DE212015000061U1 - CRISPR-enabled multiplex genome engineering - Google Patents

Abstract

Use of a vector comprising: (i) at least one editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region and (c) a first "Protospacer Adjacent Motif" (PAM) mutation; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease to produce a drug for genome engineering.

Description

RELATED APPLICATION

This application decreases 35 USC §119 the priority of provisional application 61 / 938,608, filed on Feb. 11, 2014, the entire teaching of which is incorporated herein by reference.

BACKGROUND OF THE INVENTION

The rational manipulation of large DNA constructs is a key challenge for the current synthetic biology and genome engineering efforts. In recent years, a variety of technologies have been developed to overcome this challenge and to increase the specificity and speed at which mutations can be generated. In addition, adaptive mutations are a key driver of evolution, but little is known about their abundance and their relative contribution to cellular phenotypes, even in the best-studied organisms. This is largely due to the technical challenges associated with observing and reconstructing these genotypes and correlating their presence with the phenotype of interest. For example, genome editing methods that rely on random mutagenesis result in complex genotypes consisting of many mutations whose relative contribution is difficult to classify. Moreover, due to the lack of information regarding the individual mutations, it is difficult to assign the epistatic interactions between the alleles.

SUMMARY OF THE INVENTION

"Clustered Regularly Interspersed Short Palindromic Repeats" (CRISPR) are found in many bacterial genomes and have been found to play an important role in adaptive bacterial immunity. Transcription of these arrays results in CRISPR RNAs that direct sequence-specific binding of the CRISPR / cas complexes to DNA targets in cells for gene repression or DNA cleavage. The specificity of these complexes allows novel in vivo applications for strain engineering.

Described herein are methods for rational multiplex manipulation of chromosomes within open reading frames (eg, to generate protein libraries) or within multiple genes in any segment of a chromosome using different CRISPR systems. These methods provide more efficient combinatorial genome engineering than previously described.

Expanding the multiplexing capabilities of CRISPR represents a current technological challenge and would allow the use of these systems to generate high-throughput rational libraries. Such advances have far-reaching implications for the fields of metabolic and protein engineering that are seeking to revise complex genetic networks for optimal production.

The methods include introducing into CRISPR system components comprising the CRISPR-associated nuclease Cas9 and a sequence-specific guide RNA (gRNA) into cells, resulting in sequence-directed double-strand breaks using the capability of the CRISPR system such breaks induce leads. The components of the CRISPR system, comprising the CRISPR-associated nuclease Cas9 and a sequence-specific guide RNA (gRNA), can be introduced into cells encoded on one or more vectors, such as a plasmid. DNA recombination cassettes or editing oligonucleotides can be rationally designed to contain a desired mutation within the target locus and a mutation at a common location outside the target locus that can be recognized by the CRISPR system. The described methods can be used for many applications, including changing a path of interest.

In one embodiment, the method is a method of genome engineering, comprising: (a) introducing a vector into cells, wherein the vector encodes: (i) an editing cassette containing a region homologous to the target region of the nucleic acid in the cell and a mutation (referred to as a desired mutation) of at least one nucleotide relative to the target region, such as a mutation of at least one nucleotide in at least one codon relative to the target region, and a protospacer adj. PAM) mutation includes; (ii) a promoter; and (iii) at least one guide RNA (gRNA), wherein the gRNA comprises: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease, thereby producing cells comprising the vector; (b) maintaining the cells comprising the vector under conditions under which Cas9 is expressed, wherein the Cas9 nuclease is encoded on the vector, encoded on a second vector or encoded in the genome of the cells resulting in the production of Leading cells comprising the vector and not comprising the PAM mutation and cells comprising the vector and the PAM mutation; (c) cultivating the product of (b) under conditions suitable for the viability of the cell, thereby producing viable cells; (D) Obtaining Viable Cells Produced in (c); and (e) sequencing the editing oligonucleotide of the vector from at least one viable cell obtained in (d) and identifying the mutation of at least one codon.

In another embodiment, the method is a method of genome engineering by trackable CRISPR-enriched recombinant engineering, comprising: (a) introducing a vector into a first population of cells, wherein the vector encodes: (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and a mutation of at least one nucleotide relative to the target region, such as a mutation of at least one nucleotide in at least one codon relative to the target region, and (b) a Protospacer Adjacent Motif (PAM) mutation; (ii) at least one promoter; and (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease, thereby producing a second population of cells comprising the vector; (b) maintaining the second population of cells under conditions in which the Cas9 nuclease is expressed, encoding the Cas9 nuclease on the vector, encoding on a second vector or in the genome of the cells, resulting in DNA cleavage into the cells Cells that do not involve the PAM mutation and cause the death of such cells; (c) obtaining viable cells produced in (b); and (d) identifying the mutation of at least one codon by sequencing the editing oligonucleotide of the vector from at least one cell of the second population of cells.

Each of the above embodiments may further comprise synthesizing and / or obtaining a population of editing oligonucleotides. Each embodiment may further comprise amplifying the population of editing oligonucleotides. In any of the embodiments, the vector may further comprise a spacer, at least two priming sites, or both a spacer and at least two priming sites. In some embodiments, the editing cassette comprises a target region comprising a mutation of at least one codon within 100 nucleotides of the PAM mutation.

• (i) eine Editier-Kassette, die eine Region umfasst, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids relativ zu der Target-Region, und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
• (ii) einen Promoter; und
• (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.

Also described is a vector comprising:

• (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide relative to the target region, and a protospacer Adjacent Motif "(PAM) mutation includes;
• (ii) a promoter; and
• (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.

• (i) eine Editier-Kassette, die eine Region beinhaltet, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
• (ii) einen Promoter; und
• (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.

Another embodiment is a vector comprising:

• (i) an editing cassette containing a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide in at least one codon relative to the target region and includes a "Protospacer Adjacent Motif" (PAM) mutation;
• (ii) a promoter; and
• (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.

• (i) mindestens eine Editier-Kassette umfassend: (a) eine Region, die homolog zu einer Target-Region einer Nukleinsäure ist und eine Mutation mindestens eines Nukleotids relativ zu der Target-Region und (b) eine „Protospacer Adjacent Motif” (PAM) Mutation umfasst;
• (ii) mindestens einen Promoter; und
• (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.

Another embodiment is a vector comprising:

• (i) at least one editing cartridge comprising: (a) a region homologous to a target region of a nucleic acid and a mutation of at least one nucleotide relative to the target region; and (b) a protospacer adj. motif (PAM ) Mutation;
• (ii) at least one promoter; and
• (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.

• (i) eine Editier-Kassette, umfassend: (a) eine Region, die homolog zu einer Target-Region einer Nukleinsäure ist und eine Mutation mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region und (b) eine „Protospacer Adjacent Motif” (PAM) Mutation umfasst;
• (ii) mindestens einen Promoter; und
• (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.

Another embodiment of the vector is a vector comprising:

• (i) an editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and a mutation of at least one nucleotide in at least one codon relative to the target region and (b) a protospacer adj Motif "(PAM) mutation comprises;
• (ii) at least one promoter; and
• (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.

In any of the embodiments, the vector may further comprise a spacer; at least two priming sites; or a spacer and at least two priming sites. For example, in these vectors where the mutation is at least one nucleotide in at least one codon, the editing cassette may be within 100 nucleotides of the PAM mutation.

• (i) eine Editier-Kassette, die eine Region beinhaltet, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids relativ zu der Target-Region und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
• (ii) einen Promoter; und
• (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.

Also described is a library comprising a population of cells produced by the methods described herein. A library of a population of cells may comprise cells with any of the vectors described herein. For example, a population of cells may comprise a vector, the vector comprising:

• (i) an editing cassette containing a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide relative to the target region and a protospacer adj Motif "(PAM) mutation includes;
• (ii) a promoter; and
• (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.

• (i) eine Editier-Kassette, die eine Region beinhaltet, die homolog zu einer Target-Region einer Nukleinsäure in einer Zelle ist und eine Mutation (bezeichnet als eine gewünschte Mutation) mindestens eines Nukleotids in mindestens einem Codon relativ zu der Target-Region, und eine „Protospacer Adjacent Motif” (PAM) Mutation beinhaltet;
• (ii) einen Promoter; und
• (iii) mindestens eine Guide-RNA (gRNA), umfassend: (a) eine Region (RNA), die komplementär zu einem Teil der Target-Region ist; und (b) eine Region (RNA), die eine Cas9 Nuklease rekrutiert.

In a further embodiment, a population of cells may comprise a vector, the vector comprising:

• (i) an editing cassette containing a region homologous to a target region of a nucleic acid in a cell and a mutation (referred to as a desired mutation) of at least one nucleotide in at least one codon relative to the target region, and a "Protospacer Adjacent Motif" (PAM) mutation;
• (ii) a promoter; and
• (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) that is complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease.

• (a) Konstruieren einer Donor-Bibliothek, die rekombinante DNA umfasst, wie beispielsweise rekombinante Chromosomen oder rekombinante DNA in Plasmiden, durch Einführen beispielsweise durch Co-Transformation, in eine Population von ersten Zellen (i) eines oder mehrerer Editier-Oligonukleotide, wie beispielsweise rational entworfene Oligonukleotide, die die Deletion eines ersten einzelnen „Protospacer Adjacent Motif” Motivs (PAM) mit einer Mutation mindestens eines Codons in einem zu dem PAM benachbarten Gen (das benachbarte Gen) koppeln und (b) eine Guide-RNA (gRNA), die eine Nukleotid-Sequenz 5' von dem offenen Leserahmen eines Chromosoms anzielt, wodurch eine Donor-Bibliothek hergestellt wird, die eine Population von ersten Zellen umfasst, die rekombinante Chromosomen mit gezielten Codon Mutationen umfasst;
• (b) Amplifizieren der in (a) konstruierten Donor-Bibliothek, beispielsweise durch PCR-Amplifikation rekombinanter Chromosome, die ein synthetisches Merkmal der Editier-Oligonukleotide verwenden und gleichzeitig eine zweite PAM-Deletion (Ziel-PAM-Deletion) an dem 3'-Terminus des Gens einbauen, wodurch die gezielten Codon-Mutationen direkt mit der Ziel-PAM-Deletion gekoppelt werden, beispielsweise durch kovalentes Koppeln, und wodurch eine wiedergewonnene Donor-Bibliothek hergestellt wird, die die Ziel-PAM-Deletion und die gezielten Codon-Mutationen trägt; und
• (c) Einführen (z. B. Co-Transformieren) der Donor-Bibliothek, die die Ziel-PAM-Deletion und die gezielten Codon-Mutationen trägt und einem Ziel-gRNA-Plasmid in eine Population von zweiten Zellen, die typischerweise eine Population von naiven Zellen ist, wodurch eine Ziel-Bibliothek hergestellt wird, die die gezielten Codon-Mutationen umfasst.

In a further embodiment, the method is a method for CRISPR-assisted rational protein engineering (combinatorial genome engineering) comprising:

• (a) constructing a donor library comprising recombinant DNA, such as recombinant chromosomes or recombinant DNA in plasmids, by introducing, for example, by co-transformation, into a population of first cells (i) of one or more editing oligonucleotides, such as rationally designed oligonucleotides coupling the deletion of a first single protospacer adjacent motif (PAM) with a mutation of at least one codon in a gene adjacent to the PAM (the adjacent gene) and (b) a guide RNA (gRNA), targeting a nucleotide sequence 5 'to the open reading frame of a chromosome, thereby producing a donor library comprising a population of first cells comprising recombinant chromosomes with targeted codon mutations;
• (b) amplifying the donor library constructed in (a), for example by PCR amplification of recombinant chromosomes using a synthetic feature of the editing oligonucleotides and simultaneously a second PAM deletion (target PAM deletion) on the 3 ' Terminus of the gene, whereby the targeted codon mutations are coupled directly to the target PAM deletion, for example by covalent coupling, and whereby a recovered donor library is prepared, the target PAM deletion and the targeted codon mutations wearing; and
• (c) introducing (e.g., co-transforming) the donor library carrying the target PAM deletion and directed codon mutations and a target gRNA plasmid into a population of second cells, typically a population of naive cells, thus producing a target library comprising the targeted codon mutations.

The population of the first cells and the population of the second cells (e.g., a population of naive cells) are typically a population in which the cells are all of the same type and may be prokaryotic or eukaryotic, such as, but not limited to limited to bacteria, mammalian cells, plant cells, insect cells.

In some embodiments, the method further comprises maintaining the target library under conditions under which protein is produced.

In some embodiments, the first cell expresses a polypeptide having Cas9 nuclease activity. In some embodiments, the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

In some embodiments, the editing oligonucleotides are complementary to one (one, one or more, at least one) target nucleic acid present in the first cell. In some embodiments, the editing oligonucleotides target more than one target site or locus in the first cell. In some embodiments, the nucleic acid sequence of the editing oligonucleotides [desired codon] comprises one or more substitutions, deletions, insertions, or any combination of substitutions, deletions, and insertions relative to the target nucleic acid. In some embodiments, the editing oligonucleotides are designed rationally; in other embodiments, they are prepared by random mutagenesis or using degenerate primer oligonucleotides. In some embodiments, the editing oligonucleotides are from a collection of nucleic acids (library).

In some embodiments, the gRNA is encoded on a plasmid. In some embodiments, the editing oligonucleotide and the gRNA are introduced by transformation into the first cell, for example by co-transformation of the editing oligonucleotide and the guide (g) RNA. In some embodiments, the editing oligonucleotide and the gRNA are introduced sequentially into the first cell. In other embodiments, the editing oligonucleotide and the gRNA are introduced simultaneously into the first cell.

In some embodiments, recovering the donor library further comprises (a) screening the cells for incorporation of the editing oligonucleotides and (b) selecting the cells that have been confirmed to have incorporated the editing oligonucleotide. In some embodiments, recovering the donor library further involves processing the recovered donor library.

In some embodiments, the target cell / naive cell expresses a polypeptide having Cas9 nuclease activity. In some embodiments, the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

• (a) Einführen (z. B., Co-Transformieren) von (i) synthetischen dsDNA Editier-Kassetten, die Editier-Oligonukleotide umfassen und (ii) einem Vektor, der eine Guide-RNA (gRNA) exprimiert, die die genomische Sequenz direkt stromaufwärts von einem Gen von Interesse in einer Population von ersten Zellen anzielt, unter Bedingungen, unter denen Multiplex Recombineering und selektive Anreicherung der Editier-Oligonukleotide durch gRNA auftritt, wodurch eine Donor-Bibliothek hergestellt wird;
• (b) Amplifizieren der Donor-Bibliothek mit einem Oligonukleotid, dass ein „Protospacer Adjacent Motif” (PAM) Motiv deletiert, das zu dem 3'-Ende des Gens von Interesse benachbart ist (Ziel-PAM), wodurch eine amplifizierte Donor-Bibliothek hergestellt wird, die dsDNA Editier-Kassetten, von denen aus die Ziel-PAM deletiert worden ist (mit einer 3' PAM-Deletion), rationale Codon-Mutationen, und eine P1-Stelle umfasst; und
• (c) Bearbeiten der amplifizierten Donor-Bibliothek mit einem Enzym, wie beispielsweise einem Restriktionsenzym (z. B. BsaI), um die P1-Stelle zu entfernen; und
• (d) Co-Transformieren einer Population von naiven Zellen mit der in (c) bearbeiteten amplifizierten Donor-Bibliothek und der Ziel-gRNA, wodurch eine Population von co-transformierten Zellen hergestellt wird, die dsDNA-Editier-Kassetten, von denen aus die Ziel-PAM deletiert worden ist (mit einer 3' PAM-Deletion), rationale Codon-Mutationen, und die Ziel-gRNA umfassen.

Also described is a method for CRISPR-assisted rational protein engineering, comprising:

• (a) introducing (e.g., co-transforming) (i) synthetic dsDNA editing cassettes comprising editing oligonucleotides and (ii) a vector expressing a guide RNA (gRNA) encoding the genomic sequence directly upstream of a gene of interest in a population of first cells, under conditions where multiplex recombineering and selective enrichment of the editing oligonucleotides by gRNA occurs, thereby producing a donor library;
• (b) amplifying the donor library with an oligonucleotide that deletes a "Protospacer Adjacent Motif" (PAM) motif adjacent to the 3 'end of the gene of interest (target PAM), yielding an amplified donor library the dsDNA editing cassettes from which the target PAM has been deleted (with a 3 'PAM deletion), rational codon mutations, and a P1 site; and
• (c) working the amplified donor library with an enzyme, such as a restriction enzyme (e.g., Bsa I) to remove the P1 site; and
• (d) co-transforming a population of naive cells with the amplified donor library processed in (c) and the target gRNA, thereby producing a population of co-transformed cells, the dsDNA editing cassettes, of which the Target PAM has been deleted (with a 3 'PAM deletion), rational codon mutations, and include the target gRNA.

In all embodiments described, a mutation may be of any desired type, such as one or more insertions, deletions, substitutions, or any combination of two or three of the foregoing (e.g., insertion and deletion; insertion and substitution; deletion and substitution; Substitution and insertion; insertion, deletion and substitution). Insertions, deletions and substitutions may involve any number of nucleotides. They can be in codons (coding regions) and / or in non-coding regions.

BRIEF DESCRIPTION OF THE FIGURES

1A and 1B review CRISPR-assisted rational protein engineering (CARPE). 1A shows a scheme for construction of a donor library. Synthetic dsDNA editing cassettes are co-transformed with a vector that expresses a guide RNA (gRNA) that targets the genomic sequence upstream of the gene of interest. The co-transformation generated via multiplex recombination a donor library from the editing oligonucleotides which are selectively enriched by the gRNA. The donor library was then amplified using an oligonucleotide that mutates (deletes) a PAM adjacent to the 3 'end of the gene (target PAM). 1B shows a scheme for constructing a final protein library. The donor library was processed with Bsa I to remove the P1 site, and the library of dsDNA cassettes with the 3 'PAM deletion and the rational codon mutations was co-transformed with the target gRNA to give the final To generate protein library.

2 shows the DNA sequences of clones from the construction of the galK donor library, indicating the highly efficient incorporation of the P1 feature of the editing oligonucleotides (90% mutation efficiency), as well as the mutation at the target codon position (underlined: 20% mutation efficiency ) approved. The sequence of P1 is provided in SEQ ID NO: 1.

3A shows the primer design. 3B shows the expected density relative to the number of primers.

4A represents linker and construct results. 4B shows 10 changes with respect to emulsion PCR-based tracking.

5 is a scheme for rational protein editing for metabolic engineering, with parallel synthesis of the library yielding 10 ⁴ -10 ⁵ features per synthesis.

6 is a scheme for generating CRISPR-enriched, rational protein libraries, comprising the steps 1) multiplex recombination, 2) library recovery, and 3) multiplex recombination by coupling PAM to the library of mutations. CRISPR allows for rapid selection of recombinant genotypes to enrich the protein libraries of the plate.

7 is a schematic of the construction and demonstration of CARPE.

8th shows strategies for iterative CRISPR co-selection.

9 shows a strategy for multiplex protein engineering using CARPE, comprising the steps 1) construction of the donor library (multiplex recombination), 2) recovery of the donor library by PCR and 3) construction of the target library (multiplex recombination ). There are two PAM sites for each gene library. This strategy allows the rational construction of the library for ORFs and a rapid protein engineering potential.

10 Figure 4 shows the concept proof of the construction of a galK donor library using CARPE, comprising the steps 1) construction of the donor library (multiplex recombination) and 2) recovery of the donor library by PCR, derived from liquid cultures, 3 hours after recombination he follows.

11A shows a scheme for multiplex CRISPR-based editing using CARPE. 11B Figure 12 shows a scheme for multiplex CRISPR-based editing (multiplex amplification / cloning) using genome engineering by recombineering enriched with trackable CRISPR (Genome Engineering by trackable CRISPR enriched recombineering, GEn-TraCER).

12 Figure 12 shows a representative GEn-TraCER vector (construct) containing an editing cartridge for editing galK codon 24, a promoter, and a spacer.

13 shows the results of galK editing using GEn-TraCER. The upper sections show DNA sequencing results of the chromosome and vector (plasmid) of the cells transformed with the galK codon 24 editing GEn-TraCER vector, suggesting that the editing cassette (oligonucleotide) on the vector can be sequenced as a "trans-barcode", allowing highly efficient tracking of the desired genome mutation. The lower part shows DNA sequencing chromatographs of the cells showing the unmodified, wild-type phenotype (red). The method allows the identification of cells with multiple chromosomes carrying both the wild-type, unmodified allele and the altered / mutated allele.

14A - 14C show schemas for GEn-TraCER. 14A shows an overview of the design components. The GEn-TraCER cassette contains guide RNA (gRNA) sequence (s) to target a specific site in the cell genome and cause dsDNA cleavage. A homologous region that is complementary to the target region mutates the PAM and other obvious desired sites. The cells undergoing recombination are selectively enriched for high abundance. Sequencing the GEn-TraCER editing cassette in the vector allows tracking of genomic changes / mutations with genome-wide tracking with a short reading. 14B Figure 12 shows an exemplary editing cartridge for the E. coli galK gene at codon 145. The PAM is deleted with the next available PAM mutation that can be made for a synonymous change at the next available PAM position. This allows mutagenesis with a "silent scar" of 1-2 nucleotides at the PAM deletion site. 14C shows GEn-TraCER cassettes that can be synthesized using array-based synthesis techniques, enabling parallel synthesis of at least 10 ⁴ -10 ⁶ cassettes for systematic targeting and simultaneous evaluation of fitness for thousands of mutations on a genome-wide scale.

15A shows an overview of GEn-TraCER vectors. 15B Figure 12 shows a portion of a representative GEn-TraCER for generating a Y145 * mutation in the E. coli galK gene in which the PAM mutation and the codon being mutated are separated by 17 nucleotides. The nucleic acid sequence of the portion of the representative GEn-TraCER is provided in SEQ ID NO: 28 and the reverse, complementary sequence is provided by SEQ ID NO: 33.

16A - 16C show controls for the GEn-TraCER design. 16A shows the effect of the size of the editing cartridge on the efficiency of the process. 16B shows the effect of the distance between the PAM mutation / deletion and the desired mutation on the efficiency of the method. 16C shows the effect of the presence or absence of the MutS system on the efficiency of the process.

DETAILED DESCRIPTION OF THE INVENTION

Bacteria and Archaea CRISPR systems have proven to be powerful tools for accurate genome editing. The type II CRISPR system of Streptococcus pyogenes (S. pyogenes) has been particularly well characterized in vitro, and simple design rules have been established for reprogramming its double-stranded DNA (dsDNA) binding activity. Jinek et al. Science (2012) 337 (6096): 816-821 ). The use of CRISPR-mediated genome editing techniques has rapidly accumulated in the literature for a wide variety of organisms, including bacteria ( Cong et al. Science (2013) 339 (6121): 819-823 ), Saccharomyces cerevisiae ( DiCarlo et al. Nucleic Acids Res. (2013) 41: 4336-4343 ), Caenorhabditis elegans ( Waaijers et al. Genetics (2013) 195: 1187-1191 ) and various mammalian cell lines ( Cong et al. Science (2013) 339 (6121): 819-823 ; Wang et al. Cell (2013) 153: 910-918 ). As with other endonuclease-based genome editing technologies, such as zinc finger nucleases (ZFNs), homing nucleases and TALENES, the ability of the CRISPR systems to convey precise genome editing relies on the highly specific nature of target recognition. For example, the type I CRISPR system of Escherichia coli and the S. pyogenes system require perfect complementarity between the CRISPR RNA (crRNA) and a 14-15 base pair long recognition target, suggesting that the immune functions of the CRISPR systems are on be used in a natural way ( Jinek et al. Science (2012) 337 (6096): 816-821 ; Brouns et al. Science (2008) 321: 960-964 ; Semenova et al. PNAS (2011) 108: 10098-10103 ).

Herein described are methods for genome editing employing an endonuclease, such as the Cas9 nuclease encoded by a cas9 gene to perform direct genome evolution / changes (deletions, substitutions, additions) in the DNA, such as genomic DNA to create. The cas9 gene can be obtained from any source, such as a bacterium, such as the bacterium S. pyogenes. The nucleic acid sequence of cas9 and / or amino acid sequence of Cas9 may be mutated relative to the sequence of a naturally occurring cas9 and / or Cas9; For example, mutations may be one or more insertions, deletions, substitutions, or any combination of two or more of the foregoing. In such embodiments, the resulting mutant Cas9 may have increased or decreased nuclease activity relative to the naturally occurring Cas9.

The 1A . 1B , and 11A show a CRISPR-mediated genome editing procedure called CRISPR-assisted rational protein engineering (CARPE). CARPE is a two-step construction process that relies on the generation of "donor" and "target" libraries that incorporate directed mutations of single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA) editing cassettes directly into the genome. In the first stage of the donor construction ( 1A ), rationally designed editing oligos with a guide RNA (gRNA) that hybridizes to or targets a target DNA sequence, such as a sequence 5 'of an open reading frame or other sequence of interest, in cells co -transformiert. A key innovation of CARPE is the design of editing oligonucleotides that couple the deletion or mutation of a single "Protospacer Adjacent Motif" (PAM) motif with the mutation of one or more desired codons in the adjacent gene, thereby creating the entire donor library in a single transformation. The donor library is then recovered by amplification of the recombinant chromosomes, e.g. By a PCR reaction, using a synthetic feature of the editing oligonucleotide; a second PAM deletion or mutation is incorporated simultaneously at the 3 'end of the gene. This approach therefore directly covalently couples the codon-targeted mutations to a PAM deletion. In a second stage of CARPE ( 1B ) are PCR amplified donor libraries carrying the target PAM deletion / mutation and the targeted mutations (desired mutation (s) of one or more nucleotides, such as one or more nucleotides in one or more codons) Target gRNA vector co-transformed into naive cells to create a population of cells expressing a rationally designed protein library.

In the CRISPR system, the CRISPR trans-activating (tracrRNA) and the spacer RNA (crRNA) direct selection of a target region. As used herein, a target region refers to any locus in the nucleic acid of a cell or population of cells in which at least one mutation of at least one nucleotide, such as a mutation of at least one nucleotide in at least one codon (one or more codons) it is asked for. The target region may be, for example, a genomic locus (genomic target sequence) or an extra-chromosomal locus. The tracrRNA and crRNA can be expressed as a single, chimeric RNA molecule, termed a single-guide RNA, guide RNA or gRNA. The nucleic acid sequence of the gRNA comprises a first Nucleic acid sequence, which is also referred to as a first region that is complementary to a region of the target region, and a second nucleic acid sequence, which is also referred to as a second region, which forms a hairpin structure and for the recruitment of Cas9 serves to the target region. In some embodiments, the first region of the gRNA is complementary to a region located upstream of the target genomic sequence. In some embodiments, the first region of the gRNA is complementary to at least a portion of the target region. The first region of the gRNA may be fully complementary (100% complementary) to the genomic target sequence or may include one or more mismatches, provided that it is sufficiently complementary to the target genomic sequence to specifically hybridize / direct Cas9 and to recruit. In some embodiments, the first region of the gRNA is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or at least 30 nucleotides long. In some embodiments, the first region of the gRNA is at least 20 nucleotides in length. In some embodiments, the hairpin structure formed by the second nucleic acid sequence is at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides long. In specific embodiments, the hairpin structure is between 80 to 90 or 82 to 85 nucleotides in length, and in other specific embodiments, the second region of the gRNA that forms a hairpin structure is 83 nucleotides in length.

In some embodiments, the sequence of the gRNA (from the donor library) introduced into the first cell using the CARPE method is the same as the sequence of the gRNA (from the target library) into the second / naive cell is introduced. In some embodiments, more than one gRNA is introduced into the population of the first cells and / or the second cell population. In some embodiments, the more than one gRNA molecule comprises a first nucleic acid sequence that is complementary to more than one target region.

In the CARPE method, double-stranded DNA cassettes, also referred to as editing oligonucleotides, for use in the described methods can be obtained from or derived from many sources. For example, in some embodiments, the dsDNA cassettes are derived from a nucleic acid library that has been diversified by non-homologous random recombination (NRR); such a library is referred to as an NRR library. In some embodiments, the editing oligonucleotides are synthesized, for example, by array-based synthesis. The length of the editing oligonucleotides may depend on the method used to obtain the editing oligonucleotides. In some embodiments, the editing oligonucleotide is about 500-200 nucleotides, 75-150 nucleotides, or between 80-120 nucleotides in length.

An editing oligonucleotide includes (a) a region homologous to a target region of the nucleic acid of the cell and a mutation (referred to as a desired mutation) of at least one codon relative to the target region, and (b) a protospacer Adjacent Motif "(PAM) mutation. The PAM mutation may be any insertion, deletion or substitution of one or more nucleotides that mutate the sequence of the PAM so that it is no longer recognized by the CRISPR system. A cell comprising a PAM mutation may be termed "immune" to CRISPR-mediated killing. The desired mutation relative to the sequence of the target region may be an insertion, deletion and / or substitution of one or more nucleotides on at least one codon of the target region.

The CARPE method will now be described for the purpose of illustration only with reference to a bacterial gene. These methods can be applied to any gene (s) of interest comprising genes from any prokaryote, including bacteria and archaea, or any eukaryotes, including yeast and mammalian (including human) genes. The CARPE procedure was performed on the galK gene in the E. coli genome, due in part to the availability of activity assays for this gene. The procedure was performed using the BW23115 parental strains and the pSIM5 vector ( Datta et al. Gene (2008) 379: 109-115 ) to facilitate recombineering. The cas9 gene was cloned under control of a pBAD promoter into a pBTBX-2 backbone to allow control of cleavage activity by the addition of arabinose. Assessment of the ability to selectively incorporate synthetic dsDNA cassettes (127 bp) was carried out using dsDNA cassettes from the NNK libraries constructed from degenerate primers and / or rationally designed oligonucleotides (oligos), part of which a library of 27,000 members were synthesized using microarray technology. In both cases, the oligonucleotides were designed to mutate the active site residues of the galK gene product. The highly efficient recovery of donor strain libraries was verified based on the changes in amplicon sizes obtained with primers against the galK locus. Sequencing of these colony PCR products from the NRR libraries indicated that the synthetic priming site (P1) from the dsDNA cassette with an efficiency of approximately 90-100% was incorporated. This suggests that these libraries can be generated with high efficiency without depending on the error-prone mutS knockout strains typically used in other recombineering-based editing approaches ( Costantino et al. PNAS (2003) 100: 15748-15753 ; Wang et al. Nature (2009) 460: 894-898 ). There was a decrease in the efficiency of codon mutations (approximately 20%), which may be due to mutS corrections by allelic exchange. A preliminary assessment of the clones in the target libraries indicates that the final codon editing efficiency was about 10% when both phases of construction were performed in the mutS ⁺ background.

A comparison was made with other recently published protocols for co-selectable editing that use alternative protocols that non-covalently link the PAM and codon mutations, but instead rely on their proximity to each other during replication ( Wang et al. Nat. Methods (2012) 9: 591-593 ). In these non-covalent experiments, the same editing oligos were used as above and efforts were made to co-select their insertion using the ssDNA oligos targeting the same donor / target PAM sites. Colony screening of the resulting mutants showed high efficiency in the recovery of PAM mutants. However, there seems to be no strong co-selection for the insertion of dsDNA editing cassettes. This may be due to the large differences in the relative recombineering efficiencies of the PAM target oligonucleotides and the editing cassettes, which generate considerable chromosomal deletions.

The ability to improve the final editing efficiencies of the CARPE process can be evaluated, for example, by performing donor construction in mutS-deficient strains before transferring them to a wild-type donor strain in an effort to loss the mutations to prevent the donor construction phase. In addition, the generality of the CARPE method can be assessed, for example, by applying CARPE to a number of essential genes, including dxs, metA, and folA. Essential genes have been effectively targeted using the described gRNA design strategies. The results also indicate that despite the gene disruption that occurs during generation of the donor library, the donor libraries can be effectively constructed and recovered within 1-3 hours after recombineering.

Also provided herein are methods for traceable, accurate genome editing using a CRISPR-mediated system, referred to as "Genome Engineering by Trackable CRISPR Enriched Recombination" (GEn-TraCER). The GEn-TraCER methods achieve highly efficient editing / muting using a single vector encoding both the editing cassette and the gRNA. GEN-TraCER, when used in conjunction with parallel DNA synthesis, such as array-based DNA synthesis, provides one-step generation of thousands of precise changes / mutations, and allows the mutation to be sequenced by editing the cassette on the cassette Vector instead of sequencing the genome of the cell (genomic DNA). These methods are widely used in protein and genome engineering applications as well as for the reconstruction of mutations such as mutations identified in laboratory evolution experiments.

The gene-TraCER methods and vectors combine an editing cassette comprising a desired mutation and a PAM mutation with a gene encoding a gRNA on a single vector which allows the generation of a library of mutations in a single vector Reaction allows. As in 11B As shown, the method comprises introducing a vector comprising an editing cassette containing the desired mutation and the PAM mutation into a cell or a population of cells. In some embodiments, the cells into which the vector was introduced also encode Cas9. In some embodiments, a gene encoding Cas9 is then introduced into the cell or population of cells. Expression of the CRISPR system, which includes Cas9 and gRNA, is activated in the cell or cell population; the gRNA recruits Cas9 to the target region where dsDNA cleavage occurs. Without wishing to be bound by any particular theory, the homologous region of the editing cassette that is complementary to the target region mutates the PAM and the one or more codons of the target region. Cells from the population of cells that did not integrate the PAM mutation undergo non-edited cell death due to Cas9-mediated dsDNA cleavage. Cells of the population of cells that have integrated the PAM mutation undergo no cell death; they remain viable and are selectively enriched for high abundance. Viable cells are obtained and a library of targeted mutations provided.

The method of traceable genome editing using GEn-TraCER comprises: (a) introducing a vector encoding at least one editing cassette, a promoter, and at least one gRNA into a cell or population cells, thereby producing a cell or a population of cells comprising the vector (a second population of cells); (b) maintaining the second population of cells under conditions under which Cas9 is expressed, wherein the Cas9 nuclease is encoded on the vector, a second vector or in the genome of the cells of the second population of cells, resulting in DNA cleavage and death of cells of the second population of cells that do not comprise the PAM mutation, wherein cells of the second population of cells comprising the PAM mutation are viable; (c) obtaining viable cells; and (d) sequencing the editing cassette of the vector in at least one cell of the second population of cells to identify the mutation of at least one codon.

In some embodiments, a separate vector encoding cas9 is also introduced into the cell or population of cells. Introduction of a vector into a cell or population of cells may be carried out using any method or technique known in the art, for example, vectors may be introduced by standard protocols, such as transformation, involving chemical transformation and electroporation, transduction and particle bombardment.

An editing cassette comprises (a) a region that recognizes (hybridizes to) a target region of a nucleic acid in a cell or a population of cells that is homologous to the target region of the nucleic acid of the cell and a mutation (referred to as a desired mutation) of at least one nucleotide in at least one codon relative to the target region, and (b) a "Protospacer Adjacent Motif" (PAM) mutation. The PAM mutation may be any insertion, deletion or substitution of one or more nucleotides that mutates the sequence of the PAM such that the mutant PAM (PAM mutation) is not recognized by the CRISPR system. A cell comprising such a PAM mutation may also be termed "immune" to CRISPR-mediated killing. The desired mutation relative to the sequence of the target region may be an insertion, deletion, or or substitution of one or more nucleotides in at least one codon of the target region. In some embodiments, the distance between the PAM mutation and the desired mutation on the editing cartridge is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides on the editing cassette. In some embodiments, the PAM mutation is at least 9 nucleotides from the end of the editing cartridge. In some embodiments, the desired mutation is at least 9 nucleotides from the end of the editing cartridge.

In some embodiments, the desired mutation, relative to the sequence of the target region, is an insertion of a nucleic acid sequence. The inserted into the target region nucleic acid sequence can be of any length. In some embodiments, the inserted nucleic acid sequence is at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or at least 2000 nucleotides long. In embodiments in which a nucleic acid sequence is inserted into the target region, the editing cassette comprises a region comprising at least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or is at least 60 nucleotides long and homologous to the target region.

The term "GEn-Tracer cassette" may be used to refer to an editing cassette, promoter, spacer sequence, and at least a portion of a gene encoding a gRNA. In some embodiments, a portion of the gRNA-encoding gene on the GEn-TraCER cassette encodes that portion of the gRNA that is complementary to the target region. In some embodiments, the portion of the gRNA that is complementary to the target region is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or at least 30 nucleotides long. In some embodiments, the portion of the gRNA that is complementary to the target region is 24 nucleotides in length. In some embodiments, the GEn-TraCER cassette further comprises at least two priming sites. In some embodiments, the priming sites may be used to amplify the GEn-TraCER cassettes, for example by PCR. In some embodiments, the portion of the gRNA that is complementary to the target region is used as a priming site.

In the GEn-TraCER method, edit cassettes and GEn-TraCER cassettes for use in the described methods may be obtained from, or derived from, many sources. For example, in some embodiments, the editing cartridge is synthesized, for example, by array-based synthesis. In some embodiments, the GEn-TraCER cassette is synthesized, for example, by array-based synthesis. The length of the edit cassette and / or GEn-TraCER cassette may depend on the methods used to obtain the edit cassette and / or the GEn-TraCER cassette. In some embodiments, the editing cartridge is about 50-30 nucleotides, 75-200 nucleotides, or between 80-120 nucleotides long. In some embodiments, the GEn-TraCER cassette is about 50-300 nucleotides, 75-200 nucleotides, or between 80-120 nucleotides long.

In some embodiments, the method also includes obtaining the GEn-TraCER cassettes, for example, by array-based synthesis, and constructing the vector. Methods for constructing a vector will be known to one of ordinary skill in the art and may involve ligating the GEn-TraCER cassette into a vector. In some embodiments, GEn-TraCER cassettes or a subset (pool) of GEn-TraCER cassettes are amplified prior to construction of the vector, for example, by PCR.

The cell or population of cells comprising the vector, and also encoded for Cas9, is maintained or cultured under conditions under which Cas9 is expressed. Cas9 expression can be controlled. The methods described herein may include maintaining the cells under conditions in which Cas9 expression is activated, resulting in the production of Cas9. Specific conditions under which Cas9 is expressed will depend on factors such as the nature of the promoter used to regulate Cas9 expression. In some embodiments, Cas9 expression is induced in the presence of an inducer molecule, such as arabinose. Cas9 expression occurs when the cell or population of cells comprising the Cas9-encoding DNA is in the presence of the inducer molecule. In some embodiments, Cas9 expression is suppressed in the presence of a repressor molecule. Expression of Cas9 occurs when the cell or population of cells comprising the Cas9-encoding DNA is in the absence of a molecule that suppresses the expression of Cas9.

The cells of the population of cells that remain viable are maintained or isolated from the cells that undergo non-edited cell death as a result of Cas9-mediated killing; this can be done, for example, by spreading the population of cells on a culture surface, allowing the viable cells to grow, which are then available for evaluation.

The desired mutation coupled to the PAM mutation is traceable using the GEn-TraCER method by sequencing the editing cassette on the vector into viable cells (cells that incorporate the PAM mutation) from the population. This allows easy identification of the mutation without having to sequence the genome of the cell. The methods include sequencing the editing cartridge to identify the mutation of one or more codons. Sequencing of the editing cassette may be done as part of the vector or after separation of the vector and optionally amplification. Sequencing can be performed using any of the sequencing techniques known in the art, such as by Sanger sequencing.

The methods described herein can be performed in any cell type in which the CRISPR system can function (e.g., target and cut DNA), including prokaryotic and eukaryotic cells. In some embodiments, the cell is a bacterial cell, such as Escherichia spp. (eg, E. coli). In other embodiments, the cell is a fungal cell, such as a yeast cell, e.g. B. Saccharomyces spp. In other embodiments, the cell is an algal cell, a plant cell, an insect cell, or a mammalian cell comprising a human cell.

A "vector" is any type of nucleic acid comprising a desired sequence or sequences to be delivered to or expressed in a cell. The desired sequence (s) can be incorporated into a vector, for example by restriction and ligation or by recombination. The vectors are usually composed of DNA, although RNA vectors are also available. Vectors include, but are not limited to: plasmids, fosmids, phagemids, virus genomes and artificial chromosomes.

Vectors useful in the GEN-TraCER method include at least one editing cassette as described herein, a promoter, and at least one gene encoding a gRNA. In some embodiments, more than one editing cartridge (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more editing cartridges) is contained on a vector. In some embodiments, the more than one editing cartridge is homologous to different target regions (e.g., there are several editing cartridges, each of which is homologous to a different target region). Alternatively or additionally, the vector may contain more than one gene encoding a gRNA (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more gRNAs). In some embodiments, the more than one gRNA contains regions that are complementary to a portion of different target regions (eg, there are different gRNAs, each of which is homologous to a different target region).

In some embodiments, a GEn-TraCER cassette comprising at least one editing cassette, a promoter, and a gene encoding a portion of a gRNA is ligated into a vector that encodes a different portion of a gRNA. After ligation, the portion of the gRNA of the GEn-TraCER cassette and the other portion of the gRNA are ligated to form a functional gRNA.

The promoter and the gene encoding the gRNA are operably linked. In some embodiments, the methods include introducing a second vector encoding Cas9. In such embodiments, the vector may further comprise one or more promoters operably linked to a gene encoding Cas9. As used herein, "operatively" means that the promoter effects or regulates transcription of the DNA encoding a gene, such as the gene encoding the gRNA or the gene encoding Cas9. The promoter may be a native promoter (a promoter present in the cell into which the vector is introduced). In some embodiments, the promoter is an inducible or repressible promoter (the promoter is regulated to facilitate inducible or repressible transcription of a gene, such as the gene encoding the gRNA or the gene encoding Cas9), such as Promoters that are regulated by the presence or absence of a molecule (eg, an inducer or a repressor). The type of promoter required for expression of the gRNA may vary based on the species or cell types and will be recognized by one skilled in the art.

In some embodiments, the method comprises introducing a separate Cas9-encoding vector into the cell or population of cells before or simultaneously with introducing the vector comprising at least one editing cassette as described herein, a promoter, and at least one gRNA. In some embodiments, the gene encoding Cas9 is integrated into the genome of the cell or population of cells. The Cas9-encoding DNA may comprise a promoter prior to introduction of the vector comprising at least one editing cassette as described herein, a promoter, and at least one gRNA, or after insertion of the vector containing at least one editing cassette as described herein , and at least one gRNA comprises integrated into the cellular genome. Alternatively, a nucleic acid molecule, such as a DNA encoding Cas9, can be expressed by the DNA integrated into the genome. In some embodiments, the gene encoding Cas9 is integrated into the genome of the cell.

Vectors useful for the GEn-TraCER methods described herein may further comprise a spacer sequence, two or more priming sites, or both a spacer sequence and two or more priming sites. In some embodiments, the presence of the priming sites flanking the GEn-TraCER cassette allows for amplification of the nucleic acid sequences of the editing cassette, promoter, and gRNA.

EXAMPLES

Example 1: Using the CARPE method to edit galK

The CARPE approach was performed on the galactokinase gene, galK, in the E. coli genome; There are many available assays to study the activity of the gene product. These experiments were performed using the E. coli BW23115 parent and the pSIM5 vector ( Datta et al. Gene (2008) 379: 109-115 ) to facilitate recombineering. The Cas9-encoding gene was cloned into the pBTBX-2 backbone under control of a pBAD promoter to allow control of Cas9 cleavage activity by adding arabinose to the culture medium.

Initially, the ability to selectively incorporate synthetic dsDNA cassettes (127 bp) was tested. The synthetic dsDNA cassettes are derived from NNR libraries constructed from degenerate primers or rationally designed oligos synthesized as part of a library of 27,000 members using microarray technology. In both cases, the oligonucleotides were designed to mutate the active site residues of the galK gene product as well as contain the synthetic priming site, P1 (SEQ ID NO: 1). The highly efficient recovery of donor strain libraries was verified based on the changes in amplicon sizes obtained by colony PCR with primers against the galK locus. Sequencing of these colony PCR products from the NNR libraries indicated that the synthetic priming site (P1) was incorporated from the dsDNA cassettes with an efficiency of approximately 90-100% ( 2 ). This surprising and unexpected result suggests that libraries can be generated with high efficiency without relying on the error-prone mutS knockout strains typically used in other recombineering-based editing approaches ( Costantino et al. PNAS (2003) 100: 15748-15753 ; Wang et al. Nature (2009) 460: 894-898 ). However, there was a decrease in the efficiency of codon mutations (approximately 20%), which may be due to correction by MutS during the allelic replacement. In this work, the final codon editing efficiency was about 10% when both phases of construction were performed in the mutS ⁺ background.

To increase the final editing efficiencies and generality of the CARPE process, donor construction can be performed in mutS-deficient strains prior to transfer to a mutS + donor strain in which Efforts to prevent the loss of mutations during the donor construction phase.

Example 2: Use of the CARPE method to target essential genes

To test the generality of the CARPE approach, the method described above was applied to a number of essential genes, including dxs, metA, and folA. Essential genes can be targeted using gRNA design strategies ( 3 ).

Data from CARPE experiments targeting the dxs gene also suggest that, in spite of the gene disruption that occurs during donor library generation, it is possible to construct the donor libraries effectively and within 1-3 hours to regain the recombineering.

Example 3: Use of the CARPE process to modulate the production of isopentenol.

The quest for better fuel for industrial manufacturing through bacterial production requires the ability to perform state-of-the-art genome design, engineering, and screening for the desired product. We have already demonstrated the ability to modify the expression levels of each gene in the E. coli genome ( Warner et al. Nat. Biotechnol (2010) 28: 856-862 ). This technique, called Traceable Multiplex Recombination (TRMR), generates a library of approximately 8,000 genomically-modified cells (~4,000 overexpressed genes and ~4,000 knock-down genes). This library was later screened under various conditions, allowing for a deeper understanding of the activities of the gene products and leading to more efficient strains among these selections. TRMR allows the modification of protein expression at two levels (overexpressed and knock-down), but it did not allow the modification of the open reading frame (ORF). Here we want to create large libraries of ORF modifications and construct whole metabolic pathways for the optimal production of biofuels.

A major difficulty in producing such libraries that are rationally designed (as opposed to random mutagenesis) is the insertion efficiency of the desired mutations into the target cells. Recombinering, the canonical method for genome modifications in E. coli, uses recombinant lambda phage genes to facilitate the insertion of foreign DNA into the host genome. However, this process suffers from low efficiencies and can be overcome either by addition of an antibiotic resistance gene followed by selection (as in TRMR) or by recursively causing recombination events (ie by MAGE (FIG. Wang et al. Nature (2008) 460: 894-898 ). The CARPE method described herein increases recombination efficiency by incorporating the use of the CRISPR system, thereby removing all non-recombinant cells from the population. CRISPR is a recently discovered RNA-based, adaptive defense mechanism of bacteria and archaea against invading phages and plasmids ( Bhaya et al. Ann. Rev. of Genetics (2011) 45: 273-297 ). This system underwent massive engineering to allow for sequence-directed double-strand breaks using two plasmids; one plasmid codes for the CRISPR-associated nuclease Cas9 and the second plasmid codes for the sequence-specific guide RNA (gRNA), which leads Cas9 to its unique position ( Qi et al. Cell (2013) 45: 273-297 ). The CARPE method utilizes the ability of the CRISPR system in a sequence-dependent manner to disrupt double-strand breaks and, as a result, to induce cell death. We produce DNA recombineering cassettes that contain, in addition to the desired mutation within the ORF, a mutation at a common location outside the open reading frame of the gene targeted by the CRISPR machinery. This approach of linking / coupling the desired mutations to avoiding CRISPR-mediated death due to PAM mutation / deletion allows for dramatic enrichment of engineered cells within the entire population of cells.

The method was further demonstrated using the DXS pathway. The DSX pathway leads to the production of isopentenyl pyrophosphate (IPP), which leads to the biosynthesis of terpenes and terpenoids. Interestingly, IPP may also be the precursor of lycopene and isopentenol, assuming the addition of the required genes. While lycopene turns the bacterial colonies red, and therefore easily screenable, isopentenol is considered a second generation biofuel with a higher energy density and lower water miscibility than ethanol. Three proteins were selected for engineering: 1) DSX, the first and rate-limiting enzyme of the pathway, 2) IspB, which redirects the metabolic flux out of the DXS pathway, and 3) NudF, which was shown to be IPP in both E. coli and B. subtilis isopentenol ( Withers et al. App. Environ. Microbiol (2007) 73: 6277-6283 ; Zheng et al. Biotechnol. for biofuels (2013) 6: 57 ). The mutations in the genes encoding DXS and IspB are screened for increased lycopene production with a new image analysis tool designed to quantify colony color. The NudF activity is measured directly by measuring the Isopentenol levels are measured by GC / MS and indirectly by isopentenol auxotrophic cells that will serve as biosensors. This method offers the possibility of rationally constructing large mutation libraries in the E. coli genome and a strain producing high yields of isopentenol with high accuracy and efficiency.

Example 4: Using the GEn-TraCER method to change galK

The GEn-TraCER method was used to edit the galK gene, which served as a model system for recombineering in E. coli ( Vu et al. 2000 ). The first GEn-TraCER cassettes constructed were designed to introduce a stop codon in-frame at codon 24 of the galK, instead of a PAM, labeled galK_Q24 (FIG. 12 ). The constructs and vectors were designed using a custom Python script to generate the required high throughput mutations.

Control cassettes were prepared by using the circular polymerase cloning method (OPEC) in U.S. Patent Nos. 3,846,769 and 5,402,854 Qi et al. Cell (2013) cloned gRNA vector described. The backbone was linearized with the following primers: CCAGAAATCATCCTTAGCGAAAGCTAAGGAT (SEQ ID NO: 29) and GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT (SEQ ID NO: 30).

The GenTRACER cassettes were ordered as gBlocks and amplified using the following primers: ATCACGAGGCAGAATTTCAGATAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGG (SEQ ID NO: 31), ACTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 32).

The components were assembled using OPEC and transformed into E. coli to generate the vectors. This procedure is to be performed in multiplex using the pooled oligonucleotide libraries with cloning efficiencies in the range of 10 ⁴ -10 ⁵ CFU / μg.

E. coli MG1655 cells carrying pSIM5 (Lambda-RED plasmid) and the X2-cas9 plasmid were incubated at 30 ° C in LB with 50 μg / mL kanamycin and 34 μg / mL chloramphenicol until mid-log phase (0.4- 0.7 OD). The recombineering functions of the pSIM5 vector were induced at 42 ° C for 15 min and then placed on ice for 10 min. The cells were then made electrocompetent by pelleting and washing 2 times with 10 mL of cooled H ₂ O. The cells were transformed with 100 ng of GEn-TraCER plasmid (which also encodes carbenicillin resistance) and recovered at 37 ° for 3 hours. 50-100 μL of the cells were plated on the appropriate medium containing 50 μg / mL kanamycin and 100 μg / mL carbenecillin to selectively enrich the CRISPR-edited strains. Editing efficiencies for the galK gene were calculated using red and white screening on galactose supplemented MacConkey agar.

Based on a screening on MacConkey Agar, editing efficiencies of ~ 100% were observed with the galK_Q24 * design. Interestingly, in contrast to oligo-mediated recombineering, mismatch repair knockouts were required to achieve high efficiencies ( Li et al. 2003 ; Sawitzke et al. 2011 ; Wang et al. 2011 ), no effect in strains with or without intact mismatch repair machinery.

The sequences of the chromosomes and vectors were then verified by Sanger sequencing.

As expected, the designed mutations on the chromosome ( 13 ), suggesting that the mutation was present at both sites and that the plasmid serves as transaging barcode (trans-barcode) or as a record of genome alteration.

The design was adapted for rational mutagenesis of protein-coding screens on a genome-wide scale by generating "silent, selectable scars" derived from synonymous PAM mutations ( 14B , ΔPAM) to "immunize" the cells against Cas9-mediated cleavage but leave the translation product intact. We concluded that the silent scars allow co-selection for nearby changes to a codon or other features of interest with high efficiency. The effects of the arm length of homology and the distance between the PAM mutation / deletion and the desired mutation in galK were examined and the efficiencies compared ( 16B ). A significant increase in mutation efficiency at galK position 145 was observed when the arm length of homology was extended to 80 to 100 nucleotides (~ 5% and 45%, respectively) with identical PAM changes.

Example 5: Use of the GEn-TraCER method to reconstruct mutations

The GEn-TraCER approach has been extended to a genomic scale using custom, automated design software that allows for targets of the sites in the genome with a simple user input function. This approach was developed by reconstructing all non-synonymous point mutations of a recent study on the thermal Adaptation in E. coli ( Tenaillon et al. 2012 ) tested. This study characterized the complete set of mutations that occurred in 115 isolates of independently propagated strains. This dataset provides a diverse source of mutations whose individual fitness effects shed light on the mechanistic foundations of this complex phenotype. Each of these mutations was, if possible, reconstructed with a 2-fold redundancy in codon usage and ΔPAM to allow statistical correction for both the PAM and codon target mutations in a subsequent fitness analysis.

Example 6: Use of the GEn-TraCER method to modulate genetic interactions

A promoter recabling library was generated by integrating a promoter that is dynamically regulated by an environmental signal (oxygen level, carbon source, stress) upstream from each gene in the E. coli genome. Using the GEn-TraCER method, strains have been generated with newly-cabled genotypes that may be advantageous, for example, for tolerance to chemicals of interest to production.

QUOTES INCLUDE IN THE DESCRIPTION

This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Cited non-patent literature

• 35 USC §119 [0001]
• Jinek et al. Science (2012) 337 (6096): 816-821 [0043]
• Cong et al. Science (2013) 339 (6121): 819-823 [0043]
• DiCarlo et al. Nucleic Acids Res. (2013) 41: 4336-4343 [0043]
• Waaijers et al. Genetics (2013) 195: 1187-1191 [0043]
• Cong et al. Science (2013) 339 (6121): 819-823 [0043]
• Wang et al. Cell (2013) 153: 910-918 [0043]
• Jinek et al. Science (2012) 337 (6096): 816-821 [0043]
• Brouns et al. Science (2008) 321: 960-964 [0043]
• Semenova et al. PNAS (2011) 108: 10098-10103 [0043]
• Datta et al. Gene (2008) 379: 109-115 [0050]
• Costantino et al. PNAS (2003) 100: 15748-15753 [0050]
• Wang et al. Nature (2009) 460: 894-898 [0050]
• Wang et al. Nat. Methods (2012) 9: 591-593 [0051]
• Datta et al. Gene (2008) 379: 109-115 [0072]
• Costantino et al. PNAS (2003) 100: 15748-15753 [0073]
• Wang et al. Nature (2009) 460: 894-898 [0073]
• Warner et al. Nat. Biotechnol (2010) 28: 856-862 [0077]
• Wang et al. Nature (2008) 460: 894-898 [0078]
• Bhaya et al. Ann. Rev. of Genetics (2011) 45: 273-297 [0078]
• Qi et al. Cell (2013) 45: 273-297 [0078]
• Withers et al. App. Environ. Microbiol (2007) 73: 6277-6283 [0079]
• Zheng et al. Biotechnol. for biofuels (2013) 6: 57 [0079]
• Vu et al. 2000 [0080]
• Qi et al. Cell (2013) [0081]
• Li et al. 2003 [0085]
• Sawitzke et al. 2011 [0085]
• Wang et al. 2011 [0085]
• Tenaillon et al. 2012 [0089]

Claims (68)

Use of a vector comprising: (i) at least one editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region, and (c) a first "Protospacer Adjacent Motif" (PAM) mutation; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease, for the manufacture of a medicament for genome engineering. Use of a vector comprising: (i) at least one synthesized editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region, and (c) a first "Protospacer Adjacent Motif" (PAM) mutation; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising: (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease, for the manufacture of a medicament for genome engineering. Use of a vector comprising: (i) at least one editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region, and (c) a first "Protospacer Adjacent Motif" (PAM) mutation, where the edit cassette serves as a trans-barcode for subsequent sequencing; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising: (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease, for the manufacture of a medicament for genome engineering. Use of a vector according to any one of claims 1-3, wherein the target region is within a gene of interest within the cell. Use of a vector according to claim 4, wherein the mutation of at least one nucleotide is located within at least one codon of the gene of interest. Use of a vector according to any one of claims 4-5, wherein the PAM mutation is outside the reading frame of the gene of interest. Use of a vector according to any one of claims 4-6, wherein the gene of interest is a prokaryotic gene. Use of a vector according to any one of claims 4-6, wherein the gene of interest is a eukaryotic gene. Use of a vector according to any one of claims 1-8, wherein the mutation of at least one codon is within 100 nucleotides of the PAM mutation. Use of a vector according to any one of claims 1-9, wherein the editing cassette has been chemically synthesized. Use of a vector according to any one of claims 1-10, wherein the editing cassette has been synthesized by array-based synthesis. Use of a vector according to any one of claims 1-11, wherein the gRNA comprises a single chimeric gRNA. Use of a vector according to any one of claims 1-11, wherein the gRNA comprises a crRNA and a trRNA. Use of a vector according to any one of claims 1-13, wherein the vector further comprises at least two priming sites. Use of a vector according to any one of claims 1-14, wherein the vector further comprises a selectable marker. Use of a vector according to any one of claims 1-15, wherein the vector further comprises a nucleic acid encoding a Cas9 nuclease. Use of a vector according to any one of claims 1-16, wherein the genome engineering comprises: (a) introducing the vector into a first population of cells, whereby a second Population of cells comprising the vector; (b) maintaining the second population of cells under conditions under which Cas9 nuclease is expressed, wherein the Cas9 nuclease is encoded on the vector, encoded on a second vector, or encoded on genomic DNA of the second population of cells, thereby obtaining a third Population of cells comprising the vector and the target region comprising the PAM mutation; (c) culturing the product of (b) under conditions suitable for the viability of the cell, thereby producing viable cells comprising a target library; (d) obtaining viable cells produced in (c); and (e) identifying the mutation of at least one nucleotide by sequencing. Use of a vector according to any one of claims 1-16, wherein the genome engineering comprises: (a) introducing the vector into a first population of cells, thereby producing a second population of cells comprising the vector; (b) maintaining the second population of cells under conditions under which Cas9 nuclease is expressed, wherein the Cas9 nuclease is encoded on the vector, encoded on a second vector, or encoded on genomic DNA of the second population of cells, thereby obtaining a third Population of cells comprising the vector and the target region comprising the PAM mutation; (c) screening or selecting for cells having a phenotype of interest; and (d) identifying the mutation of at least one nucleotide by sequencing. Use of a vector according to claim 17 or 18, wherein sequencing comprises sequencing the editing cassette of the vector. Use of a vector according to any one of claims 1-16, wherein the genome engineering comprises: (a) introducing the vector into a first population of cells, thereby producing a second population of cells comprising the vector; (b) maintaining the second population of cells under conditions under which Cas9 nuclease is expressed, wherein the Cas9 nuclease is encoded on the vector, encoded on a second vector, or encoded on genomic DNA of the second population of cells, thereby obtaining a third Population of cells comprising the vector and the target region comprising the PAM mutation; (c) cultivating the product of (b) under conditions suitable for the viability of the cell, thereby producing viable cells containing a target library; (d) obtaining viable cells produced in (c); and (e) identifying the mutation of at least one nucleotide by sequencing the editing cassette of the vector. Use of a vector according to any one of claims 1-16, wherein the genome engineering comprises: (a) introducing the vector into a first population of cells, thereby producing a second population of cells comprising the vector; (b) maintaining the second population of cells under conditions under which Cas9 nuclease is expressed, wherein the Cas9 nuclease is encoded on the vector, encoded on a second vector, or encoded on genomic DNA of the second population of cells, thereby obtaining a third Population of cells comprising the vector and the target region comprising the PAM mutation; (c) screening or selecting for cells having a phenotype of interest; and (d) identifying the mutation of at least one nucleotide by sequencing the editing cassette of the vector. Use of a vector according to any one of claims 17-21, wherein genome engineering further comprises Cas-9-induced cell death of cells that do not comprise the PAM mutation. Use of a vector according to any one of claims 17-22, wherein the cells are prokaryotic cells. Use of a vector according to any one of claims 17-22, wherein the cells are eukaryotic cells. Use of a vector according to claim 24, wherein the cells are yeast, algal, plant or mammalian cells. Use of a vector library for the manufacture of a medicament for genome engineering, wherein the vector library comprises at least two vectors as defined in any one of claims 1-16. Use of a vector library according to claim 26, wherein the vector library is generated by a method comprising: providing a plurality of synthesized editing oligonucleotides each of which (a) is a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region; and (c) a temporary "protospacer adj. motif" (PAM) mutation, transforming the plurality of synthesized editing oligonucleotides and a first guide RNA into a population of Maintaining the cells in the conditions under which Cas9 nuclease is expressed, wherein the Cas9 nuclease on genomic DNA within the Cell is encoded or encoded on a polynucleotide transformed into the cells, enriching the cells comprising the temporary PAM mutation, thereby producing a donor library comprising target regions having the mutation in at least one nucleotide and the temporary PAM mutation comprises amplifying the donor library to incorporate a first PAM mutation, thereby producing an amplified donor library comprising a mutant target region and the first PAM mutation, incorporating a nucleic acid, the encoding at least one guide RNA and at least one promoter into the polynucleotides of the donor library, thereby producing the vector library. Use of a vector library according to claim 27, wherein the enrichment step comprises Cas9-induced cell death of cells which do not comprise the temporary PAM mutation. Use of a vector library according to any one of claims 27-28, wherein the cells are prokaryotic cells. Use of a vector library according to any one of claims 27-28, wherein the cells are eukaryotic cells. Use of a vector library according to any one of claims 27-30, wherein the first gRNA is encoded on a plasmid. Use of a vector library according to any of claims 27-31, wherein the synthesized editing oligonucleotides and the gRNA are introduced sequentially into the first cell. Use of a vector library according to any of claims 27-31, wherein the synthesized editing oligonucleotides and the gRNA are introduced simultaneously into the first cell. Use of a vector library according to any one of claims 27-33, wherein any of the gRNAs comprises a single chimeric gRNA. Use of a vector library according to any one of claims 27-33, wherein any of the gRNAs comprises a crRNA and a trRNA. Use of a vector library according to any one of claims 27-35, wherein the Cas9 nuclease is expressed under the control of an inducible promoter. Use of a vector library according to any one of claims 27-36, wherein the first PAM mutation is downstream of the gene of interest. Use of a vector library according to any one of claims 27-36, wherein the first PAM mutation is upstream of the gene of interest. Use of a vector library according to any one of claims 27-38, wherein the mutation of at least one nucleotide is within 100 nucleotides of the temporary PAM mutation. Use of a vector library according to any one of claims 27-39, wherein the mutation of at least one nucleotide is within 100 nucleotides of the first PAM mutation. Use of a vector library according to any one of claims 27-40, wherein the temporary PAM mutation is near the 5 'terminus of the editing oligonucleotides. Use of a vector library according to any of claims 27-40, wherein the temporary PAM mutation is near the 3 'terminus of the editing oligonucleotides. Use of a vector library according to any one of claims 27-42, wherein the target region is in a gene of interest in the cell. Use of a vector library according to claim 43, wherein the mutation of at least one nucleotide is located within at least one codon of the gene of interest. Use of a vector library according to any of claims 43-44, wherein the temporary PAM mutation is outside a reading frame of the gene of interest. Use of a vector library according to any one of claims 43-45, wherein the first PAM mutation is outside a reading frame of the gene of interest. Use of a vector library according to any one of claims 27-42, wherein the synthesized editing oligonucleotides comprise different mutations within the same target region. Use of a vector library according to any one of claims 27-42, wherein the synthesized editing oligonucleotides comprise different mutations within a different target region. Use of a vector library according to any one of claims 27-48, wherein the synthesized editing oligonucleotides are synthesized by array-based synthesis and optionally amplified. Use of a vector library according to any one of claims 27-49, wherein the synthesized editing oligonucleotides are rationally designed. Use of a vector library according to any one of claims 27-50, wherein the mutation of at least one oligonucleotide comprises one or more substitutions, deletions, or insertions relative to the target region. Use of a vector library according to any of claims 27-51, wherein the nucleic acid encoding at least one guide RNA and a promoter is incorporated into the polynucleotides of the donor library by ligation-based cloning. Use of a vector library according to any one of claims 27-51, wherein the nucleic acid encoding at least one guide RNA and a promoter is incorporated by ligation-free cloning into the polynucleotides of the donor library. Use of a cell for the manufacture of a medicament for genome engineering, the cell comprising a vector as defined in any one of claims 1-16. Use of a cell library for the manufacture of a medicament for genome engineering, the cell library comprising a vector library as defined in any one of claims 26-53. Use of a cell comprising (a) a nucleic acid comprising a target region, (b) a vector comprising (i) at least one editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region, and (c) a first "Protospacer Adjacent Motif" (PAM) mutation; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease, and (c) a Cas9 nuclease for the manufacture of a medicament for genome engineering. Use of a cell comprising (a) a nucleic acid comprising a target region, (b) a vector comprising (i) at least one synthesized editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region, and (c) a first "Protospacer Adjacent Motif" (PAM) mutation; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease, and (c) a Cas9 nuclease for the manufacture of a medicament for genome engineering. Use of a cell comprising (a) a nucleic acid comprising a target region, (b) a vector comprising (i) at least one editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation of at least one nucleotide relative to the target region, and (c) a first "Protospacer Adjacent Motif" (PAM) mutation; the edit cassette serving as a trans-barcode for subsequent sequencing; (ii) a promoter; and (iii) a nucleic acid encoding at least one guide RNA (gRNA) comprising (a) a region that is complementary to a portion of the target region; and (b) a region that interacts with a Cas9 nuclease, and (c) a Cas9 nuclease for the manufacture of a medicament for genome engineering. Use of a cell according to any one of claims 56-58, wherein the nucleic acid further comprises (a) the mutation of at least one nucleotide, and (b) a first "protospacer adj. Motif" (PAM) mutation. Use of a cell according to claim 59, wherein the mutation of at least one nucleotide is identified by sequencing the editing cassette of the vector. Use of a population of cells for the manufacture of a medicament for genome engineering, wherein the population of cells comprises a plurality of cells as defined in any of claims 56-60. Use of a population of cells according to claim 61, comprising a mutant library, wherein each cell of the mutant library comprises a nucleic acid comprising (a) a target region, (b) a mutation of at least one nucleotide within the target region relative to a wild-type target region, thereby producing a target region variant, and (c) comprising a PAM mutation. Use of a population of cells according to claim 62, wherein the mutant library comprises rationally designed mutations in at least one gene of interest. Use of a population of cells according to claim 63, wherein said at least one gene of interest is a prokaryotic gene. Use of a population of cells according to claim 63, wherein said at least one gene of interest is a eukaryotic gene. Use of a population of cells according to any one of claims 62-65, wherein the mutant library comprises target region variants of a gene of interest. Use of a population of cells according to any one of claims 62-65, wherein the mutant library comprises target region variants of at least one gene of interest. Use of a population of cells according to any one of claims 62-65, wherein the mutant library comprises target region variants of at least two genes of interest.

Images