRII-fragment fra pM215. Dette plasmid pM215 blev konstrueret ved subkloning af EcoRI - Xbal-fragmentet indeholdende proinsulin-B-C-A-genet fra p285 i pUC13 (konstrueret som beskrevet for pUC8 og pUC9 af Vieira et al., Gene 19: 259 - 268 (1982)) og efterfølgende in vitro loop-out fjernelse af de 12 baser, derFor constructing a plasmid to express B'A following an MFal leader (J. Kurjan and I. Herskowitz, "Structure of a Yeast Pheromone Gene (MFa): A Putative α-Factor Precursor 30 Contains Four Tandem Copies of Mature α -Factor ", Cell 30 (1982) 933-943), which lacks its last four amino acids (Glu Ala Glu Ala), the 0.14 kb Xbal - EcoRII fragment containing A and part of the B 'sequence was isolated from pMT319. Similarly, the 5 'proximal portion of the B' gene was isolated from a 0.36 kb EcoRI -35 EcoRII fragment from pM215. This plasmid pM215 was constructed by subcloning the EcoRI - XbaI fragment containing the proinsulin BCA gene from p285 into pUC13 (constructed as described for pUC8 and pUC9 by Vieira et al., Gene 19: 259-268 (1982)) and subsequently in vitro loop-out removal of the 12 bases that
19 DK 157938B19 DK 157938B
koder for Glu-Ala-Glu-Ala ved sammenføjningen mellem MFal-leaderen og proinsulin B-C-A-genet. Disse to stykker, der dækker B'A-genet, blev ligeret til pUCl3-vektoren fordøjet med EcoRI -Xbal (jrf. fig. 2) til dannelse af pMT473. Det modificerede gen, 5 der var indeholdt i et 0,5 kb EcoRI - Xbal-fragment, blev isoleret fra pMT473 og derpå ligeret til to fragmenter (4,3 kb Xbal -EcoRV og 3,3 kb EcoRV - EcoRI) fra pMT342. pMT342 er gærvektoren pMT212 med den indsatte sekvens TPIp-MFal-leader-B-C-A-TPIT. Det fremkomne plasmid, pMT475, indeholder den indsatte sekvens: 10 TPIp-MFal-leader-(minus Glu-Ala-Glu-Ala) - ΒΆ-ΤΡΙΤ. Konstruktionen af plasmiderne pMT342, 473 og 475 er beskrevet i fig. 2. Konstruktionen af vektoren pMT212 er vist i fig. 3. Plasmidet pMLB1034 er beskrevet af M.L. Berman et al., Advanced Bacterial Genetics, Cold Spring Harbor (1982), 49 - 51, og pUCl2 blev kon-15 strueret som beskrevet for pUCl3 (Vieira et al., ibid.).encodes Glu-Ala-Glu-Ala at the junction between the MFal leader and the proinsulin B-C-A gene. These two pieces, which cover the B'A gene, were ligated to the pUCl3 vector digested with EcoRI-Xbal (cf. Fig. 2) to generate pMT473. The modified gene 5 contained in a 0.5 kb EcoRI - XbaI fragment was isolated from pMT473 and then ligated to two fragments (4.3 kb XbaI-EcoRV and 3.3 kb EcoRV - EcoRI) from pMT342. pMT342 is the yeast vector pMT212 with the inserted sequence TPIp-MFal leader-B-C-A-TPIT. The resulting plasmid, pMT475, contains the inserted sequence: 10 TPIp-MFal leader- (minus Glu-Ala-Glu-Ala) - ΒΆ-ΤΡΙΤ. The construction of plasmids pMT342, 473 and 475 is described in FIG. 2. The construction of the vector pMT212 is shown in FIG. 3. The plasmid pMLB1034 is described by M.L. Berman et al., Advanced Bacterial Genetics, Cold Spring Harbor (1982), 49-51, and pUCl2 were constructed as described for pUCl3 (Vieira et al., Ibid.).
Eksempel 4Example 4
Indføring af B(l-29)-A(l-21) (B'A)-genet i et stabilt gærplasmid 20 pMT479Introduction of the B (1-29) -A (1-21) (B'A) gene into a stable yeast plasmid 20 pMT479
Det modificerede ΒΆ-gen fra pMT475 blev isoleret som et 2,1 kb BamHI-partielt Sphl-fragment og ligeret til et ca. 11 kb BamHI - Sphl-fragment af plasmid CPOT (ATCC No. 39685) til dannelse af plasmid pMT479 (fig. 4). Plasmid CPOT er baseret på 25 vektoren Cl/1, der er blevet modificeret ved at erstatte det originale pBR322 Bgll - BamHI-fragment med det lignende Bgll -BamHI-fragment fra pUC13 og efterfølgende indføring af S.pombe-TPI-genet (EP patentansøgning nr. 85303702.6) som et BamHI -Sall-fragment til dannelse af CPOT. Cl/1 er afledt fra pJDB248, 30 Beggs et al., Nature 275, 104 - 109 (1978) som beskrevet i EP patentansøgning 0103409A.The modified ΒΆ gene from pMT475 was isolated as a 2.1 kb Bam HI partial SphI fragment and ligated to a ca. 11 kb BamHI - Sphl fragment of plasmid CPOT (ATCC No. 39685) to generate plasmid pMT479 (Fig. 4). Plasmid CPOT is based on the vector C1 / 1 that has been modified by replacing the original pBR322 Bgll - BamHI fragment with the similar Bgll -BamHI fragment from pUC13 and subsequent introduction of the S.pombe TPI gene (EP patent application No. 85303702.6) as a BamHI -Sall fragment to form CPOT. Cl / 1 is derived from pJDB248, 30 Beggs et al., Nature 275, 104 - 109 (1978) as described in EP Patent Application 0103409A.
Eksempel 5 35 Transformering S. cerevisiae stamme MT118 (a, leu 2, ura 3, trp 1) blev dyrket på YPD-medium (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) til ODgoo 2,1. 100 ml kulturvæske blev høstet ved centrifugering, vasket med 10Example 5 Transformation S. cerevisiae strain MT118 (a, leu 2, ura 3, trp 1) was grown on YPD medium (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) to ODgoo 2.1 . 100 ml of culture fluid was harvested by centrifugation, washed with 10
DK 157938BDK 157938B
ml vand, recentrifugeret og resuspenderet i 10 ml 1,2 M sorbitol, 25 mM Na2EDTA pH= 8,0, 6,7 mg/ml dithiotreitol. Suspensionen blev inkuberet ved 30°C i 15 minutter og centrifugeret, og cellerne blev resuspenderet i 10 ml 1,2 M sorbitol, 10 mM 5 Na2EDTA, 0,1 M natriumcitrat pH = 5,8 og 2 mg Novozym®234.water, recentrifuged and resuspended in 10 ml 1.2 M sorbitol, 25 mM Na 2 EDTA pH = 8.0, 6.7 mg / ml dithiotreitol. The suspension was incubated at 30 ° C for 15 minutes and centrifuged, and the cells were resuspended in 10 ml 1.2 M sorbitol, 10 mM 5 Na 2 EDTA, 0.1 M sodium citrate pH = 5.8 and 2 mg Novozym®234.
Suspensionen blev inkuberet ved 30°C i 30 minutter, cellerne blev opsamlet ved centrifugering, vasket i 10 ml 1,2 M sorbitol og i 10 ml CAS (1,2 M sorbitol, 10 mM CaCl2* 10 mM Tris (Tris =The suspension was incubated at 30 ° C for 30 minutes, the cells were collected by centrifugation, washed in 10 ml 1.2 M sorbitol and in 10 ml CAS (1.2 M sorbitol, 10 mM CaCl 2 * 10 mM Tris (Tris =
Tris(hydroxymethyl)-aminometan) pH = 7,5) og resuspenderet i 2 ml 10 CAS. Til transformering blev 0,1 ml af de CAS-resuspenderede celler blandet med ca. 1 μg plasmid pMT344 og henstillet ved stuetemperatur i 15 minutter. Derpå blev der tilsat 1 ml 20% polyethylenglycol 4000, 10 mM CaCl2, 10 mM Tris pH = 7,5, og blandingen blev henstillet i yderligere 30 minutter ved stuetem-15 peratur. Blandingen blev centrifugeret og pillerne resuspenderet i 0,1 ml SOS (1,2 M sorbitol, 33% v/v YPD, 6,7 mM CaCl2, 14 μg/ml leucin) og inkuberet ved 30°C i to timer. Suspensionen blev derpå centrifugeret, og bundfaldet blev resuspenderet i 0,5 ml 1,2 M sorbitol. Der blev tilsat 6 ml topagar ved 52°C (SC-mediet ifølge 20 Sherman et al., (Methods in Yeast Genetics, Cold Spring Harbor Laboratory 1981) med leucin udeladt og indeholdende 1,2 M sorbitol plus 2,5% agar) ved 52°C, og suspensionen blev udhældt på plader indeholdende det .samme agarstørknede, sorbitolholdige medium. Transformantkolonier blev taget op efter 3 dage ved 30°C, 25 reisoleret og anvendt til at starte flydende kulturer. En sådan transformant MT350 (=MT 118/pMT344) blev valgt til yderligere karakterisering.Tris (hydroxymethyl) aminomethane) pH = 7.5) and resuspended in 2 ml of 10 CAS. For transformation, 0.1 ml of the CAS resuspended cells were mixed with ca. 1 μg of plasmid pMT344 and left at room temperature for 15 minutes. Then 1 ml of 20% polyethylene glycol 4000, 10 mM CaCl 2, 10 mM Tris pH = 7.5 was added and the mixture was allowed to stand for an additional 30 minutes at room temperature. The mixture was centrifuged and the pills resuspended in 0.1 ml of SOS (1.2 M sorbitol, 33% v / v YPD, 6.7 mM CaCl 2, 14 μg / ml leucine) and incubated at 30 ° C for two hours. The suspension was then centrifuged and the precipitate resuspended in 0.5 ml of 1.2 M sorbitol. 6 ml of top agar was added at 52 ° C (SC medium of 20 Sherman et al., (Methods in Yeast Genetics, Cold Spring Harbor Laboratory 1981) omitted with leucine and containing 1.2 M sorbitol plus 2.5% agar) at 52 ° C and the suspension was poured onto plates containing the same agar-dried sorbitol-containing medium. Transformant colonies were taken up after 3 days at 30 ° C, 25 isolated and used to start liquid cultures. Such a transformant MT350 (= MT 118 / pMT344) was selected for further characterization.
Plasmid pMT 475 blev transformeret i S. cerevisiae stamme MT362 (a,leu2) ved den samme procedure som ovenfor, og 30 transformanten MT371 (=MT362/pMT475) blev isoleret.Plasmid pMT 475 was transformed into S. cerevisiae strain MT362 (a, leu2) by the same procedure as above, and the transformant MT371 (= MT362 / pMT475) was isolated.
Transformering af pMT479 i stamme E2-7B X E11-3C (a/α, ^tpi/^tpi, PeP 4-3/pep 4-3 (denne stamme vil blive refereret til som MT501) blev udført på samme måde med den modifikation, at stammen MT501 før transformering blev dyrket på YPGaL 35 (1% Bacto gærekstrakt, 2% Bacto pepton, 2% galactose og 1% lactat) til ODgQQ på 0,6, og at SOS-opløsningen indeholdt YPGaL i stedet for YPD. En transformant MT519 (=MT501/pMT479) blev valgt til yderligere karakterisering.Transformation of pMT479 into strain E2-7B X E11-3C (α / α, β tpi / β tpi, PeP 4-3 / pep 4-3 (this strain will be referred to as MT501) was performed in the same manner with the modification that the MT501 strain was grown on YPGaL 35 (1% Bacto yeast extract, 2% Bacto peptone, 2% galactose and 1% lactate) to ODgQQ of 0.6 prior to transformation and that the SOS solution contained YPGaL instead of YPD. transformant MT519 (= MT501 / pMT479) was selected for further characterization.
2121
DK 157938 BDK 157938 B
De transformerede mikroorganismer MT 350, MT 371 og MT 519 er blevet deponeret ved Deutsche Sammlung von Mikororganismen (DSM), Griesebachstrasse 8, D-3400 Gottingen, den 15. maj 1984 og fik tildelt deponeringsnumrene henholdsvis DSM 2957, DSM 2958 5 og DSM 2959.The transformed microorganisms MT 350, MT 371 and MT 519 were deposited at Deutsche Sammlung von Mikororganismen (DSM), Griesebachstrasse 8, D-3400 Gottingen, on May 15, 1984 and were assigned the deposit numbers DSM 2957, DSM 2958 5 and DSM 2959 respectively. .
Eksempel 6Example 6
Udtrykkelse af B(1-29)-A(1-21) insulin i gær 10 Stammerne MT350 (DSM 2957) og MT371 (DSM 2958) blev dyrket på et syntetisk komplet medium SC (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory 1981) med leucin udeladt. Hver stamme blev dyrket i 2 énliters kulturer i toliters rystekolber ved 30°C, indtil de nåede en ΟΟ600ηπι på 7-10. De blev 15 derpå centrifugeret, og supernatanten blev fjernet til yderligere analyse.Expression of B (1-29) -A (1-21) Insulin in Yeast 10 Strains MT350 (DSM 2957) and MT371 (DSM 2958) were grown on a synthetic complete medium SC (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory 1981) with leucine omitted. Each strain was cultured in 2 one-liter cultures in titer shaker flasks at 30 ° C until reaching a -10600ηπι of 7-10. They were then centrifuged and the supernatant removed for further analysis.
Stamme MT519 (DSM 2959) blev dyrket på lignende måde, men på et YPD-medium (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) til en på 15. Der 20 blev derpå centrifugeret, og supernatanten blev fraskilt til yderligere analyse som ovenfor.Strain MT519 (DSM 2959) was grown in a similar manner, but on a YPD medium (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) to one of 15. Then, 20 were centrifuged and the supernatant separated for further analysis as above.
Eksempel 7Example 7
25 Udtrykkelse af B(l-29)-A(l-21) insulin i gærstamme MT350 (DSMExpression of B (l-29) -A (l-21) insulin in yeast strain MT350 (DSM
2957) Gærstamme MT350 (DSM 2957) blev dyrket som beskrevet i eksempel 6, og udtrykkelsesprodukterne fra 1100 ml af supernatanten fra denne stamme blev isoleret som følger: 30 10 g LiChroprep® RP-18 (Merck, art. 9303) blev vasket 3 gange med 50 mM NH^HCO^, 60% EtOH og blev derpå pakket i en 6 x 1 cm kolonne. Kolonnen blev ækvilibreret med 50 ml 50 mM NH^HCO^.2957) Yeast strain MT350 (DSM 2957) was grown as described in Example 6 and the expression products from 1100 ml of the supernatant from this strain were isolated as follows: 30 g of LiChroprep® RP-18 (Merck, art. 9303) was washed 3 times. with 50 mM NH 2 HCO 3, 60% EtOH and then packed in a 6 x 1 cm column. The column was equilibrated with 50 ml of 50 mM NH 2 HCO 3.
Der blev tilsat 55 ml 96% EtOH til 1100 ml af gærsupernatanten, og blandingen blev påført kolonnen i løbet af natten (flow: 70 35 ml/time).55 ml of 96% EtOH was added to 1100 ml of the yeast supernatant and the mixture was applied to the column overnight (flow: 70 35 ml / h).
Kolonnen blev vasket med 10 ml 0,5 M NaCl og 10 ml H2O/ og peptiderne blev elueret med 50 mM Ntf^HCOg, 60% EtOH. Eluatet (5 ml) blev koncentreret ved vakuumcentrifugering til 1,4 ml (til fjernelse af ethanol), og rumfanget blev indstillet til 10 ml medThe column was washed with 10 ml of 0.5 M NaCl and 10 ml of H 2 O / and the peptides were eluted with 50 mM Ntf 2 HCO The eluate (5 ml) was concentrated by vacuum centrifugation to 1.4 ml (to remove ethanol) and the volume was adjusted to 10 ml with
22 DK 157938B22 DK 157938B
25 mM HEPES puffer pH = 7,4. Blandingen blev påført en antiinsu-lin-immunoabsorptionskolonne (AIS-kolonne) (2,5 x 4,5 cm), der var blevet vasket 4 gange med 5 ml NaFAM-puffer (Heding, L., Diabetologia 8, 260 - 66, 1972) og to gange med 5 ml 25 mM 5 HEPES-puffer før påføringen. Efter påføringen fik kolonnen lov til at henstå i 30 minutter ved stuetemperatur og blev derpå vasket 10 gange med 4 ml 25 mM HEPES-puffer. Peptiderne blev elueret med 20% HAc. pH-værdien af eluatet blev indstillet til 7,0 med NH^OH, og blandingen blev koncentreret til 500 μΐ ved 10 vakuumrotation.25 mM HEPES buffer pH = 7.4. The mixture was applied to an anti-insulin immunoabsorption column (AIS column) (2.5 x 4.5 cm) which had been washed 4 times with 5 ml of NaFAM buffer (Heding, L., Diabetologia 8, 260-66, 1972) and twice with 5 ml of 25 mM 5 HEPES buffer prior to application. After application, the column was allowed to stand for 30 minutes at room temperature and then washed 10 times with 4 ml of 25 mM HEPES buffer. The peptides were eluted with 20% HAc. The pH of the eluate was adjusted to 7.0 with NH 4 OH and the mixture was concentrated to 500 μΐ by 10 vacuum rotation.
Prøven fra det forrige trin blev yderligere oprenset på HPLC på en 10 μ Waters μBondopak C-18 kolonne (3,9 x 300 mm). A-og B-pufferne var henholdsvis 0,1% TFA i H20 og 0,07% TFA i MeCN. Kolonnen blev ækvilibreret med 25% B (flow: 1,5 ml/minut), og 15 peptiderne blev elueret med en lineær gradient af MeCN (1%/minut) og påvist ved 276 nm. Udbyttet i hvert trin af oprensningen blev bestemt ved radioimmunoassay som tidligere beskrevet, og tabel 2 gengiver oprensningen. Det samlede udbytte var 68%.The sample from the previous step was further purified by HPLC on a 10 μ Waters μBondopak C-18 column (3.9 x 300 mm). The A and B buffers were 0.1% TFA in H2 O and 0.07% TFA in MeCN, respectively. The column was equilibrated with 25% B (flow: 1.5 ml / min) and the 15 peptides were eluted with a linear gradient of MeCN (1% / min) and detected at 276 nm. The yield at each stage of the purification was determined by radioimmunoassay as previously described and Table 2 depicts the purification. The overall yield was 68%.
tt
DK 157938 BDK 157938 B
2323
Tabel 2Table 2
Oprensning af udtrykkelsesprodukterne fra gærstamme MT350-super-5 natantPurification of the expression products of yeast strain MT350 supernatant
Oprensningstrin Rumfang (ml) Immunoreaktivt B(l-29)-A(l-21)-______insulin (nmol)_ 10 Supernatant 1100 110* RP-8 10 116Purification step Volume (ml) Immunoreactive B (1-29) -A (1-21) -____ insulin (nmol) 10 Supernatant 1100 110 * RP-8 10 116
Anti-insulin sepharose 0,5 116 HPLC_2jJj_75_ 15 * Fortyndningseffekt blev iagttaget i denne prøveAnti-insulin Sepharose 0.5 116 HPLC_2jJj_75_ 15 * Dilution effect was observed in this sample
Kun én top indeholdende immunoreaktivt B(1-29)-A(1-21) insulinmateriale blev påvist fra HPLC-kolonnen. Peptidmaterialet 20 fra denne top blev isoleret og underkastet aminosyresekvensana-lyse. Sekvensanalysen blev udført med en Gasfasesekvanator (Applied Biosystem Model 470A) som beskrevet af Hewick, R.M. et al. (J.Biol.Chem. 256, 7990-7997, 1981). Fra sekventeringsresul-taterne kunne det konkluderes, at udtrykkelsesprodukterne bestod 25 af 3 peptider: (Glu-Ala)2-B(l-29)-A(l-21) insulin 89%Only one peak containing immunoreactive B (1-29) -A (1-21) insulin material was detected from the HPLC column. Peptide material 20 from this peak was isolated and subjected to amino acid sequence analysis. The sequence analysis was performed with a Gas Phase Equator (Applied Biosystem Model 470A) as described by Hewick, R.M. et al. (J. Biol. Chem. 256, 7990-7997, 1981). From the sequencing results, it was concluded that the expression products consisted of 25 peptides: (Glu-Ala) 2-B (l-29) -A (l-21) insulin 89%
Glu-Ala-B(1-29)—A(1-21) insulin 2% B(1-29)-A(1-21) insulin 9% 30Glu-Ala-B (1-29) -A (1-21) insulin 2% B (1-29) -A (1-21) insulin 9%
Peptiderne fandtes i de angivne forholdsvise mængder.The peptides were found in the proportions indicated.
Eksempel 8Example 8
35 Udtrykkelse af B(1-29)-A(1-21) insulin i gærstamme MT371 (DSMExpression of B (1-29) -A (1-21) insulin in yeast strain MT371 (DSM
2958) Gærstamme MT371 (DSM 2958) blev dyrket som beskrevet ovenfor i eksempel 6, og udtrykkelsesprodukterne fra 665 ml supernatant fra denne stamme blev isoleret som beskrevet i eksem- £.*± - - - - - — pel 7. Det samlede udbytte var 50 nmol svarende til 39%. Peptidmaterialet blev isoleret fra HPLC-kolonnen og sekvensbestemt som beskrevet i eksempel 7. Fra sekvensresulaterne (18 aminosyre-rester fra N-terminalen) kunne det konkluderes, at peptidet var 5 homogent B(l-29)-A(l-21) insulin.2958) Yeast strain MT371 (DSM 2958) was grown as described above in Example 6 and the expression products of 665 ml of supernatant from this strain were isolated as described in Example 7. ± ± - - - - - - pel 7. The total yield was 50 nmol, corresponding to 39%. The peptide material was isolated from the HPLC column and sequenced as described in Example 7. From the sequence results (18 amino acid residues from the N-terminus) it was concluded that the peptide was homogeneous B (1-29) -A (1-21) insulin. .
Sammenligning af disse resultater med resultaterne i eksempel 7 antyder hensigtsmæssigheden i fjernelse af Glu-Ala-Glu-Ala-sekvensen fra C-terminalen af MFal-leaderen. Det fremgår af eksempel 7, at gærdipeptidaseenzymet ikke fungerer særlig 10 effektivt ved fraspaltning af Glu-Ala og Glu-Ala-Glu-Ala fra B(1-29)-A(1-21)-insulinet før udskillelse af insulinprecursoren fra gærcellerne.Comparing these results with the results of Example 7 suggests the appropriateness of removing the Glu-Ala-Glu-Ala sequence from the C-terminus of the MFal leader. It can be seen from Example 7 that the yeast dipeptidase enzyme does not function very efficiently by cleaving Glu-Ala and Glu-Ala-Glu-Ala from the B (1-29) -A (1-21) insulin before secretion of the insulin precursor from the yeast cells.
15 Eksempel 9Example 9
Udtrykkelse af B(1-29)-A(1-21) insulin i gærstamme MT519 (DSMExpression of B (1-29) -A (1-21) insulin in yeast strain MT519 (DSM
2959) Gærstamme MT519 (DSM 2959) blev dyrket som beskrevet ovenfor i eksempel 6, og udtrykkelsesprodukter fra 70 ml af 20 supernatanten blev isoleret som beskrevet i eksempel 7. Det samlede udbytte var 116 nmol, svarende til 57%. Peptidet blev sekvensbestemt som beskrevet i eksempel 7. Peptidet blev vurderet til at være homogent B(1-29)-A(1-21) insulin ud fra de 42 amino-syrerester identificeret fra den N-terminale ende. Omtrent 5 nmol 25 af peptidet blev hydrolyseret i 100 μΐ 6N HC1 i 24 timer ved 110°C. Hydrolysatet blev analyseret på en Beckman Model 121M aminosyreanalysator. Følgende aminosyresammensætning blev fundet:2959) Yeast strain MT519 (DSM 2959) was grown as described above in Example 6 and expression products from 70 ml of the 20 supernatant were isolated as described in Example 7. The overall yield was 116 nmol, corresponding to 57%. The peptide was sequenced as described in Example 7. The peptide was assessed to be homogeneous B (1-29) -A (1-21) insulin from the 42 amino acid residues identified from the N-terminal end. Approximately 5 nmol 25 of the peptide was hydrolyzed in 100 μΐ 6N HCl for 24 hours at 110 ° C. The hydrolyzate was analyzed on a Beckman Model 121M amino acid analyzer. The following amino acid composition was found:
. DK 157938B. DK 157938B
2525
Tabel 3Table 3
Aminosyreanalyse af oprenset B(1-29)-A(1-21) insulin 5 Aminosyre Fundet Teoretisk itAminosyre Fundet TeoretiskAmino Acid Analysis of Purified B (1-29) -A (1-21) Insulin 5 Amino Acid Found Theoretically itAmino Acid Found Theoretically
Asx* 2,97 3 Val 3,37 4Asx * 2.97 3 Val 3.37 4
Thr 1,77 2 Ile 1,65 2Thr 1.77 2 Ile 1.65 2
Ser 2,45 3 Leu* 5,65 6 10 Glx* 6,68 7 Tyr 3,51 4Ser 2.45 3 Leu * 5.65 6 10 Glx * 6.68 7 Tyr 3.51 4
Pro 1,33 1 Phe* 2,73 3Pro 1.33 1 Phe * 2.73 3
Gly* 3,95 4 Lys* 0,95 1Gly * 3.95 4 Lys * 0.95 1
Ala* 1,22 1 His* 1,84 2Ala * 1.22 1 His * 1.84 2
Cys 0,5 4,54 6 Arg* 1,13 1 15 * Aminosyre anvendt til normalisering Eksempel 10 20 Konstruktion af et gærplasmid pMT610 til udtrykkelse af B(1-29)-Ala-Ala-Lys-A(1-21)Cys 0.5 4.54 6 Arg * 1.13 1 15 * Amino acid used for normalization Example 10 20 Construction of a yeast plasmid pMT610 to express B (1-29) -Ala-Ala-Lys-A (1-21)
Et 4,3 kb EcoRV-Xbal og et 3,3 kb EcoRI-EcoRV fragment fra pMT342 (se eksempel 3) blev ligeret til et 0,6 kb EcoRI-Xbal fragment af pM215 (se eksempel 3). Det fremkomne plasmid pMT462 25 indeholder indsatsen MFal-leaderen-(minus Glu-Ala-Glu-Ala)-B-C-A. Til konvertering af fragmentet, der koder for B-C-A, til et fragment, der koder for B(1-29)-Ala-Ala-Lys-A(1-21), anvendtes den modificerede site specific mutagenesis fremgangsmåde (K. Norris et al., ibid.). Et 0,6 kb EcoRI-Xbal-fragment fra pMT462, der 30 koder for MFal-leaderen-(minus Glu-Ala-Glu-Ala)-B-C-A, blev indsat i M13 mplO RF fag skåret med Xbal-EcoRI. Enkeltstrenget M13 fag indeholdende det ovenfor nævnte EcoRI-Xbal fragment blev inkuberet med en 30-mer d(TTCACAATGCCCTTAGCGGCCTTGGGTGTG) primer (KFN15) og den "universelle" 15-mer M13 primer d(TCCCAGTCACGACGT) 35 (se eksempel 1), opvarmet til 90°C i 5 minutter og langsomt nedkølet til stuetemperatur for at tillade annealing. Derpå fremstilledes delvist dobbeltstrenget DNA ved tilsætning af en d-NTP-blanding, Klenow Polymerase og T4 ligase. Efter fenolekstraktion, ethano ludfældning og resuspension blev DNA skåret med 40 restriktionsenzymer Apal, Xbal og EcoRl. Efter en yderligere fenolekstraktion, ethanoludfældning og resuspension blev DNA ligeret til EcoRI-Xbal skåret pUC13. Ligeringsblandingen blev transformeret i en E. coli (r m+)-stamme, og plasmider blev fremstillet fra en del af transformanterne. Plasmidpræparaterne blevA 4.3 kb EcoRV-Xbal and a 3.3 kb EcoRI-EcoRV fragment from pMT342 (see Example 3) were ligated to a 0.6 kb EcoRI-Xbal fragment of pM215 (see Example 3). The resulting plasmid pMT462 contains the insert MFal leader (minus Glu-Ala-Glu-Ala) -B-C-A. To convert the fragment encoding BCA into a fragment encoding B (1-29) -Ala-Ala-Lys-A (1-21), the modified site specific mutagenesis method was used (K. Norris et al ., ibid.). A 0.6 kb EcoRI-Xbal fragment from pMT462 encoding the MFα1 leader (minus Glu-Ala-Glu-Ala) -B-C-A was inserted into the M13 mp10 RF phage cut with Xbal-EcoRI. Single stranded M13 phage containing the aforementioned EcoRI-XbaI fragment was incubated with a 30-mer d (TTCACAATGCCCTTAGCGGCCTTGGGTGTG) primer (KFN15) and the "universal" 15-mer M13 primer d (TCCCAGTCACGACGT) 35 (see Example 1), ° C for 5 minutes and slowly cooled to room temperature to allow annealing. Then, partially double-stranded DNA was prepared by adding a d-NTP mixture, Klenow Polymerase and T4 ligase. After phenol extraction, ethanol precipitation and resuspension, DNA was cut with 40 restriction enzymes Apal, Xbal and EcoRl. After a further phenol extraction, ethanol precipitation, and resuspension, DNA was ligated to EcoRI-Xbal cut pUC13. The ligation mixture was transformed into an E. coli (r m +) strain and plasmids were prepared from part of the transformants. The plasmid preparations were
DK 187938BDK 187938B
skåret med EcoRl og Xbal, og de præparater, der viste bånd ved både 0,5 og 0,6 kb, blev retransformeret i E. coli. Fra retrans-formeringen blev der udvalgt en transformant indeholdende kun pUC13 med en 0,5 kb indsats. Sekvensen af EcoRl-Xbal indsatsen i 5 dette plasmid pMT598 blev derpå bekræftet ved Maxam-Gilbert metoden til at kode for MFal-leaderen-(minus Glu-Ala-Glu-Ala)-B(l-29)-Ala-Ala-Lys-A(l-21). Xbal-EcoRI indsatsen fra pMT598 blev forsynet med TPI-promotoren og TPI-terminator ved ligering af et 0,5 kb Xbal-EcoRI fragment fra pMT598 med et 5,5 kb Xbal-EcoRI 10 fragment fra pT5. Konstruktionen af pT5 indeholdende indsatsen TPIp-MFal-leader-B-C-A-TPIT er vist i fig. 8. Det fremkomne plasmid pMT601 indeholdende indsatsen TPIp-MFal-leader-(minus Glu-Ala-Glu-Ala)-B(1-29)-Ala-Ala-Lys-A(1-21)-TPIT blev skåret med BamHl og delvist med Sphl, og 2,1 kb fragmentet blev indsat i 15 CPOT skåret med BamHl og Sphl. Det fremkomne plasmid pMT610 blev anvendt til transformering af gær.cut with EcoRl and XbaI, and the compositions showing bands at both 0.5 and 0.6 kb were retransformed into E. coli. From the retrans propagation, a transformant containing only pUC13 with a 0.5 kb insert was selected. The sequence of EcoR1-Xbal insert in this plasmid pMT598 was then confirmed by the Maxam-Gilbert method of encoding the MFα1 leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ala-Ala-Lys -A (l-21). The Xbal-EcoRI insert from pMT598 was provided with the TPI promoter and TPI terminator by ligating a 0.5 kb Xbal-EcoRI fragment from pMT598 with a 5.5 kb Xbal-EcoRI 10 fragment from pT5. The construction of pT5 containing the insert TPIp-MFal-leader-B-C-A-TPIT is shown in FIG. 8. The resulting plasmid pMT601 containing the insert TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ala-Ala-Lys-A (1-21) -TPIT was cut with BamH1 and partially with SphI, and the 2.1 kb fragment was inserted into the 15 CPOT cut with Bam HI and SphI. The resulting plasmid pMT610 was used to transform yeast.
Eksempel 11 20 Konstruktion af et gærplasmid pMT639 til udtrykkelse af B(l-29)-Ser-Lys-A(l-21)Example 11 Construction of a Yeast Plasmid pMT639 to Express B (1-29) -Ser-Lys-A (1-21)
Fragmentet fra pMT462 (se eksempel 10), der koder for BCA, blev konverteret til B(1-29)-Ser-Lys-A(1-21) ved en fremgangsmåde svarende til den i eksempel 10 beskrevne ved site 25 specific mutagenesis med en blanding af en 27-mer d(TCCACAATGCCCTTAGACTTGGGTGTG) primer KFN36 og den "universelle" 15-mer M13 primer. Efter udfyldning med Klenow polymerase og ligering med T4 ligase blev det delvist dobbeltstrengede DNA fordøjet med Apal, EcoRl og Xbal og ligeret til 5,5 kb Xbal-EcoRI 30 fragmentet fra plasmid pT5 (se eksempel 10). Efter transformering og retransformering i E. coli blev et plasmid pMT630 indeholdende indsatsen MFal-leader-(minus Glu-Ala-Glu-Ala)-B(l-29)-Ser-Lys-A(1-21) isoleret, og sekvensen af indsatsen blev bekræftet. Den videre fremgangsmåde til opnåelse af plasmid pMT639 indeholdende 35 indsatsen TPIp-MFal-(minus Glu-Ala-Glu-Ala)- B(l-29)-Ser-Lys-A(1-21)-TPIT var som beskrevet i eksempel 10. Konstruktionen af pMT639 er vist i fig. 9.The fragment from pMT462 (see Example 10) encoding BCA was converted to B (1-29) -Ser-Lys-A (1-21) by a method similar to that described in Example 10 at site 25 specific mutagenesis with a mixture of a 27-mer d (TCCACAATGCCCTTAGACTTGGGTGTG) primer KFN36 and the "universal" 15-mer M13 primer. After filling with Klenow polymerase and ligation with T4 ligase, the partially double-stranded DNA was digested with Apal, EcoRl and Xbal and ligated to the 5.5 kb Xbal-EcoRI 30 fragment from plasmid pT5 (see Example 10). After transformation and retransformation in E. coli, a plasmid pMT630 containing the insert MFal leader- (minus Glu-Ala-Glu-Ala) -B (l-29) -Ser-Lys-A (1-21) was isolated and the sequence of the effort was confirmed. The further method of obtaining plasmid pMT639 containing the insert TPIp-MFal- (minus Glu-Ala-Glu-Ala) - B (1-29) -Ser-Lys-A (1-21) -TPIT was as described in Example 10. The construction of pMT639 is shown in FIG. 9th
2727
DK 15 7 9 3 8 BDK 15 7 9 3 8 B
Eksempel 12Example 12
Udtrykkelse af B (1-29)-Ala-Ala-Lys-A(1-21) i gærstamme MT620 S. cerevisiae stamme MT501 (se eksempel 5) blev transformeret med pMT610 som beskrevet for pMT479 i eksempel 5. Trans-5 formantkolonier blev opsamlet efter 3 dage ved 30°C, genisoleret og anvendt til start af flydende kulturer. En af disse transfor-manter MT620 = (MT501/pMT610) blev udvalgt til yderligere karakterisering. MT620 blev deponeret af ansøgeren hos Deutsche Sammlung von Mikroorganismen (DSM), den 16. januar 1985 og fik 10 referencenummeret DSM3196.Expression of B (1-29) -Ala-Ala-Lys-A (1-21) in yeast strain MT620 S. cerevisiae strain MT501 (see Example 5) was transformed with pMT610 as described for pMT479 in Example 5. Transform 5 colonies were collected after 3 days at 30 ° C, reinsulated and used for starting liquid cultures. One of these transformants MT620 = (MT501 / pMT610) was selected for further characterization. MT620 was deposited by the applicant with the Deutsche Sammlung von Microorganism (DSM), on January 16, 1985 and was given 10 reference number DSM3196.
MT620 blev dyrket på YPD medium. En toliters kultur i to liters rystekolber blev rystet ved 30°C til ODgøonm 15.MT620 was grown on YPD medium. A two-titer culture in two liter flasks was shaken at 30 ° C to ODgøonm 15.
Efter centrifugering blev supernatanten fjernet til yderligere analyse. Udtrykkelsesniveauet bestemt ved radioimmunoassay var 15 1,2 μπιοΐ/ΐ. Udtrykkelsesprodukterne fra 840 ml af supernatanten blev renset som beskrevet i eksempel 7. (RP-18 kolonne, Anti-insulin Sepharose og HPLC). Det samlede udbytte var 100 nmol svarende til ca. 10%. Peptidmaterialet blev isoleret fra HPLC-kolonnen og sekventeret som beskrevet i eksempel 7. 35 Edman-20 nedbrydningscyklus'er blev udført (tabel 4). Fra sekventerings-resultatene blev positionen af kæden med tre aminosyrerester (Ala-Ala-Lys), der adskiller B(l-29)- og A(1-21)-kæderne, bekræftet (se tabel 4).After centrifugation, the supernatant was removed for further analysis. The expression level determined by radioimmunoassay was 15 1.2 μπιοΐ / ΐ. The expression products from 840 ml of the supernatant were purified as described in Example 7. (RP-18 column, Anti-insulin Sepharose and HPLC). The total yield was 100 nmol, corresponding to approx. 10%. The peptide material was isolated from the HPLC column and sequenced as described in Example 7. 35 Edman-20 degradation cycles were performed (Table 4). From the sequencing results, the position of the chain with three amino acid residues (Ala-Ala-Lys) separating the B (l-29) and A (1-21) chains was confirmed (see Table 4).
55
DK 157938BDK 157938B
2828
Tabel 4Table 4
Sekvensanalyse af B(l-29)-Ala-Ala-Lys-A(1-21) isoleret fra kulturmediet af stamme MT620.Sequence analysis of B (1-29) -Ala-Ala-Lys-A (1-21) isolated from the culture medium of strain MT620.
Cyclus nr. PTH-aminosyrerest Udbytte, (pmol) 1 Phe 3351 2 Val 1738 10 3 Asn 5169 4 . Gin 2750 _5_His_2045_ 6 Leu 1405 7 Cys 15 8 Gly 1372 9 Ser 345 10 His 1105 Π Leu 2225 12 Val 1963 20 13 Glu 1219 14 Ala 1514 15 Leu 1793 T§ Tyr Γ757 17 Leu 1354 25 18 Val 1765 19 Cys 20 Gly 882 -Π-gE-Γ0Ϊ3 22 Arg 1100 30 23 Gly 1123 24 Phe 1492 25 Phe 2042 26 Tyr 1014 27 Thr 195 35 28 Pro 710 29 BOQLys 1173 30 2yAla 1026 31 Ala 555 32 Lys 1175 40 33 A.Gly 552 34 Ile 518 35 _Val_548_Cycle No. PTH Amino Acid Residue Yield (pmol) 1 Phe 3351 2 Val 1738 10 3 Asn 5169 4. Gin 2750 _5_His_2045_ 6 Leu 1405 7 Cys 15 8 Gly 1372 9 Ser 345 10 His 1105 Π Leu 2225 12 Val 1963 20 13 Glu 1219 14 Ala 1514 15 Leu 1793 T§ Tyr Γ757 17 Leu 1354 25 18 Val 1765 19 Cys 20 Gly 882 -Π-gE-Γ0Ϊ3 22 Arg 1100 30 23 Gly 1123 24 Phe 1492 25 Phe 2042 26 Tyr 1014 27 Thr 195 35 28 Pro 710 29 BOQLys 1173 30 2yAla 1026 31 Ala 555 32 List 1175 40 33 A.Gly 552 34 Ile 518 35 _Val_548_
Middelrepetitivudbyttet var 95,6%.The mean repetition yield was 95.6%.
4545
Eksempel 13Example 13
Udtrykkelse af B(l-29)-Ser-Lys-A(l-21) i gærstamme MT643 S. cerevisiae stamme MT501 blev transformeret med 50 pMT639 som beskrevet for pMT479 i eksempel 5.Expression of B (l-29) -Ser-Lys-A (l-21) in yeast strain MT643 S. cerevisiae strain MT501 was transformed with 50 pMT639 as described for pMT479 in Example 5.
En transformant MT643 = (MT501/pMT639) blev udvalgt til yderligere karakterisering. MT643 blev deponeret af ansøgeren ved DSM den 16. januar 1985 og fik referencenr. DSM 3197.A transformant MT643 = (MT501 / pMT639) was selected for further characterization. MT643 was deposited by the applicant at DSM on January 16, 1985 and was given reference no. DSM 3197.
2929
DK 157938 BDK 157938 B
MT643 blev dyrket som beskrevet i eksempel 12. Efter centrifugering blev supernatanten fjernet til yderligere analyse.MT643 was grown as described in Example 12. After centrifugation, the supernatant was removed for further analysis.
Udtrykkelsesniveauet af insulinprecursoren bestemt ved radioimmunoassay var 1,6 μπιοΐ/ΐ. Udtrykkelsesprodukter fra super-5 natanten fra stamme MT643 blev isoleret som beskrevet i eksempel 7. Peptidmaterialet isoleret fra HPLC kolonnen blev underkastet sekvensanalyse som beskrevet i eksempel 7. Fra sekvensresultaterne (ikke vist) blev positionen af kæden med to aminosyrerester (Ser-Lys), der adskiller B(l-29)- og A(1-21)-kæderne, bekræftet.The expression level of the insulin precursor determined by radioimmunoassay was 1.6 μπιοΐ / ΐ. Expression products of the supernatant from strain MT643 were isolated as described in Example 7. The peptide material isolated from the HPLC column was subjected to sequence analysis as described in Example 7. From the sequence results (not shown), the position of the chain with two amino acid residues (Ser-Lys), separating the B (l-29) and A (1-21) chains, confirmed.
1010
Eksempel 14Example 14
Konvertering af B(1-29)-A(1-21) til ThrtBu^-OBu^CBSO) human insulinConversion of B (1-29) -A (1-21) to ThrtBu ^ -OBu ^ CBSO) human insulin
15 20 mg af B(l-29)-A(l-21) blev opløst i 0,1 ml 10 M15 mg of B (1-29) -A (1-221) was dissolved in 0.1 ml of 10 M
eddikesyre. Der tilsattes 0,26 ml af 1,54 M Thr(Bu*")-0But i N,N-dimethylacetamid. Blandingen blev afkølet til 12°C. 2,8 mg trypsin opløst i 0,035 ml 0,05 M calciumacetat blev tilsat. Efter 72 timer ved 12°C blev proteinerne udfældet ved tilsætning af 4 ml 20 acetone, isoleret ved centrifugering og tørret i vacuum. Konverteringen af B(1-29)-A(1-21) til Thr(Bu^)-OBu^(B30) human insulin var 64% ved HPLC.acetic acid. 0.26 ml of 1.54 M Thr (Bu *) - OBut in N, N-dimethylacetamide was added. The mixture was cooled to 12 ° C. 2.8 mg of trypsin dissolved in 0.035 ml of 0.05 M calcium acetate was added. After 72 hours at 12 ° C, the proteins were precipitated by the addition of 4 ml of 20 acetone, isolated by centrifugation and dried in vacuo. The conversion of B (1-29) -A (1-21) to Thr (Bu 2) - OBu (B30) human insulin was 64% by HPLC.
25 Eksempel 15Example 15
Konvertering af B(1-29)-A(1-21) til Thr-Ome(B30) human insulin 20 mg af B(1-29)-A(1-21) blev opløst i 0,1 ml af 10 M eddikesyre. Der tilsattes 0,26 ml af 1,54 M Thr-OMe i en blanding af dimethyl sulphoxid og butan-1,4-diol 1/1 (v/v). 1 mg lysyl-30 endopeptidase fra Achromobacter lyticus (Wako Pure ChemicalConversion of B (1-29) -A (1-21) to Thr-Ome (B30) human insulin 20 mg of B (1-29) -A (1-21) was dissolved in 0.1 ml of 10 M acetic acid. 0.26 ml of 1.54 M Thr-OMe was added in a mixture of dimethyl sulphoxide and butane-1,4-diol 1/1 (v / v). 1 mg lysyl endopeptidase from Achromobacter lyticus (Wako Pure Chemical
Industries, Osaka, Japan) i 0,07 ml vand blev tilsat. Efter 120 timer ved 25°C blev proteinerne udfældet ved tilsætning af 4 ml acetone, isoleret ved centrifugering og tørret i vacuum. Konverteringen af B(1-29)—A(1-21) til Thr-Ome(B30) human insulin var 35 75% ved HPLC.Industries, Osaka, Japan) in 0.07 ml of water was added. After 120 hours at 25 ° C, the proteins were precipitated by the addition of 4 ml of acetone, isolated by centrifugation and dried in vacuo. The conversion of B (1-29) -A (1-21) to Thr-Ome (B30) human insulin was 75% by HPLC.
DK 157938 BDK 157938 B
3030
Eksempel 16Example 16
Konvertering af B(1-29)-Ser-Lys-A(1-21) til Thr-OBut(B30) human insulin 20 mg af B(l-29)-Ser-Lys-A(l-21) blev opløst i 0,1 ml 5 af en blanding af 34,3% eddikesyre (v/v) og 42,2% N,N-dimethyl-formamid (v/v) i vand. Der tilsattes 0,2 ml 2 M Thr-0But som hydroacetatsalt i N,N,dimethylformamid. Blandingen blev thermo-statteret ved 12°C. Der tilsattes 2 mg trypsin i 0,05 ml 0,05 M calciumacetat. Efter 24 timer ved 12°C blev proteinerne udfældet 10 ved tilsætning af 4 ml acetone, isoleret ved centrifugering og tørret i vacuum. Konverteringen af B(1-29)-Ser-Lys-A(1-21) til Thr-OB^(B30) human insulin var 85% ved HPLC.Conversion of B (1-29) -Ser-Lys-A (1-21) to Thr-OBut (B30) human insulin 20 mg of B (1-29) -Ser-Lys-A (1-21) was dissolved in 0.1 ml of a mixture of 34.3% acetic acid (v / v) and 42.2% N, N-dimethylformamide (v / v) in water. 0.2 ml of 2 M Thr-OBut was added as hydroacetate salt in N, N, dimethylformamide. The mixture was thermostated at 12 ° C. 2 mg of trypsin was added in 0.05 ml of 0.05 M calcium acetate. After 24 hours at 12 ° C, the proteins were precipitated 10 by the addition of 4 ml of acetone, isolated by centrifugation and dried in vacuo. The conversion of B (1-29) -Ser-Lys-A (1-21) to Thr-OB ^ (B30) human insulin was 85% by HPLC.
15 Eksempel 17Example 17
Konvertering af B(1-29)-Ala-Ala-Lys-A(1-21) til Thr-OBut(B30) human insulin 20 mg B(1-29)-Ala-Ala-Lys-A(1-21) blev opløst i 0,1 ml af en blanding af 34,3% eddikesyre (v/v) og 42,2% N,N dimethyl-20 formamid (v/v) i vand. Der tilsattes 0,2 ml 2 M Thr-OBu1' som hydroacetatsalt i Ν,Ν-dimethylformamid. Blandingen blev thermo-statteret ved 12°C. Der tilsattes 2 mg trypsin i 0,05 ml 0,05 M calciumacetat. Efter 96 timer ved 12°C blev proteinerne udfældet ved tilsætning af 4 ml acetone, isoleret ved centrifugering og 25 tørret i vacuum. Konverteringen af B( 1-29 )-Ala-Ala-Lys-A( 1-21) til Τ]ιτ-ΟΒϋ^(Β30) human insulin var 84% ved HPLC.Conversion of B (1-29) -Ala-Ala-Lys-A (1-21) to Thr-OBut (B30) human insulin 20 mg B (1-29) -Ala-Ala-Lys-A (1-21) ) was dissolved in 0.1 ml of a mixture of 34.3% acetic acid (v / v) and 42.2% N, N dimethylformamide (v / v) in water. 0.2 ml of 2 M Thr-OBu1 'was added as hydroacetate salt in Ν, Ν-dimethylformamide. The mixture was thermostated at 12 ° C. 2 mg of trypsin was added in 0.05 ml of 0.05 M calcium acetate. After 96 hours at 12 ° C, the proteins were precipitated by the addition of 4 ml of acetone, isolated by centrifugation and 25 dried in vacuo. The conversion of B (1-29) -Ala-Ala-Lys-A (1-21) to Τ] ιτ-ΟΒϋ ^ (Β30) human insulin was 84% by HPLC.
Eksempel 18 30 Fremstilling af human insulin fra forskellige human insulinestereExample 18 Preparation of human insulin from various human insulin esters
Human insulinesterne i de rå acetoneudfældninger blev renset ved gelfiltration og anionbytterchromatografi som beskrevet i Methods in Diabetes Research vol. 1, p. 407-408 (Eds. J.The human insulin residues in the crude acetone precipitates were purified by gel filtration and anion exchange chromatography as described in Methods in Diabetes Research vol. 1, pp. 407-408 (Eds. J.
35 larner & S. Pohl (John Wiley Sons, New York, 1984)). Fremgangsmåden kunne anvendes i forbindelse med en hvilken som helst af de tre human insulin estere. Fraspaltningen af de forskellige estergrupper, som gav human insulinudbytter på næsten 100%, blev ud-35 larner & S. Pohl (John Wiley Sons, New York, 1984)). The method could be used in conjunction with any of the three human insulin esters. The cleavage of the various ester groups, which yielded human insulin yields of almost 100%, was obtained.
DK 157938 BDK 157938 B
ført ved hydrolyse af Thr-OMe(B30) human insulin og ved acidolyse t t med trifluoreddikesyre af Thr(Bu )-OBu (B30) human insulin og af Thr-OBu^(B30) human insulin som beskrevet ibid. p. 409.conducted by hydrolysis of Thr-OMe (B30) human insulin and by acidolysis t with trifluoroacetic acid of Thr (Bu) -OBu (B30) human insulin and of Thr-OBu ^ (B30) human insulin as described in p. 409.
55
Claims (8)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DK238585A DK157938C (en) | 1984-05-30 | 1985-05-29 | DNA SEQUENCE FOR INSULIN PRECURSORS, VECTORS CONTAINING THIS SEQUENCE, YEAR TRANSFORMED WITH THESE VECTORS, AND A PROCEDURE FOR PREPARING INSULIN PRECURSORS AND A PROCEDURE FOR PREPARING THEM. |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DK266584 | 1984-05-30 | ||
DK266584A DK266584D0 (en) | 1984-05-30 | 1984-05-30 | DNA SEQUENCE CODING A BIOSYNTHETIC INSULIN PRECURSOR AND PROCEDURE FOR MANUFACTURING THE INSULIN PRECURSOR |
DK58285 | 1985-02-08 | ||
DK58285A DK58285D0 (en) | 1984-05-30 | 1985-02-08 | PEPTIDES AND MANUFACTURING AND USING THEREOF |
DK238585 | 1985-05-29 | ||
DK238585A DK157938C (en) | 1984-05-30 | 1985-05-29 | DNA SEQUENCE FOR INSULIN PRECURSORS, VECTORS CONTAINING THIS SEQUENCE, YEAR TRANSFORMED WITH THESE VECTORS, AND A PROCEDURE FOR PREPARING INSULIN PRECURSORS AND A PROCEDURE FOR PREPARING THEM. |
Publications (4)
Publication Number | Publication Date |
---|---|
DK238585D0 DK238585D0 (en) | 1985-05-29 |
DK238585A DK238585A (en) | 1985-12-01 |
DK157938B true DK157938B (en) | 1990-03-05 |
DK157938C DK157938C (en) | 1990-08-27 |
Family
ID=27220795
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DK238585A DK157938C (en) | 1984-05-30 | 1985-05-29 | DNA SEQUENCE FOR INSULIN PRECURSORS, VECTORS CONTAINING THIS SEQUENCE, YEAR TRANSFORMED WITH THESE VECTORS, AND A PROCEDURE FOR PREPARING INSULIN PRECURSORS AND A PROCEDURE FOR PREPARING THEM. |
Country Status (1)
Country | Link |
---|---|
DK (1) | DK157938C (en) |
-
1985
- 1985-05-29 DK DK238585A patent/DK157938C/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
DK157938C (en) | 1990-08-27 |
DK238585D0 (en) | 1985-05-29 |
DK238585A (en) | 1985-12-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0427296B1 (en) | Insulin precursors | |
EP0195691B1 (en) | Process for the preparation of insulin precursors and process for the preparation of human insulin | |
JP2609367B2 (en) | Yeast processing system consisting of negatively charged amino acids adjacent to the processing site | |
US5102789A (en) | Production of epideramal growth factor in pichia pastoris yeast cells | |
ES2333942T3 (en) | INSULIN PRECURSORS AND PROCESS FOR PREPARATION. | |
US7105314B2 (en) | Method for making human insulin precursors | |
CA1294232C (en) | Process for preparing glucagon or derivatives or fragments thereof in yeast | |
DK157938B (en) | DNA sequence for insulin precursors, vectors containing this sequence, yeast strains which are transformed with the vectors, and also a process for preparing the insulin precursors and a process for preparing human insulin | |
IE950351L (en) | Insulin percursors | |
WO2004085472A1 (en) | Method for making human insulin precursors and human insulin | |
DK158270B (en) | Process for preparing human insulin precursors and human insulin, and also DNA sequences and plasmids for use in these processes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PBP | Patent lapsed |
Country of ref document: DK |