DE212015000061U1 - CRISPR-enabled multiplex genome engineering - Google Patents
CRISPR-enabled multiplex genome engineering Download PDFInfo
- Publication number
- DE212015000061U1 DE212015000061U1 DE212015000061.3U DE212015000061U DE212015000061U1 DE 212015000061 U1 DE212015000061 U1 DE 212015000061U1 DE 212015000061 U DE212015000061 U DE 212015000061U DE 212015000061 U1 DE212015000061 U1 DE 212015000061U1
- Authority
- DE
- Germany
- Prior art keywords
- vector
- cells
- mutation
- target region
- population
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1024—In vivo mutagenesis using high mutation rate "mutator" host strains by inserting genetic material, e.g. encoding an error prone polymerase, disrupting a gene for mismatch repair
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1082—Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
- C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/30—Production chemically synthesised
- C12N2330/31—Libraries, arrays
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Computational Biology (AREA)
- Mycology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Saccharide Compounds (AREA)
Abstract
Verwendung eines Vektors, umfassend: (i) mindestens eine Editier-Kassette, umfassend (a) eine Region, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist, (b) eine Mutation mindestens eines Nukleotids relativ zu der Target-Region, und (c) eine erste „Protospacer Adjacent Motif” (PAM) Mutation; (ii) einen Promotor; und (iii) eine Nukleinsäure, die für mindestens eine Guide-RNA (gRNA) codiert, umfassend (a) eine Region, die komplementär zu einem Teil der Target-Region ist; und (b) eine Region, die mit einer Cas9 Nuklease interagiert, zur Herstellung eines Medikaments zum Genom Engineering.Use of a vector comprising: (i) at least one editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region and (c) a first "Protospacer Adjacent Motif" (PAM) mutation; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease to produce a drug for genome engineering.
Description
VERWANDTE ANMELDUNGRELATED APPLICATION
Diese Anmeldung nimmt nach
HINTERGRUND DER ERFINDUNGBACKGROUND OF THE INVENTION
Die rationale Manipulation von großen DNA-Konstrukten ist eine zentrale Herausforderung für die aktuelle synthetische Biologie und Bemühungen des Genom Engineerings. In den letzten Jahren ist eine Vielzahl von Technologien entwickelt worden, um diese Herausforderung zu bewältigen und die Spezifität und Geschwindigkeit zu erhöhen, mit der Mutationen erzeugt werden können. Darüber hinaus sind adaptive Mutationen eine zentrale Triebkraft der Evolution, aber über ihre Häufigkeit und ihren relativen Beitrag zu zellulären Phänotypen ist selbst in den am besten untersuchten Organismen nur wenig bekannt. Dies ist zum Großteil auf die technischen Herausforderungen zurückzuführen, die mit der Beobachtung und Rekonstruktion dieser Genotypen und der Korrelation ihrer Anwesenheit mit dem Phänotyp von Interesse assoziiert sind. Beispielsweise führen Genom Editier-Verfahren, die auf zufällige Mutagenese angewiesen sind, zu komplexen Genotypen, die aus vielen Mutationen bestehen, deren relativer Beitrag schwer aufzuschlüsseln ist. Darüber hinaus ist es aufgrund des Fehlens von Informationen bezüglich der individuellen Mutationen schwierig, die epistatischen Interaktionen zwischen den Allelen zuzuordnen.The rational manipulation of large DNA constructs is a key challenge for the current synthetic biology and genome engineering efforts. In recent years, a variety of technologies have been developed to overcome this challenge and to increase the specificity and speed at which mutations can be generated. In addition, adaptive mutations are a key driver of evolution, but little is known about their abundance and their relative contribution to cellular phenotypes, even in the best-studied organisms. This is largely due to the technical challenges associated with observing and reconstructing these genotypes and correlating their presence with the phenotype of interest. For example, genome editing methods that rely on random mutagenesis result in complex genotypes consisting of many mutations whose relative contribution is difficult to classify. Moreover, due to the lack of information regarding the individual mutations, it is difficult to assign the epistatic interactions between the alleles.
ZUSAMMENFASSUNG DER ERFINDUNGSUMMARY OF THE INVENTION
”Clustered Regularly Interspersed Short Palindromic Repeats” (CRISPR) kommen in vielen bakteriellen Genomen vor und man hat herausgefunden, dass sie eine wichtige Rolle in der adaptiven bakteriellen Immunität spielen. Transkription dieser Arrays führt zu CRISPR-RNAs, die für die Gen-Repression oder DNA-Spaltung die sequenz-spezifische Bindung der CRISPR/cas-Komplexe zu DNA-Targets in Zellen dirigieren. Die Spezifität dieser Komplexe ermöglicht neuartige in vivo Anwendungen für Stamm-Engineering."Clustered Regularly Interspersed Short Palindromic Repeats" (CRISPR) are found in many bacterial genomes and have been found to play an important role in adaptive bacterial immunity. Transcription of these arrays results in CRISPR RNAs that direct sequence-specific binding of the CRISPR / cas complexes to DNA targets in cells for gene repression or DNA cleavage. The specificity of these complexes allows novel in vivo applications for strain engineering.
Hierin werden Verfahren zur rationalen multiplex Manipulation von Chromosomen innerhalb der offenen Leserahmen (z. B. zur Erzeugung von Protein-Bibliotheken) oder innerhalb mehrerer Gene in einem beliebigen Segment eines Chromosoms beschrieben, in denen verschiedene CRISPR-Systeme verwendet werden. Diese Verfahren stellen ein effizienteres kombinatorisches Genom Engineering als die bisher beschriebenen zur Verfügung.Described herein are methods for rational multiplex manipulation of chromosomes within open reading frames (eg, to generate protein libraries) or within multiple genes in any segment of a chromosome using different CRISPR systems. These methods provide more efficient combinatorial genome engineering than previously described.
Die Erweiterung der Multiplexing-Fähigkeiten von CRISPR stellt eine aktuelle technologische Herausforderung dar und würde die Verwendung dieser Systeme zum Erzeugen rationaler Bibliotheken im Hochdurchsatzformat ermöglichen. Solche Fortschritte weisen weitreichende Auswirkungen auf die Felder des metabolischen und Protein-Engineerings auf, die die Überarbeitung komplexer genetischer Netzwerke für eine optimale Produktion anstreben.Expanding the multiplexing capabilities of CRISPR represents a current technological challenge and would allow the use of these systems to generate high-throughput rational libraries. Such advances have far-reaching implications for the fields of metabolic and protein engineering that are seeking to revise complex genetic networks for optimal production.
Die Verfahren umfassen Einführen von Bestandteilen des CRISPR-Systems, umfassend die CRISPR-assoziierte Nuklease Cas9 und eine sequenz-spezifische Guide-RNA (gRNA), in Zellen, was zu sequenz-gerichteten Doppelstrangbrüchen unter Verwendung der Fähigkeit des CRISPR-Systems solche Brüche zu induzieren, führt. Die Bestandteile des CRISPR-Systems, umfassend die CRISPR-assoziierte Nuklease Cas9 und eine sequenz-spezifische Guide-RNA (gRNA), können codiert auf einem oder mehreren Vektoren, wie beispielsweise einem Plasmid, in die Zellen eingeführt werden. DNA-Rekombineering-Kassetten oder Editier-Oligonukleotide können rational entworfen werden, so dass sie eine gewünschte Mutation innerhalb des Target-Locus und eine Mutation an einem gemeinsamen Ort außerhalb des Target-Locus enthalten, die von dem CRISPR-System erkannt werden können. Die beschriebenen Verfahren können für viele Anwendungen verwendet werden, umfassend Ändern eines Wegs von Interesse.The methods include introducing into CRISPR system components comprising the CRISPR-associated nuclease Cas9 and a sequence-specific guide RNA (gRNA) into cells, resulting in sequence-directed double-strand breaks using the capability of the CRISPR system such breaks induce leads. The components of the CRISPR system, comprising the CRISPR-associated nuclease Cas9 and a sequence-specific guide RNA (gRNA), can be introduced into cells encoded on one or more vectors, such as a plasmid. DNA recombination cassettes or editing oligonucleotides can be rationally designed to contain a desired mutation within the target locus and a mutation at a common location outside the target locus that can be recognized by the CRISPR system. The described methods can be used for many applications, including changing a path of interest.
In einer Ausführungsform ist das Verfahren ein Verfahren zum Genom Engineering, umfassend: (a) Einführen eines Vektors in Zellen, wobei der Vektor codiert: (i) eine Editier-Kassette, die eine Region beinhaltet, die homolog zu der Target-Region der Nukleinsäure in der Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids relativ zu der Target-Region, wie beispielsweise eine Mutation mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region, und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet; (ii) einen Promoter; und (iii) mindestens eine Guide-RNA (gRNA), wobei die gRNA umfasst: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert, wodurch Zellen hergestellt werden, die den Vektor umfassen; (b) Aufrechterhalten der Zellen, die den Vektor umfassen, unter Bedingungen, unter denen Cas9 exprimiert wird, wobei die Cas9 Nuklease auf dem Vektor codiert wird, auf einem zweiten Vektor codiert wird oder in dem Genom der Zellen codiert wird, was zur Herstellung von Zellen führt, die den Vektor umfassen und die PAM-Mutation nicht umfassen und Zellen die den Vektor und die PAM-Mutation umfassen; (c) Kultivieren des Produkts von (b) unter Bedingungen, die für die Lebensfähigkeit der Zelle geeignet sind, wodurch lebensfähige Zellen hergestellt werden; (d) Erhalten von lebensfähigen Zellen, die in (c) hergestellt wurden; und (e) Sequenzieren des Editier-Oligonukleotids des Vektors von mindestens einer lebensfähigen Zelle, die in (d) erhalten wurde und Identifizieren der Mutation mindestens eines Codons.In one embodiment, the method is a method of genome engineering, comprising: (a) introducing a vector into cells, wherein the vector encodes: (i) an editing cassette containing a region homologous to the target region of the nucleic acid in the cell and a mutation (referred to as a desired mutation) of at least one nucleotide relative to the target region, such as a mutation of at least one nucleotide in at least one codon relative to the target region, and a protospacer adj. PAM) mutation includes; (ii) a promoter; and (iii) at least one guide RNA (gRNA), wherein the gRNA comprises: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease, thereby producing cells comprising the vector; (b) maintaining the cells comprising the vector under conditions under which Cas9 is expressed, wherein the Cas9 nuclease is encoded on the vector, encoded on a second vector or encoded in the genome of the cells resulting in the production of Leading cells comprising the vector and not comprising the PAM mutation and cells comprising the vector and the PAM mutation; (c) cultivating the product of (b) under conditions suitable for the viability of the cell, thereby producing viable cells; (D) Obtaining Viable Cells Produced in (c); and (e) sequencing the editing oligonucleotide of the vector from at least one viable cell obtained in (d) and identifying the mutation of at least one codon.
In einer anderen Ausführungsform ist das Verfahren ein Verfahren zum Genom Engineering durch mit verfolgbarem CRISPR angereichertes Recombineering (engl. trackable CRISPR enriched recombineering), umfassend: (a) Einführen eines Vektors in eine erste Population von Zellen, wobei der Vektor codiert: (i) mindestens eine Editier-Kassette, die umfasst: (a) eine Region, die homolog zu einer Target-Region einer Nukleinsäure ist und eine Mutation mindestens eines Nukleotids relativ zu der Target-Region, wie beispielsweise eine Mutation mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region, und (b) eine „Protospacer Adjacent Motif” (PAM) Mutation umfasst; (ii) mindestens einen Promoter; und (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert, wodurch eine zweite Population von Zellen hergestellt wird, die den Vektor umfasst; (b) Aufrechterhalten der zweiten Population von Zellen unter Bedingungen, unter denen die Cas9 Nuklease exprimiert wird, wobei die Cas9 Nuklease auf dem Vektor codiert wird, auf einem zweiten Vektor oder in dem Genom der Zellen codiert wird, was zur DNA-Spaltung in den Zellen, die die PAM-Mutation nicht umfassen, und zum Tod solcher Zellen führt; (c) Erhalten von lebensfähigen Zellen, die in (b) hergestellt wurden; und (d) Identifizieren der Mutation mindestens eines Codons durch Sequenzieren des Editier-Oligonukleotids des Vektors von mindestens einer Zelle der zweiten Population von Zellen.In another embodiment, the method is a method of genome engineering by trackable CRISPR-enriched recombinant engineering, comprising: (a) introducing a vector into a first population of cells, wherein the vector encodes: (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and a mutation of at least one nucleotide relative to the target region, such as a mutation of at least one nucleotide in at least one codon relative to the target region, and (b) a Protospacer Adjacent Motif (PAM) mutation; (ii) at least one promoter; and (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease, thereby producing a second population of cells comprising the vector; (b) maintaining the second population of cells under conditions in which the Cas9 nuclease is expressed, encoding the Cas9 nuclease on the vector, encoding on a second vector or in the genome of the cells, resulting in DNA cleavage into the cells Cells that do not involve the PAM mutation and cause the death of such cells; (c) obtaining viable cells produced in (b); and (d) identifying the mutation of at least one codon by sequencing the editing oligonucleotide of the vector from at least one cell of the second population of cells.
Jede der obigen Ausführungsformen kann weiter Synthetisieren und/oder Erhalten einer Population von Editier-Oligonukleotiden umfassen. Jede Ausführungsform kann weiter Amplifizieren der Population von Editier-Oligonukleotiden umfassen. In jeder der Ausführungsformen kann der Vektor weiter einen Spacer, mindestens zwei Priming-Stellen oder sowohl einen Spacer als auch mindestens zwei Priming-Stellen umfassen. In einigen Ausführungsformen umfasst die Editier-Kassette eine Target-Region, die eine Mutation mindestens eines Codons innerhalb von 100 Nukleotiden von der PAM-Mutation umfasst.Each of the above embodiments may further comprise synthesizing and / or obtaining a population of editing oligonucleotides. Each embodiment may further comprise amplifying the population of editing oligonucleotides. In any of the embodiments, the vector may further comprise a spacer, at least two priming sites, or both a spacer and at least two priming sites. In some embodiments, the editing cassette comprises a target region comprising a mutation of at least one codon within 100 nucleotides of the PAM mutation.
Ebenfalls beschrieben ist ein Vektor, umfassend:
- (i) eine Editier-Kassette, die eine Region umfasst, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids relativ zu der Target-Region, und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
- (ii) einen Promoter; und
- (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.
- (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide relative to the target region, and a protospacer Adjacent Motif "(PAM) mutation includes;
- (ii) a promoter; and
- (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.
Eine weitere Ausführungsform ist ein Vektor, umfassend:
- (i) eine Editier-Kassette, die eine Region beinhaltet, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
- (ii) einen Promoter; und
- (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.
- (i) an editing cassette containing a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide in at least one codon relative to the target region and includes a "Protospacer Adjacent Motif" (PAM) mutation;
- (ii) a promoter; and
- (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.
Eine weitere Ausführungsform ist ein Vektor, umfassend:
- (i) mindestens eine Editier-Kassette umfassend: (a) eine Region, die homolog zu einer Target-Region einer Nukleinsäure ist und eine Mutation mindestens eines Nukleotids relativ zu der Target-Region und (b) eine „Protospacer Adjacent Motif” (PAM) Mutation umfasst;
- (ii) mindestens einen Promoter; und
- (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.
- (i) at least one editing cartridge comprising: (a) a region homologous to a target region of a nucleic acid and a mutation of at least one nucleotide relative to the target region; and (b) a protospacer adj. motif (PAM ) Mutation;
- (ii) at least one promoter; and
- (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.
Eine weitere Ausführungsform des Vektors ist ein Vektor, umfassend:
- (i) eine Editier-Kassette, umfassend: (a) eine Region, die homolog zu einer Target-Region einer Nukleinsäure ist und eine Mutation mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region und (b) eine „Protospacer Adjacent Motif” (PAM) Mutation umfasst;
- (ii) mindestens einen Promoter; und
- (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.
- (i) an editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and a mutation of at least one nucleotide in at least one codon relative to the target region and (b) a protospacer adj Motif "(PAM) mutation comprises;
- (ii) at least one promoter; and
- (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.
In jeder der Ausführungsformen kann der Vektor weiter einen Spacer; mindestens zwei Priming-Stellen; oder einen Spacer und mindestens zwei Priming-Stellen umfassen. In diesen Vektoren, in denen die Mutation mindestens eines Nukleotids in mindestens einem Codon ist, kann sich die Editier-Kassette beispielsweise innerhalb von 100 Nukleotiden von der PAM-Mutation befinden.In any of the embodiments, the vector may further comprise a spacer; at least two priming sites; or a spacer and at least two priming sites. For example, in these vectors where the mutation is at least one nucleotide in at least one codon, the editing cassette may be within 100 nucleotides of the PAM mutation.
Ebenfalls beschrieben ist eine Bibliothek, umfassend eine Population von Zellen, die durch die hierin beschriebenen Verfahren hergestellt wurde. Eine Bibliothek von einer Population von Zellen kann Zellen mit jedem der hierin beschriebenen Vektoren umfassen. Beispielsweise kann eine Population von Zellen einen Vektor umfassen, wobei der Vektor umfasst:
- (i) eine Editier-Kassette, die eine Region beinhaltet, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids relativ zu der Target-Region und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
- (ii) einen Promoter; und
- (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.
- (i) an editing cassette containing a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide relative to the target region and a protospacer adj Motif "(PAM) mutation includes;
- (ii) a promoter; and
- (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.
In einer weiteren Ausführungsform kann eine Population von Zellen einen Vektor umfassen, wobei der Vektor umfasst:
- (i) eine Editier-Kassette, die eine Region beinhaltet, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region, und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
- (ii) einen Promoter; und
- (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.
- (i) an editing cassette containing a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide in at least one codon relative to the target region, and a "Protospacer Adjacent Motif" (PAM) mutation;
- (ii) a promoter; and
- (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.
In einer weiteren Ausführungsform ist das Verfahren ein Verfahren für CRISPR-unterstütztes rationales Protein-Engineering (kombinatorisches Genom Engineering), umfassend:
- (a) Konstruieren einer Donor-Bibliothek, die rekombinante DNA umfasst, wie beispielsweise rekombinante Chromosomen oder rekombinante DNA in Plasmiden, durch Einführen beispielsweise durch Co-Transformation, in eine Population von ersten Zellen (i) eines oder mehrerer Editier-Oligonukleotide, wie beispielsweise rational entworfene Oligonukleotide, die die Deletion eines ersten einzelnen „Protospacer Adjacent Motif” Motivs (PAM) mit einer Mutation mindestens eines Codons in einem zu dem PAM benachbarten Gen (das benachbarte Gen) koppeln und (b) eine Guide-RNA (gRNA), die eine Nukleotid-Sequenz 5' von dem offenen Leserahmen eines Chromosoms anzielt, wodurch eine Donor-Bibliothek hergestellt wird, die eine Population von ersten Zellen umfasst, die rekombinante Chromosomen mit gezielten Codon Mutationen umfasst;
- (b) Amplifizieren der in (a) konstruierten Donor-Bibliothek, beispielsweise durch PCR-Amplifikation rekombinanter Chromosome, die ein synthetisches Merkmal der Editier-Oligonukleotide verwenden und gleichzeitig eine zweite PAM-Deletion (Ziel-PAM-Deletion) an dem 3'-Terminus des Gens einbauen, wodurch die gezielten Codon-Mutationen direkt mit der Ziel-PAM-Deletion gekoppelt werden, beispielsweise durch kovalentes Koppeln, und wodurch eine wiedergewonnene Donor-Bibliothek hergestellt wird, die die Ziel-PAM-Deletion und die gezielten Codon-Mutationen trägt; und
- (c) Einführen (z. B. Co-Transformieren) der Donor-Bibliothek, die die Ziel-PAM-Deletion und die gezielten Codon-Mutationen trägt und einem Ziel-gRNA-Plasmid in eine Population von zweiten Zellen, die typischerweise eine Population von naiven Zellen ist, wodurch eine Ziel-Bibliothek hergestellt wird, die die gezielten Codon-Mutationen umfasst.
- (a) constructing a donor library comprising recombinant DNA, such as recombinant chromosomes or recombinant DNA in plasmids, by introducing, for example, by co-transformation, into a population of first cells (i) of one or more editing oligonucleotides, such as rationally designed oligonucleotides coupling the deletion of a first single protospacer adjacent motif (PAM) with a mutation of at least one codon in a gene adjacent to the PAM (the adjacent gene) and (b) a guide RNA (gRNA), targeting a nucleotide sequence 5 'to the open reading frame of a chromosome, thereby producing a donor library comprising a population of first cells comprising recombinant chromosomes with targeted codon mutations;
- (b) amplifying the donor library constructed in (a), for example by PCR amplification of recombinant chromosomes using a synthetic feature of the editing oligonucleotides and simultaneously a second PAM deletion (target PAM deletion) on the 3 ' Terminus of the gene, whereby the targeted codon mutations are coupled directly to the target PAM deletion, for example by covalent coupling, and whereby a recovered donor library is prepared, the target PAM deletion and the targeted codon mutations wearing; and
- (c) introducing (e.g., co-transforming) the donor library carrying the target PAM deletion and directed codon mutations and a target gRNA plasmid into a population of second cells, typically a population of naive cells, thus producing a target library comprising the targeted codon mutations.
Die Population der ersten Zellen und die Population der zweiten Zellen (z. B. Eine Population von naiven Zellen) sind typischerweise eine Population, in denen die Zellen alle von dem gleichen Typ sind und die prokaryotisch oder eukaryotisch sein können, wie beispielsweise, aber nicht beschränkt auf Bakterien, Säugerzellen, Pflanzenzellen, Insektenzellen.The population of the first cells and the population of the second cells (e.g., a population of naive cells) are typically a population in which the cells are all of the same type and may be prokaryotic or eukaryotic, such as, but not limited to limited to bacteria, mammalian cells, plant cells, insect cells.
In einigen Ausführungsformen umfasst das Verfahren weiter Aufrechterhalten der Ziel-Bibliothek unter Bedingungen, unter denen Protein hergestellt wird.In some embodiments, the method further comprises maintaining the target library under conditions under which protein is produced.
In einigen Ausführungsformen exprimiert die erste Zelle ein Polypeptid mit Cas9-Nukleaseaktivität. In einigen Ausführungsformen wird das Polypeptid mit Cas9-Nukleaseaktivität unter Kontrolle eines induzierbaren Promoters exprimiert.In some embodiments, the first cell expresses a polypeptide having Cas9 nuclease activity. In some embodiments, the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.
In einigen Ausführungsformen sind die Editier-Oligonukleotide komplementär zu einer (einer, einer oder mehreren, mindestens einer) Target-Nukleinsäure, die in der ersten Zelle vorliegt. In einigen Ausführungsformen zielen die Editier-Oligonukleotide mehr als eine Target-Stelle oder -Locus in der ersten Zelle an. In einigen Ausführungsformen umfasst die Nukleinsäuresequenz der Editier-Oligonukleotide [gewünschtes Codon] eine oder mehrere Substitutionen, Deletionen, Insertionen oder jegliche Kombinationen von Substitutionen, Deletionen und Insertionen relativ zu der Target-Nukleinsäure. In einigen Ausführungsformen werden die Editier-Oligonukleotide rational entworfen; in weiteren Ausführungsformen werden sie durch zufällige Mutagenese oder unter Verwendung degenerierter Primer-Oligonukleotide hergestellt. In einigen Ausführungsformen stammen die Editier-Oligonukleotide aus einer Sammlung von Nukleinsäuren (Bibliothek).In some embodiments, the editing oligonucleotides are complementary to one (one, one or more, at least one) target nucleic acid present in the first cell. In some embodiments, the editing oligonucleotides target more than one target site or locus in the first cell. In some embodiments, the nucleic acid sequence of the editing oligonucleotides [desired codon] comprises one or more substitutions, deletions, insertions, or any combination of substitutions, deletions, and insertions relative to the target nucleic acid. In some embodiments, the editing oligonucleotides are designed rationally; in other embodiments, they are prepared by random mutagenesis or using degenerate primer oligonucleotides. In some embodiments, the editing oligonucleotides are from a collection of nucleic acids (library).
In einigen Ausführungsformen wird die gRNA auf einem Plasmid codiert. In einigen Ausführungsformen werden das Editier-Oligonukleotid und die gRNA durch Transformation in die erste Zelle eingeführt, beispielsweise durch Co-Transformation des Editier-Oligonukleotids und der Guide(g)-RNA. In einigen Ausführungsformen werden das Editier-Oligonukleotid und die gRNA sequenziell in die erste Zelle eingeführt. In anderen Ausführungsformen werden das Editier-Oligonukleotid und die gRNA gleichzeitig in die erste Zelle eingeführt. In some embodiments, the gRNA is encoded on a plasmid. In some embodiments, the editing oligonucleotide and the gRNA are introduced by transformation into the first cell, for example by co-transformation of the editing oligonucleotide and the guide (g) RNA. In some embodiments, the editing oligonucleotide and the gRNA are introduced sequentially into the first cell. In other embodiments, the editing oligonucleotide and the gRNA are introduced simultaneously into the first cell.
In einigen Ausführungsformen umfasst Wiedergewinnen der Donor-Bibliothek weiter (a) Screening der Zellen auf Einbau der Editier-Oligonukleotide und (b) Selektieren der Zellen, bei denen bestätigt wurde, dass sie das Editier-Oligonukleotid eingebaut haben. In einigen Ausführungsformen umfasst Wiedergewinnen der Donor-Bibliothek weiter Bearbeitung der wiedergewonnenen Donor-Bibliothek.In some embodiments, recovering the donor library further comprises (a) screening the cells for incorporation of the editing oligonucleotides and (b) selecting the cells that have been confirmed to have incorporated the editing oligonucleotide. In some embodiments, recovering the donor library further involves processing the recovered donor library.
In einigen Ausführungsformen exprimiert die Zielzelle/naive Zelle ein Polypeptid mit Cas9-Nukleaseaktivität. In einigen Ausführungsformen wird das Polypeptid mit Cas9-Nukleaseaktivität unter Kontrolle eines induzierbaren Promotors exprimiert.In some embodiments, the target cell / naive cell expresses a polypeptide having Cas9 nuclease activity. In some embodiments, the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.
Ebenfalls beschrieben ist ein Verfahren für CRISPR-unterstütztes rationales Protein-Engineering, umfassend:
- (a) Einführen (z. B., Co-Transformieren) von (i) synthetischen dsDNA Editier-Kassetten, die Editier-Oligonukleotide umfassen und (ii) einem Vektor, der eine Guide-RNA (gRNA) exprimiert, die die genomische Sequenz direkt stromaufwärts von einem Gen von Interesse in einer Population von ersten Zellen anzielt, unter Bedingungen, unter denen Multiplex Recombineering und selektive Anreicherung der Editier-Oligonukleotide durch gRNA auftritt, wodurch eine Donor-Bibliothek hergestellt wird;
- (b) Amplifizieren der Donor-Bibliothek mit einem Oligonukleotid, dass ein „Protospacer Adjacent Motif” (PAM) Motiv deletiert, das zu dem 3'-Ende des Gens von Interesse benachbart ist (Ziel-PAM), wodurch eine amplifizierte Donor-Bibliothek hergestellt wird, die dsDNA Editier-Kassetten, von denen aus die Ziel-PAM deletiert worden ist (mit einer 3' PAM-Deletion), rationale Codon-Mutationen, und eine P1-Stelle umfasst; und
- (c) Bearbeiten der amplifizierten Donor-Bibliothek mit einem Enzym, wie beispielsweise einem Restriktionsenzym (z. B. BsaI), um die P1-Stelle zu entfernen; und
- (d) Co-Transformieren einer Population von naiven Zellen mit der in (c) bearbeiteten amplifizierten Donor-Bibliothek und der Ziel-gRNA, wodurch eine Population von co-transformierten Zellen hergestellt wird, die dsDNA-Editier-Kassetten, von denen aus die Ziel-PAM deletiert worden ist (mit einer 3' PAM-Deletion), rationale Codon-Mutationen, und die Ziel-gRNA umfassen.
- (a) introducing (e.g., co-transforming) (i) synthetic dsDNA editing cassettes comprising editing oligonucleotides and (ii) a vector expressing a guide RNA (gRNA) encoding the genomic sequence directly upstream of a gene of interest in a population of first cells, under conditions where multiplex recombineering and selective enrichment of the editing oligonucleotides by gRNA occurs, thereby producing a donor library;
- (b) amplifying the donor library with an oligonucleotide that deletes a "Protospacer Adjacent Motif" (PAM) motif adjacent to the 3 'end of the gene of interest (target PAM), yielding an amplified donor library the dsDNA editing cassettes from which the target PAM has been deleted (with a 3 'PAM deletion), rational codon mutations, and a P1 site; and
- (c) working the amplified donor library with an enzyme, such as a restriction enzyme (e.g., Bsa I) to remove the P1 site; and
- (d) co-transforming a population of naive cells with the amplified donor library processed in (c) and the target gRNA, thereby producing a population of co-transformed cells, the dsDNA editing cassettes, of which the Target PAM has been deleted (with a 3 'PAM deletion), rational codon mutations, and include the target gRNA.
In allen beschriebenen Ausführungsformen kann eine Mutation von jedem gewünschten Typ sein, wie beispielsweise eine oder mehrere Insertionen, Deletionen, Substitutionen oder jegliche Kombinationen von zwei oder drei der zuvor genannten (z. B. Insertion und Deletion; Insertion und Substitution; Deletion und Substitution; Substitution und Insertion; Insertion, Deletion und Substitution). Insertionen, Deletionen und Substitutionen können eine beliebige Zahl von Nukleotiden betreffen. Sie können sich in Codons (codierenden Regionen) und/oder in nicht-codierenden Regionen befinden.In all embodiments described, a mutation may be of any desired type, such as one or more insertions, deletions, substitutions, or any combination of two or three of the foregoing (e.g., insertion and deletion; insertion and substitution; deletion and substitution; Substitution and insertion; insertion, deletion and substitution). Insertions, deletions and substitutions may involve any number of nucleotides. They can be in codons (coding regions) and / or in non-coding regions.
KURZE BESCHREIBUNG DER FIGURENBRIEF DESCRIPTION OF THE FIGURES
DETAILLIERTE BESCHREIBUNG DER ERFINDUNG DETAILED DESCRIPTION OF THE INVENTION
Bakterien und Archaea CRISPR-Systeme haben sich als leistungsfähige Werkzeuge für präzises Genom Editieren herausgestellt. Das Typ-II CRISPR-System von Streptococcus pyogenes (S. pyogenes) ist in vitro besonders gut charakterisiert worden, und es sind einfache Design-Regeln zum Umprogrammieren von dessen doppelsträngiger DNA(dsDNA)-Bindungsaktivität aufgestellt worden (
Hierin werden Verfahren zum Genom Editieren beschrieben, die eine Endonuklease einsetzen, wie beispielsweise die Cas9 Nuklease, die durch ein cas9 Gen codiert wird, um direkte Genom-Evolution durchzuführen/Änderungen (Deletionen, Substitutionen, Additionen) in der DNA, wie beispielsweise genomischer DNA zu erzeugen. Das cas9 Gen kann aus jeder beliebigen Quelle erhalten werden, wie beispielsweise aus einem Bakterium, wie beispielsweise dem Bakterium S. pyogenes. Die Nukleinsäuresequenz von cas9 und/oder Aminosäuresequenz von Cas9 kann relativ zu der Sequenz eines natürlich vorkommenden cas9 und/oder Cas9 mutiert sein; Mutationen können beispielsweise ein oder mehrere Insertionen, Deletionen, Substitutionen oder jegliche Kombinationen von zwei oder mehr der zuvor genannten sein. In solchen Ausführungsformen kann das resultierende mutierte Cas9 eine erhöhte oder verminderte Nukleaseaktivität relativ zu dem natürlich vorkommenden Cas9 aufweisen.Herein described are methods for genome editing employing an endonuclease, such as the Cas9 nuclease encoded by a cas9 gene to perform direct genome evolution / changes (deletions, substitutions, additions) in the DNA, such as genomic DNA to create. The cas9 gene can be obtained from any source, such as a bacterium, such as the bacterium S. pyogenes. The nucleic acid sequence of cas9 and / or amino acid sequence of Cas9 may be mutated relative to the sequence of a naturally occurring cas9 and / or Cas9; For example, mutations may be one or more insertions, deletions, substitutions, or any combination of two or more of the foregoing. In such embodiments, the resulting mutant Cas9 may have increased or decreased nuclease activity relative to the naturally occurring Cas9.
Die
In dem CRISPR-System lenken die CRISPR trans-aktivierende (tracrRNA) und die Spacer-RNA (crRNA) die Auswahl einer Target-Region. Wie hierin verwendet, bezieht sich eine Target-Region auf jeden Locus in der Nukleinsäure einer Zelle oder einer Population von Zellen, in denen mindestens eine Mutation mindestens eines Nukleotids, wie beispielsweise eine Mutation mindestens eines Nukleotids in mindestens einem Codon (einem oder mehreren Codons) gewünscht wird. Die Target-Region kann beispielsweise ein genomischer Locus (genomische Target-Sequenz) oder ein extra-chromosomaler Locus sein. Die tracrRNA und crRNA können als ein einzelnes, chimäres RNA-Molekül exprimiert werden, das als eine Einzel-Guide-RNA, Guide-RNA oder gRNA bezeichnet wird. Die Nukleinsäuresequenz der gRNA umfasst eine erste Nukleinsäuresequenz, die auch als eine erste Region bezeichnet wird, die komplementär zu einer Region der Target-Region ist und eine zweite Nukleinsäuresequenz, die auch als eine zweite Region bezeichnet wird, die eine Haarnadelstruktur (engl: stem loop structure) bildet und zur Rekrutierung von Cas9 zu der Target-Region dient. In einigen Ausführungsformen ist die erste Region der gRNA komplementär zu einer Region, die sich stromaufwärts der genomischen Target-Sequenz befindet. In einigen Ausführungsformen ist die erste Region der gRNA komplementär zu mindestens einem Teil der Target-Region. Die erste Region der gRNA kann vollständig komplementär (100% komplementär) zu der genomischen Target-Sequenz sein oder eine oder mehrere Fehlpaarungen beinhalten, vorausgesetzt, dass sie ausreichend komplementär zu der genomischen Target-Sequenz ist, um Cas9 spezifisch zu hybridisieren/zu lenken und zu rekrutieren. In einigen Ausführungsformen ist die erste Region der gRNA mindestens 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, oder mindestens 30 Nukleotide lang. In einigen Ausführungsformen ist die erste Region der gRNA mindestens 20 Nukleotide lang. In einigen Ausführungsformen ist die Haarnadelstruktur, die durch die zweite Nukleinsäuresequenz gebildet wird, mindestens 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, oder 100 Nukleotide lang. In spezifischen Ausführungsformen ist die Haarnadelstruktur zwischen 80 bis 90 oder 82 bis 85 Nukleotide lang, und in weiteren spezifischen Ausführungsformen ist die zweite Region der gRNA, die eine Haarnadelstruktur bildet, 83 Nukleotide lang.In the CRISPR system, the CRISPR trans-activating (tracrRNA) and the spacer RNA (crRNA) direct selection of a target region. As used herein, a target region refers to any locus in the nucleic acid of a cell or population of cells in which at least one mutation of at least one nucleotide, such as a mutation of at least one nucleotide in at least one codon (one or more codons) it is asked for. The target region may be, for example, a genomic locus (genomic target sequence) or an extra-chromosomal locus. The tracrRNA and crRNA can be expressed as a single, chimeric RNA molecule, termed a single-guide RNA, guide RNA or gRNA. The nucleic acid sequence of the gRNA comprises a first Nucleic acid sequence, which is also referred to as a first region that is complementary to a region of the target region, and a second nucleic acid sequence, which is also referred to as a second region, which forms a hairpin structure and for the recruitment of Cas9 serves to the target region. In some embodiments, the first region of the gRNA is complementary to a region located upstream of the target genomic sequence. In some embodiments, the first region of the gRNA is complementary to at least a portion of the target region. The first region of the gRNA may be fully complementary (100% complementary) to the genomic target sequence or may include one or more mismatches, provided that it is sufficiently complementary to the target genomic sequence to specifically hybridize / direct Cas9 and to recruit. In some embodiments, the first region of the gRNA is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or at least 30 nucleotides long. In some embodiments, the first region of the gRNA is at least 20 nucleotides in length. In some embodiments, the hairpin structure formed by the second nucleic acid sequence is at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides long. In specific embodiments, the hairpin structure is between 80 to 90 or 82 to 85 nucleotides in length, and in other specific embodiments, the second region of the gRNA that forms a hairpin structure is 83 nucleotides in length.
In einigen Ausführungsformen ist die Sequenz der gRNA (von der Donor-Bibliothek), die unter Verwendung des CARPE-Verfahrens in die erste Zelle eingeführt wird, die gleiche, wie die Sequenz der gRNA (von der Ziel-Bibliothek), die in die zweite/naive Zelle eingeführt wird. In einigen Ausführungsformen wird mehr als eine gRNA in die Population der ersten Zellen und/oder der Population der zweiten Zellen eingeführt. In einigen Ausführungsformen umfasst das mehr als eine gRNA-Molekül eine erste Nukleinsäuresequenz, die komplementär zu mehr als einer Target-Region ist.In some embodiments, the sequence of the gRNA (from the donor library) introduced into the first cell using the CARPE method is the same as the sequence of the gRNA (from the target library) into the second / naive cell is introduced. In some embodiments, more than one gRNA is introduced into the population of the first cells and / or the second cell population. In some embodiments, the more than one gRNA molecule comprises a first nucleic acid sequence that is complementary to more than one target region.
In dem CARPE Verfahren können Doppelstrang-DNA-Kassetten, die auch als Editier-Oligonukleotide bezeichnet werden, zur Verwendung in den beschriebenen Verfahren aus vielen Quellen erhalten werden oder daraus abstammen. Beispielsweise stammen die dsDNA-Kassetten in einigen Ausführungsformen von einer Nukleinsäure-Bibliothek, die durch nicht-homologe zufällige Rekombination (engl. non-homologous random recombination, NRR) diversifiziert wurde; solch eine Bibliothek wird als eine NRR-Bibliothek bezeichnet. In einigen Ausführungsformen werden die Editier-Oligonukleotide synthetisiert, beispielsweise durch Array-basierte Synthese. Die Länge der Editier-Oligonukleotide kann von dem Verfahren abhängen, das zur Gewinnung der Editier-Oligonukleotide verwendet wird. In einigen Ausführungsformen ist das Editier-Oligonukleotid ungefähr 500–200 Nukleotide, 75–150 Nukleotide, oder zwischen 80–120 Nukleotide lang.In the CARPE method, double-stranded DNA cassettes, also referred to as editing oligonucleotides, for use in the described methods can be obtained from or derived from many sources. For example, in some embodiments, the dsDNA cassettes are derived from a nucleic acid library that has been diversified by non-homologous random recombination (NRR); such a library is referred to as an NRR library. In some embodiments, the editing oligonucleotides are synthesized, for example, by array-based synthesis. The length of the editing oligonucleotides may depend on the method used to obtain the editing oligonucleotides. In some embodiments, the editing oligonucleotide is about 500-200 nucleotides, 75-150 nucleotides, or between 80-120 nucleotides in length.
Ein Editier-Oligonukleotid beinhaltet (a) eine Region, die homolog zu einer Target-Region der Nukleinsäure der Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Codons relativ zu der Target-Region, und (b) eine ”Protospacer Adjacent Motif” (PAM) Mutation beinhaltet. Die PAM-Mutation kann jede Insertion, Deletion oder Substitution eines oder mehrerer Nukleotiden sein, die die Sequenz des PAM mutieren, so dass es nicht mehr von dem CRISPR-System erkannt wird. Eine Zelle, die eine PAM-Mutation umfasst kann als „immun” gegenüber CRISPR-vermittelter Tötung bezeichnet werden. Die gewünschte Mutation relativ zu der Sequenz der Target-Region kann eine Insertion, Deletion und/oder Substitution eines oder mehrerer Nukleotiden an mindestens einem Codon der Target-Region sein.An editing oligonucleotide includes (a) a region homologous to a target region of the nucleic acid of the cell and a mutation (referred to as a desired mutation) of at least one codon relative to the target region, and (b) a protospacer Adjacent Motif "(PAM) mutation. The PAM mutation may be any insertion, deletion or substitution of one or more nucleotides that mutate the sequence of the PAM so that it is no longer recognized by the CRISPR system. A cell comprising a PAM mutation may be termed "immune" to CRISPR-mediated killing. The desired mutation relative to the sequence of the target region may be an insertion, deletion and / or substitution of one or more nucleotides on at least one codon of the target region.
Das CARPE-Verfahren wird nachfolgend nur zum Zweck der Veranschaulichung in Bezug auf ein bakterielles Gen beschrieben. Diese Verfahren können auf jedes Gen(e) von Interesse angewendet werden, umfassend Gene von jedem Prokaryoten, umfassend Bakterien und Archaea, oder jedem Eukaryonten, umfassend Hefe und Säuger (umfassend humane) Gene. Das CARPE-Verfahren wurde auf dem galK Gen in dem E. coli Genom durchgeführt, teilweise aufgrund der Verfügbarkeit von Aktivitätstests für dieses Gen. Das Verfahren wurde unter Verwendung der BW23115 Elternstämme und des pSIM5-Vektors (
Es wurde ein Vergleich mit anderen kürzlich-veröffentlichten Protokollen für co-selektierbares Editieren durchgeführt, die alternative Protokolle verwenden, die die PAM- und Codon-Mutationen nicht-kovalent verknüpfen, sondern sich stattdessen auf deren Nähe zueinander während der Replikation verlassen (
Die Fähigkeit, die endgültigen Editier-Effizienzen des CARPE-Verfahrens zu verbessern, können beispielsweise beurteilt werden durch Durchführen der Donor-Konstruktion in mutS-defizienten Stämmen, bevor sie in einen Wildtyp Donor-Stamm transferiert werden, in dem Bemühen den Verlust der Mutationen während der Donor-Konstruktionsphase zu verhindern. Zusätzlich kann die Allgemeingültigkeit des CARPE-Verfahrens beispielsweise durch Anwenden von CARPE auf eine Reihe von essenziellen Genen, umfassend dxs, metA, und folA, beurteilt werden. Essenzielle Gene sind unter Verwendung der beschriebenen gRNA-Designstrategien effektiv angezielt worden. Die Ergebnisse deuten auch darauf hin, dass trotz der Genzerstörung, die während der Erzeugung der Donor-Bibliothek auftritt, die Donor-Bibliotheken effektiv konstruiert werden können und innerhalb von 1–3 Stunden nach dem Recombineering wiedererlangt werden können.The ability to improve the final editing efficiencies of the CARPE process can be evaluated, for example, by performing donor construction in mutS-deficient strains before transferring them to a wild-type donor strain in an effort to loss the mutations to prevent the donor construction phase. In addition, the generality of the CARPE method can be assessed, for example, by applying CARPE to a number of essential genes, including dxs, metA, and folA. Essential genes have been effectively targeted using the described gRNA design strategies. The results also indicate that despite the gene disruption that occurs during generation of the donor library, the donor libraries can be effectively constructed and recovered within 1-3 hours after recombineering.
Hierin werden auch Verfahren für verfolgbares, präzises Genom Editieren unter Verwendung eines CRISPR-vermittelten Systems bereitgestellt, bezeichnet als „Genome Engineering by Trackable CRISPR Enriched Recombineering” (GEn-TraCER). Die GEn-TraCER-Verfahren erzielen hocheffizientes Editieren/Mutieren unter Verwendung eines einzigen Vektors, der sowohl für die Editier-Kassette als auch für die gRNA codiert. GEN-TraCER stellt, wenn es zusammen mit paralleler DNA-Synthese, wie beispielsweise Array-basierter DNA-Synthese, verwendet wird, eine einstufige Erzeugung von tausenden präzisen Änderungen/Mutationen bereit und ermöglicht es, die Mutation durch Sequenzieren der Editier-Kassette auf dem Vektor, statt durch Sequenzieren des Genoms der Zelle (genomischer DNA), zuzuordnen. Diese Verfahren finden in Protein- und Genom Engineering-Anwendungen eine breite Verwendung, sowie zur Rekonstruktion von Mutationen, wie beispielsweise Mutationen, die in Labor-Evolutionsexperimenten identifiziert wurden.Also provided herein are methods for traceable, accurate genome editing using a CRISPR-mediated system, referred to as "Genome Engineering by Trackable CRISPR Enriched Recombination" (GEn-TraCER). The GEn-TraCER methods achieve highly efficient editing / muting using a single vector encoding both the editing cassette and the gRNA. GEN-TraCER, when used in conjunction with parallel DNA synthesis, such as array-based DNA synthesis, provides one-step generation of thousands of precise changes / mutations, and allows the mutation to be sequenced by editing the cassette on the cassette Vector instead of sequencing the genome of the cell (genomic DNA). These methods are widely used in protein and genome engineering applications as well as for the reconstruction of mutations such as mutations identified in laboratory evolution experiments.
Die Gen-TraCER-Verfahren und Vektoren kombinieren eine Editier-Kassette, die eine gewünschte Mutation und eine PAM-Mutation umfasst, mit einem Gen, das für eine gRNA codiert, auf einem einzigen Vektor, der die Erzeugung einer Bibliothek von Mutationen in einer einzigen Reaktion ermöglicht. Wie in
Das Verfahren des verfolgbaren Genom Editierens unter Verwendung von GEn-TraCER umfasst: (a) Einführen eines Vektors, der für mindestens eine Editier-Kassette, einen Promotor, und mindestens eine gRNA codiert, in eine Zelle oder in eine Population von Zellen, wodurch eine Zelle oder eine Population von Zellen hergestellt wird, die den Vektor umfasst (eine zweite Population von Zellen); (b) Aufrechterhalten der zweiten Population von Zellen unter Bedingungen, unter denen Cas9 exprimiert wird, wobei die Cas9 Nuklease auf dem Vektor, einem zweiten Vektor oder in dem Genom der Zellen der zweiten Population von Zellen codiert wird, was zur DNA-Spaltung und Tod von Zellen der zweiten Population von Zellen führt, die die PAM-Mutation nicht umfassen, wobei Zellen der zweiten Population von Zellen, die die PAM-Mutation umfassen, lebensfähig sind; (c) Erhalten lebensfähiger Zellen; und (d) Sequenzieren der Editier-Kassette des Vektors in mindestens einer Zelle der zweiten Population von Zellen, um die Mutation mindestens eines Codons zu identifizieren.The method of traceable genome editing using GEn-TraCER comprises: (a) introducing a vector encoding at least one editing cassette, a promoter, and at least one gRNA into a cell or population cells, thereby producing a cell or a population of cells comprising the vector (a second population of cells); (b) maintaining the second population of cells under conditions under which Cas9 is expressed, wherein the Cas9 nuclease is encoded on the vector, a second vector or in the genome of the cells of the second population of cells, resulting in DNA cleavage and death of cells of the second population of cells that do not comprise the PAM mutation, wherein cells of the second population of cells comprising the PAM mutation are viable; (c) obtaining viable cells; and (d) sequencing the editing cassette of the vector in at least one cell of the second population of cells to identify the mutation of at least one codon.
In einigen Ausführungsformen wird ein separater für cas9 codierender Vektor ebenfalls in die Zelle oder die Population von Zellen eingeführt. Einführen eines Vektors in eine Zelle oder eine Population von Zellen kann unter Verwendung jeglicher in der Technik bekannter Verfahren oder Techniken durchgeführt werden, beispielsweise können Vektoren durch Standardprotokolle eingeführt werden, wie beispielsweise Transformation, umfassend chemische Transformation und Elektroporation, Transduktion und Partikelbeschuss.In some embodiments, a separate vector encoding cas9 is also introduced into the cell or population of cells. Introduction of a vector into a cell or population of cells may be carried out using any method or technique known in the art, for example, vectors may be introduced by standard protocols, such as transformation, involving chemical transformation and electroporation, transduction and particle bombardment.
Eine Editier-Kassette umfasst (a) eine Region, die eine Target-Region einer Nukleinsäure in einer Zelle oder einer Population von Zellen erkennt (daran hybridisiert), die homolog zu der Target-Region der Nukleinsäure der Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region, und (b) eine ”Protospacer Adjacent Motif” (PAM) Mutation beinhaltet. Die PAM-Mutation kann jede Insertion, Deletion oder Substitution eines oder mehrerer Nukleotide sein, die die Sequenz des PAM mutiert, so dass das mutierte PAM (PAM-Mutation) nicht durch das CRISPR-System erkannt wird. Eine Zelle, die eine solche PAM-Mutation umfasst, kann auch als „immun” gegenüber CRISPR-vermittelter Tötung bezeichnet werden. Die gewünschte Mutation, relativ zu der Sequenz der Target-Region kann eine Insertion, Deletion, und oder Substitution eines oder mehrerer Nukleotide in mindestens einem Codon der Target-Region sein. In einigen Ausführungsformen beträgt der Abstand zwischen der PAM-Mutation und der gewünschten Mutation auf der Editier-Kassette mindestens 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 Nukleotide auf der Editier-Kassette. In einigen Ausführungsformen befindet sich die PAM-Mutation mindestens 9 Nukleotide von dem Ende der Editier-Kassette. In einigen Ausführungsformen befindet sich die gewünschte Mutation mindestens 9 Nukleotide von dem Ende der Editier-Kassette.An editing cassette comprises (a) a region that recognizes (hybridizes to) a target region of a nucleic acid in a cell or a population of cells that is homologous to the target region of the nucleic acid of the cell and a mutation (referred to as a desired mutation) of at least one nucleotide in at least one codon relative to the target region, and (b) a "Protospacer Adjacent Motif" (PAM) mutation. The PAM mutation may be any insertion, deletion or substitution of one or more nucleotides that mutates the sequence of the PAM such that the mutant PAM (PAM mutation) is not recognized by the CRISPR system. A cell comprising such a PAM mutation may also be termed "immune" to CRISPR-mediated killing. The desired mutation relative to the sequence of the target region may be an insertion, deletion, or or substitution of one or more nucleotides in at least one codon of the target region. In some embodiments, the distance between the PAM mutation and the desired mutation on the editing cartridge is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides on the editing cassette. In some embodiments, the PAM mutation is at least 9 nucleotides from the end of the editing cartridge. In some embodiments, the desired mutation is at least 9 nucleotides from the end of the editing cartridge.
In einigen Ausführungsformen ist die gewünschte Mutation, relativ zu der Sequenz der Target-Region, eine Insertion einer Nukleinsäuresequenz. Die in die Target-Region insertierte Nukleinsäuresequenz kann beliebig lang sein. In einigen Ausführungsformen ist die insertierte Nukleinsäuresequenz mindestens 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, oder mindestens 2000 Nukleotide lang. In Ausführungsformen, in denen eine Nukleinsäuresequenz in die Target-Region insertiert wird, umfasst die Editier-Kassette eine Region, die mindestens 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, oder mindestens 60 Nukleotide lang ist und homolog zu der Target-Region ist.In some embodiments, the desired mutation, relative to the sequence of the target region, is an insertion of a nucleic acid sequence. The inserted into the target region nucleic acid sequence can be of any length. In some embodiments, the inserted nucleic acid sequence is at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or at least 2000 nucleotides long. In embodiments in which a nucleic acid sequence is inserted into the target region, the editing cassette comprises a region comprising at least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or is at least 60 nucleotides long and homologous to the target region.
Der Ausdruck ”GEn-TraCER Kassette” kann verwendet werden, um sich auf eine Editier-Kassette, Promoter, Spacer-Sequenz und mindestens einen Teil eines für eine gRNA codierenden Gens zu beziehen. In einigen Ausführungsformen codiert ein Teil des für die gRNA codierenden Gens auf der GEn-TraCER Kassette den Teil der gRNA, der komplementär zu der Target-Region ist. In einigen Ausführungsformen ist der Teil der gRNA, der komplementär zu der Target-Region ist, mindestens 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, oder mindestens 30 Nukleotide lang. In einigen Ausführungsformen ist der Teil der gRNA, der komplementär zu der Target-Region ist, 24 Nukleotide lang. In einigen Ausführungsformen umfasst die GEn-TraCER Kassette weiter mindestens zwei Priming-Stellen. In einigen Ausführungsformen können die Priming-Stellen verwendet werden, um die GEn-TraCER Kassetten zu amplifizieren, beispielsweise durch PCR. In einigen Ausführungsformen wird der Teil der gRNA, der komplementär zu der Target-Region ist, als eine Priming-Stelle verwendet.The term "GEn-Tracer cassette" may be used to refer to an editing cassette, promoter, spacer sequence, and at least a portion of a gene encoding a gRNA. In some embodiments, a portion of the gRNA-encoding gene on the GEn-TraCER cassette encodes that portion of the gRNA that is complementary to the target region. In some embodiments, the portion of the gRNA that is complementary to the target region is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or at least 30 nucleotides long. In some embodiments, the portion of the gRNA that is complementary to the target region is 24 nucleotides in length. In some embodiments, the GEn-TraCER cassette further comprises at least two priming sites. In some embodiments, the priming sites may be used to amplify the GEn-TraCER cassettes, for example by PCR. In some embodiments, the portion of the gRNA that is complementary to the target region is used as a priming site.
In dem GEn-TraCER-Verfahren können Editier-Kassetten und GEn-TraCER-Kassetten zur Verwendung in den beschriebenen Verfahren aus vielen Quellen erhalten werden, oder daraus stammen. Beispielsweise wird in einigen Ausführungsformen die Editier-Kassette synthetisiert, zum Beispiel durch Array-basierte Synthese. In einigen Ausführungsformen wird die GEn-TraCER-Kassette synthetisiert, zum Beispiel durch Array-basierte Synthese. Die Länge der Editier-Kassette und/oder GEn-TraCER-Kassette kann von den Verfahren abhängen, die zur Gewinnung der Editier-Kassette und/oder der GEn-TraCER-Kassette verwendet werden. In einigen Ausführungsformen ist die Editier-Kassette ungefähr 50–30 Nukleotide, 75–200 Nukleotide, oder zwischen 80–120 Nukleotide lang. In einigen Ausführungsformen ist die GEn-TraCER-Kassette ungefähr 50–300 Nukleotide, 75–200 Nukleotide, oder zwischen 80–120 Nukleotide lang.In the GEn-TraCER method, edit cassettes and GEn-TraCER cassettes for use in the described methods may be obtained from, or derived from, many sources. For example, in some embodiments, the editing cartridge is synthesized, for example, by array-based synthesis. In some embodiments, the GEn-TraCER cassette is synthesized, for example, by array-based synthesis. The length of the edit cassette and / or GEn-TraCER cassette may depend on the methods used to obtain the edit cassette and / or the GEn-TraCER cassette. In some embodiments, the editing cartridge is about 50-30 nucleotides, 75-200 nucleotides, or between 80-120 nucleotides long. In some embodiments, the GEn-TraCER cassette is about 50-300 nucleotides, 75-200 nucleotides, or between 80-120 nucleotides long.
In einigen Ausführungsformen beinhaltet das Verfahren auch Erhalten der GEn-TraCER-Kassetten, zum Beispiel durch Array-basierte Synthese, und Konstruieren des Vektors. Verfahren zum Konstruieren eines Vektors werden dem Durchschnittsfachmann bekannt sein und können Ligieren der GEn-TraCER-Kassette in einen Vektor beinhalten. In einigen Ausführungsformen werden die GEn-TraCER-Kassetten oder eine Untergruppe (Pool) der GEn-TraCER-Kassetten vor der Konstruktion des Vektors amplifiziert, zum Beispiel durch PCR. In some embodiments, the method also includes obtaining the GEn-TraCER cassettes, for example, by array-based synthesis, and constructing the vector. Methods for constructing a vector will be known to one of ordinary skill in the art and may involve ligating the GEn-TraCER cassette into a vector. In some embodiments, GEn-TraCER cassettes or a subset (pool) of GEn-TraCER cassettes are amplified prior to construction of the vector, for example, by PCR.
Die Zelle oder die Population von Zellen, die den Vektor umfasst, und auch für Cas9 codiert, wird unter Bedingungen Aufrechterhalten oder kultiviert, unter denen Cas9 exprimiert wird. Die Cas9-Expression kann kontrolliert werden. Die hierin beschriebenen Verfahren können aufrechterhalten der Zellen unter Bedingungen beinhalten, unter denen Cas9-Expression aktiviert wird, was zur Herstellung von Cas9 führt. Spezifische Bedingungen, unter denen Cas9 exprimiert wird, werden von Faktoren abhängen, wie beispielsweise der Natur des Promotors, der verwendet wird, um Expression Cas9 zu regulieren. In einigen Ausführungsformen wird die Cas9-Expression in der Anwesenheit eines Induktormoleküls, wie beispielsweise Arabinose, induziert. Cas9-Expression tritt auf, wenn die Zelle oder die Population von Zellen, die die für Cas9-codierende DNA umfasst, sich in der Anwesenheit des Induktormoleküls befinden. In einigen Ausführungsformen wird Cas9-Expression in der Gegenwart eines Repressormoleküls unterdrückt. Expression von Cas9 tritt auf, wenn die Zelle oder die Population von Zellen, die die für Cas9-codierende DNA umfasst, sich in der Abwesenheit eines Moleküls befindet, das die Expression von Cas9 unterdrückt.The cell or population of cells comprising the vector, and also encoded for Cas9, is maintained or cultured under conditions under which Cas9 is expressed. Cas9 expression can be controlled. The methods described herein may include maintaining the cells under conditions in which Cas9 expression is activated, resulting in the production of Cas9. Specific conditions under which Cas9 is expressed will depend on factors such as the nature of the promoter used to regulate Cas9 expression. In some embodiments, Cas9 expression is induced in the presence of an inducer molecule, such as arabinose. Cas9 expression occurs when the cell or population of cells comprising the Cas9-encoding DNA is in the presence of the inducer molecule. In some embodiments, Cas9 expression is suppressed in the presence of a repressor molecule. Expression of Cas9 occurs when the cell or population of cells comprising the Cas9-encoding DNA is in the absence of a molecule that suppresses the expression of Cas9.
Die Zellen der Population von Zellen, die lebensfähig bleiben, werden erhalten oder von den Zellen getrennt, die als eine Folge von Cas9-vermittelter Tötung nicht-editierten Zelltod durchlaufen; dies kann beispielsweise durchgeführt werden durch Ausbreiten der Population von Zellen auf einer Kulturoberfläche, Wachsen lassen der lebensfähigen Zellen, die dann zur Beurteilung zur Verfügung stehen.The cells of the population of cells that remain viable are maintained or isolated from the cells that undergo non-edited cell death as a result of Cas9-mediated killing; this can be done, for example, by spreading the population of cells on a culture surface, allowing the viable cells to grow, which are then available for evaluation.
Die gewünschte Mutation, die an die PAM-Mutation gekoppelt ist, ist verfolgbar unter Verwendung des GEn-TraCER-Verfahrens durch Sequenzieren der Editier-Kassette auf dem Vektor in lebensfähigen Zellen (Zellen, die die PAM-Mutation integrieren) von der Population. Dies ermöglicht eine einfache Identifizierung der Mutation, ohne dass das Genom der Zelle sequenziert werden muss. Die Verfahren beinhalten Sequenzieren der Editier-Kassette, um die Mutation eines oder mehrerer Codons zu identifizieren. Sequenzieren der Editier-Kassette kann als ein Bestandteil des Vektors erfolgen oder nach der Trennung des Vektors und gegebenenfalls Amplifikation, durchgeführt werden. Sequenzieren kann unter Verwendung jeglicher in der Technik bekannter Sequenzier-Verfahren durchgeführt werden, wie beispielsweise durch Sanger-Sequenzieren.The desired mutation coupled to the PAM mutation is traceable using the GEn-TraCER method by sequencing the editing cassette on the vector into viable cells (cells that incorporate the PAM mutation) from the population. This allows easy identification of the mutation without having to sequence the genome of the cell. The methods include sequencing the editing cartridge to identify the mutation of one or more codons. Sequencing of the editing cassette may be done as part of the vector or after separation of the vector and optionally amplification. Sequencing can be performed using any of the sequencing techniques known in the art, such as by Sanger sequencing.
Die hierin beschriebenen Verfahren können in jedem Zelltyp durchgeführt werden, in dem das CRISPR-System funktionieren kann (z. B. DNA anzielen und schneiden), umfassend prokaryotische und eukaryotische Zellen. In einigen Ausführungsformen ist die Zelle eine bakterielle Zelle, wie beispielsweise Escherichia spp. (z. B., E. coli). In anderen Ausführungsformen ist die Zelle eine Pilzzelle, wie beispielsweise eine Hefezelle, z. B. Saccharomyces spp. In anderen Ausführungsformen ist die Zelle eine Algenzelle, eine Pflanzenzelle, eine Insektenzelle, oder eine Säugerzelle, umfassend eine humane Zelle.The methods described herein can be performed in any cell type in which the CRISPR system can function (e.g., target and cut DNA), including prokaryotic and eukaryotic cells. In some embodiments, the cell is a bacterial cell, such as Escherichia spp. (eg, E. coli). In other embodiments, the cell is a fungal cell, such as a yeast cell, e.g. B. Saccharomyces spp. In other embodiments, the cell is an algal cell, a plant cell, an insect cell, or a mammalian cell comprising a human cell.
Ein „Vektor” ist jede Art von Nukleinsäure, die eine gewünschte Sequenz oder Sequenzen umfasst, die an eine Zelle geliefert oder darin exprimiert werden sollen. Die gewünschte Sequenz(en) kann in einen Vektor eingebaut werden, beispielsweise durch Restriktion und Ligation oder durch Rekombination. Die Vektoren sind üblicherweise aus DNA zusammengesetzt, obwohl RNA-Vektoren ebenfalls erhältlich sind. Vektoren umfassen, aber sind nicht beschränkt auf: Plasmide, Fosmide, Phagemide, Virus-Genome und künstliche Chromosomen.A "vector" is any type of nucleic acid comprising a desired sequence or sequences to be delivered to or expressed in a cell. The desired sequence (s) can be incorporated into a vector, for example by restriction and ligation or by recombination. The vectors are usually composed of DNA, although RNA vectors are also available. Vectors include, but are not limited to: plasmids, fosmids, phagemids, virus genomes and artificial chromosomes.
Vektoren, die in dem GEN-TraCER-Verfahren nützlich sind, umfassen mindestens eine wie hierin beschriebene Editier-Kassette, einen Promotor, und mindestens ein für eine gRNA codierendes Gen. In einigen Ausführungsformen ist mehr als eine Editier-Kassette (beispielsweise 2, 3, 4, 5, 6, 7, 8, 9, 10 oder mehr Editier-Kassetten) auf einem Vektor enthalten. In einigen Ausführungsformen ist die mehr als eine Editier-Kassette homolog zu verschiedenen Target-Regionen (z. B. gibt es verschiedene Editier-Kassetten, von denen jede zu einer anderen Target-Region homolog ist). Alternativ oder zusätzlich kann der Vektor mehr als ein Gen enthalten, das für eine gRNA codiert (z. B. 2, 3, 4, 5, 6, 7, 8, 9, 10 oder mehr gRNAs). In einigen Ausführungsformen enthält die mehr als eine gRNA Regionen, die komplementär zu einem Teil von verschiedenen Target-Regionen sind (z. B. gibt es verschiedene gRNAs, von denen jede zu einer anderen Target-Region homolog ist).Vectors useful in the GEN-TraCER method include at least one editing cassette as described herein, a promoter, and at least one gene encoding a gRNA. In some embodiments, more than one editing cartridge (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more editing cartridges) is contained on a vector. In some embodiments, the more than one editing cartridge is homologous to different target regions (e.g., there are several editing cartridges, each of which is homologous to a different target region). Alternatively or additionally, the vector may contain more than one gene encoding a gRNA (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more gRNAs). In some embodiments, the more than one gRNA contains regions that are complementary to a portion of different target regions (eg, there are different gRNAs, each of which is homologous to a different target region).
In einigen Ausführungsformen wird eine eine GEn-TraCER-Kassette, die mindestens eine Editier-Kassette, einen Promoter und ein Gen umfasst, das für einen Teil einer gRNA codiert, in einen Vektor ligiert, der für einen anderen Teil einer gRNA codiert. Nach der Ligation ist der Teil der gRNA der GEn-TraCER-Kassette und der andere Teil der gRNA ligiert und bildet eine funktionelle gRNA.In some embodiments, a GEn-TraCER cassette comprising at least one editing cassette, a promoter, and a gene encoding a portion of a gRNA is ligated into a vector that encodes a different portion of a gRNA. After ligation, the portion of the gRNA of the GEn-TraCER cassette and the other portion of the gRNA are ligated to form a functional gRNA.
Der Promotor und das für die gRNA codierende Gen sind operativ verknüpft. In einigen Ausführungsformen umfassen die Verfahren Einführen eines zweiten Vektors, der für Cas9 codiert. In solchen Ausführungsformen kann der Vektor weiter einen oder mehrere Promotoren umfassen, die operativ an ein Gen verknüpft sind, das für Cas9 codiert. Wie hierin verwendet, bedeutet „operativ” verknüpft, dass der Promotor die Transkription der DNA bewirkt oder reguliert, die für ein Gen codiert, wie beispielsweise das Gen, das für die gRNA codiert oder das Gen, das für Cas9 codiert. Der Promotor kann ein nativer Promotor sein (ein Promoter, der in der Zelle, in die der Vektor eingeführt wird, vorliegt). In einigen Ausführungsformen ist der Promotor ein induzierbarer oder reprimierbarer Promotor (der Promotor wird reguliert, um eine induzierbare oder reprimierbare Transkription eines Gens zu ermöglichen, wie beispielsweise des Gens, das für die gRNA codiert oder des Gens, das für Cas9 codiert), wie beispielsweise Promotoren, die durch die Anwesenheit oder Abwesenheit eines Moleküls reguliert werden (z. B. ein Induktor oder ein Repressor). Die Art des Promotors, der für die Expression der gRNA benötigt wird, kann basierend auf den Spezien oder Zelltypen variieren und wird von einem Fachmann erkannt werden. The promoter and the gene encoding the gRNA are operably linked. In some embodiments, the methods include introducing a second vector encoding Cas9. In such embodiments, the vector may further comprise one or more promoters operably linked to a gene encoding Cas9. As used herein, "operatively" means that the promoter effects or regulates transcription of the DNA encoding a gene, such as the gene encoding the gRNA or the gene encoding Cas9. The promoter may be a native promoter (a promoter present in the cell into which the vector is introduced). In some embodiments, the promoter is an inducible or repressible promoter (the promoter is regulated to facilitate inducible or repressible transcription of a gene, such as the gene encoding the gRNA or the gene encoding Cas9), such as Promoters that are regulated by the presence or absence of a molecule (eg, an inducer or a repressor). The type of promoter required for expression of the gRNA may vary based on the species or cell types and will be recognized by one skilled in the art.
In einigen Ausführungsformen umfasst das Verfahren Einführen eines separaten für Cas9 codierenden Vektors in die Zelle oder Population von Zellen vor oder gleichzeitig mit dem Einführen des Vektors, der mindestens eine wie hierin beschriebene Editier-Kassette, einen Promotor und mindestens eine gRNA umfasst. In einigen Ausführungsformen wird das für Cas9 codierende Gen in das Genom der Zelle oder Population von Zellen integriert. Die Cas9-codierende DNA kann vor dem Einführen des Vektors, der mindestens eine wie hierin beschriebene Editier-Kassette, einen Promotor, und mindestens eine gRNA umfasst, oder nach dem Einführen des Vektors, der mindestens eine wie hierin beschriebene Editier-Kassette, einen Promotor, und mindestens eine gRNA umfasst, in das zelluläre Genom integriert werden. Alternativ kann ein Nukleinsäuremolekül, wie beispielsweise eine für Cas9-codierende DNA, von der in das Genom integrierten DNA exprimiert werden. In einigen Ausführungsformen wird das für Cas9 codierende Gen in das Genom der Zelle integriert.In some embodiments, the method comprises introducing a separate Cas9-encoding vector into the cell or population of cells before or simultaneously with introducing the vector comprising at least one editing cassette as described herein, a promoter, and at least one gRNA. In some embodiments, the gene encoding Cas9 is integrated into the genome of the cell or population of cells. The Cas9-encoding DNA may comprise a promoter prior to introduction of the vector comprising at least one editing cassette as described herein, a promoter, and at least one gRNA, or after insertion of the vector containing at least one editing cassette as described herein , and at least one gRNA comprises integrated into the cellular genome. Alternatively, a nucleic acid molecule, such as a DNA encoding Cas9, can be expressed by the DNA integrated into the genome. In some embodiments, the gene encoding Cas9 is integrated into the genome of the cell.
Vektoren, die für die hierin beschriebenen GEn-TraCER-Verfahren nützlich sind, können weiter eines Spacer-Sequenz, zwei oder mehr Priming-Stellen oder sowohl eine Spacer-Sequenz als auch zwei oder mehr Priming-Stellen umfassen. In einigen Ausführungsformen ermöglicht die Anwesenheit der Priming-Stellen, die die GEn-TraCER-Kassette flankieren, Amplifikation der Nukleinsäuresequenzen der Editier-Kassette, des Promotors und der gRNA.Vectors useful for the GEn-TraCER methods described herein may further comprise a spacer sequence, two or more priming sites, or both a spacer sequence and two or more priming sites. In some embodiments, the presence of the priming sites flanking the GEn-TraCER cassette allows for amplification of the nucleic acid sequences of the editing cassette, promoter, and gRNA.
BEISPIELEEXAMPLES
Beispiel 1: Verwendung des CARPE-Verfahrens um galK zu editierenExample 1: Using the CARPE method to edit galK
Der CARPE-Ansatz wurde auf dem Galactokinase Gen, galK, in dem E. coli Genom durchgeführt; es gibt viele verfügbare Assays, um die Aktivität des Genprodukts zu untersuchen. Diese Experimente wurden unter Verwendung des E. coli BW23115 Elternstamms und dem pSIM5 Vektor (
Zunächst wurde die Fähigkeit getestet selektiv synthetische dsDNA-Kassetten (127 bp) einzubauen. Die synthetischen dsDNA-Kassetten stammen aus NNR-Bibliotheken, die aus degenerierten Primern oder aus rational entworfenen Oligos konstruiert wurden, die als Teil einer Bibliothek mit 27.000 Mitgliedern mittels Microarray-Technologie synthetisiert wurden. In beiden Fällen wurden die Oligonukleotide entworfen, um die Reste des aktiven Zentrums des galK Genprodukts zu mutieren, als auch die synthetische Priming-Stelle, P1 (SEQ ID NO: 1) zu enthalten. Die hocheffiziente Rückgewinnung der Donorstamm-Bibliotheken wurde basierend auf den Änderungen der Amplicongrößen verifiziert, die durch Kolonie-PCR mit Primern gegen den galK Locus erhalten wurden. Sequenzieren dieser Kolonie-PCR-Produkte aus den NNR-Bibliotheken wies darauf hin, dass die synthetische Priming-Stelle (P1) aus den dsDNA-Kassetten mit einer Effizienz von ungefähr 90–100% eingebaut wurde (
Um die endgültigen Editier-Effizienzen und die Allgemeingültigkeit des CARPE-Verfahrens zu erhöhen, kann die Donor-Konstruktion in mutS-defizienten Stämmen vor dem Transferieren in einen mutS+-Donor Stamm durchgeführt werden, in der Bemühungen den Verlust von Mutationen während der Donor-Konstruktionsphase zu verhindern.To increase the final editing efficiencies and generality of the CARPE process, donor construction can be performed in mutS-deficient strains prior to transfer to a mutS + donor strain in which Efforts to prevent the loss of mutations during the donor construction phase.
Beispiel 2: Verwendung des CARPE-Verfahren, um essenzielle Gene anzuzielenExample 2: Use of the CARPE method to target essential genes
Um die Allgemeingültigkeit des CARPE-Ansatzes zu testen, wurde das oben beschriebene Verfahren auf eine Reihe essenzieller Gene angewendet, umfassend dxs, metA, und folA. Essenzielle Gene können unter Verwendung der gRNA-Designstrategien angezielt werden (
Daten aus CARPE-Experimenten, die das dxs Gen anzielen, legen auch nahe, dass trotz der Genzerstörung, die während der Erzeugung der Donor-Bibliothek auftritt, es möglich ist, die Donor-Bibliotheken effektiv zu konstruieren und innerhalb von 1–3 Stunden nach dem Recombineering wiederzugewinnen.Data from CARPE experiments targeting the dxs gene also suggest that, in spite of the gene disruption that occurs during donor library generation, it is possible to construct the donor libraries effectively and within 1-3 hours to regain the recombineering.
Beispiel 3: Verwendung des CARPE-Verfahrens, um die Produktion von Isopentenol zu modulieren.Example 3: Use of the CARPE process to modulate the production of isopentenol.
Die Jagd nach besseren Treibstoffen für die industrielle Fertigung mittels bakterieller Produktion erfordert die Fähigkeit State-of-the-Art Genom-Design, Engineering, und Screenen für das gewünschte Produkt durchführen zu können. Wir haben bereits die Fähigkeit nachgewiesen, die Expressionslevel jedes Gens in dem E. Coli Genom zu modifizieren (
Eine Hauptschwierigkeit bei der Produktion solcher Bibliotheken, die (im Gegensatz zu zufälliger Mutagenese) rational entworfen werden, ist die Insertionseffizienz der gewünschten Mutationen in die Target-Zellen. Beim Recombineering, dem kanonischen Verfahren für Genom-Modifikationen in E. coli, werden rekombinante Gene des Lambda Phagen verwendet, um die Insertion fremder DNA in das Wirtsgenom zu erleichtern. Jedoch leidet dieser Prozess an geringen Effizienzen und kann entweder durch Zugabe eines antibiotischen Resistenzgens, gefolgt von Selektion (wie in TRMR), oder durch rekursives Veranlassen von Rekombinationsereignissen überwunden werden (d. h. durch MAGE (
Das Verfahren wurde weiter unter Verwendung des DXS-Wegs demonstriert. Der DSX-Weg führt zu Produktion von Isopentenyl-Pyrophosphat (IPP), das zur Biosynthese von Terpenen und Terpenoiden führt. Interessanterweise kann IPP auch der Vorläufer von Lycopin und Isopentenol sein, die Zugabe der benötigten Gene vorausgesetzt. Während Lycopin die Bakterienkolonien rot färbt, und daher einfach screenbar ist, wird Isopentenol als ein Biokraftstoff der ,zweiten Generation' mit einer höheren Energiedichte und einer geringeren Wassermischbarkeit als Ethanol betrachtet. Es wurden drei Proteine zum Engineering ausgewählt: 1) DSX, das erste und das geschwindigkeitsbegrenzende der Enzym des Weges, 2) IspB, das den metabolischen Fluss aus dem DXS-Weg umleitet, und 3) NudF, für das gezeigt wurde, dass es IPP sowohl in E. coli als auch B. subtilis in Isopentenol umsetzt (
Beispiel 4: Verwendung des GEn-TraCER-Verfahrens, um galK zu ändernExample 4: Using the GEn-TraCER method to change galK
Das GEn-TraCER-Verfahren wurde verwendet, um das galK-Gen zu editieren, welches als ein Modelsystem für Recombineering in E. coli gedient hat (
Kontroll-Kassetten wurden unter Verwendung des zirkulären Polymerase-Klonier-Verfahrens (engl. Polymerase cloning, OPEC) in den durch
Die GenTRACER-Kassetten wurden als gBlocks bestellt und unter Verwendung der folgenden Primer amplifiziert: ATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGG (SEQ ID NO: 31), ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 32).The GenTRACER cassettes were ordered as gBlocks and amplified using the following primers: ATCACGAGGCAGAATTTCAGATAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGG (SEQ ID NO: 31), ACTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 32).
Die Bestandteile wurden unter Verwendung von OPEC zusammengefügt und in E. coli transformiert, um die Vektoren zu erzeugen. Diese Prozedur ist in multiplex unter Verwendung der gepoolten Oligonukleotid-Bibliotheken mit Klonierungseffizienzen im Bereich von 104–105 CFU/μg durchzuführen.The components were assembled using OPEC and transformed into E. coli to generate the vectors. This procedure is to be performed in multiplex using the pooled oligonucleotide libraries with cloning efficiencies in the range of 10 4 -10 5 CFU / μg.
E. coli MG1655 Zellen, die pSIM5 (Lambda-RED Plasmid) und das X2-cas9 Plasmid tragen, wurden bei 30°C in LB mit 50 μg/mL Kanamycin und 34 μg/mL Chloramphenicol bis zur mittleren log-Phase (0.4–0.7 OD) gezüchtet. Die Recombineering-Funktionen des pSIM5-Vektor wurden bei 42°C für 15 min induziert und anschließend für 10 min auf Eis gestellt. Die Zellen wurden dann durch Pelletieren und 2-maliges Waschen mit 10 mL gekühltem H2O elektrokompetent gemacht. Die Zellen wurden mit 100 ng eines GEn-TraCER Plasmids (das auch für eine Carbenicillin-Resistenz codiert) transformiert und erholten sich für 3 Stunden bei 37°. 50–100 μL der Zellen wurden auf das geeignete Medium ausplattiert, das 50 μg/mL Kanamycin und 100 μg/ml Carbenecillin enthält, um die CRISPR-editierten Stämme selektiv anzureichern. Editier-Effizienzen für das galK Gen wurden unter Verwendung eines rotweiß-Screenings auf mit Galaktose supplementiertem MacConkey Agar berechnet.E. coli MG1655 cells carrying pSIM5 (Lambda-RED plasmid) and the X2-cas9 plasmid were incubated at 30 ° C in LB with 50 μg / mL kanamycin and 34 μg / mL chloramphenicol until mid-log phase (0.4- 0.7 OD). The recombineering functions of the pSIM5 vector were induced at 42 ° C for 15 min and then placed on ice for 10 min. The cells were then made electrocompetent by pelleting and
Basierend auf einem Screening auf MacConkey Agar wurden Editier-Effizienzen von ~100% mit dem galK_Q24* Design beobachtet. Interessanterweise gab es, im Gegensatz zu Oligo-vermittelten Recombineering-Verfahren, die Mismatch-Repair-Knockouts benötigen, um hohe Effizienzen zu erzielen (
Die Sequenzen der Chromosomen und Vektoren wurden anschließend durch Sanger-Sequenzieren verifiziert.The sequences of the chromosomes and vectors were then verified by Sanger sequencing.
Wie erwartet, wurden die entworfenen Mutationen auf dem Chromosom (
Das Design wurde für rationale Mutagenese von Protein-codierenden Rastern auf einer genomweiten Skala adaptiert, durch Erzeugen ”stiller, selektierbarer Narben”, die aus synonymen PAM-Mutationen (
Beispiel 5: Verwendung des GEn-TraCER-Verfahrens, um Mutationen zu rekonstruierenExample 5: Use of the GEn-TraCER method to reconstruct mutations
Der GEn-TraCER-Ansatz wurde unter Verwendung einer benutzerdefinierten, automatisierten Design-Software auf einen genomischen Maßstab ausgeweitet, die an Targets der Stellen in dem Genom mit einer einfachen Benutzer-Eingabefunktion ermöglicht. Dieser Ansatz wurde durch Rekonstruieren aller nicht-synonymen Punktmutationen einer kürzlich veröffentlichten Studie über die thermale Adaption in E. coli (
Beispiel 6: Verwendung des GEn-TraCER-Verfahrens, um genetische Interaktionen zu modulierenExample 6: Use of the GEn-TraCER method to modulate genetic interactions
Eine Promotor-Neuverkabelungs-Bibliothek wurde durch Integrieren eines Promotors erzeugt, der dynamisch durch ein Umgebungssignal (Sauerstoffspiegel, Kohlenstoffquelle, Stress) stromaufwärts von jedem Gen in dem E. coli Genom reguliert wird. Unter Verwendung des GEn-TraCER-Verfahrens wurden Stämme mit neu-verkabelten Genotypen erzeugt, die beispielsweise für die Toleranz gegenüber Chemikalien von Interesse für die Produktion vorteilhaft sein können.A promoter recabling library was generated by integrating a promoter that is dynamically regulated by an environmental signal (oxygen level, carbon source, stress) upstream from each gene in the E. coli genome. Using the GEn-TraCER method, strains have been generated with newly-cabled genotypes that may be advantageous, for example, for tolerance to chemicals of interest to production.
ZITATE ENTHALTEN IN DER BESCHREIBUNG QUOTES INCLUDE IN THE DESCRIPTION
Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.
Zitierte Nicht-PatentliteraturCited non-patent literature
- 35 U.S.C. §119 [0001] 35 USC §119 [0001]
- Jinek et al. Science (2012) 337 (6096): 816–821 [0043] Jinek et al. Science (2012) 337 (6096): 816-821 [0043]
- Cong et al. Science (2013) 339 (6121): 819–823 [0043] Cong et al. Science (2013) 339 (6121): 819-823 [0043]
- DiCarlo et al. Nucleic Acids Res. (2013) 41: 4336–4343 [0043] DiCarlo et al. Nucleic Acids Res. (2013) 41: 4336-4343 [0043]
- Waaijers et al. Genetics (2013) 195: 1187–1191 [0043] Waaijers et al. Genetics (2013) 195: 1187-1191 [0043]
- Cong et al. Science (2013) 339 (6121): 819–823 [0043] Cong et al. Science (2013) 339 (6121): 819-823 [0043]
- Wang et al. Cell (2013) 153: 910–918 [0043] Wang et al. Cell (2013) 153: 910-918 [0043]
- Jinek et al. Science (2012) 337 (6096): 816–821 [0043] Jinek et al. Science (2012) 337 (6096): 816-821 [0043]
- Brouns et al. Science (2008) 321: 960–964 [0043] Brouns et al. Science (2008) 321: 960-964 [0043]
- Semenova et al. PNAS (2011) 108: 10098–10103 [0043] Semenova et al. PNAS (2011) 108: 10098-10103 [0043]
- Datta et al. Gene (2008) 379: 109–115 [0050] Datta et al. Gene (2008) 379: 109-115 [0050]
- Costantino et al. PNAS (2003) 100: 15748–15753 [0050] Costantino et al. PNAS (2003) 100: 15748-15753 [0050]
- Wang et al. Nature (2009) 460: 894–898 [0050] Wang et al. Nature (2009) 460: 894-898 [0050]
- Wang et al. Nat. Methods (2012) 9: 591–593 [0051] Wang et al. Nat. Methods (2012) 9: 591-593 [0051]
- Datta et al. Gene (2008) 379: 109–115 [0072] Datta et al. Gene (2008) 379: 109-115 [0072]
- Costantino et al. PNAS (2003) 100: 15748–15753 [0073] Costantino et al. PNAS (2003) 100: 15748-15753 [0073]
- Wang et al. Nature (2009) 460: 894–898 [0073] Wang et al. Nature (2009) 460: 894-898 [0073]
- Warner et al. Nat. Biotechnol (2010) 28: 856–862 [0077] Warner et al. Nat. Biotechnol (2010) 28: 856-862 [0077]
- Wang et al. Nature (2008) 460: 894–898 [0078] Wang et al. Nature (2008) 460: 894-898 [0078]
- Bhaya et al. Ann. Rev. of Genetics (2011) 45: 273–297 [0078] Bhaya et al. Ann. Rev. of Genetics (2011) 45: 273-297 [0078]
- Qi et al. Cell (2013) 45: 273–297 [0078] Qi et al. Cell (2013) 45: 273-297 [0078]
- Withers et al. App. Environ. Microbiol (2007) 73: 6277–6283 [0079] Withers et al. App. Environ. Microbiol (2007) 73: 6277-6283 [0079]
- Zheng et al. Biotechnol. for biofuels (2013) 6: 57 [0079] Zheng et al. Biotechnol. for biofuels (2013) 6: 57 [0079]
- Vu et al. 2000 [0080] Vu et al. 2000 [0080]
- Qi et al. Cell (2013) [0081] Qi et al. Cell (2013) [0081]
- Li et al. 2003 [0085] Li et al. 2003 [0085]
- Sawitzke et al. 2011 [0085] Sawitzke et al. 2011 [0085]
- Wang et al. 2011 [0085] Wang et al. 2011 [0085]
- Tenaillon et al. 2012 [0089] Tenaillon et al. 2012 [0089]
Claims (68)
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201461938608P | 2014-02-11 | 2014-02-11 | |
US61/938,608 | 2014-02-11 | ||
PCT/US2015/015476 WO2015123339A1 (en) | 2014-02-11 | 2015-02-11 | Crispr enabled multiplexed genome engineering |
Publications (1)
Publication Number | Publication Date |
---|---|
DE212015000061U1 true DE212015000061U1 (en) | 2017-09-03 |
Family
ID=53800598
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DE212015000061.3U Active DE212015000061U1 (en) | 2014-02-11 | 2015-02-11 | CRISPR-enabled multiplex genome engineering |
Country Status (22)
Country | Link |
---|---|
US (16) | US10266849B2 (en) |
EP (4) | EP3985114A1 (en) |
JP (3) | JP2017505145A (en) |
KR (3) | KR102496984B1 (en) |
CN (2) | CN111705365A (en) |
AU (2) | AU2015217208B2 (en) |
CA (3) | CA3075047C (en) |
CY (1) | CY1123115T1 (en) |
DE (1) | DE212015000061U1 (en) |
DK (1) | DK3105328T3 (en) |
ES (2) | ES2802984T3 (en) |
GB (1) | GB2544382B (en) |
HR (1) | HRP20201040T1 (en) |
HU (1) | HUE049634T2 (en) |
IL (2) | IL246951B (en) |
LT (1) | LT3105328T (en) |
MX (1) | MX2016010285A (en) |
PL (1) | PL3105328T3 (en) |
PT (1) | PT3105328T (en) |
RS (1) | RS60492B1 (en) |
SI (1) | SI3105328T1 (en) |
WO (1) | WO2015123339A1 (en) |
Families Citing this family (116)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3613852A3 (en) | 2011-07-22 | 2020-04-22 | President and Fellows of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
JP6411463B2 (en) | 2013-04-16 | 2018-10-24 | リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
US9163284B2 (en) | 2013-08-09 | 2015-10-20 | President And Fellows Of Harvard College | Methods for identifying a target site of a Cas9 nuclease |
US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
US9322037B2 (en) | 2013-09-06 | 2016-04-26 | President And Fellows Of Harvard College | Cas9-FokI fusion proteins and uses thereof |
US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
US9228207B2 (en) | 2013-09-06 | 2016-01-05 | President And Fellows Of Harvard College | Switchable gRNAs comprising aptamers |
AU2014346559B2 (en) | 2013-11-07 | 2020-07-09 | Editas Medicine,Inc. | CRISPR-related methods and compositions with governing gRNAs |
RU2685914C1 (en) | 2013-12-11 | 2019-04-23 | Регенерон Фармасьютикалс, Инк. | Methods and compositions for genome targeted modification |
US20150166982A1 (en) | 2013-12-12 | 2015-06-18 | President And Fellows Of Harvard College | Methods for correcting pi3k point mutations |
PL3105328T3 (en) | 2014-02-11 | 2020-10-19 | The Regents Of The University Of Colorado, A Body Corporate | Crispr enabled multiplexed genome engineering |
GB201406970D0 (en) * | 2014-04-17 | 2014-06-04 | Green Biologics Ltd | Targeted mutations |
GB201406968D0 (en) | 2014-04-17 | 2014-06-04 | Green Biologics Ltd | Deletion mutants |
US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
JP7044373B2 (en) * | 2015-07-15 | 2022-03-30 | ラトガース,ザ ステート ユニバーシティ オブ ニュージャージー | Nuclease-independent targeted gene editing platform and its uses |
US11371040B2 (en) | 2015-10-22 | 2022-06-28 | Institut National De La Sante Et De La Recherche Medical (Inserm) | Endonuclease-barcoding |
IL294014B1 (en) | 2015-10-23 | 2024-03-01 | Harvard College | Nucleobase editors and uses thereof |
CA3007635A1 (en) | 2015-12-07 | 2017-06-15 | Zymergen Inc. | Promoters from corynebacterium glutamicum |
US11208649B2 (en) | 2015-12-07 | 2021-12-28 | Zymergen Inc. | HTP genomic engineering platform |
US9988624B2 (en) | 2015-12-07 | 2018-06-05 | Zymergen Inc. | Microbial strain improvement by a HTP genomic engineering platform |
WO2017106251A1 (en) * | 2015-12-14 | 2017-06-22 | President And Fellows Of Harvard College | Cas discrimination using tuned guide rna |
JP7002454B2 (en) * | 2016-01-15 | 2022-02-10 | アストラゼネカ アクチボラグ | Gene modification assay |
EP3219799A1 (en) | 2016-03-17 | 2017-09-20 | IMBA-Institut für Molekulare Biotechnologie GmbH | Conditional crispr sgrna expression |
US11939571B2 (en) | 2016-06-10 | 2024-03-26 | President And Fellows Of Harvard College | Library-scale engineering of metabolic pathways |
CN109312386B (en) * | 2016-06-15 | 2022-10-25 | 株式会社图尔金 | Method of screening target-specific nucleases using a multi-target system of in-target and off-target targets and uses thereof |
US11293021B1 (en) | 2016-06-23 | 2022-04-05 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
AU2017280353B2 (en) | 2016-06-24 | 2021-11-11 | Inscripta, Inc. | Methods for generating barcoded combinatorial libraries |
EP3478845A4 (en) | 2016-06-30 | 2019-07-31 | Zymergen, Inc. | Methods for generating a glucose permease library and uses thereof |
US10544390B2 (en) | 2016-06-30 | 2020-01-28 | Zymergen Inc. | Methods for generating a bacterial hemoglobin library and uses thereof |
AU2017306676B2 (en) | 2016-08-03 | 2024-02-22 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
HUE057901T2 (en) | 2016-08-08 | 2022-06-28 | Aerase Inc | Compositions and methods for treating cancer with arginine depletion and immuno oncology agents |
CA3033327A1 (en) | 2016-08-09 | 2018-02-15 | President And Fellows Of Harvard College | Programmable cas9-recombinase fusion proteins and uses thereof |
WO2018039438A1 (en) | 2016-08-24 | 2018-03-01 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
CN110214180A (en) | 2016-10-14 | 2019-09-06 | 哈佛大学的校长及成员们 | The AAV of nucleobase editing machine is delivered |
WO2018119359A1 (en) | 2016-12-23 | 2018-06-28 | President And Fellows Of Harvard College | Editing of ccr5 receptor gene to protect against hiv infection |
IL267470B2 (en) * | 2017-01-10 | 2023-10-01 | F O R E Biotherapeutics Ltd | Methods for in vitro site-directed mutagenesis using gene editing technologies |
US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
JP2020510439A (en) | 2017-03-10 | 2020-04-09 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Base-editing factor from cytosine to guanine |
KR20190130613A (en) | 2017-03-23 | 2019-11-22 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Nucleobase edits comprising nucleic acid programmable DNA binding proteins |
WO2018209320A1 (en) | 2017-05-12 | 2018-11-15 | President And Fellows Of Harvard College | Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation |
US10011849B1 (en) | 2017-06-23 | 2018-07-03 | Inscripta, Inc. | Nucleic acid-guided nucleases |
US9982279B1 (en) | 2017-06-23 | 2018-05-29 | Inscripta, Inc. | Nucleic acid-guided nucleases |
HRP20220615T1 (en) | 2017-06-30 | 2022-06-24 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
WO2019023680A1 (en) | 2017-07-28 | 2019-01-31 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace) |
US10738327B2 (en) | 2017-08-28 | 2020-08-11 | Inscripta, Inc. | Electroporation cuvettes for automation |
US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
BR112020005416A2 (en) | 2017-09-19 | 2020-09-29 | Tropic Biosciences UK Limited | modification of the specificity of non-coding RNA molecules to silence gene expression in eukaryotic cells |
CA3074927A1 (en) | 2017-09-30 | 2019-04-04 | Inscripta, Inc. | Flow through electroporation instrumentation |
US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
JP2021505620A (en) | 2017-12-05 | 2021-02-18 | イーレイズ・インコーポレーテッド | Methods and Compositions for Treating Arginase 1 Deficiency |
CN112204131A (en) | 2018-03-29 | 2021-01-08 | 因思科瑞普特公司 | Automated control of cell growth rate for induction and transformation |
US10376889B1 (en) | 2018-04-13 | 2019-08-13 | Inscripta, Inc. | Automated cell processing instruments comprising reagent cartridges |
US10557216B2 (en) | 2018-04-24 | 2020-02-11 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
US10858761B2 (en) | 2018-04-24 | 2020-12-08 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
WO2019209926A1 (en) | 2018-04-24 | 2019-10-31 | Inscripta, Inc. | Automated instrumentation for production of peptide libraries |
KR20210005138A (en) | 2018-04-27 | 2021-01-13 | 이오반스 바이오테라퓨틱스, 인크. | Closure method for expansion and gene editing of tumor infiltrating lymphocytes and their use in immunotherapy |
WO2019217837A1 (en) | 2018-05-11 | 2019-11-14 | Memorial Sloan-Kettering Cancer Center | T cell receptors targeting pik3ca mutations and uses thereof |
IL292273B2 (en) | 2018-08-14 | 2023-10-01 | Inscripta Inc | Instruments, modules, and methods for improved detection of edited sequences in live cells |
US10752874B2 (en) | 2018-08-14 | 2020-08-25 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
US10532324B1 (en) | 2018-08-14 | 2020-01-14 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
US11142740B2 (en) | 2018-08-14 | 2021-10-12 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
EP3844263A4 (en) | 2018-08-30 | 2022-05-25 | Inscripta, Inc. | Improved detection of nuclease edited sequences in automated modules and instruments |
US11214781B2 (en) | 2018-10-22 | 2022-01-04 | Inscripta, Inc. | Engineered enzyme |
WO2020086475A1 (en) | 2018-10-22 | 2020-04-30 | Inscripta, Inc. | Engineered enzymes |
US20220010305A1 (en) * | 2018-10-31 | 2022-01-13 | Novozymes A/S | Genome Editing by Guided Endonuclease and Single-stranded Oligonucleotide |
EP3942040A1 (en) | 2019-03-19 | 2022-01-26 | The Broad Institute, Inc. | Methods and compositions for editing nucleotide sequences |
CN113631713A (en) | 2019-03-25 | 2021-11-09 | 因思科瑞普特公司 | Simultaneous multiplex genome editing in yeast |
US11001831B2 (en) | 2019-03-25 | 2021-05-11 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
CA3139122C (en) | 2019-06-06 | 2023-04-25 | Inscripta, Inc. | Curing for recursive nucleic acid-guided cell editing |
EP3967703B1 (en) * | 2019-06-11 | 2023-07-26 | FUJIFILM Corporation | Cyclic peptide, cell scaffold material, cell separation material and culture medium |
US10907125B2 (en) | 2019-06-20 | 2021-02-02 | Inscripta, Inc. | Flow through electroporation modules and instrumentation |
CN114008070A (en) | 2019-06-21 | 2022-02-01 | 因思科瑞普特公司 | Whole genome rationally designed mutations leading to increased lysine production in E.coli |
US10927385B2 (en) | 2019-06-25 | 2021-02-23 | Inscripta, Inc. | Increased nucleic-acid guided cell editing in yeast |
KR20220031070A (en) * | 2019-07-08 | 2022-03-11 | 인스크립타 인코포레이티드 | Increased Nucleic Acid-Guided Cell Editing Via LEXA-RAD51 Fusion Protein |
CA3153197A1 (en) | 2019-10-03 | 2021-04-08 | Ryan T. Gill | Crispr systems with engineered dual guide nucleic acids |
JP2022553389A (en) | 2019-10-25 | 2022-12-22 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Gene editing of tumor-infiltrating lymphocytes and its use in immunotherapy |
WO2021102059A1 (en) | 2019-11-19 | 2021-05-27 | Inscripta, Inc. | Methods for increasing observed editing in bacteria |
WO2021118626A1 (en) | 2019-12-10 | 2021-06-17 | Inscripta, Inc. | Novel mad nucleases |
US10704033B1 (en) | 2019-12-13 | 2020-07-07 | Inscripta, Inc. | Nucleic acid-guided nucleases |
KR20220118498A (en) | 2019-12-18 | 2022-08-25 | 인스크립타 인코포레이티드 | Cascade/DCAS3 Complementary Assay for In Vivo Detection of Nucleic Acid-Guided Nuclease Edited Cells |
US10689669B1 (en) | 2020-01-11 | 2020-06-23 | Inscripta, Inc. | Automated multi-module cell processing methods, instruments, and systems |
AU2021213705A1 (en) | 2020-01-27 | 2022-06-16 | Inscripta, Inc. | Electroporation modules and instrumentation |
CN115667491A (en) | 2020-03-10 | 2023-01-31 | 赛阿瑞斯公司 | Systems, devices, and methods for cell processing |
KR20210123237A (en) | 2020-04-02 | 2021-10-13 | 중앙대학교 산학협력단 | Method for Genome Editing Based on CRISPR/Cas9 System and Uses Thereof |
US20210332388A1 (en) | 2020-04-24 | 2021-10-28 | Inscripta, Inc. | Compositions, methods, modules and instruments for automated nucleic acid-guided nuclease editing in mammalian cells |
MX2022014008A (en) | 2020-05-08 | 2023-02-09 | Broad Inst Inc | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence. |
US11787841B2 (en) | 2020-05-19 | 2023-10-17 | Inscripta, Inc. | Rationally-designed mutations to the thrA gene for enhanced lysine production in E. coli |
WO2022010286A1 (en) * | 2020-07-08 | 2022-01-13 | 경상국립대학교산학협력단 | Donor nucleic acid used for gene correction through microhomology-mediated end joining and uses thereof |
WO2022060749A1 (en) | 2020-09-15 | 2022-03-24 | Inscripta, Inc. | Crispr editing to embed nucleic acid landing pads into genomes of live cells |
WO2022072878A1 (en) * | 2020-10-02 | 2022-04-07 | Inscripta, Inc. | Methods and systems for modeling of design representation in a library of editing cassettes |
US11512297B2 (en) | 2020-11-09 | 2022-11-29 | Inscripta, Inc. | Affinity tag for recombination protein recruitment |
WO2022103699A1 (en) * | 2020-11-10 | 2022-05-19 | Inscripta, Inc. | Transcriptional roadblocks for gene editing and methods of using the same |
EP4271802A1 (en) | 2021-01-04 | 2023-11-08 | Inscripta, Inc. | Mad nucleases |
WO2022150269A1 (en) | 2021-01-07 | 2022-07-14 | Inscripta, Inc. | Mad nucleases |
JP2024506557A (en) | 2021-01-29 | 2024-02-14 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Methods of producing modified tumor-infiltrating lymphocytes and their use in adoptive cell therapy |
US11884924B2 (en) | 2021-02-16 | 2024-01-30 | Inscripta, Inc. | Dual strand nucleic acid-guided nickase editing |
WO2022198141A1 (en) | 2021-03-19 | 2022-09-22 | Iovance Biotherapeutics, Inc. | Methods for tumor infiltrating lymphocyte (til) expansion related to cd39/cd69 selection and gene knockout in tils |
WO2022229902A1 (en) | 2021-04-29 | 2022-11-03 | Alcon Inc. | Colored cosmetic photochromic contact lenses |
CA3219148A1 (en) | 2021-05-17 | 2022-11-24 | Frederick G. Vogt | Pd-1 gene-edited tumor infiltrating lymphocytes and uses of same in immunotherapy |
WO2022256448A2 (en) | 2021-06-01 | 2022-12-08 | Artisan Development Labs, Inc. | Compositions and methods for targeting, editing, or modifying genes |
WO2022266538A2 (en) | 2021-06-18 | 2022-12-22 | Artisan Development Labs, Inc. | Compositions and methods for targeting, editing or modifying human genes |
WO2022267842A1 (en) * | 2021-06-21 | 2022-12-29 | Westlake University | Disruptions of pdcd1, adora2a, and ctla4 genes and uses thereof |
EP4373270A2 (en) | 2021-07-22 | 2024-05-29 | Iovance Biotherapeutics, Inc. | Method for cryopreservation of solid tumor fragments |
WO2023028521A1 (en) | 2021-08-24 | 2023-03-02 | Inscripta, Inc. | Genome-wide rationally-designed mutations leading to enhanced cellobiohydrolase i production in s. cerevisiae |
WO2023147488A1 (en) | 2022-01-28 | 2023-08-03 | Iovance Biotherapeutics, Inc. | Cytokine associated tumor infiltrating lymphocytes compositions and methods |
WO2023167882A1 (en) | 2022-03-01 | 2023-09-07 | Artisan Development Labs, Inc. | Composition and methods for transgene insertion |
WO2023196877A1 (en) | 2022-04-06 | 2023-10-12 | Iovance Biotherapeutics, Inc. | Treatment of nsclc patients with tumor infiltrating lymphocyte therapies |
WO2023200770A1 (en) | 2022-04-12 | 2023-10-19 | Inscripta, Inc. | Curing for iterative nucleic acid-guided nuclease editing |
WO2023201369A1 (en) | 2022-04-15 | 2023-10-19 | Iovance Biotherapeutics, Inc. | Til expansion processes using specific cytokine combinations and/or akti treatment |
WO2023220608A1 (en) | 2022-05-10 | 2023-11-16 | Iovance Biotherapeutics, Inc. | Treatment of cancer patients with tumor infiltrating lymphocyte therapies in combination with an il-15r agonist |
WO2023225410A2 (en) | 2022-05-20 | 2023-11-23 | Artisan Development Labs, Inc. | Systems and methods for assessing risk of genome editing events |
WO2024026344A1 (en) | 2022-07-27 | 2024-02-01 | Inscripta, Inc. | Modulating cellular repair mechanisms for genomic editing |
WO2024062138A1 (en) | 2022-09-23 | 2024-03-28 | Mnemo Therapeutics | Immune cells comprising a modified suv39h1 gene |
WO2024098027A1 (en) | 2022-11-04 | 2024-05-10 | Iovance Biotherapeutics, Inc. | Methods for tumor infiltrating lymphocyte (til) expansion related to cd39/cd103 selection |
WO2024112571A2 (en) | 2022-11-21 | 2024-05-30 | Iovance Biotherapeutics, Inc. | Two-dimensional processes for the expansion of tumor infiltrating lymphocytes and therapies therefrom |
WO2024118836A1 (en) | 2022-11-30 | 2024-06-06 | Iovance Biotherapeutics, Inc. | Processes for production of tumor infiltrating lymphocytes with shortened rep step |
Family Cites Families (107)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US1028757A (en) | 1910-07-28 | 1912-06-04 | Charles Margerison | Combined curtain-pole and shade-support. |
US1024016A (en) | 1910-10-29 | 1912-04-23 | Emma R Bowne | Gas-burner. |
US1001776A (en) | 1911-01-12 | 1911-08-29 | Augustin Scohy | Railroad switch and frog. |
US1001184A (en) | 1911-04-20 | 1911-08-22 | Charles M Coover | Non-slipping device. |
US1026684A (en) | 1911-09-16 | 1912-05-21 | Emil A Lauer | Lamp. |
US6562594B1 (en) | 1999-09-29 | 2003-05-13 | Diversa Corporation | Saturation mutagenesis in directed evolution |
EP1276861A2 (en) * | 2000-03-24 | 2003-01-22 | Maxygen, Inc. | Methods for modulating cellular and organismal phenotypes |
US20030044866A1 (en) | 2001-08-15 | 2003-03-06 | Charles Boone | Yeast arrays, methods of making such arrays, and methods of analyzing such arrays |
EP2359869B1 (en) | 2001-12-17 | 2018-12-26 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same and uses therefor |
EP1516053B1 (en) | 2002-06-14 | 2012-10-17 | Verenium Corporation | Xylanases, nucleic adics encoding them and methods for making and using them |
JP4447977B2 (en) | 2004-06-30 | 2010-04-07 | 富士通マイクロエレクトロニクス株式会社 | Secure processor and program for secure processor. |
US10066233B2 (en) | 2005-08-26 | 2018-09-04 | Dupont Nutrition Biosciences Aps | Method of modulating cell resistance |
CN101583370A (en) * | 2005-09-27 | 2009-11-18 | 阿穆尼克斯公司 | Proteinaceous pharmaceuticals and uses thereof |
CN101395282A (en) * | 2006-01-03 | 2009-03-25 | 麻省理工学院 | Promoter engineering and genetic control |
AU2007258872A1 (en) | 2006-06-16 | 2007-12-21 | Danisco A/S | Bacterium |
WO2008052101A2 (en) | 2006-10-25 | 2008-05-02 | President And Fellows Of Harvard College | Multiplex automated genome engineering |
US9309511B2 (en) | 2007-08-28 | 2016-04-12 | The Johns Hopkins University | Functional assay for identification of loss-of-function mutations in genes |
US20140121118A1 (en) | 2010-11-23 | 2014-05-01 | Opx Biotechnologies, Inc. | Methods, systems and compositions regarding multiplex construction protein amino-acid substitutions and identification of sequence-activity relationships, to provide gene replacement such as with tagged mutant genes, such as via efficient homologous recombination |
WO2012142591A2 (en) | 2011-04-14 | 2012-10-18 | The Regents Of The University Of Colorado | Compositions, methods and uses for multiplex protein sequence activity relationship mapping |
EP2702160B1 (en) * | 2011-04-27 | 2020-05-27 | Amyris, Inc. | Methods for genomic modification |
CA3226329A1 (en) | 2011-12-16 | 2013-06-20 | Targetgene Biotechnologies Ltd | Compositions and methods for modifying a predetermined target nucleic acid sequence |
US9637739B2 (en) | 2012-03-20 | 2017-05-02 | Vilnius University | RNA-directed DNA cleavage by the Cas9-crRNA complex |
PT2800811T (en) | 2012-05-25 | 2017-08-17 | Univ California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
KR102247979B1 (en) | 2012-05-25 | 2021-05-04 | 셀렉티스 | Methods for engineering allogeneic and immunosuppressive resistant t cell for immunotherapy |
CA2877290A1 (en) * | 2012-06-19 | 2013-12-27 | Daniel F. Voytas | Gene targeting in plants using dna viruses |
WO2014022702A2 (en) | 2012-08-03 | 2014-02-06 | The Regents Of The University Of California | Methods and compositions for controlling gene expression by rna processing |
CN110643600A (en) | 2012-10-23 | 2020-01-03 | 基因工具股份有限公司 | System for cutting target DNA and use thereof |
ES2769310T3 (en) | 2012-12-06 | 2020-06-25 | Sigma Aldrich Co Llc | Modification and regulation of the genome based on CRISPR |
MX2015007550A (en) | 2012-12-12 | 2017-02-02 | Broad Inst Inc | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications. |
EP4279588A3 (en) | 2012-12-12 | 2024-01-17 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
SG10201912327SA (en) | 2012-12-12 | 2020-02-27 | Broad Inst Inc | Engineering and Optimization of Improved Systems, Methods and Enzyme Compositions for Sequence Manipulation |
US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
EP3825401A1 (en) | 2012-12-12 | 2021-05-26 | The Broad Institute, Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
US20140186843A1 (en) | 2012-12-12 | 2014-07-03 | Massachusetts Institute Of Technology | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
EP3553174A1 (en) | 2012-12-17 | 2019-10-16 | President and Fellows of Harvard College | Rna-guided human genome engineering |
CA2897390A1 (en) | 2013-01-10 | 2014-07-17 | Ge Healthcare Dharmacon, Inc. | Templates, libraries, kits and methods for generating molecules |
WO2014113493A1 (en) | 2013-01-16 | 2014-07-24 | Emory University | Cas9-nucleic acid complexes and uses related thereto |
US10612043B2 (en) | 2013-03-09 | 2020-04-07 | Agilent Technologies, Inc. | Methods of in vivo engineering of large sequences using multiple CRISPR/cas selections of recombineering events |
ES2901396T3 (en) | 2013-03-14 | 2022-03-22 | Caribou Biosciences Inc | Nucleic Acid Targeting Nucleic Acid Compositions and Methods |
CN110540991B (en) | 2013-03-15 | 2023-10-24 | 通用医疗公司 | Enhancement of specificity of RNA-guided genome editing using truncated guide RNA (tru-gRNA) |
US9234213B2 (en) | 2013-03-15 | 2016-01-12 | System Biosciences, Llc | Compositions and methods directed to CRISPR/Cas genomic engineering systems |
WO2014165825A2 (en) | 2013-04-04 | 2014-10-09 | President And Fellows Of Harvard College | Therapeutic uses of genome editing with crispr/cas systems |
US9890393B2 (en) | 2013-05-29 | 2018-02-13 | Cellectis | Methods for engineering T cells for immunotherapy by using RNA-guided CAS nuclease system |
RU2764637C2 (en) | 2013-07-09 | 2022-01-19 | Президент Энд Фэллоуз Оф Харвард Коллидж | Multiplex genomic engineering guided by rna |
EP3971287A1 (en) | 2013-07-11 | 2022-03-23 | ModernaTX, Inc. | Compositions comprising synthetic polynucleotides encoding crispr related proteins and synthetic sgrnas and methods of use |
US10563225B2 (en) | 2013-07-26 | 2020-02-18 | President And Fellows Of Harvard College | Genome engineering |
ES2915377T3 (en) | 2013-08-02 | 2022-06-22 | Enevolv Inc | Procedures and host cells for genomic, pathway and biomolecular engineering |
US9163284B2 (en) | 2013-08-09 | 2015-10-20 | President And Fellows Of Harvard College | Methods for identifying a target site of a Cas9 nuclease |
EP4074330A1 (en) | 2013-09-05 | 2022-10-19 | Massachusetts Institute of Technology | Tuning microbial populations with programmable nucleases |
WO2015040402A1 (en) | 2013-09-18 | 2015-03-26 | Kymab Limited | Methods. cells & organisms |
US20160237455A1 (en) | 2013-09-27 | 2016-08-18 | Editas Medicine, Inc. | Crispr-related methods and compositions |
US10822606B2 (en) | 2013-09-27 | 2020-11-03 | The Regents Of The University Of California | Optimized small guide RNAs and methods of use |
US20150098954A1 (en) | 2013-10-08 | 2015-04-09 | Elwha Llc | Compositions and Methods Related to CRISPR Targeting |
US10752906B2 (en) | 2013-11-05 | 2020-08-25 | President And Fellows Of Harvard College | Precise microbiota engineering at the cellular level |
WO2015068785A1 (en) | 2013-11-06 | 2015-05-14 | 国立大学法人広島大学 | Vector for nucleic acid insertion |
US11326209B2 (en) | 2013-11-07 | 2022-05-10 | Massachusetts Institute Of Technology | Cell-based genomic recorded accumulative memory |
CA2930877A1 (en) | 2013-11-18 | 2015-05-21 | Crispr Therapeutics Ag | Crispr-cas system materials and methods |
US9074199B1 (en) | 2013-11-19 | 2015-07-07 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
RU2685914C1 (en) | 2013-12-11 | 2019-04-23 | Регенерон Фармасьютикалс, Инк. | Methods and compositions for genome targeted modification |
AU2014362248A1 (en) | 2013-12-12 | 2016-06-16 | Massachusetts Institute Of Technology | Compositions and methods of use of CRISPR-Cas systems in nucleotide repeat disorders |
US10787654B2 (en) | 2014-01-24 | 2020-09-29 | North Carolina State University | Methods and compositions for sequence guiding Cas9 targeting |
PL3105328T3 (en) * | 2014-02-11 | 2020-10-19 | The Regents Of The University Of Colorado, A Body Corporate | Crispr enabled multiplexed genome engineering |
CA2939621C (en) | 2014-02-13 | 2019-10-15 | Takara Bio Usa, Inc. | Methods of depleting a target molecule from an initial collection of nucleic acids, and compositions and kits for practicing the same |
US10507232B2 (en) | 2014-04-02 | 2019-12-17 | University Of Florida Research Foundation, Incorporated | Materials and methods for the treatment of latent viral infection |
GB201406970D0 (en) | 2014-04-17 | 2014-06-04 | Green Biologics Ltd | Targeted mutations |
GB201406968D0 (en) | 2014-04-17 | 2014-06-04 | Green Biologics Ltd | Deletion mutants |
JP2017514488A (en) | 2014-05-02 | 2017-06-08 | タフツ ユニバーシティー | Method and apparatus for transformation of naturally competent cells |
CA2949697A1 (en) | 2014-05-20 | 2015-11-26 | Regents Of The University Of Minnesota | Method for editing a genetic sequence |
JP2017516500A (en) | 2014-05-28 | 2017-06-22 | ツールゲン インコーポレイテッドToolgen Incorporated | Sensitive detection method of target DNA using target-specific nuclease |
WO2015188065A1 (en) | 2014-06-05 | 2015-12-10 | Sangamo Biosciences, Inc. | Methods and compositions for nuclease design |
CA2951707A1 (en) | 2014-06-10 | 2015-12-17 | Massachusetts Institute Of Technology | Method for gene editing |
EP3157328B1 (en) | 2014-06-17 | 2021-08-04 | Poseida Therapeutics, Inc. | A method for directing proteins to specific loci in the genome and uses thereof |
US20150376587A1 (en) | 2014-06-25 | 2015-12-31 | Caribou Biosciences, Inc. | RNA Modification to Engineer Cas9 Activity |
GB201411344D0 (en) | 2014-06-26 | 2014-08-13 | Univ Leicester | Cloning |
US11254933B2 (en) | 2014-07-14 | 2022-02-22 | The Regents Of The University Of California | CRISPR/Cas transcriptional modulation |
US20160053304A1 (en) | 2014-07-18 | 2016-02-25 | Whitehead Institute For Biomedical Research | Methods Of Depleting Target Sequences Using CRISPR |
US20160053272A1 (en) | 2014-07-18 | 2016-02-25 | Whitehead Institute For Biomedical Research | Methods Of Modifying A Sequence Using CRISPR |
US20160076093A1 (en) | 2014-08-04 | 2016-03-17 | University Of Washington | Multiplex homology-directed repair |
JP6715419B2 (en) | 2014-08-06 | 2020-07-01 | トゥールジェン インコーポレイテッド | Genome editing using RGEN derived from Campylobacter jejuni CRISPR/CAS system |
US10513711B2 (en) | 2014-08-13 | 2019-12-24 | Dupont Us Holding, Llc | Genetic targeting in non-conventional yeast using an RNA-guided endonuclease |
WO2016040594A1 (en) | 2014-09-10 | 2016-03-17 | The Regents Of The University Of California | Reconstruction of ancestral cells by enzymatic recording |
CN107002078A (en) | 2014-10-09 | 2017-08-01 | 生命技术公司 | CRISPR oligonucleotides and gene editing |
JP6788584B2 (en) | 2014-10-31 | 2020-11-25 | マサチューセッツ インスティテュート オブ テクノロジー | Massively Parallel Combinatorial Genetics on CRISPR |
EP3227447B1 (en) | 2014-12-03 | 2024-04-24 | Agilent Technologies, Inc. | Guide rna with chemical modifications |
CA2971391C (en) | 2014-12-17 | 2023-05-09 | E. I. Du Pont De Nemours And Company | Compositions and methods for efficient gene editing in e. coli using guide rna/cas endonuclease systems in combination with circular polynucleotide modification templates. |
JP6947638B2 (en) | 2014-12-20 | 2021-10-13 | アーク バイオ, エルエルシー | Compositions and Methods for Targeted Depletion, Enrichment and Division of Nucleic Acids Using CRISPR / CAS Proteins |
GB201506509D0 (en) | 2015-04-16 | 2015-06-03 | Univ Wageningen | Nuclease-mediated genome editing |
AU2016263026A1 (en) | 2015-05-15 | 2017-11-09 | Pioneer Hi-Bred International, Inc. | Guide RNA/Cas endonuclease systems |
US9790490B2 (en) | 2015-06-18 | 2017-10-17 | The Broad Institute Inc. | CRISPR enzymes and systems |
RU2752834C2 (en) | 2015-06-18 | 2021-08-09 | Те Брод Инститьют, Инк. | Crispr enzyme mutations reducing non-targeted effects |
WO2017004261A1 (en) | 2015-06-29 | 2017-01-05 | Ionis Pharmaceuticals, Inc. | Modified crispr rna and modified single crispr rna and uses thereof |
WO2017015015A1 (en) | 2015-07-17 | 2017-01-26 | Emory University | Crispr-associated protein from francisella and uses related thereto |
WO2017019867A1 (en) | 2015-07-28 | 2017-02-02 | Danisco Us Inc | Genome editing systems and methods of use |
US11339408B2 (en) | 2015-08-20 | 2022-05-24 | Applied Stemcell, Inc. | Nuclease with enhanced efficiency of genome editing |
CA3002647A1 (en) | 2015-09-21 | 2017-03-30 | Arcturus Therapeutics, Inc. | Allele selective gene editing and uses thereof |
EP3353309A4 (en) | 2015-09-25 | 2019-04-10 | Tarveda Therapeutics, Inc. | Compositions and methods for genome editing |
US11371040B2 (en) | 2015-10-22 | 2022-06-28 | Institut National De La Sante Et De La Recherche Medical (Inserm) | Endonuclease-barcoding |
DK3350327T3 (en) | 2015-10-23 | 2019-01-21 | Caribou Biosciences Inc | CONSTRUCTED CRISPR CLASS-2-NUCLEIC ACID TARGETING-NUCLEIC ACID |
US11905521B2 (en) | 2015-11-17 | 2024-02-20 | The Chinese University Of Hong Kong | Methods and systems for targeted gene manipulation |
US20210285035A1 (en) | 2015-11-26 | 2021-09-16 | Dnae Group Holdings Limited | Single molecule controls |
JP6605042B2 (en) | 2015-12-07 | 2019-11-13 | ザイマージェン インコーポレイテッド | Improvement of microbial strain by HTP genome manipulation platform |
CN109310784B (en) | 2015-12-07 | 2022-08-19 | 阿克生物公司 | Methods and compositions for making and using guide nucleic acids |
US9988624B2 (en) | 2015-12-07 | 2018-06-05 | Zymergen Inc. | Microbial strain improvement by a HTP genomic engineering platform |
US20210207134A1 (en) | 2015-12-24 | 2021-07-08 | B.R.A I.N. Ag | Reconstitution of dna-end repair pathway in prokaryotes |
AU2017280353B2 (en) | 2016-06-24 | 2021-11-11 | Inscripta, Inc. | Methods for generating barcoded combinatorial libraries |
US10011849B1 (en) | 2017-06-23 | 2018-07-03 | Inscripta, Inc. | Nucleic acid-guided nucleases |
US9982279B1 (en) | 2017-06-23 | 2018-05-29 | Inscripta, Inc. | Nucleic acid-guided nucleases |
-
2015
- 2015-02-11 PL PL15749644T patent/PL3105328T3/en unknown
- 2015-02-11 EP EP21200160.6A patent/EP3985114A1/en active Pending
- 2015-02-11 GB GB1615434.6A patent/GB2544382B/en active Active
- 2015-02-11 CA CA3075047A patent/CA3075047C/en active Active
- 2015-02-11 DE DE212015000061.3U patent/DE212015000061U1/en active Active
- 2015-02-11 ES ES15749644T patent/ES2802984T3/en active Active
- 2015-02-11 WO PCT/US2015/015476 patent/WO2015123339A1/en active Application Filing
- 2015-02-11 KR KR1020207037824A patent/KR102496984B1/en active IP Right Grant
- 2015-02-11 EP EP20161652.1A patent/EP3690044B1/en active Active
- 2015-02-11 US US15/116,616 patent/US10266849B2/en active Active
- 2015-02-11 JP JP2016568490A patent/JP2017505145A/en not_active Withdrawn
- 2015-02-11 EP EP15749644.9A patent/EP3105328B1/en active Active
- 2015-02-11 LT LTEP15749644.9T patent/LT3105328T/en unknown
- 2015-02-11 CN CN202010437901.2A patent/CN111705365A/en active Pending
- 2015-02-11 MX MX2016010285A patent/MX2016010285A/en active IP Right Grant
- 2015-02-11 KR KR1020167024869A patent/KR102209636B1/en active IP Right Grant
- 2015-02-11 CA CA3161903A patent/CA3161903A1/en active Pending
- 2015-02-11 CN CN201580018819.3A patent/CN106164271B/en active Active
- 2015-02-11 AU AU2015217208A patent/AU2015217208B2/en active Active
- 2015-02-11 DK DK15749644.9T patent/DK3105328T3/en active
- 2015-02-11 PT PT157496449T patent/PT3105328T/en unknown
- 2015-02-11 KR KR1020227035511A patent/KR20220142547A/en not_active Application Discontinuation
- 2015-02-11 SI SI201531276T patent/SI3105328T1/en unknown
- 2015-02-11 EP EP22164530.2A patent/EP4063503A1/en active Pending
- 2015-02-11 ES ES20161652T patent/ES2974229T3/en active Active
- 2015-02-11 RS RS20200793A patent/RS60492B1/en unknown
- 2015-02-11 HU HUE15749644A patent/HUE049634T2/en unknown
- 2015-02-11 CA CA2938456A patent/CA2938456C/en active Active
-
2016
- 2016-07-26 IL IL246951A patent/IL246951B/en active IP Right Grant
-
2017
- 2017-06-22 US US15/630,909 patent/US9982278B2/en active Active
-
2018
- 2018-04-09 US US15/948,785 patent/US10351877B2/en active Active
- 2018-04-09 US US15/948,789 patent/US10240167B2/en active Active
- 2018-08-06 US US16/056,310 patent/US10364442B2/en active Active
- 2018-09-06 IL IL261664A patent/IL261664B/en active IP Right Grant
- 2018-11-27 AU AU2018271257A patent/AU2018271257B2/en active Active
-
2019
- 2019-02-14 US US16/275,439 patent/US10435715B2/en active Active
- 2019-02-14 US US16/275,465 patent/US10465207B2/en active Active
- 2019-08-23 US US16/550,092 patent/US11702677B2/en active Active
- 2019-08-26 US US16/551,517 patent/US10669559B2/en active Active
- 2019-09-13 JP JP2019167052A patent/JP6863620B2/en active Active
-
2020
- 2020-01-27 US US16/773,712 patent/US10731180B2/en active Active
- 2020-01-27 US US16/773,618 patent/US10711284B2/en active Active
- 2020-07-01 HR HRP20201040TT patent/HRP20201040T1/en unknown
- 2020-07-03 CY CY20201100615T patent/CY1123115T1/en unknown
- 2020-07-24 US US16/938,739 patent/US11078498B2/en active Active
-
2021
- 2021-03-08 JP JP2021036322A patent/JP7232540B2/en active Active
- 2021-04-05 US US17/222,936 patent/US11795479B2/en active Active
- 2021-12-07 US US17/544,921 patent/US11345933B2/en active Active
-
2022
- 2022-06-29 US US17/853,753 patent/US11639511B2/en active Active
-
2023
- 2023-05-26 US US18/324,928 patent/US20240093241A1/en active Pending
Non-Patent Citations (24)
Title |
---|
35 U.S.C. §119 |
Bhaya et al. Ann. Rev. of Genetics (2011) 45: 273–297 |
Brouns et al. Science (2008) 321: 960–964 |
Cong et al. Science (2013) 339 (6121): 819–823 |
Costantino et al. PNAS (2003) 100: 15748–15753 |
Datta et al. Gene (2008) 379: 109–115 |
DiCarlo et al. Nucleic Acids Res. (2013) 41: 4336–4343 |
Jinek et al. Science (2012) 337 (6096): 816–821 |
Li et al. 2003 |
Qi et al. Cell (2013) |
Qi et al. Cell (2013) 45: 273–297 |
Sawitzke et al. 2011 |
Semenova et al. PNAS (2011) 108: 10098–10103 |
Tenaillon et al. 2012 |
Vu et al. 2000 |
Waaijers et al. Genetics (2013) 195: 1187–1191 |
Wang et al. 2011 |
Wang et al. Cell (2013) 153: 910–918 |
Wang et al. Nat. Methods (2012) 9: 591–593 |
Wang et al. Nature (2008) 460: 894–898 |
Wang et al. Nature (2009) 460: 894–898 |
Warner et al. Nat. Biotechnol (2010) 28: 856–862 |
Withers et al. App. Environ. Microbiol (2007) 73: 6277–6283 |
Zheng et al. Biotechnol. for biofuels (2013) 6: 57 |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DE212015000061U1 (en) | CRISPR-enabled multiplex genome engineering |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
R207 | Utility model specification | ||
R150 | Utility model maintained after payment of first maintenance fee after three years | ||
R151 | Utility model maintained after payment of second maintenance fee after six years | ||
R152 | Utility model maintained after payment of third maintenance fee after eight years |