DE19529116A1 - DNA encoding Hevea brasiliensis (S)-hydroxy:nitrilase - Google Patents

Abstract

Purified, isolated (S)-hydroxynitrilase (A) is new. Also new are: (1) a DNA sequence (I) encoding (A) (817 bp sequence given in the specification) or a sequence with at least 80% identity with it in the coding region; (2) vectors contg. (I); (3) host cells contg. (I) or the vector; (4) a recombinant protein expressed from (I) in the cells (sequence of 257 amino acids given in the specification).

Description

The implementation of chemical reactions with the help of biological Catalysts are becoming increasingly important, especially in such Areas of application in which the often pronounced in enzymes Property, in reactions with chiral or prochiral components preferably implement one of the two enantiomers, can be used.

One of the enzymes used is the (S) -hydroxynitrile lyase (Hnl) from Hevea brasiliensis, which besides the formation of aromatic also the formation aliphatic (S) -cyanohydrins from the corresponding aldehydes or ketones catalyzed with HCN or HCN donors (EP-A- 0 632 130). This is important in that with others (S) - Hydroxynitrile lyases such as those from Sorghum bicolor none aliphatic (S) -cyanohydrins can be prepared (tetrahedron letters, 31: 1249-1252, 1990).

The previously known Hnl is made from the leaves of the Hevea brasiliensis Selmar (Physiologia plantarum 75: 97-101, 1989) and has one molecular mass of 46 kDa on (J.E. Poulton in: Cyanide Compounds in Biology [Ciba Foundation Symposium 140], pp 67-91, 1988). However, it is thus, the enzyme was not isolated pure enough to produce specific anti-Hnl antibodies gain or determine amino acid sequences of the Hnl protein. All Attempts to use pure HNL enzyme using other common chromatographic Isolating cleaning steps failed. In all attempts, the enzyme by means of ion exchange chromatography using sodium chloride Gradient elution in pure form to gain no Hnl activity in the column eluate being found. This only succeeded after instead of the usual Sodium chloride gradient ammonium sulfate was used for elution.

The invention accordingly relates to a (S) -hydroxynitrile lyase in purified form and isolated form.

The Hnl isolated and purified in this way has a molecular mass of 30 ± 1 kDa, a specific activity of 19 IU / mg protein and includes the following Amino acid partial sequences:

Partial sequence 1:. . .-leu-met-glu-val-phe-pro-. . .

Partial sequence 2:. . . -gly-ser-leu-phe-gln-asn-. . .

Partial sequence 3:. . .-glu-ile-ala-glu-ile-leu-gln-glu-val-ala.

This made it possible afterwards to reverse transcribe mRNA from Hevea brasiliensis to clone a cDNA copy of the hnl gene has the following nucleotide sequence, of which for the Hnl protein deduced amino acid sequence is given below and that from Hnl Protein-identified partial sequences are marked by underline.

The cDNA contains the entire coding region of the hnl gene with one open reading frame for a polypeptide of 257 amino acids. The molecular one Mass was derived from the DNA sequence determined Amino acid sequence of the coding protein calculated to be 29,227 Da.

Another object of the invention is accordingly a DNA sequence which for (S) -hydroxynitrile lyase encoded or with this sequence in the for hydroxynitrile lyase coding area is over 85% identical. It was made by reverse Transcription obtained from mRNA. The cDNA forms the basis for the extraction of enzyme preparations by heterologous expression in different Host organisms.

The present invention further relates to recombinant proteins, can be produced by heterologous expression of the hnl gene (cDNA) from Hevea brasiliensis in suitable microorganisms, preferably in eukaryotic Microorganisms.

In particular, it has been shown that recombinant Hnl protein which is produced by heterologous expression of the Hevea brasiliensis hnl gene (cDNA) in eukaryotic Microorganisms, such as in Saccharomyces cerevisiae or Pichia pastoris was produced, clearly from the natural, from the plant Hevea brasiliensis isolated Hnl protein differs. The main characteristic is that the specific activity of such recombinant Hnl protein is significantly higher is as the specific activity of the purified natural protein from Hevea brasiliensis. The differences are also manifested in the electrophoretic Behavior of proteins. Both in isoelectric focusing and in Separation in native polyacrylamide gels are the protein bands of purified recombinant and natural Hnl proteins in different Positions found. It is believed that this is different Behavior on plants that do not run identically in the plant and in the microorganisms post-translational modification processes is due and that the higher specific activity of the recombinant Hnl protein on in eukaryotic Microorganisms differently modified protein molecules is due.

example 1 Obtaining pure Hnl protein from Hevea brasiliensis

Portions of 8 g leaves of Hevea brasiliensis (stored at -20 ° C. in 80 ml 20 mM potassium phosphate buffer pH 6.5 with an omnimixer (10,000 U / min, 1.5 min) homogenized with ice cooling. The extract obtained was 1 Hold at 4 ° C for an hour and then to separate the coarse ones Cell components filtered through women's nylon stockings. The retentate was washed again with 20 mM potassium phosphate buffer pH 6.5. Small particles were removed by centrifugation (40 min, 18,000 rpm). This so preserved The crude protein extract was purified by chromatography in the following sequence.

Ion exchange chromatography

A QAE Sepharose F.F. Column (XK 16, 21 cm, Pharmacia, Uppsala, Sweden) was started with buffer I (10 mM histidine-sulfuric acid pH 6.5, 10% sorbitol) equilibrated. After sample application, the column was filled with at least 50 ml Start buffer washed. A linear gradient from 0 to 0.6 M was used for elution (NH₄) ₂SO₄ used in start buffer I. Fractions (10 ml) were collected and tested for Hnl activity, and fractions with Hnl activity pooled.

Hydrophobic interaction chromatography

One column (XK 26, 11 cm) packed with phenyl-Sepharose low subsitution, (Pharmacia) was started with buffer H (0.65 M (NH₄) ₂SO₄ in 0.1 M Potassium phosphate buffer pH 6.0) equilibrated. The united Hnl fractions of the Ion exchange chromatography were at 25% (NH₄) ₂SO₄ saturation set and applied. Then the column was filled with 200 ml of start buffer washed and then with a falling linear (NH₄) ₂SO₄ Gradients (in 0.1 M potassium phosphate, pH 6.0) eluted. 10 ml fractions were collected, tested for Hnl activity, and pooled fractions with Hnl activity.

Exclusion chromatography

A Biogel PISO column (26 × 34 cm, Biorad, Hercules, California) was used 100 mM potassium phosphate buffer pH 6.5 equilibrated. The volume of the Enzyme solution was removed by ultrafiltration (exclusion limit 10,000 Da, Amicon Inc., Beverly, MA). The elution took place at 100 mM potassium phosphate buffer pH 6.5 at room temperature, fractions (6 ml) were collected. The Hnl protein purified in this way showed in the SDS Polyacrylamide gel electrophoresis only a single band in one Molecular weight of 30 ± 1 kDa and had a specific activity of 19 IU / mg.  

Test for Hnl activity

The Hnl enzyme activity was characterized by the formation of benzaldehyde racemic mandelonitrile at 25 ° C and pH 5.0 tracked. 50 µl Enzyme solution was mixed with 900 ul 50 mM sodium citrate buffer pH 5.0 and the activity test by adding 100 µl substrate solution (37.5 mM Mandelonitrile in 10 mM sodium citrate buffer pH 3.5, freshly prepared daily) started. The increase in absorption at 280 nm (measurement against Substrate solution without enzyme) followed for 5 min. 1 IU corresponds to the Amount of enzyme, which is the conversion of 1 µmol of benzaldehyde per minute Mandelonitrile catalyzed under the given conditions.

Example 2 Prepare an expression cDNA library from Hevea brasiliensis

mRNA was made from young leaves of a 10 year old tree of the genus Hevea brasiliensis from the botanical garden of the University of Graz Standard methods prepared (Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, New York, 1990). The cDNA library was produced using and according to Instructions of the documents of the "Zap-cDNA Synthesis Kit" and the "Gigapack II Gold Packaging Extract" (Stratagene Cloning Systems, La Jolla, CA, USA).

Example 3 Isolation of a recombinant plasmid, the expressed protein of which interacts immunologically with antiserum against Hevea brasiliensis hydroxynitrile lyase

Approx. 100,000 phages from the cDNA gene bank were detected in an immune screening Standard methods using a polyclonal anti-Hnl antiserum (Rabbit) examined. The visualization of the specifically bound Antibody was made with an alkaline phosphatase and the chromogenic substrate NBT (Nitroblue Tetrazolium) / X-phosphate (5-Bromo-4- chloro-3-indolyl phosphate; 4-toluidine salt) based detection system (Boehringer Mannheim Biochemica, Mannheim, Germany). From a preserved one the insert from the phage DNA was positive clone according to the protocol "In vivo Excision of pBluescript from Uni-Zap XR "(Stratagene Cloning Systems, La Jolla, CA, USA) into the corresponding recombinant plasmid  (pHNL-100). The size of the cDNA insert was 1100 bp. pHNL-100 was in E. coli SOLR (Stratagene Cloning Systems, La Jolla, CA, USA). By induction with 1 mM IPTG one with the anti-Hnl antiserum immunoreactive LacZ-Hnl fusion protein with a molecular weight of approximately 30-32 kDa detected, as well as in cytosolic protein fractions Hydroxynitrile lyase activity of 0.035 IU / mg protein can be detected. All molecular biological working techniques were derived from Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersience, New York, 1990).

Example 4 Sequencing of the cDNA fragment from Hevea brasiliensis and cloning of the Full length cDNA using PCR methods

DNA sequencing was carried out according to the chain termination method of Sanger et al. (Sanger et al., PNAS, 74: 5463-5467, 1977) using the "DyeDeoxy Terminator Cycle Sequencing Kit" (Applied Biosystems Inc., Foster City, CA, USA) and an automatic "DNA Sequencer 373A" (Applied Biosystems). From first sequence data could be seen will contain an incomplete cDNA insert in the plasmid pHNL-100 is. The missing part in the 5′-area was added as described below:

Phage DNA was isolated from the H. brasiliensis cDNA gene bank and used as Template for a two-stage PCR with two gene-specific primers (primer 1: CCTCCAAGAACGTCAACAAG; Primer 2: CATCAAATGAGCCAATCTCC) and a vector-specific primer (T3: AATTAACCCTCACTAAAGGG) used. PCR cycle 1: only primer 1 and 40 mg cDNA library (H. brasiliensis) DNA; PCR cycle 2: Primer 2 and T3 and 1/10 volume from PCR Cycle 1 as a DNA template. The DNA obtained from PCR cycle 2 was analyzed with EcoRI and StyI cut and the resulting fragment in the corresponding Area of the plasmid pHNL-100 (EcoRI and StyI cut) cloned. The Insert in the resulting construct called pHNL-101 completely sequenced.

Analysis of the DNA sequence revealed an open reading frame starting with ATG at position 1 and ending with a TGA stop codon at position 772, which codes for a protein of 29,227 Da. The size of this protein correlates with the determined molecular weight of that from leaves of H. brasiliensis isolated hydroxynitrile lyase (Hnl). The DNA coding for this protein Sequence was determined as the hnl gene (cDNA) from H. brasiliensis.  

Example 5 Production of hydroxynitrile lyase preparations by overexpression of the H. brasiliensis hnl gene (cDNA) in Escherichia coli

For reasons of cloning technology, new restriction sites, Ncol im Area of the start codon (position 1) and HindIII after the stop codon (position 783), introduced using standard PCR techniques (replacement of the corresponding regions by the PCR fragments). In both cases DNA of the plasmid pHNL-101.

3 ′ area: PCR with primer P51-HX (CCGCTCGAGAAGCTTCAAAGAAGTCAATTATAG) and primer P51-3.2 (CACGCTTCTGAGGGAAAAT), cutting the DNA from the PCR with XhoI and Ce / II and cloning the fragment into the plasmid pHNL-101 (XhoI and Ce / II cut). The resulting plasmid was named pHNL-102.

5 ′ area: PCR with primer P51-EN (GGAATTCCATGGCATTCGCTCATTTT) and Primer P51-3.1A (CCTCCAAGAACGTCAACAAG), cutting the DNA from the PCR with EcoRI and StyI and cloning the fragment into the plasmid pHNL-102 (EcoRI and StyI cut). The resulting plasmid called pHNL-103 was checked by sequencing.

The Ncol-HindIII fragment from pHNL-103 was in the last step in the E. coli Expression vector pSE420 (Invitrogen Corp., San Diego, CA, USA) was cloned. The resulting plasmid pHNL-200 was checked by sequencing and in the E. coli strain Top10 ′ (Invitrogen Corp., San Diego, CA, USA) transformed.

A corresponding transformant was dissolved in 100 ml 2xYT medium (10 g / l NaCl, 10 g / l yeast extract, 16 g / l bactotryptone), supplemented with 100 mg / l Ampicillin-Na salt, in a baffle shake flask at 37 ° C and 160 rpm grown to an optical density of OD₆₀₀ = 0.5. The Protein production was increased by adding 1 mM IPTG (isopropyl-β-D- thiogalactopyranoside) and induced the culture after adding 1% glucose for 3 h continued under the same conditions. The cells were then harvested by centrifugation and in 4 ml digestion buffer (50 mM Potassium phosphate pH 7.4, 1 mM EDTA [ethylenediaminetetraacetate], 1 mM PMSF [Phenylmethylsulfonyl fluoride], 5% glycerol) added. The digestion of the Cells were made under ice cooling with an ultrasonic disintegrator (Labsonic 2000, Braun) with 45 watts over 3 min. The digestion solution was by Centrifugation for 15 min at 27,000 g and 4 ° C in a Sorvall SS-34 rotor and a Sorvall RC-5 centrifuge (DuPont Company, Wilmington, Delaware, USA) separated into soluble and insoluble components. The soluble fraction contained protein with hydroxynitrile lyase activity (0.15 U / mg protein). A Analysis of the proteins in the soluble and insoluble fractions by SDS  Polyacrylamide gel electrophoresis and Western blotting revealed that only about 1% of the entire heterologous immunoreactive Hnl protein produced in the active soluble fraction was present, while 99% of the immunoreactive Hnl Protein in the insoluble fraction in the form of inactive "Inclusion bodies" were to be found.

Proteins of the insoluble fraction were removed by adding 20 ml Denaturation buffer (3.5 M urea, 0.1 M Tris; pH 8.0) solubilized and the insoluble components by centrifugation (15 min at 27,000 g at 4 ° C) away. The protein solution obtained was first countered in several stages Buffer 1 (50 mM potassium phosphate pH 7.4, 1 mM EDTA, 1 M urea) and 5 times against buffer 2 (50 mM potassium phosphate pH 7.4, 1 mM EDTA) at 4 ° C dialyzed. The resulting solubilized and renatured protein preparation showed a specific Hnl activity of 0.8 to 1.4 IU / mg protein.

Example 6 Preparation of hydroxynitrile lyase preparations by overexpression of H. brasiliensis hnl gene (cDNA) in Saccharomyces cerevisiae

For cloning reasons, HindIII Restriction site of the plasmid pHNL-103 two new sites (EcoRI, BamHI) by ligation of the plasmid linearized with HindIII with the Adapter B / E (AGCTTGAATTCGGATCC; AGCTGGATCCGAATTCA) introduced. The resulting construct, designated pHNL-104, was created by Sequencing checked.

The hnl gene (cDNA) was a BamHI fragment from the plasmid pHNL-104 removed and into the Bg / II linearized yeast expression vector pMA91 (Kingsman et al., Methods in Enzymology, 185: 329-341, 1990). The resulting plasmid called pHNL-300 was by Sequencing checked and further in the S. cerevisiae laboratory strain W303 D (Hill et al., Yeast, 2: 163-167, 1986). Transformants were on Minimal medium without leucine (6.7 g / l Yeast Nitrogen Base wlo Amino Acids [Fa. Difco, USA], 20 g / l glucose, 20 ml / l amino acid concentrate without leucine [Adenine 1.0 g / l, methionine 1.0 g / l, arginine 1.0 g / l, threonine 15.0 g / l, histidine 140 g / l, tryptophan 1.0 g / l, uracil 2.0 g / l, lysine 11.5 g / l]). For the The cells were protein produced in a baffle conical flask in 100 ml leucine-free minimal medium at 30 ° C and 150 rpm up to an optical Density of OD₆₀₀ = 5.0 grown and harvested by centrifugation. The Cells were slurried in 5 ml digestion buffer (as in Example 5) and according to the "glass ball method" (Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersience, New York, 1990)  open-minded in a Merckenschlager (Braun, Melsungen, Germany). In the soluble cytosolic fraction could have a hydroxynitrile lyase activity of 4.62 IU / mg protein can be detected. Yeast transformants served as controls with the empty plasmid pMA91, where no cytosolic Hydroxynitrile lyase activity could be demonstrated. The so produced aqueous protein preparations were stored at -20 ° C. Another The possibility of permanent storage of the protein preparation was the preparation after removal of all low molecular weight substances (dialysis at 4 ° C against distilled water) or digestion of the yeast cells Freeze-dry suspension in water (Benchtop 3L, VIRTIS Co., Inc., Gardiner, NY, USA). The activity of an in digestion buffer (as in Example 5) Resolubilized enzyme sample remained almost 100%.

It was also easily possible, starting from the watery ones To prepare protein preparations of highly purified recombinant Hnl protein. Following the same procedure as described in Example 1, it was easy to Way, an enzyme preparation used in SDS-polyacrylamide gel electrophoresis practically only shows a band at 30 ± 1 kDa. Such Preparations of recombined, by overexpression in S. cere visiae Hnl obtained showed specific activity of 22 to 28 IU / mg protein.

Example 7 Production of hydroxynitrile lyase preparations by overexpression of the H. brasiliensis hnl gene (cDNA) in Pichia pastoris

The hnl gene (cDNA) was generated as an EcoRI fragment from the plasmid pHNL-104 in the P. pastoris expression vector pHIL-D2 (Invitrogen Corp., San Diego, CA, USA). The construct with the label pHNL-400 was checked by sequencing.

The transformation of the host strain GS115 (His4-), selection of the histidine Prototrophs and at the same time methanol recovery auxotrophs followed the documentation of the "Pichia Expression Kit" system (Invitrogen Corp., San Diego, CA, USA). Two out of 20 positive transformants which identify the hydroxynitrile lyase in high concentration produced intracellularly. Culturing cells for protein production was also carried out according to the protocols of the "Pichia Expression Kit". By Centrifugation harvested cells were in digestion buffer (as example 5) an optical density of OD₆₀₀ = 50.0 suspended and after the "Glass ball method" (as in Example 6) unlocked. In the soluble cytosolic fraction could hydroxynitrile lyase activity of 16 U / mg protein can be detected. The protein preparations produced in this way were able to do the same  Way as described in Example 6 without significant loss of activity be stored.

Following the same procedure as described in Example 1, you can easily Way a highly purified enzyme preparation can be obtained, which in SDS Polyacrylamide gel electrophoresis practically only one band at 30 ± 1 kDa showed. Such recombinant preparations, by overexpression in Hnl obtained from P. pastoris showed specific activity in the range from 41 to 46 IU / mg protein.

Example 8 Comparison of recombinant Hnl products

Purified Hnl protein preparations were by isoelectric focusing with gels 3-9 (Phast System, Pharmacia, Uppsala, Sweden) or by native Polyacrylamide gel electrophoresis (7.5% polyacrylamide, Tris-Glycine buffer pH 8.8) analyzed. It was found that different There were bands in the various preparations.

With isoelectric focusing, Hnl from H. brasiliensis showed a band an isoelectric point of 4.1. With the recombinant proteins S. cerevisiae and P. pastoris were able to find two or three close together Gangs are found that are slightly further towards basic areas corresponding positions were localized. With recombinant Hnl from P. pastoris was predominant in these shifted positions Find.

The recombinant proteins were shown on native polyacrylamide gel electrophoresis from S. cerevisiae and P. pastoris rather similar behavior. Each could two strong, closely spaced bands flanked by two weak ones Bands as specific for Hnl protein by Western blotting (with polyclonal anti-Hnl antiserum). When analyzing the protein In contrast, H. brasiliensis identified a somewhat diffuse band who had run a little further.  

Example 9 Identification of essential amino acids of hydroxynitrile lyase involved in catalysis

Research in protein databases (Swissprot, PIR, Genpept) using of the search module BLAST (Altschul et al., J. Mol. Biol. 21 Sf 403-410, 1990) as well as the creation of "multiple alignments" and their statistical analysis using program modules from the GCG software package (Program Manual for the Wisconsin Package, version 8, September 1994, Genetics Computer Group, 575 Science Drive ,. Madison, Wisconsin, USA 53711) led to the following interpretation: hydroxynitrile lyase from Hevea brasiliensis is likely to be a large group of structurally related proteins of "α / β hydrolase fold "type (Ollis et al., Protein Engineering, Vol. 5, 197-211, 1992). In addition to a characteristic tertiary fold, these proteins have one So - called catalytic triad with Asp or Ser or Cys as the nucleophilic part of the Triad as well as Asp / Glu and His. To prove that this is from Computer predictions also found amino acids on the catalytic Hydroxynitrile lyase activity is involved (Glu79, Ser80, Cys81, Asp207 and His235), mutant proteins of hydroxynitrile lyase were each with the Amino acid alanine at positions 79, 80, 207, 235 and serine at position 81 manufactured. The mutations were at the level of the plasmid pHNL-104 (see example 6) introduced using standard PCR methods. For the change in amino acid positions 79, 80, and 81 became one mutant, antisense end primer that also contains the subcloning gene-specific restriction interface MunI overlaps, and a vector-specific primer (T3) used (Ausubel et al., Current Protocols in Molecular Biology, Vol. 1 & 2, Greene Publishing Associates and Wiley- Interscience, New York, 1990). For changing the amino acid positions 207 and 235 a special PCR method was used. In doing so a phosphorylated mutant primer in the sense direction, a gene-specific Primer, which is also the restriction site necessary for subcloning Ce / II overlaps and another vector-specific primer (T7) is used (Michael S.F., Bio Techniques 16, 410-412, 1994). Purification of the PCR Products and subcloning were carried out using standard methods. The resulting mutant hnl genes (cDNA) in the plasmids pHNL-105-pHNL-109 were cloned into the expression plasmid pMA91 (pHNL-302-pHNL-306) and the mutant proteins in Saccharomyces cerevisiae as in Example 6 described, produced. In the soluble cytosolic fraction the Hydroxynitrile lyase activity determined with the result that each of the 5 mutations to completely inactivate enzyme activity led. A participation of these amino acids in the direct enzymatic  Catalysis can be derived from this. The global preservation of the protein structure in the mutant proteins compared to the non-mutated protein almost the same running behavior with isoelectric focusing or native Polyacrylamide gel electrophoresis verified (Ausubel et al., Current Protocols in Molecular Biology, Vol. 1 & 2, Greene Publishing Associates and Wiley- Interscience, New York, 1990).

Claims (11)

1. (S) -hydroxynitrile lyase in purified and isolated form. 2. (S) -hydroxynitrile lyase according to claim 1, which has the amino acid sequence derived from the following DNA sequence or is at least 80% identical to it: 3. DNA sequence according to claim 2, which codes for (S) -hydroxynitrile lyase or with this sequence in the region coding for hydroxynitrile lyase is over 85% identical. 4. DNA sequence according to claim 3, which for (S) -hydroxynitrile lyase- Activity includes necessary sequences. 5. Vector, which is a DNA sequence according to one of claims 3 or 4 contains. 6. host cells containing a DNA sequence according to one of claims 3 or 4, which was introduced by means of a vector. 7. Host cells according to claim 6, characterized in that they are cells of microorganisms. 8. Host cells according to claim 6 or 7, characterized in that they Saccharomyces cerevisiae or Pichia pastoris come from. 9. Recombinant protein which can be produced by heterologous expression of a DNA Sequence according to one of claims 3 or 4 in a host cell according to one of claims 6 to 8. 10. Method for producing a protein with (S) -hydroxynitrile lyase- Activity, characterized in that host cells according to one of the Claims 6 to 8 are cultivated and the protein formed is isolated. 11. Use of a recombinant protein according to claim 9 for Production of (S) -cyanohydrins.