DK157938B - DNA sequence for insulin precursors, vectors containing this sequence, yeast strains which are transformed with the vectors, and also a process for preparing the insulin precursors and a process for preparing human insulin - Google Patents

Description

DK 157938 B

The present invention relates to DNA sequences encoding insulin precursors, vectors containing such sequences, yeast strains transformed with these vectors, and a method for producing such insulin precursors and a method for producing human insulin.

2 DK 157938B

5

Insulin has previously been synthesized (from synthetic A and B chains) or re-synthesized (from A and B chains from natural sources) by combining the two chains in an oxidation process / whereby the six cysteine sulfhydryl groups in the reduced 10 chains (4 in the A chain and 2 in the B chain) are converted to disulfide bridges.

By this method, the disulfide bridges are formed largely randomly, which means that the yield of insulin with properly placed disulfide bridges between the cysteine residues A-6 and A-11, A-7 and B-7 and A-20 and B-19 is very low, respectively. .

After the discovery of proinsulin as a biological precursor to insulin, it was observed that the A and B polypeptide chains of the linear-chain, totally reduced proinsulin (which correspond to the A and B chains of insulin, respectively) could be oxidatively combined with much less randomness of the disulfide bridges 20 to obtain substantially higher yields of properly folded proinsulin compared to the combination of free A and B chains (DF Steiner et al .: Proc.Nat.Acad.Sci. 60 (1968), 622 ). Although only high yields were obtained at proinsulin concentrations too low to make the process feasible in a preparative sequence, 25a, the function of the C (i.e. connecting peptide) chain in the BCA polypeptide sequence of proinsulin was clearly demonstrated, namely that function. to bring the six cysteine residues in spatially favorable positions to a proper oxidation to proinsulin.

The proinsulin formed can act as an in vitro precursor for insulin in that the "connecting" peptide can be removed enzymatically (W. Kemmler et al., J. Biol. Chem. 246 (1971), 6786).

It has since been shown that proinsulin-like compounds with shorter binding chains than the C peptide and flanked at both ends by specific, enzymatic or chemical cleavage sites (the so-called miniproinsulins (A. Wollmer et al., Hoppe-Seyler's Z. Physiol. Chem. 355 (11974), 1471-1476, and Dietrich Brandenburg et al., Hoppe-Seyler's Z.Physiol. Chem. 354 (1973), 1521-1524) may also serve as insulin precursors.

J

Attempts to provide biosynthetic ^ nsujli ^ J ^ insulin identical to human insulin have followed the same strategy as for the synthesis of insulin. Insulin A and B chains have been expressed in separate host organisms, isolated therefrom and then combined as described above (R.E. Chance et al .: Diabetes Care 4 (1982), 147). Obtaining the A and B chains by separate fermentation processes followed by a combination of the chains is by nature impractical.

The doubled fermentation cost can be avoided by choosing the proinsulin or miniproinsulin strategy.

In the first experiments, E. coli was transformed with cloning vectors encoding preproinsulin or proinsulin that can be excreted as such (W. Gilbert et al: European Patent Application No. 6694) or accumulated intracellularly as hybrid gene products (DV Goeddel et al .: European Patent Application No. 55945). The miniproinsulin route has also been tried in E. coli, cf. D. V. Goeddel, supra, and European Patent Publication no.

'68701, proposing the preparation of modified proinsulins with a more or less abbreviated C peptide.

However, these methods suffer from several disadvantages, which are mainly due to the fact that E. coli is used as a host organism. Thus, cleavage, folding, and establishment of disulfide bridges must occur in vitro, as E. coli is unable to mature the expressed product. In addition, intracellular accumulation will increase the risk of enzymatic degradation of the expressed product.

It has also been attempted to produce insulin in yeast by introducing a preproinsulant inserted into a suitable vector. The idea was that yeasts should be able to express preproinsulin, which then, like in the human cells, should be cleaved to proinsulin on which the disulfide bridges are formed, and finally the C-peptide is proteolytically cleaved by cleavage at the two pairs of basic amino acids. flanking the C-peptide to form mature insulin, cf. European Patent Publication No. 121884.

35 However, it has been shown that insulin precursors of

The pro-insulin type, in which two basic amino acids flank the C-peptide, is sensitive to enzymatic degradation in yeast, and thus, in this method of preparation, no proinsulin or mature insulin is obtained at all or only in very low yields. IN

In 4 yeasts, human proinsulin and proinsulin analogs with a more or less abbreviated C peptide have been shown to be particularly S? £ fUps & ralnl 8 B against enzymatic cleavage at the two dibasic sequences flanking the C peptide region. Apparently, these cleavages 5 occur before the establishment of the S-S bridges resulting in the formation of C-peptide, A-chain and B-chain.

It is the object of the present invention to overcome these drawbacks by providing biosynthetic insulin precursors which are generated with widely correctly disulfide bridges between the A and B chains and which are furthermore more resistant to proteolytic degradation than the hitherto known biosynthetic insulin precursors.

A single-chain insulin precursor consisting of a precursor Bi B29 tet insulin B chain from Phe to Lys, which proceeds in a complete A chain from Gly to AsnA, B (1-29) -A (1-21) is known ( Jan Markussen, "Proteolytic Degradation of Proinsulin and of the Intermediate Forms", Proceedings of the Symposium on Proinsulin, Insulin and C-Peptide, Tokushima, July 12-14, 1978, Publishers: S. Baba et al. The insulin precursor B (l-29) -A (l-21) is produced by a semi-synthetic process from porcine insulin. First, the insulin B (l-29) and A (1-21) chains are prepared and coupled to a linear peptide B (1-29) -A (l-21). The compound is oxidized in the hexathiole form in vitro to form the single-chain des- (B30) insulin molecule.

The present invention is based on the surprising realization that the single-chain insulin precursor B (l-29) -A (l-21) and its derivatives with a bridge chain connecting the C-terminal end of B (1-29) The chain with the N-terminal end of the A (1-21) chain is expressed in high yields and with properly placed disulfide bridges in the cultivation of yeast strains transformed with DNA sequences encoding such insulin precursors. The proof that the expressed insulin precursors have properly disulfide bridges is that the precursors can be transformed into a product identical to human insulin, cf. the following Examples 14-18.

In its first aspect, the present invention provides a DNA sequence for use in a yeast vector which consists of a nucleotide combination encoding an insulin precursor of the formula

B (l-29) - (Xn-Y) m-A (l-21) I

5

DK 15 7 9 3 8 B

where is a peptide chain with n amino acid residues, Y is Lys or

Arg, n is an integer from 0 to 33, m is 0 or 1, B (l-29) is one

B1 B29 shortened human insulin B chain from Phe to Lys and A (1-21) is the A chain of human insulin, however, the peptide chain -x -Y- cannot contain two adjacent basic amino acid residues (ie Lys or Arg) .

Preferred insulin precursors of formula I are B (l-29) -A (l-21), i.e. m = 0 in Formula I, and compounds having a relatively short bridge chain between the B (1-29) and A (1-21) chains.

When m = 1, n is preferably 1-33, more preferably 1-15, 1-8 or 1-5 and most preferably 1-3 or 1-2. x is preferably selected from the group consisting of Ala, Ser and Thr, where the individual Xs are the same or different. Examples of such preferred compounds are B (1-29) -Ser-Lys ~ A (1-21) and B (1-29) -Ala-Ala-Lys-A (1-21).

In its second aspect, the present invention provides a yeast replicable vector capable of expressing a DNA sequence encoding insulin precursors of formula (I).

The vector is a plasmid capable of replication in yeast.

According to a third aspect, the present invention provides a method for preparing insulin precursors of formula I in yeast, wherein a transformed yeast strain containing a plasmid capable of expressing the insulin precursors is grown in an appropriate nutrient medium followed by of isolation of the insulin precursors.

According to a fourth aspect, the present invention provides a yeast strain transformed with a vector capable of expressing a DNA sequence encoding the insulin precursors in yeast.

The insulin precursors may be expressed with additional protein prior to the insulin precursor. The additional protein may function to protect the insulin precursor from e.g. in vivo degradation with the organism's own enzymes or may function to provide the necessary information to transport the desired protein into the periplasmic cavity and finally across the cell wall into the medium.

6

DK 157938B

The additional protein contains a selective cleavage site adjacent to the N-terminus of the B (1-29) chain of the insulin precursor, thereby ensuring a subsequent cleavage of the additional protein either by the microorganism itself or by 5 later enzymatic or chemical cleavage.

When the insulin precursors are expressed in yeast, the additional amino acid sequence may contain two basic amino acids (e.g. Lys-Lys, Arg-Arg, Lys-Arg or Arg-Lys) adjacent to the N-terminus of the B (1-29) chain of the insulin precursor, with yeast being able to cleave the peptide bond between the basic amino acids and the precursor. Also, a Glu-Ala or Asp-Ala cleavage site adjacent to the desired protein provides a separation of the additional amino acid sequence by the yeast itself by a dipeptidase enzyme produced by the yeast.

The insulin precursors may be secreted by an amino acid sequence attached to the B (1-29) chain of the precursor, provided that this amino acid sequence contains a selective cleavage site adjacent to the B (1-29) chain for later cleavage of the excess amino acid sequence. Since the insulin precursors do not contain methionine, cyanogen bromide cleavage by methionine adjacent to the desired protein will be operative. Similarly, arginine and lysine cleavage sites provide adjacent to the desired protein cleavage with trypsin-like proteases.

To provide secretion, the DNA sequence encoding the insulin precursors can be associated with an additional DNA sequence encoding a signal peptide, the signal peptide being cleaved off by the transformed microorganism during the secretion of the expressed protein product from the cells, simple isolation of the desired product. The secreted product 30 may be the insulin precursor or may contain an additional N-terminal amino acid sequence to be removed later as explained above.

Excretion can be achieved by inserting into the vector the yeast MFα1 leader sequence (Kurjan, J. and Herskowitz, I., 35 Cell 30, (1982), 933-943).

The expression of the desired DNA sequence will be under the control of a promoter sequence correctly positioned relative to the DNA sequence encoding the desired protein product, whereby the desired protein is expressed in the host organism. There can 7

DK 157938 B

preferably a promoter of a gene resident in the host organism is used. The DNA sequence of the desired protein will be followed by a transcription terminator sequence, preferably a terminator sequence from a gene native to the host organism. Preferred promoter and terminator sequences are the promoter and terminator of the triosephosphate isomerase (TPI) gene, respectively.

Other promoters such as phosphoglycerate kinase (PGK1) and MFα1 promoters may also be used.

The present invention further provides a method for producing human insulin in which a yeast strain transformed with a replicable vector containing a DNA sequence encoding the insulin precursors of the above formula I is grown in a suitable nutrient medium, insulin-15. the precursors are recovered from the culture medium and converted into human insulin in vitro.

The insulin precursors of the process can be converted to human insulin by transpeptidation with an L-threonine ester in the presence of trypsin or a trypsin derivative, as described in the specification of Danish Patent Application No. 574/80, followed by conversion of the threonine ester of human insulin to human insulin in known manner.

If the insulin precursors are secreted with an additional amino acid sequence attached to the N-terminus of the B (1-29) chain, such an amino acid sequence should either be removed in vitro prior to transpeptidation or should contain at least one basic amino acid adjacent to the N-terminus of B (1 -29) chain, since trypsin will cleave the peptide bond between the basic amino acid and the amino group of Phe during transpeptidation.

The invention will be explained in more detail with reference to the drawing, in which: FIG. 1 shows the preparation of plasmid 2 shows the preparation of plasmid pMT475; FIG. 3 shows the preparation of plasmid pMT212; FIG. 4 shows the preparation of plasmid pMT479r 5 FIG. 5 shows the preparation of plasmid pMT319f FIG. 6 shows the preparation of plasmid pMT598; 7 shows the preparation of plasmid pMT610; FIG. 8 shows the preparation of plasmid pT5 and FIG. 9 shows the preparation of plasmid pMT639.

In the drawings and in parts of the following description, the term B 'is used instead of B (l-29) and A instead of A (l-21). The term B'A is accordingly equivalent to the term B (1-29) -A (1-221).

1. Preparation of a gene encoding human proinsulin BCA Fully purified RNA (Chirgwin, JM Przybyla, AE, McDonald, RJ & Rutter, WJ, Biochemistry 18, (1979) 5294-55299) from human pancreas was reverse-transcribed (Boel, E .,

Vuust, J., Norris, F., Norris, K., Wind, A., Rehfeld, J.F. & 20 Marcker, K.A., Proc.Natl.Acad.Sci. USA 80, (1983), 2866 - 2869) with AMV reverse transcriptase and d (GCTTTATTCCATCTCTC) as 1st strand primer. Following preparative urea polyacrylamide gel purification of human proinsulin cDNA, the second strand was synthesized on this template with DNA polymerase large fragment and e 25 d (CAGATCACTGTCC) as second strand primer. Following Si nuclease digestion, human proinsulin double-stranded cDNA was purified by polyacrylamide gel electrophoresis, the end formed with terminal transferase, and double-stranded cDNA was cloned at the Pst1 site of pBR327 (Sorberon et al., Gene 9, (1980), 287-305) in E. coli. A correct clone containing a plasmid encoding human proinsulin was identified among the recombinants by restriction endonuclease analysis and confirmed by nucleotide sequencing (Maxam, A., & Gilbert, W., Methods in Enzymology, 65 (1980), 499 560. Singer, F., Nicklen, S., & Coulson, A. R., Proc. Nat. Acad. Sci. U.S. 74, (1977), 5463-55467).

9 2. Preparation of Genes Encoding Human InsulQip ^: ec ^ r ^ <^: ^ r ^^

The gene encoding B (1-29) -A (1-21) of human insulin was produced by "site specific mutagenesis" of the human proinsulin sequence with a 75bp in frame deletion in the region encoding 5 for the C peptide, inserted into a circular, single-stranded M-13 baking riophage vector. A modified method (K. Norris et al., Nuel.Acids.Res. 11 (1983) 5103-5112) was used, in which a chemically synthesized 19-mer deletion primer was hybridized to the M-13 template. After a short enzymatic extension reaction 10, a "universal" 15-mer M-13 dideoxy sequencing primer was added followed by enzymatic extension and ligation. A double-stranded restriction fragment (BamH1-Hind III) was excised from the partially double-stranded circular DNA and ligated into pBR322 cut with BamHI and Hind III.

The resulting ligation mixture was used to transform E. coli, and transformants containing a plasmid pMT319 containing the gene encoding B (1-29) -A (1-21) of human insulin were identified.

Genes encoding B (1-29) -Ala-Ala-Lys-A (1-21) and 20 B (1-29) -Ser-Lys-A (1-21) were prepared by inserting a fragment coding for MFα1-BCA in the M-13 bacteriophage and site specific mutagenesis of the human proinsulin sequence with chemically synthesized 30-mer and 27-mer deletion primers and the aforementioned "universal" 15-mer M13 dideoxy sequencing 25 primer, respectively. A double stranded restriction fragment (XbaI-EcoR1) was excised from the partially double stranded circular DNA and ligated to pUC13 and pT5, respectively. Transforming and retransmitting E. coli, transformants were identified with a plasmid pMT598 containing the gene encoding B (l-29) -Ala-30 Ala-Lys-A (l-21) and pMT630 containing the gene. encoding B (1-29) -Ser-Lys-A (1-21).

A gene encoding B (l-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A (l-21) was prepared in the same manner as described above by inserting a fragment encoding MFal-35 B (1-29) -A (1-21) in an M13 mpll bacteriophage and site specific mutagenesis of the B (1-29) -A (1-21) sequence with a chemically synthesized 46-mer deletion primer (5'-CACACCCAAGACTAAAGAAGCTGAAGACTTGCAAAGAGGCATTGTG-3 ') and the universal primer. Likewise, by a similar method 10

DK 157938 B

prepared a gene encoding B (1-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Val-Gly-Gln-Val-Glu-Leu-Gly-Gly-Gly-Pro Gly-Ala-Gly-Ser-Leu-Gln-Pro-Leu-Ala-Leu-Glu-Gly-Ser-Leu-Gln-Lys-A (l-21).

5 3. Plasmid constructs

The gene encoding B (1-29) -A (1-21) of human insulin (ΒΆ) was isolated as a restriction fragment from pMT319 and combined with fragments encoding the TPI promoter (TPIp) (T. Alber and G. Kawasaki. " Nucleotide Sequence of the Triose Phosphate Isome-10 Gene Gene of Saccharomyces cerevisiae. "J. Mol. Applied Genet. 1 (1982) 419 - 434), MFal leader sequences (J. Kurjan and I. Herskowitz, Structure of a Yeast Pheromone Gene (MFa): "A Putative α-Factor Precursor Contains Four Tandem Copies of Mature α-Factor," Cell 30 (1982) 933 - 943) and the transcription termination sequence of TPI from S. cerevisiae (TPIT). These fragments provide sequences to ensure a high frequency of transcription of the B'A coding gene and also provide a pre-sequence which may cause localization of B'A in the secretory pathway and its possible secretion into the growth medium. This secretion-20 unit for ΒΆ (TPIp-MFal leader - ΒΆ - TPI ^) was then inserted into a plasmid vector containing yeast 2μ replication initiation site and a selectable marker, LEU 2, to form pMT344, a yeast expression reading vector for B ' A.

By in vivo maturation of α-factor in yeast, the last 25 (C-terminal) six amino acids of the MFα leader peptide (Lys-Arg-Glu-Ala-Glu-Ala) are removed from the α-factor precursor by sequential action of an endopeptidase recognizing The Lys-Arg sequence, and an amino dipeptidase that removes the Glu-Ala amino acid residue (Julius, D. et al. Cell 32 (1983) 839-852). To eliminate the need for the yeast aminodipeptidase, the sequence encoding the C-terminal Glu-Ala-Glu-Ala in the MFα1 leader was removed from pMT344 via in vitro mutagenesis. The resulting yeast expression plasmid, pMT475, contains an inserted portion encoding the TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -ΒΆ-ΤΡΙΤ.

In a preferred construct, the modified expression unit was transferred to a stable, high-capital yeast plasmid CPOT, (ATCC No. 39685) selectable only for the presence of glucose in the growth medium. The resulting yeast expression vector for B'A was designated pMT479.

11

DK 157 9 3 8 B

Fragments encoding the MFα1 leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ala-Ala-Lys-A (1-21) were isolated as a restriction fragment from pMT598 and assembled with fragments , which encodes the TPI promoter and the TPI terminator, and transferred to the aforementioned high-capital yeast plasmid CPOT. The resulting yeast expression vector for B {1-29) -Ala-Ala-Lys-A (1-21) was called pMT610.

The fragment containing the inserted TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ser-Lys-A (1-21J-TPII) was isolated as a restriction fragment from pMT630 and transferred to 10 CPOT The resulting yeast expression vector for B (l-29) -Ser-Lys-A (l-21) was called pMT639.

The fragment containing the inserted sequence TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A ( 1-21) -TPIT was inserted into a high-capital yeast plasmid DPOT, which is a CPOT derivative containing an

BamHI fragment of pBR322 inserted into a SpH1-BamHI fragment of CPOT. The resulting yeast expression vector for B (l-29) -Thr-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Lys-A (l-21) was called pll26.

4. Transformation

The plasmids pMT344 and pMT475 were transformed into S. cerevisiae leu 2 mutants by selection for leucine prototrophy as described by Hinnen et al. (A. Hinnen, J.B. Hicks 25, and G.R. Fink, "Transformation of Yeast," Proc.Nat.Aca.Sci. 75 (1978) 1929).

Plasmid pMT479, pMT610, pMT639 and pll26 were transformed into S. cerevisiae strains having deletions in the TPI gene by selection for glucose growth. Such strains are usually unable to grow on glucose as the only carbon source and grow very slowly on a galactose lactate medium. This defect is due to a mutation in the triosephosphate isomerase gene, obtained by deletion and replacement of a substantial part of this gene by the S. cerevisiae LEU 2 gene. Due to the growth defect, there is a strong selection for a plasmid containing a gene encoding TPI. CPOT and DPOT contain the Schizo.pombe TPI gene.

DK 157938B

5. Expression of human insulin precursors in yeast

The human insulin-type expression products were measured by insulin radioimmunoassay as described by Heding, L. (Diabetologia 8f 260-66, 1972) with the sole exception that the insulin precursor standard in question was used instead of an insulin standard. The purity of the standards was approx. 98% determined by HPLC and the actual concentration of the peptide in the standard was determined by amino acid analysis. The expression amounts of immunoreactive human insulin precursors in the transformed yeast strains are given in Table I.

Table 1

Expression levels of immunoreactive human insulin precursors in 15 yeast __________

Immunoreactive insulin precursors Yeast strain Plasmid Construction (nmol / liter _ supernatant) _ 20 MT 350 (DSM 2957) pMT 344 B (1-29) -A (1-21) 100 MT 371 (DSM 2958) pMT 475 B (1-29 ) -A (1-21) 192 MT 519 (DSM 2959) pMT 479 B (1-29) -A (1-21) 2900 MT 620 (DSM 3196) pMT 610 B (1-29) -Ala-Ala- Lys-A (l-21) 1200 - 1600 MT 649 (DSM 3197) pMT 639 B (1-29) -Ser-Lys-A (1-21) 1600 ZA 426 p 1126 B (1-29) -Thr -Arg-Glu-Ala-Glu- 200

Asp-Leu-Gln-Lys-A (1-21) B (1-29) -Gly-Ser-Lys-A (1-21) 1260 B (1-29) -Thr-Leu-Lys-A (1 -21) 670 B (1-29) -Asp-Thr-Lys-A (1-21) 2900 B (1-29) -His-Thr-Lys-A (1-21) 580 B (1-29) ) -Asp-Ala-Lys-A (1-21) 2500 B (1-29) -Asp-Gly-Lys-A (1-21) 3340 B (1-29) -Ser-Ser-Glu-Asn- Thr- 620

Trp-Asp-Lys-A (1-21) B (1-29) -Gly-Ala-Gly-Pro-Thr-880

Pro-Gly-Lys-A (1-21) B (1-29) -Val-Pro-Pro-Val-Thr-560

Glu-Asp-Lys-A (1-21) * 13

DK 157938 B

The isolation and characterization of expression products is given in Examples 7 - 9 and 12 - 13.

6. Conversion of the human insulin precursors to B30 esters of 5 human insulin

The conversion of the human insulin precursors to human insulin esters can be quantitatively monitored by reverse-phase HPLC (high pressure liquid chromatography). A 4 x 300 mm 3 Bondapak C18 column (Waters Ass.) Was used and the elution was performed with a buffer containing 0.2 M ammonium sulfate (adjusted to a pH of 3.5 with sulfuric acid) and Containing 26 - 50% acetonitrile The optimal acetonitrile concentration depends on which ester one wants to separate from the insulin precursor, in the case of human insulin methyl ester the separation is obtained in about 26% 15 (v / v) acetonitrile.

Prior to application to the HPLC column, the proteins in the reaction mixture were precipitated by the addition of 10 volumes of acetone. The precipitate was isolated by centrifugation, dried in vacuo and dissolved in 1 M acetic acid.

20

Example 1

Construction of a gene encoding B (1-29) -A (1-21) insulin s' 25 Materials and Methods

The "universal" 15-mer M13 dideoxy sequencing primer d (TCCCAGTCACGACGT), T4 DNA ligase, and restriction enzymes were obtained from New England Biolabs. DNA Polymerase I ”Klenow

fragment "and T4 polynucleotide kinase, were purchased from P-L

32 30 Biochemicals. (γ-P) -ATP (7500 Ci / nmol) was obtained from New

England Nuclear. The support for oligonucleotide synthesis was 5'-0-2 dimethoxytrityl-N-isobutyryldeoxyguanosine linked via a 3'-0-succinyl group to Bachem aminomethylated 1% cross-linked polystyrene pellets.

35 14

Construction of M13 mplO insHX ^ Pst phage DK 157938 B

The M13 mp10 derived phage mp10 insHX was constructed by cloning the 284 bp proinsulin-coding Hind III-XbaI fragment, isolated from p285, into Hind III-XbaI cut M13 mp10 RF.

5 M13 mp10 RF is available from P-L Biochemicals, Inc. Milwaukee, Wis. (Catalog No. 1541).

M13 mplO insHX ^ Pst was constructed from mplO insHX, RF by complete Pstl digestion followed by ligation and transformation of E. coli JM103. The resulting phage contains the -10 human proinsulin coding sequence, with a 75 bp in frame deletion in the C-peptide coding portion. Single stranded phages were prepared as described by Messing.J. and Vieira, J., (1982), Gene 19, 269-276).

Oligodeoxyribonucleotide Synthesis The 19-mer deletion primer d (CACACCCAAGGGCATTGTG) was synthesized by the triester method on a 1% cross-linked polystyrene support (Ito, H., Ike, Y., Ikuta, S. and Itakura, K. (1982)).

Nucl.Acids Res. 10, 1755 - 1769). The polymer was packed in a short 20 column and solvents and reagents were supplied semi-automatically by an HPLC pump and a control module. The oligo nucleotide was purified after deprotection by HPLC on a LiChrosorb RP18 column (Chrompack (Fritz, H.-J., Belagaje, R., Brown, EL, Fritz, R.H., Jones, R.A., Lees, R.G. and Khorana, 25HG (1978) Biochemistry 17, 1257-1267).

DK 157938B

For colony hybridization, the oligonucleotide was labeled without the addition of "cold" ATP as described (Boel, E., Vuust, J., Norris, F., Norris, K., Wind, A., rehfeld, J. and Marcker, K.

(1983) Proc.Natl.Acad.Sci. USA 80, 2866 - 2869).

5

Oligodeoxyribonucleotide "pr imed" DNA synthesis

The single-stranded M13 mp10 insHXAPst (0.4 pmol) was 32

incubated with the 19-mer 5 '- (P) -labeled oligodeoxyribonucleotide primer (10 pmol) in 20 μΐ 50 mM NaCl, 20 mM Tris-HCl pH 7.5, 10 10 mM MgCl 2 and 1 mM DDT for 5 min. at 55 ° C and heated for 30 minutes at 11 ° C. Then, 9 μΐ d-NTP mixture consisting of 2.2 mM of each dATP, dCTP, dGTP, dTTP, 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 50 mM NaCl, 1 mM DDT was added followed by 7 units of E. coli DNA polymerase I (Klenow). The mixture was kept at 11 ° C for 30 minutes and heated to 65 ° C for 10 minutes. The universal 15-mer primer for dideoxy sequencing (4 pmol) was added and the mixture was heated to 65 ° C for one more minute. After cooling to 11 ° C, 26 μΐ of a solution containing 20 mM was added

Tris-HCl pH 7.5, 10 mM MgCl-, 10 mM DTT, 0.8 mM of each dATP, 1 3 dCTP, dGTP, dTTP, 2.4 mM ATP, and 10 units of T4 ligase followed by 9.5 units of E. ooli DNA polymerase I (Klenow). The final volume of the mixture was 64 μΐ. After incubation for 3 hours at 11 ° C, 20 μΐ of 4M sodium acetate was added and the volume was adjusted to 200 μL · with TE buffer (10 mM Tris-HCl pH 8.0, 1 mM 25 EDTA).

The mixture was extracted twice with phenol / chloroform. 0.9 µg (0.3 pmol) of the purified large fragment of pBR322 digested with BamHI and Hind III was added as carrier DNA. After ether extraction of the aqueous phase, DNA was isolated by ethanol precipitation.

endonuclease digestion

DNA, prepared as described above, was digested with 16 and 20 units, respectively, of the restriction endonucleases 35 BamHI and Hind III in a total volume of 22 μ (buffer (50 mM

NaCl, 10 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 # 1 mM DDT, 4 mM spermidine). The mixture was extracted with phenol / chloroform followed by 16 ether and DNA was isolated by ethanol precipitation

dissolved in 12 μΐ H2 O. 2 μΐ was used for electrophoresis on a 7 M

urea 6% polyacrylamide gel.

5 Ligation

To a portion of DNA (5 μΐ) was added a new portion of the purified large fragment of pBR322 cut with BamHI and Hind III (0.38 μg) and 400 units of T4 DNA ligase in a total volume of 41 μΐ containing 66 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 1 mM ATP, 10 10 mM DDT, 40 μg / ml gelatin. The ligation was performed at 16 ° C for 16 hours.

Transforming 20.5 μΐ of the ligation mixture was used to transform CaCl2 treated E.coli MC 1000 (r, m +). The bacteria were spread on LB agar plates and selected for resistance to ampicillin (100 μg / ml). 2.6 x 10 6 colonies per pmol M13 mplO insHX Pst.

Colony Hybridization 123 transformed colonies were transferred to fresh ampicillin plates and grown overnight at 37 ° C. The colonies were transferred to Whatman 540 filter paper and fixed (Gergen, J.P.,

Stern, R.H. and Wensink, P.C. (1979), Nucl.Acids Res. 7, 2115 - 2136). A prehybridization was carried out in a sealed plastic bag with 6 ml of 0.9 M NaCl, 0.09 M Tris-HCl pH 7.5 0.006 M EDTA, 0.2%

Ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, 0.1% SDS

and 50 μg / ml salmon sperm DNA for two hours at 65 ° C. Then 6 32 were added 8.5 x 10 cpm P-labeled 19-mer, and the hybridization was carried out overnight at 45 ° C. The filtrate was washed 3 times at 0 ° C for 5 minutes with 0.9 M NaCl, 0.09 M sodium citrate and then autoradiographed and washed once at 45 ° C for one minute and autoradiographed again. After washing at 45 ° C, 3 colonies containing mutated plasmids were identified.

35

Endonuclease analysis of mutated plasmids

Plasmids from the putative mutated colonies were prepared by rapid methods (Ish-Horowicz, D. and Burke, J.F. (1981), Nucl.Acids Res. 9, 2989-2998) digested with a mixture of BamHI

DK 157938B

and Hind III and then analyzed by electrophoresis on a 2% agarose gel. The presence of a 179 bp fragment confirmed that the 3 colonies contained mutated plasmid.

5 Retransformation

The colonies identified as "mutant" -containing plasmids are descended from a heteroduplex. Pure mutants could be obtained by retransformation of CaCl3-treated E. coli MC1000 (r, m +) with plasmid from 2 of the mutant colonies. From each plate, 5 ampicillin resistant clones were isolated, plasmid DNA was prepared and analyzed by endonuclease cleavage as mentioned above. 3 out of 5 and 5 out of 5, respectively, were shown to be pure mutants.

A plasmid pMT319 was selected for further use.

DNA sequence analysis 5 μg of pMT319 was digested with BamHI under standard conditions, extracted with phenol and precipitated with ethanol. Filling of the BamHI cohesive ends was performed with Klenow DNA polymerase 32 I, dCTP, dGTP, dTTP and α-β-dATP. · 20 After extraction with phenol and precipitation with ethanol 32, DNA was digested with EcoRI. The -P labeled fragment with the deletion was purified by electrophoresis on a 2% agarose gel and sequenced by the Maxam-Gilbert method (Maxam, A. and Gilbert, W (1980) Methods in Enzymology 65, 499-560).

Example 2

Construction of a yeast plasmid pMT344 to express B (l-29) -A (l-21) of human insulin (B'A) 30 Plasmid pMT319 containing the gene encoding B'A and constructed as described above was cut with the restriction enzymes Hind III and Xbal, and a 0.18 kb fragment was isolated (T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning, Cold Spring Harbor Press 1982) from a 2% agarose gel. Similarly, a fragment (6.5 kb XhoI - Hind III) containing the S. cerevisiae TPI promoter (TPlp) (T. Alber and G.

Kawasaki, "Nucleotide Sequence of the Triose Phosphate Isomerase Gene of Saccharomyces cerevisiae", J.Mol. Applied Genet. 1 (1982) 419 - 434) and the MFal leader sequence (J. Kurjan and I. Herskowitz, 18

DK 157938B

"Structure of a Yeast Pheromone Gene (MFa): A Putative α-Factor Precursor Contains Four Tandem Copies of Mature α-Factor", Cell 30 (1982) 933 - 943) isolated from plasmid p285. p285 contains the inserted sequence TPIp-MFal leader-B-C-A-TPI ^, and is deposited 5 in yeast strain Z33 (ATCC No. 20681). A fragment (0.7 kb XbaI-BamHI) containing the TPI transcription termination sequences (TPIT) (T. Alber and G. Kawasaki, "Nucleotide Sequence of the Triose Phosphate Isomerase Gene of Saccharomyces cerevisiae", J. Mol. Applied Genet. 1 ( 1982) 419 - 434) were also isolated from · 10 p285. Finally, a 5.4 kb Xhol - BamHI fragment was isolated from the yeast vector YEP13 (J.R. Broach, "Construction of High Copy Yeast Vectors Using 2 μιη Circle Sequences", Methods Enzymology 101 (1983) 307 - 325). The above four fragments were ligated (T. Maniatis, E.F. Fritsch, and J. Sambrook, "Molecular Cloning," Cold 15 Spring Harbor Press 1982) and transformed into E. coli (T.

Maniatis, E.F. Fritsch and J. Sambrook, "Molecular Cloning," Cold Spring Harbor Press 1982), selecting for ampicillin resistance. Plasmids were isolated from the transformants and the structure of one of them, pMT344, was verified by restriction mapping. The preparation and essential properties of pMT344 are described in FIG. First

Example 3 Construction of a yeast plasmid pMT475 to express B (l-29) -A (l-21) of human insulin (B'A) following a modified MFal leader.

For constructing a plasmid to express B'A following an MFal leader (J. Kurjan and I. Herskowitz, "Structure of a Yeast Pheromone Gene (MFa): A Putative α-Factor Precursor 30 Contains Four Tandem Copies of Mature α -Factor ", Cell 30 (1982) 933-943), which lacks its last four amino acids (Glu Ala Glu Ala), the 0.14 kb Xbal - EcoRII fragment containing A and part of the B 'sequence was isolated from pMT319. Similarly, the 5 'proximal portion of the B' gene was isolated from a 0.36 kb EcoRI -35 EcoRII fragment from pM215. This plasmid pM215 was constructed by subcloning the EcoRI - XbaI fragment containing the proinsulin BCA gene from p285 into pUC13 (constructed as described for pUC8 and pUC9 by Vieira et al., Gene 19: 259-268 (1982)) and subsequently in vitro loop-out removal of the 12 bases that

19 DK 157938B

encodes Glu-Ala-Glu-Ala at the junction between the MFal leader and the proinsulin B-C-A gene. These two pieces, which cover the B'A gene, were ligated to the pUCl3 vector digested with EcoRI-Xbal (cf. Fig. 2) to generate pMT473. The modified gene 5 contained in a 0.5 kb EcoRI - XbaI fragment was isolated from pMT473 and then ligated to two fragments (4.3 kb XbaI-EcoRV and 3.3 kb EcoRV - EcoRI) from pMT342. pMT342 is the yeast vector pMT212 with the inserted sequence TPIp-MFal leader-B-C-A-TPIT. The resulting plasmid, pMT475, contains the inserted sequence: 10 TPIp-MFal leader- (minus Glu-Ala-Glu-Ala) - ΒΆ-ΤΡΙΤ. The construction of plasmids pMT342, 473 and 475 is described in FIG. 2. The construction of the vector pMT212 is shown in FIG. 3. The plasmid pMLB1034 is described by M.L. Berman et al., Advanced Bacterial Genetics, Cold Spring Harbor (1982), 49-51, and pUCl2 were constructed as described for pUCl3 (Vieira et al., Ibid.).

Example 4

Introduction of the B (1-29) -A (1-21) (B'A) gene into a stable yeast plasmid 20 pMT479

The modified ΒΆ gene from pMT475 was isolated as a 2.1 kb Bam HI partial SphI fragment and ligated to a ca. 11 kb BamHI - Sphl fragment of plasmid CPOT (ATCC No. 39685) to generate plasmid pMT479 (Fig. 4). Plasmid CPOT is based on the vector C1 / 1 that has been modified by replacing the original pBR322 Bgll - BamHI fragment with the similar Bgll -BamHI fragment from pUC13 and subsequent introduction of the S.pombe TPI gene (EP patent application No. 85303702.6) as a BamHI -Sall fragment to form CPOT. Cl / 1 is derived from pJDB248, 30 Beggs et al., Nature 275, 104 - 109 (1978) as described in EP Patent Application 0103409A.

Example 5 Transformation S. cerevisiae strain MT118 (a, leu 2, ura 3, trp 1) was grown on YPD medium (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) to ODgoo 2.1 . 100 ml of culture fluid was harvested by centrifugation, washed with 10

DK 157938B

water, recentrifuged and resuspended in 10 ml 1.2 M sorbitol, 25 mM Na 2 EDTA pH = 8.0, 6.7 mg / ml dithiotreitol. The suspension was incubated at 30 ° C for 15 minutes and centrifuged, and the cells were resuspended in 10 ml 1.2 M sorbitol, 10 mM 5 Na 2 EDTA, 0.1 M sodium citrate pH = 5.8 and 2 mg Novozym®234.

The suspension was incubated at 30 ° C for 30 minutes, the cells were collected by centrifugation, washed in 10 ml 1.2 M sorbitol and in 10 ml CAS (1.2 M sorbitol, 10 mM CaCl 2 * 10 mM Tris (Tris =

Tris (hydroxymethyl) aminomethane) pH = 7.5) and resuspended in 2 ml of 10 CAS. For transformation, 0.1 ml of the CAS resuspended cells were mixed with ca. 1 μg of plasmid pMT344 and left at room temperature for 15 minutes. Then 1 ml of 20% polyethylene glycol 4000, 10 mM CaCl 2, 10 mM Tris pH = 7.5 was added and the mixture was allowed to stand for an additional 30 minutes at room temperature. The mixture was centrifuged and the pills resuspended in 0.1 ml of SOS (1.2 M sorbitol, 33% v / v YPD, 6.7 mM CaCl 2, 14 μg / ml leucine) and incubated at 30 ° C for two hours. The suspension was then centrifuged and the precipitate resuspended in 0.5 ml of 1.2 M sorbitol. 6 ml of top agar was added at 52 ° C (SC medium of 20 Sherman et al., (Methods in Yeast Genetics, Cold Spring Harbor Laboratory 1981) omitted with leucine and containing 1.2 M sorbitol plus 2.5% agar) at 52 ° C and the suspension was poured onto plates containing the same agar-dried sorbitol-containing medium. Transformant colonies were taken up after 3 days at 30 ° C, 25 isolated and used to start liquid cultures. Such a transformant MT350 (= MT 118 / pMT344) was selected for further characterization.

Plasmid pMT 475 was transformed into S. cerevisiae strain MT362 (a, leu2) by the same procedure as above, and the transformant MT371 (= MT362 / pMT475) was isolated.

Transformation of pMT479 into strain E2-7B X E11-3C (α / α, β tpi / β tpi, PeP 4-3 / pep 4-3 (this strain will be referred to as MT501) was performed in the same manner with the modification that the MT501 strain was grown on YPGaL 35 (1% Bacto yeast extract, 2% Bacto peptone, 2% galactose and 1% lactate) to ODgQQ of 0.6 prior to transformation and that the SOS solution contained YPGaL instead of YPD. transformant MT519 (= MT501 / pMT479) was selected for further characterization.

21

DK 157938 B

The transformed microorganisms MT 350, MT 371 and MT 519 were deposited at Deutsche Sammlung von Mikororganismen (DSM), Griesebachstrasse 8, D-3400 Gottingen, on May 15, 1984 and were assigned the deposit numbers DSM 2957, DSM 2958 5 and DSM 2959 respectively. .

Example 6

Expression of B (1-29) -A (1-21) Insulin in Yeast 10 Strains MT350 (DSM 2957) and MT371 (DSM 2958) were grown on a synthetic complete medium SC (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory 1981) with leucine omitted. Each strain was cultured in 2 one-liter cultures in titer shaker flasks at 30 ° C until reaching a -10600ηπι of 7-10. They were then centrifuged and the supernatant removed for further analysis.

Strain MT519 (DSM 2959) was grown in a similar manner, but on a YPD medium (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) to one of 15. Then, 20 were centrifuged and the supernatant separated for further analysis as above.

Example 7

Expression of B (l-29) -A (l-21) insulin in yeast strain MT350 (DSM

2957) Yeast strain MT350 (DSM 2957) was grown as described in Example 6 and the expression products from 1100 ml of the supernatant from this strain were isolated as follows: 30 g of LiChroprep® RP-18 (Merck, art. 9303) was washed 3 times. with 50 mM NH 2 HCO 3, 60% EtOH and then packed in a 6 x 1 cm column. The column was equilibrated with 50 ml of 50 mM NH 2 HCO 3.

55 ml of 96% EtOH was added to 1100 ml of the yeast supernatant and the mixture was applied to the column overnight (flow: 70 35 ml / h).

The column was washed with 10 ml of 0.5 M NaCl and 10 ml of H 2 O / and the peptides were eluted with 50 mM Ntf 2 HCO The eluate (5 ml) was concentrated by vacuum centrifugation to 1.4 ml (to remove ethanol) and the volume was adjusted to 10 ml with

22 DK 157938B

25 mM HEPES buffer pH = 7.4. The mixture was applied to an anti-insulin immunoabsorption column (AIS column) (2.5 x 4.5 cm) which had been washed 4 times with 5 ml of NaFAM buffer (Heding, L., Diabetologia 8, 260-66, 1972) and twice with 5 ml of 25 mM 5 HEPES buffer prior to application. After application, the column was allowed to stand for 30 minutes at room temperature and then washed 10 times with 4 ml of 25 mM HEPES buffer. The peptides were eluted with 20% HAc. The pH of the eluate was adjusted to 7.0 with NH 4 OH and the mixture was concentrated to 500 μΐ by 10 vacuum rotation.

The sample from the previous step was further purified by HPLC on a 10 μ Waters μBondopak C-18 column (3.9 x 300 mm). The A and B buffers were 0.1% TFA in H2 O and 0.07% TFA in MeCN, respectively. The column was equilibrated with 25% B (flow: 1.5 ml / min) and the 15 peptides were eluted with a linear gradient of MeCN (1% / min) and detected at 276 nm. The yield at each stage of the purification was determined by radioimmunoassay as previously described and Table 2 depicts the purification. The overall yield was 68%.

t

DK 157938 B

23

Table 2

Purification of the expression products of yeast strain MT350 supernatant

Purification step Volume (ml) Immunoreactive B (1-29) -A (1-21) -____ insulin (nmol) 10 Supernatant 1100 110 * RP-8 10 116

Anti-insulin Sepharose 0.5 116 HPLC_2jJj_75_ 15 * Dilution effect was observed in this sample

Only one peak containing immunoreactive B (1-29) -A (1-21) insulin material was detected from the HPLC column. Peptide material 20 from this peak was isolated and subjected to amino acid sequence analysis. The sequence analysis was performed with a Gas Phase Equator (Applied Biosystem Model 470A) as described by Hewick, R.M. et al. (J. Biol. Chem. 256, 7990-7997, 1981). From the sequencing results, it was concluded that the expression products consisted of 25 peptides: (Glu-Ala) 2-B (l-29) -A (l-21) insulin 89%

Glu-Ala-B (1-29) -A (1-21) insulin 2% B (1-29) -A (1-21) insulin 9%

The peptides were found in the proportions indicated.

Example 8

Expression of B (1-29) -A (1-21) insulin in yeast strain MT371 (DSM

2958) Yeast strain MT371 (DSM 2958) was grown as described above in Example 6 and the expression products of 665 ml of supernatant from this strain were isolated as described in Example 7. ± ± - - - - - - pel 7. The total yield was 50 nmol, corresponding to 39%. The peptide material was isolated from the HPLC column and sequenced as described in Example 7. From the sequence results (18 amino acid residues from the N-terminus) it was concluded that the peptide was homogeneous B (1-29) -A (1-21) insulin. .

Comparing these results with the results of Example 7 suggests the appropriateness of removing the Glu-Ala-Glu-Ala sequence from the C-terminus of the MFal leader. It can be seen from Example 7 that the yeast dipeptidase enzyme does not function very efficiently by cleaving Glu-Ala and Glu-Ala-Glu-Ala from the B (1-29) -A (1-21) insulin before secretion of the insulin precursor from the yeast cells.

Example 9

Expression of B (1-29) -A (1-21) insulin in yeast strain MT519 (DSM

2959) Yeast strain MT519 (DSM 2959) was grown as described above in Example 6 and expression products from 70 ml of the 20 supernatant were isolated as described in Example 7. The overall yield was 116 nmol, corresponding to 57%. The peptide was sequenced as described in Example 7. The peptide was assessed to be homogeneous B (1-29) -A (1-21) insulin from the 42 amino acid residues identified from the N-terminal end. Approximately 5 nmol 25 of the peptide was hydrolyzed in 100 μΐ 6N HCl for 24 hours at 110 ° C. The hydrolyzate was analyzed on a Beckman Model 121M amino acid analyzer. The following amino acid composition was found:

. DK 157938B

25

Table 3

Amino Acid Analysis of Purified B (1-29) -A (1-21) Insulin 5 Amino Acid Found Theoretically itAmino Acid Found Theoretically

Asx * 2.97 3 Val 3.37 4

Thr 1.77 2 Ile 1.65 2

Ser 2.45 3 Leu * 5.65 6 10 Glx * 6.68 7 Tyr 3.51 4

Pro 1.33 1 Phe * 2.73 3

Gly * 3.95 4 Lys * 0.95 1

Ala * 1.22 1 His * 1.84 2

Cys 0.5 4.54 6 Arg * 1.13 1 15 * Amino acid used for normalization Example 10 20 Construction of a yeast plasmid pMT610 to express B (1-29) -Ala-Ala-Lys-A (1-21)

A 4.3 kb EcoRV-Xbal and a 3.3 kb EcoRI-EcoRV fragment from pMT342 (see Example 3) were ligated to a 0.6 kb EcoRI-Xbal fragment of pM215 (see Example 3). The resulting plasmid pMT462 contains the insert MFal leader (minus Glu-Ala-Glu-Ala) -B-C-A. To convert the fragment encoding BCA into a fragment encoding B (1-29) -Ala-Ala-Lys-A (1-21), the modified site specific mutagenesis method was used (K. Norris et al ., ibid.). A 0.6 kb EcoRI-Xbal fragment from pMT462 encoding the MFα1 leader (minus Glu-Ala-Glu-Ala) -B-C-A was inserted into the M13 mp10 RF phage cut with Xbal-EcoRI. Single stranded M13 phage containing the aforementioned EcoRI-XbaI fragment was incubated with a 30-mer d (TTCACAATGCCCTTAGCGGCCTTGGGTGTG) primer (KFN15) and the "universal" 15-mer M13 primer d (TCCCAGTCACGACGT) 35 (see Example 1), ° C for 5 minutes and slowly cooled to room temperature to allow annealing. Then, partially double-stranded DNA was prepared by adding a d-NTP mixture, Klenow Polymerase and T4 ligase. After phenol extraction, ethanol precipitation and resuspension, DNA was cut with 40 restriction enzymes Apal, Xbal and EcoRl. After a further phenol extraction, ethanol precipitation, and resuspension, DNA was ligated to EcoRI-Xbal cut pUC13. The ligation mixture was transformed into an E. coli (r m +) strain and plasmids were prepared from part of the transformants. The plasmid preparations were

DK 187938B

cut with EcoRl and XbaI, and the compositions showing bands at both 0.5 and 0.6 kb were retransformed into E. coli. From the retrans propagation, a transformant containing only pUC13 with a 0.5 kb insert was selected. The sequence of EcoR1-Xbal insert in this plasmid pMT598 was then confirmed by the Maxam-Gilbert method of encoding the MFα1 leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ala-Ala-Lys -A (l-21). The Xbal-EcoRI insert from pMT598 was provided with the TPI promoter and TPI terminator by ligating a 0.5 kb Xbal-EcoRI fragment from pMT598 with a 5.5 kb Xbal-EcoRI 10 fragment from pT5. The construction of pT5 containing the insert TPIp-MFal-leader-B-C-A-TPIT is shown in FIG. 8. The resulting plasmid pMT601 containing the insert TPIp-MFal leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ala-Ala-Lys-A (1-21) -TPIT was cut with BamH1 and partially with SphI, and the 2.1 kb fragment was inserted into the 15 CPOT cut with Bam HI and SphI. The resulting plasmid pMT610 was used to transform yeast.

Example 11 Construction of a Yeast Plasmid pMT639 to Express B (1-29) -Ser-Lys-A (1-21)

The fragment from pMT462 (see Example 10) encoding BCA was converted to B (1-29) -Ser-Lys-A (1-21) by a method similar to that described in Example 10 at site 25 specific mutagenesis with a mixture of a 27-mer d (TCCACAATGCCCTTAGACTTGGGTGTG) primer KFN36 and the "universal" 15-mer M13 primer. After filling with Klenow polymerase and ligation with T4 ligase, the partially double-stranded DNA was digested with Apal, EcoRl and Xbal and ligated to the 5.5 kb Xbal-EcoRI 30 fragment from plasmid pT5 (see Example 10). After transformation and retransformation in E. coli, a plasmid pMT630 containing the insert MFal leader- (minus Glu-Ala-Glu-Ala) -B (l-29) -Ser-Lys-A (1-21) was isolated and the sequence of the effort was confirmed. The further method of obtaining plasmid pMT639 containing the insert TPIp-MFal- (minus Glu-Ala-Glu-Ala) - B (1-29) -Ser-Lys-A (1-21) -TPIT was as described in Example 10. The construction of pMT639 is shown in FIG. 9th

27

DK 15 7 9 3 8 B

Example 12

Expression of B (1-29) -Ala-Ala-Lys-A (1-21) in yeast strain MT620 S. cerevisiae strain MT501 (see Example 5) was transformed with pMT610 as described for pMT479 in Example 5. Transform 5 colonies were collected after 3 days at 30 ° C, reinsulated and used for starting liquid cultures. One of these transformants MT620 = (MT501 / pMT610) was selected for further characterization. MT620 was deposited by the applicant with the Deutsche Sammlung von Microorganism (DSM), on January 16, 1985 and was given 10 reference number DSM3196.

MT620 was grown on YPD medium. A two-titer culture in two liter flasks was shaken at 30 ° C to ODgøonm 15.

After centrifugation, the supernatant was removed for further analysis. The expression level determined by radioimmunoassay was 15 1.2 μπιοΐ / ΐ. The expression products from 840 ml of the supernatant were purified as described in Example 7. (RP-18 column, Anti-insulin Sepharose and HPLC). The total yield was 100 nmol, corresponding to approx. 10%. The peptide material was isolated from the HPLC column and sequenced as described in Example 7. 35 Edman-20 degradation cycles were performed (Table 4). From the sequencing results, the position of the chain with three amino acid residues (Ala-Ala-Lys) separating the B (l-29) and A (1-21) chains was confirmed (see Table 4).

5

DK 157938B

28

Table 4

Sequence analysis of B (1-29) -Ala-Ala-Lys-A (1-21) isolated from the culture medium of strain MT620.

Cycle No. PTH Amino Acid Residue Yield (pmol) 1 Phe 3351 2 Val 1738 10 3 Asn 5169 4. Gin 2750 _5_His_2045_ 6 Leu 1405 7 Cys 15 8 Gly 1372 9 Ser 345 10 His 1105 Π Leu 2225 12 Val 1963 20 13 Glu 1219 14 Ala 1514 15 Leu 1793 T§ Tyr Γ757 17 Leu 1354 25 18 Val 1765 19 Cys 20 Gly 882 -Π-gE-Γ0Ϊ3 22 Arg 1100 30 23 Gly 1123 24 Phe 1492 25 Phe 2042 26 Tyr 1014 27 Thr 195 35 28 Pro 710 29 BOQLys 1173 30 2yAla 1026 31 Ala 555 32 List 1175 40 33 A.Gly 552 34 Ile 518 35 _Val_548_

The mean repetition yield was 95.6%.

45

Example 13

Expression of B (l-29) -Ser-Lys-A (l-21) in yeast strain MT643 S. cerevisiae strain MT501 was transformed with 50 pMT639 as described for pMT479 in Example 5.

A transformant MT643 = (MT501 / pMT639) was selected for further characterization. MT643 was deposited by the applicant at DSM on January 16, 1985 and was given reference no. DSM 3197.

29

DK 157938 B

MT643 was grown as described in Example 12. After centrifugation, the supernatant was removed for further analysis.

The expression level of the insulin precursor determined by radioimmunoassay was 1.6 μπιοΐ / ΐ. Expression products of the supernatant from strain MT643 were isolated as described in Example 7. The peptide material isolated from the HPLC column was subjected to sequence analysis as described in Example 7. From the sequence results (not shown), the position of the chain with two amino acid residues (Ser-Lys), separating the B (l-29) and A (1-21) chains, confirmed.

10

Example 14

Conversion of B (1-29) -A (1-21) to ThrtBu ^ -OBu ^ CBSO) human insulin

15 mg of B (1-29) -A (1-221) was dissolved in 0.1 ml of 10 M

acetic acid. 0.26 ml of 1.54 M Thr (Bu *) - OBut in N, N-dimethylacetamide was added. The mixture was cooled to 12 ° C. 2.8 mg of trypsin dissolved in 0.035 ml of 0.05 M calcium acetate was added. After 72 hours at 12 ° C, the proteins were precipitated by the addition of 4 ml of 20 acetone, isolated by centrifugation and dried in vacuo. The conversion of B (1-29) -A (1-21) to Thr (Bu 2) - OBu (B30) human insulin was 64% by HPLC.

Example 15

Conversion of B (1-29) -A (1-21) to Thr-Ome (B30) human insulin 20 mg of B (1-29) -A (1-21) was dissolved in 0.1 ml of 10 M acetic acid. 0.26 ml of 1.54 M Thr-OMe was added in a mixture of dimethyl sulphoxide and butane-1,4-diol 1/1 (v / v). 1 mg lysyl endopeptidase from Achromobacter lyticus (Wako Pure Chemical

Industries, Osaka, Japan) in 0.07 ml of water was added. After 120 hours at 25 ° C, the proteins were precipitated by the addition of 4 ml of acetone, isolated by centrifugation and dried in vacuo. The conversion of B (1-29) -A (1-21) to Thr-Ome (B30) human insulin was 75% by HPLC.

DK 157938 B

30

Example 16

Conversion of B (1-29) -Ser-Lys-A (1-21) to Thr-OBut (B30) human insulin 20 mg of B (1-29) -Ser-Lys-A (1-21) was dissolved in 0.1 ml of a mixture of 34.3% acetic acid (v / v) and 42.2% N, N-dimethylformamide (v / v) in water. 0.2 ml of 2 M Thr-OBut was added as hydroacetate salt in N, N, dimethylformamide. The mixture was thermostated at 12 ° C. 2 mg of trypsin was added in 0.05 ml of 0.05 M calcium acetate. After 24 hours at 12 ° C, the proteins were precipitated 10 by the addition of 4 ml of acetone, isolated by centrifugation and dried in vacuo. The conversion of B (1-29) -Ser-Lys-A (1-21) to Thr-OB ^ (B30) human insulin was 85% by HPLC.

Example 17

Conversion of B (1-29) -Ala-Ala-Lys-A (1-21) to Thr-OBut (B30) human insulin 20 mg B (1-29) -Ala-Ala-Lys-A (1-21) ) was dissolved in 0.1 ml of a mixture of 34.3% acetic acid (v / v) and 42.2% N, N dimethylformamide (v / v) in water. 0.2 ml of 2 M Thr-OBu1 'was added as hydroacetate salt in Ν, Ν-dimethylformamide. The mixture was thermostated at 12 ° C. 2 mg of trypsin was added in 0.05 ml of 0.05 M calcium acetate. After 96 hours at 12 ° C, the proteins were precipitated by the addition of 4 ml of acetone, isolated by centrifugation and 25 dried in vacuo. The conversion of B (1-29) -Ala-Ala-Lys-A (1-21) to Τ] ιτ-ΟΒϋ ^ (Β30) human insulin was 84% by HPLC.

Example 18 Preparation of human insulin from various human insulin esters

The human insulin residues in the crude acetone precipitates were purified by gel filtration and anion exchange chromatography as described in Methods in Diabetes Research vol. 1, pp. 407-408 (Eds. J.

35 larner & S. Pohl (John Wiley Sons, New York, 1984)). The method could be used in conjunction with any of the three human insulin esters. The cleavage of the various ester groups, which yielded human insulin yields of almost 100%, was obtained.

DK 157938 B

conducted by hydrolysis of Thr-OMe (B30) human insulin and by acidolysis t with trifluoroacetic acid of Thr (Bu) -OBu (B30) human insulin and of Thr-OBu ^ (B30) human insulin as described in p. 409.

5

Claims (8)

32 DK 157938B 1. DNA sequence for use in a yeast vector, characterized in that it consists of a nucleotide combination encoding an insulin precursor of formula B (l-29) - (Xn-Y) mA (l-21) (I) 10 where Xn is a peptide chain with n naturally occurring amino acid residues, Y is Lys or Arg, n is an integer from 0 to 33, m is 0 B1 or 1, B (1-29) is an abbreviated B chain of human insulin from Phe B2 9 to Lys and A (1-21) is the A chain of human insulin, however, the peptide chain -X -Y- cannot contain two neighboring basic amino acid residues. DNA sequence according to claim 1, characterized in that it consists of a nucleotide combination encoding an insulin precursor of formula B (1-29) -Ala-Ala-Lys-A (1-21) or B (1). -29) -Ser-Lys-A (l-21). A yeast replicable vector, characterized in that it contains a DNA sequence according to claim 1 or 2. A yeast strain for use in the preparation of an insulin precursor, characterized in that it is transformed by a vector according to claim 3. A process for preparing an insulin precursor of the formula B (1-29) - (X -Y) -A (1-21) (I) nm where XR is a peptide chain with n naturally occurring amino acid residues, Y is Lys or Arg, n is an integer from 0 to 33, m is 0 B1 or 1, B (1-29) is a shortened B chain of human insulin from Phe B29 to Lys and A (1-21) is the A chain of human insulin, with the condition that the peptide chain -X -Y- does not contain two adjacent basic amino acid residues, characterized in that a yeast strain according to claim 4 is grown in a suitable nutrient medium followed by recovery of the insulin precursor in a manner known per se. A method according to claim 5 for the preparation of an insulin precursor of formula B (l-29) -A (l-21), known g-10, by using as a yeast strain DSM 2959 or a variant or mutant thereof with essentially the same properties. Process according to claim 5 for the preparation of an insulin precursor of formula B (1-29) -Ala-Ala-Lys-A (1-21), characterized in that DSM 3196 or a variant is used as a yeast strain. or mutant thereof having substantially the same properties. Process for producing human insulin, characterized in that a yeast strain according to claim 4 is grown in a suitable nutrient medium, whereby the expressed insulin precursor is recovered from the culture fluid and converted into human insulin in a manner known per se. 25