DE102021000394A1 - Production of 3,4-dihydroxybenzoate from D-xylose with coryneform bacteria - Google Patents

Abstract

The invention relates to a method for the microbial production of 3,4-dihydroxybenzoic acid starting from a C5 carbon source in the presence of a modified coryneform bacterial cell which has a partially or completely inactivated pyruvate kinase activity (PK) or whose gene encodes the pyruvate Kinase (pyk) is partially or completely deleted. Furthermore, the present invention includes a modified coryneform bacterial cell which has a partially or completely inactivated pyruvate kinase activity and an increased xylose isomerase and xylulose kinase activity and its use for the production of 3,4-dihydroxybenzoic acid. The invention also includes a composition containing 3,4-dihydroxybenzoic acid and the use of 3,4-dihydroxybenzoic acid or a composition containing 3,4-dihydroxybenzoic acid for the production of plastic, plastic fibers, pharmaceuticals, cosmetics, food and/or animal feed.

Description

The invention relates to a microbial, fermentative process for the production of 3,4-dihydroxybenzoate starting from D-xylose units with coryneform bacteria.

3,4-Dihydroxybenzoic acid (3,4-dihydroxybenzoate, protocatechuate, PCA) is a phenolic compound that occurs naturally in plants. In the chemical industry, protocatechuate is of particular interest because, as a copolymer, together with anilines, it is a sought-after starting material for a large number of new polymers and plastic compounds or new polymer fibers. PCA is also in demand as a supplement in the food and feed industry. In addition, PCA has great potential for cosmetic or pharmaceutical applications due to its anti-inflammatory, anti-oxidative, anti-bacterial, anti-viral, anti-aging and anti-fibrotic properties. In addition, positive activities in the fight against cancer are ascribed to PCA.

Due to the chemical synthesis from petroleum, with the known disadvantages of a time, material, cost and resource-intensive production, which is also particularly harmful to the environment, the need to provide a system or process for the production of protocatechuate, the previously no longer has the disadvantages mentioned, is of enormous economic relevance. At the same time, there is the challenge of ensuring that yields and product titers are achieved with a new process that make production on an industrial scale attractive.

Various microorganisms show a native potential for the biosynthesis of PCA. For example, the soil bacterium Bacillus thuringiensis excretes PCA into the medium under iron-limited conditions (Garner, B.L., et al., Curr Microbiol, 2004. 49(2): p. 89-94). Azotobacter paspali accumulates PCA when cultured in defined medium with acetate and D-glucose or sucrose as carbon and energy sources (Collinson, S.K., et al., Canadian Journal of Microbiology, 1987. 33(2): p. 169-175) . In these cases, however, the resulting titers are very low and both organisms are of no industrial importance to date.

The industrially important organism Corynebacterium glutamicum is able to synthesize PCA natively (Kallscheuer, N. et al., Microb Cell Fact, 2018. 17(1): p. 70) and, conversely, to use PCA as a carbon and energy source (Shen, X.H. et al., Applied Microbiology and Biotechnology, 2012. 95(1): pp. 77-89). Due to this, however, the natural PCA production capacity of C. glutamicum is also very low in this strain.

For this reason, various attempts have been made to increase PCA production with coryneform bacteria. The phenylalanine-producing strain C. glutamicum ATCC 21420 was modified to express the gene vanAB, which encodes vanillate O-demethylase. The C. glutamicum ATCC 21420 pCH_vanAB strain showed the bioconversion of 16.0 mM ferulic acid, a lignin-derived phenolic compound, into 6.91 mM PCA after 12 h of fed-batch cultivation (Okai, N., et al., AMB Express, 2017. 7(1): p.130). The expression of the gene ubiC, which codes for the chorismate-pyruvate-lyase, in the strain C. glutamicum ATCC 21420, enabled the formation of 1.4 mM PCA from D-glucose after 80 h cultivation in a 3 L shake flask. The same strain (C. glutamicum ATCC 21420 pCH_ubiC) showed a maximum production of 7.4 mM PCA from D-glucose after 96 h bioreactor-scale fed-batch fermentation (Okai, N., et al., Appl Microbiol Biotechnol, 2016. 100(1): pp. 135-45). In both approaches, the natural PCA catabolism in C.glutamicum was not suppressed.

Further work was therefore initially aimed at the targeted suppression of PCA catabolism and the provision of the new platform strain C. glutamicum DelAro ⁵ (Kallscheuer, N. et al., Microb Cell Fact, 2018. 17(1): p. 70). This strain was further modified by mutagenesis of the IolR operator sequence in the iolT1 promoter region to enhance sugar import and by overexpression of the genes aroF*, qsub and tkt encoding 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase, the Encode dehydroshikimate dehydratase or transketolase and served to enhance PCA biosynthesis. The resulting strain C. glutamicum DelAro ⁵ C7 PO6-iolT1 pMKEx2_aroF*_qsuB pEKEx3_tkt showed production of 13 mM PCA in shake flasks from D-glucose as sole carbon and energy source (Kallscheuer, N. et al., Microb Cell Fact, 2018. 17(1): p.70). This yield is too low for the industrial production of PCA and is therefore unattractive. The most recent work by Kogure et al (2020, Metabolic Engineering), which initially gives the impression that the production of PCA with a titer of 82.7 g L ^-1 appears possible, still points to an economically relevant production of PCA clear disadvantages. A two-stage fermentation approach is required there, in which the cells have to be cultivated to high cell densities in a first step on complex medium. The cells then have to be concentrated and harvested in a manual centrifugation step. Only then can PCA be produced starting from D-glucose in a subsequent biotransformation to be carried out. In addition to the two-stage approach, the use of expensive complex media or D-glucose also remains disadvantageous, so that this process is also not particularly suitable for economical, cost-effective and resource-saving production.

It is therefore an object of the present invention to provide a microorganism which enables PCA synthesis by biotechnological fermentation on an industrial scale. Due to the increased environmental awareness, it is also an object of the present invention to provide a microorganism that enables a safe and at the same time environmentally compatible PCA synthesis that saves time, material, costs and resources. The aim of the present invention is also to do justice to a sustainable bioeconomy in the large-scale production of basic building blocks such as PCA that can be used extensively. A further object is to be able to carry out a biotechnological synthesis of PCA starting from renewable, inexpensive raw materials and to provide correspondingly safe microorganisms with PCA synthesis capacities that can use such raw materials as starting material.

This object is achieved according to the invention by a process for the microbial production of 3,4-dihydroxybenzoic acid, comprising the steps a) providing a solution containing at least water, nitrogen, mineral salts and a C5 carbon source, b) microbial conversion of the C5 carbon source into a solution according to step a) to 3,4-dihydroxybenzoic acid in the presence of a modified coryneform bacterial cell whose pyruvate kinase activity (PK) is partially or completely inactivated or whose gene coding for the pyruvate kinase (pyk) is partially or completely deleted and c) optionally isolating and/or recovering 3,4-dihydroxybenzoic acid from the solution.

Furthermore, the object on which this is based is achieved according to the invention by a modified coryneform bacterial cell which has partially or completely inactivated pyruvate kinase activity and increased xylose isomerase and xylulose kinase activity or whose gene codes for pyruvate kinase (pyk ) is partially or completely deleted and whose genes coding for a xylose isomerase (xyIA) and xylulose kinase (xyIB) are overexpressed.

The present object is also achieved according to the invention by using a corynform bacterial cell modified according to the invention selected from the group containing Corynebacterium and Brevibacterium for the microbial production of 3,4-dihydroxybenzoic acid from D-xylose.

Further advantageous refinements result from the subclaims which refer back thereto.

Advantageous configurations of the method and of the modified coryneform bacterial cell and their use also result from the respective patent claims which refer back thereto.

The invention includes a method for the microbial production of 3,4-dihydroxybenzoic acid, comprising the steps a) providing a solution containing at least water, nitrogen, mineral salts and a C5 carbon source, b) microbial conversion of the C5 carbon source in a solution Step a) to 3,4-dihydroxybenzoic acid in the presence of a modified coryneform bacterial cell whose pyruvate kinase activity (PK) is partially or completely inactivated or whose gene coding for the pyruvate kinase (pyk) is partially or completely deleted and c) an optional isolation and/or purification of 3,4-dihydroxybenzoic acid from the solution.

For the purposes of the present invention, a “modified” coryneform bacterial cell means that a coryneform bacterial cell has endogenous properties to a modified extent, such as increased or reduced, compared to the wild-type host cell or a corresponding starting strain or progenitor strain, or has additional properties through heterologous expression has acquired. According to the invention, this can be done using common methods, such as increased expression of endogenous genes by increasing the number of copies of these genes, e.g. by incorporating further copies into the genome or introducing plasmids with an increased number of copies into the coryneform bacterial cell. According to the invention, these methods can also be used for the increased expression of heterologous genes. The same also applies analogously to the reduction, weakening or partial or complete inactivation of endogenous or heterologously acquired properties of a coryneform bacterial cell.

For the purposes of the present invention, “partially or completely inactivated” or “partially or completely deleted” means that, for example, inactivation of pyruvate kinase (PK) by deleting the gene cg2291 or by inserting a vector or an alternative Sequence in the gene region of cg2291 can be achieved. The gene coding for the pyruvate kinase can be partially or completely changed or deleted, resulting in the complete or almost complete (partial) inactivation of the enzymatic activity.

Alternatively, the gene expression of the pyruvate kinase can be weakened or reduced by genetic modification (mutation) of the signal structures of the gene expression. Signal structures of gene expression are, for example, repressor genes, activator genes, operators, promoters, attenuators, ribosome binding sites, the start codon and terminators. The expert can find information on this, e.g. B. in the patent application WO 96/15246 , in Boyd and Murphy (J. Bacteriol. 1988. 170:5949), in Voskuil and Chambliss (Nucleic Acids Res. 1998. 26:3548, in Jensen and Hammer (Biotechnol. Bioeng. 1998 58:191), in Patek et al (Microbiology 1996. 142:1297 and in known textbooks on genetics and molecular biology such as the textbook by Knippers (“Molecular Genetics”, 8th edition, Georg Thieme Verlag, Stuttgart, Germany, 2001) or that by Winnacker ("Genes and Clones", VCH Verlagsgesellschaft, Weinheim, Germany, 1990).

Mutations that lead to a change in the functional properties of PK, in particular to a changed substrate specificity, are known from the prior art. The work of Yano et al. 1998 Proc Natl Acad Sci USA. 95:5511-5, Oue S. et al. J Biol Chem 1999, 274:2344-9. and Onuffer et al. Protein Sci. 1995 4:1750-7. Transitions, transversions, insertions and deletions can be considered as mutations, as well as methods of directed evolution. Instructions for generating such mutations and proteins belong to the prior art and can be found in well-known textbooks (R. Knippers "Molekulare Genetik", 8th edition, 2001, Georg Thieme Verlag, Stuttgart, Germany), or review articles (N. Pokala 2001, J. Struct Biol 134:269-81 A Tramontano 2004 Angew Chem Int Ed Engl 43:3222-3 NV Dokholyan 2004 Proteins 54:622-8 J Pei 2003 Proc Natl Acad Sci USA 100:11361-6 H Lilie 2003 EMBO Rep 4:346-51 R Jaenicke Angew Chem Int Ed Engl 42:140-2).

"Reduced" or "switched off" in the context of the present invention means that the expression of the coding nucleic acid sequence is worse compared to the situation in a wild-type host cell or is no longer under the expression control of regulatory structures as compared to the situation in the wild-type host cell. For the purposes of the present invention, “reduced” or “switched off” is to be provided as equivalent to “deregulated” or “derepressed”. In the sense of the invention, the regulatory or catalytic activity of proteins or enzymes can also be “reduced” or “switched off”.

The same applies analogously to the "increase" or "increase" of regulatory or catalytic activities of proteins or enzymes.

For the purposes of the present invention, “enhanced” is synonymous with “increased” or “improved”, “changed” or “deregulated” and is used synonymously. “Increased” within the meaning of the present invention means, for example, the increased gene expression of a gene compared to the expression of the respective starting gene or the situation in a wild-type host cell in the unchanged, naturally not increased state. The same is meant within the meaning of the invention with regard to the increased enzyme activity. For example, the wild type of a coryneform bacterial cell represents a genetically unmodified starting gene or enzyme. Coryneform wild type cells of the genus Corynbacterium or Brevibacterium are preferred, coryneform bacterial cells of the wild type Corynebacterium glutamicum are particularly preferred.

According to the invention, in the sense of "wild-type host cells" or as "starting strain" or "precursor strain" or as "production strain" or as "wild-type platform strain" for the corynform bacterial cells modified according to the invention also includes coryneform bacterial cells, which in turn have already changed in their properties are that they are defined and established platform strains or defined production strains of coryneform bacterial cells that are also prepared for the production of intermediates on a large technical or industrial scale and are therefore suitable. For example, the genus Corynebacterium is known in the art for its ability to produce L-amino acids and organic acids. Suitable strains of the genus Corynebacterium, in particular the species Corynebacterium glutamicum, are, for example, the known wild-type strains Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum MB0001 (DE3), Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC13870, Brevibacterium flavum ATCC14067, Brevibacterium lactofermentum ATCC13869 and Brevibacterium divaricatum ATCC14020, and overproducing mutants or strains produced therefrom, so-called production strains or platform strains. The strain Corynebacterium glutamicum DelAro ⁵ -C7 P _O6 iolT1 is also advantageous according to the invention as “wild-type host cells” or as “starting strain” or “precursor strain” or as “production strain” or as “wild-type platform strain” within the meaning of the present invention. The present invention thus also includes modified coryneform bacterial cells which represent a further development according to the invention of the starting strain Corynebacterium glutamicum DelAro ⁵ _-C7 PO6 iolT1, this starting strain being to be regarded as a “wild-type platform strain” according to the invention. For further experiments, modified coryneform bacterial cells were also produced according to the invention and are therefore included in the invention, which represent a further development of the strain Cornyebacterium glutamicum MB0001 (DE3) or also a further development of the strain Cornyebacterium glutamicum DelAro ⁵ , in which case the respective starting strain for this further development according to the invention as "wild-type host cells" or a "parental strain" or "progenitor strain" or a "production strain" or a "wild-type platform strain".

A variant of the present invention comprises a method in which a modified coryneform bacterial cell is used which has increased xylose isomerase and xylulose kinase activity (XylA, XylB) or whose genes code for a xylose isomerase (xylA ) and xylulose kinase (xyIB) are overexpressed.

According to the invention, increased expression of xylose isomerase (xyIA) and/or xylulose kinase (xyIB) can be based on changes selected from the group consisting of a) changes in the regulation or signal structures for gene expression, b) changes in the transcription activity of the coding nucleic acid sequence, or c) increasing the gene copy number of the coding nucleic acid sequence. According to the invention, changes in the signal structures of gene expression are included, for example by changing the repressor genes, activator genes, operators, promoters; Attenuators, ribosome binding sites, the start codon, terminators. Also included is the introduction of a stronger promoter, such as the tac promoter or an IPTG-inducible promoter. Introducing a stronger promoter, such as B. the tac promoter (Amann et al (Gene 1988 69:301-15), or promoters from the group of promoters described by Patek et al (Microbiology 1996 142:1297) is preferred, but not limiting for the present invention. Further examples can be found in WO 96/15246 or in Boyd and Murphy (Journal of Bacteriology 170: 5949 (1988)), in Voskuil and Chambliss (Nucleic Acids Research 26: 3548 (1998)), in Jensen and Hammer (Biotechnology and Bioengineering 58: 191 (1998)), in Pátek et al (Microbiology 142: 1297 (1996)), in Knippers (“Molecular Genetics”, 6th Edition, Georg Thieme Verlag, Stuttgart, Germany, 1995) or also in Winnacker (“ Genes and clones ", VCH Verlagsgesellschaft, Weinheim, Germany, 1990). An increased gene copy number of the nucleic acid sequence coding according to the invention can be chromosomally coded or vector-based, preferably plasmid-coded, in further variants of the invention. The subject of the present invention is a coryneform bacterial cell which encodes the increase in copy number chromosomally or extra-chromosomally, preferably encodes the vector or encodes the plasmid. According to the invention, suitable plasmids are those which are replicated in coryneform bacteria. Numerous known plasmid vectors such. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64:549-554), pEKEx1 (Eikmanns et al., Gene 102:93-98 (1991)), or pHS2-1 (Sonnen et al., Gene 107:69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1. Other plasmid vectors such. B. Those on

pCG4 (US Pat 4, 489, 160 ), or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66 , 119-124 (1990)), or pAG1 (US-A 5, 158, 891 ) can be used in the same way (O. Kirchner 2003, J. Biotechnol. 104:287-99). Vectors with regulatable expression can also be used, such as pEKEx2 (B. Eikmanns, 1991 Gene 102:93-8; O. Kirchner 2003, J. Biotechnol. 104:287-99). Also, the gene can be expressed by integration into the chromosome in single copy (P. Vasicova 1999, J. Bacteriol. 181:6188-91), or multiple copy (D. Reinscheid 1994 Appl. Environ Microbiol 60:126-132). The transformation of the desired strain with the vector to increase the number of copies is carried out by conjugation or electroporation of the desired strain of, for example, C. glutamicum. The method of conjugation is, for example, in Schäfer et al. (Applied and Environmental Microbiology (1994) 60:756-759). Methods for transformation are, for example, in Tauch et al. (FEMS Microbiological Letters (1994) 123:343-347).

In a further variant of the present invention, an increased activity of xylose isomerase (xyIA) and/or xylulose kinase (xyIB) can be based on changes selected from the group containing a) an increase in expression of the coding nucleic acid sequence, b) expression a nuc Leic acid sequence or fragments thereof, which codes for a xylose isomerase (xyIA) and/or xylulose kinase (xyIB) with increased catalytic activity and/or substrate specificity, c) an increase in the stability of the mRNA derived from the coding nucleic acid sequence, or d) a change in the catalytic activity and/or substrate specificity of a xylose isomerase (XylA) and/or xylulose kinase (XylB) for the conversion of D-xylose or a combination of a) - d). The increase in mRNA stability can be achieved, for example, by mutation of the terminal positions that control transcription termination. Measures which lead to a change in the catalytic properties of enzyme proteins, in particular to a changed substrate specificity, are known from the prior art. In addition to preferred partial or complete deletions of regulatory structures according to the invention, changes such as e.g. B. transitions, transversions or insertions, as well as methods of directed evolution. Instructions for generating such changes can be found in well-known textbooks (R. Knippers "Molekulare Genetik", 8th edition, 2001, Georg Thieme Verlag, Stuttgart, Germany).

In a further variant of the present invention, a corynform bacterial cell is used in the method according to the invention, which is modified in such a way that it has increased activity or overexpression of the gene coding for a heterologous xylose isomerase (XylA, xyla), preferably a heterologous xylose -Isomerase from the bacterial isomerase pathway starting from D-xylose, particularly preferably from the organism Xanthomonas campetris. The invention also includes a variant of a method in which a corynform bacterial cell is used which is modified in such a way that it has increased activity or overexpression of the gene coding for an endogenous or native xylulose kinase (XylB, xylB), preferably one endogenous xylulose kinase from the bacterial isomerase pathway starting from D-xylose, particularly preferably from the organism Corynebacterium glutamicum.

The invention also includes a method in which a modified coryneform bacterial cell is used, the catabolic metabolism of which is inactivated for aromatic compounds and which additionally has an increased activity of a DAHP synthase (AroF), preferably a feedback-deregulated DAHP synthase (AroF*). ), and a 3-dehydroshikimate dehydrogenase (QsuB) or whose genes coding for enzymes of the catabolic metabolism of aromatic compounds (DelAro ⁵ ) are deleted and an overexpression of the genes coding for a DAHP synthase (aroF), preferably a feedback-deregulated, DAHP synthase (AroF*), and a 3-dehydroshikimate dehydrogenase (qsuB).

According to the present method, the microbial conversion of a C5 carbon source is carried out using a modified coryneform bacterial cell in which the catabolic network for the degradation of aromatic compounds is switched off by deleting 27 genes (DelAro ⁵ ). In addition, the bacterial cell according to the invention has an increased activity of 3-deoxy-D-arabinoheptulosanate-7-phosphate synthase (DAHP synthase; AroF), preferably a feedback-deregulated DAHP synthase (AroF*), particularly preferably a heterologous feedback-deregulated DAHP synthase (AroF*) from Escherichia coli, and a 3-dehydroshikimate dehydrogenase (QsuB), preferably an endogenous, native or homologous 3-dehydroshikimate dehydrogenase (QsuB) from coryneform bacteria. Or the coryneform bacterial cell modified according to the invention has an overexpression of the gene coding for a DAHP synthase (aroF), preferably a feedback-deregulated DAHP synthase (aroF*) from Escherichia coli, which very particularly preferably codon- is optimized, and an overexpression of the gene coding for a 3-dehydroshikimate dehydrogenase (qsuB), particularly preferably a gene coding for an endogenous, native, homologous 3-dehydroshikimate dehydrogenase (QsuB) from coryneform bacteria, preferably Corynebacterium glutamicum.

Optionally, the solution containing 3,4-dihydroxybenzoic acid (PCA) can be processed according to common methods of microbial or biotechnological practice and/or PCA can be isolated from the solution. If appropriate, the product of the process according to the invention can also be further purified or concentrated or, for further use, can be provided with additives which are adapted to the final end product.

A further variant of the present invention comprises a method in which a modified coryneform bacterial cell is used which additionally has a phosphotransferase (PTS)-independent carbon transporter system, preferably a myo-inositol/proton symporter iolT1, particularly preferably an IolR-derepressed myo- Inositol/proton symporter P ₆ -iolT1.

The invention also includes a method in which a modified coryneform bacterial cell is used, selected from the group containing Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum.

In a further variant of the method according to the invention, a modified coryneform bacterial cell of the genus Corynebacterium glutamicum is used, which consists of a "wild-type host cell" or an "initial strain" or "progenitor strain" or a "production strain" or a "wild-type platform strain" of the genus Corynebacterium glutamicum emerges, preferably from the strain Corynebacterium glutamicum DelAro ⁵ -C7 P _O6 iolT1 emerges.

Also included according to the invention is a method in which the microbial conversion takes place in a solution starting from a C5 carbon source selected from the group containing a) oligosaccharides or polysaccharides containing D-xylose units, b) D-xylose, c) Biomass containing lignocellulose, cellulose or hemicellulose, its hydrolyzate or extract obtained therefrom containing D-xylose units or d) a combination of a) to c). In a further variant of the process according to the invention, the C5 carbon source used is spent sulfite liquor, corn straw, rice straw or bagasse, or their hydrolyzates or extracts obtained therefrom containing D-xylose units.

Variants of the process according to the invention can be run continuously or discontinuously, e.g. A summary of known cultivation methods is described in the textbook by Chmiel (Bioprocess Engineering 1. Introduction to Biochemical Engineering (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreactors and peripheral devices (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)). .

A culture medium to be used should suitably meet the requirements of the respective microorganisms. Descriptions of culture media of various microorganisms are contained in the "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981).

In addition to D-xylose as the starting substrate for PCA formation, sugar and carbohydrates such as e.g. Glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as palmitic acid, stearic acid and linoleic acid, alcohols such as e.g. B. glycerol and ethanol and organic acids such. B. acetic acid can be used.

The invention also includes biomass containing lignocellulose, cellulose or hemicellulose, its hydrolyzate or extract obtained therefrom containing D-xylose units or a combination of the aforementioned substrates. Furthermore, as a C5 carbon source, sulfite waste liquor, corn straw, rice straw or bagasse, or their hydrolyzates or extracts obtained therefrom containing D-xylose units are also included according to the invention.

These aforementioned substances can be used individually or as a mixture.

As the nitrogen source, organic nitrogen-containing compounds such as peptone, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used. The nitrogen sources can be used individually or as a mixture. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as a source of phosphorus.

The culture medium must also contain salts of metals such. B. magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth substances such as amino acids and vitamins can be used in addition to the substances mentioned above. The ingredients mentioned can be added to the culture in the form of a one-off batch or fed in in a suitable manner during the cultivation.

Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acidic compounds such as hydrochloric acid, phosphoric acid or sulfuric acid are more suitable for pH control of the culture way used. Antifoam agents such as e.g. B. fatty acid polyglycol esters can be used. In order to maintain the stability of plasmids, suitable selectively acting substances, e.g. As antibiotics are added. In order to maintain aerobic conditions, oxygen or oxygen-containing gas mixtures such as e.g. B. Air introduced into the culture. The temperature of the culture is usually from 20°C to 45°C, and preferably from 25°C to 40°C. The culture is continued until a maximum of PCA has formed. This goal is usually reached within 10 hours to 160 hours.

The present invention also relates to a modified coryneform bacterial cell which has a partially or completely inactivated pyruvate kinase activity (PK) and an increased xylose isomerase and xylulose kinase activity (XylA, XylB) or whose gene encodes the Pyruvate kinase (pyk) is partially or completely deleted and the genes encoding a xylose isomerase (xyIA) and xylulose kinase (xyIB) are overexpressed.

The invention includes a modified coryneform bacterial cell which has partial or complete inactivation of pyruvate kinase (PK), which can be achieved according to the invention by deleting the gene cg2291 or by inserting a vector or an alternative sequence into the gene region of cg2291 . The gene coding for the pyruvate kinase (pyk) can be partially or completely modified or deleted (Δpyk), with the consequence of the complete or almost complete or partial inactivation of the enzymatic activity of the pyruvate kinase (PK). According to the invention, the pyruvate kinase (PK) or the gene coding for the pyruvate kinase (pyk) is the endogenous enzyme or gene from the genus Cornyebacterium or Brevibacterium. It is preferably the pyruvate kinase or the gene encoding it from Corynebacterium glutamicum. Interestingly, a modified coryneform bacterial cell of the present invention is viable without pyruvate kinase activity and is also capable of microbial production of PCA, which was unexpected.

In a further variant of the present invention, a modified corynform bacterial cell is used which, in addition to the inactivation of the PK or deletion Δpyk, has an increased activity or overexpression of the gene coding for a heterologous xylose isomerase (XylA, xyla), preferably a heterologous xylose -Isomerase from the bacterial isomerase pathway starting from D-xylose, particularly preferably from the organism Xanthomonas campestris. The invention also includes a variant of a corynform bacterial cell which, in addition to the inactivation of the PK or deletion Δpyk and an increased activity of a heterologous xylose isomerase or overexpression of the gene coding for a heterologous xylose isomerase (XylA, xyla) still has an increased activity or Overexpression of the gene coding for a xylulose kinase (XylB, xylB), preferably an endogenous xylulose kinase from the bacterial isomerase pathway starting from D-xylose, particularly preferably from the organism Corynebacterium glutamicum.

1. a) eine teilweise oder komplette Inaktivierung einer Pyruvat-Kinase (PK) mit einer Aminosäuresequenz von wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO: 1 oder Fragmente davon aufweist,
2. b) eine Xylose-Isomerase-Aktivität (XylA) mit einer Aminosäuresequenz von wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO: 2 oder Fragmente davon aufweist,
3. c) eine gesteigerte Aktivität einer Xylose-Isomerase-Aktivität (XylB) mit einer Aminosäuresequenz von wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO: 3 oder Fragmente davon aufweist.

The present invention also relates to a modified coryneform bacterial cell which

1. a) a partial or complete inactivation of a pyruvate kinase (PK) with an amino acid sequence of at least 70% identity to the amino acid sequence according to SEQ ID NO: 1 or fragments thereof,
2. b) a xylose isomerase activity (XylA) with an amino acid sequence of at least 70% identity to the amino acid sequence according to SEQ ID NO: 2 or fragments thereof,
3. c) an increased activity of a xylose isomerase activity (XylB) with an amino acid sequence of at least 70% identity to the amino acid sequence according to SEQ ID NO: 3 or fragments thereof.

1. a) eine Nukleinsäuresequenz kodierend für eine Xylose-Isomerase (xyIA) mit wenigstens 70% Identität zu SEQ ID NO. 5 oder Fragmente oder Allele davon aufweist, und
2. b) eine gesteigerte Expression einer Nukleinsäuresequenz kodierend für eine Xylulose-Kinase (xylB) mit wenigstens 70% Identität zu SEQ ID NO. 6 oder Fragmente oder Allele davon aufweist.
3. c) eine teilweise oder komplette Deletion der Nukleinsäuresequenz kodierend für die Pyruvat-Kinase gemäß SEQ ID NO. 4 der Fragmente oder Allele davon aufweist.

A variant of a modified coryneform bacterial cell according to the invention is characterized in that it

1. a) a nucleic acid sequence coding for a xylose isomerase (xyIA) with at least 70% identity to SEQ ID NO. 5 or fragments or alleles thereof, and
2. b) increased expression of a nucleic acid sequence coding for a xylulose kinase (xylB) with at least 70% identity to SEQ ID NO. 6 or fragments or alleles thereof.
3. c) a partial or complete deletion of the nucleic acid sequence coding for the pyruvate kinase according to SEQ ID NO. 4 having fragments or alleles thereof.

1. a) einer Nukleinsäuresequenz, die unter stringenten Bedingungen mit einer komplementären Sequenz einer Nukleinsäuresequenz gemäß SEQ ID NO. 5 oder SEQ ID NO. 6 oder Fragmente oder Allele davon hybridisiert,
2. b) einer Nukleinsäuresequenz gemäß SEQ ID NO. 5 und SEQ ID NO. 6 oder Fragmente davon, oder
3. c) einer Nukleinsäuresequenz entsprechend jeder der Nukleinsäuren gemäß a) oder b), die sich jedoch von diesen Nukleinsäuresequenzen durch die Degeneriertheit des genetischen Codes oder funktionsneutrale Mutationen unterscheidet.
4. d) einer Nukleinsäure entsprechend jeder der Nukleinsäuren gemäß a) - c), die an die Codon-Usage des Wirts-Stammes angepasst (Codon-optimiert) ist, und
5. e) einer teilweisen oder kompletten Deletion der Nukleinsäure gemäß SEQ ID NO: 4.

A variant of a modified coryneform bacterial cell is also included according to the invention

1. a) a nucleic acid sequence which, under stringent conditions, reacts with a complementary sequence of a nucleic acid sequence according to SEQ ID NO. 5 or SEQ ID NO. 6 or fragments or alleles thereof hybridized,
2. b) a nucleic acid sequence according to SEQ ID NO. 5 and SEQ ID NO. 6 or fragments thereof, or
3. c) a nucleic acid sequence corresponding to each of the nucleic acids according to a) or b), which, however, differs from these nucleic acid sequences by the degeneracy of the genetic code or function-neutral mutations.
4. d) a nucleic acid corresponding to each of the nucleic acids according to a) - c), which is adapted to the codon usage of the host strain (codon-optimized), and
5. e) a partial or complete deletion of the nucleic acid according to SEQ ID NO: 4.

A variant of the present invention further comprises a modified coryneform bacterial cell whose enzymes are inactive for the catabolism of aromatic compounds and which additionally has an increased activity of a DAHP synthase (AroF), preferably a feedback-deregulated DAHP synthase (AroF*), and one 3-dehydroshikimate dehydrogenase (QsuB) or whose genes encoding enzymes of the catabolism of aromatic compounds (Delaro ⁵ ) are deleted and which overexpress the genes encoding a DAHP synthase (aroF), preferably a feedback-deregulated DAHP synthase (aroF *), and a 3-dehydroshikimate dehydrogenase (qsuB).

Included in the invention is a modified coryneform bacterial cell in which the catabolic network for degrading aromatic compounds is switched off by deleting 27 genes (DelAro ⁵ ). In addition, the bacterial cell according to the invention has an increased activity of 3-deoxy-D-arabinoheptulosanate-7-phosphate synthase (DAHP synthase; AroF), preferably a feedback-deregulated DAHP synthase (AroF*), particularly preferably a heterologous feedback-deregulated DAHP synthase (AroF*) from Escherichia coli, and a 3-dehydroshikimate dehydrogenase (QsuB), preferably an endogenous, native or homologous 3-dehydroshikimate dehydrogenase (QsuB) from coryneform bacteria. Or the coryneform bacterial cell modified according to the invention has an overexpression of the gene coding for a DAHP synthase (aroF), preferably a feedback-deregulated DAHP synthase (aroF*) from Escherichia coli, which very particularly preferably codon- is optimized, and an overexpression of the gene coding for a 3-dehydroshikimate dehydrogenase (qsuB), particularly preferably a gene coding for an endogenous, native, homologous 3-dehydroshikimate dehydrogenase (QsuB) from coryneform bacteria, preferably Corynebacterium glutamicum.

The invention also includes a modified coryneform bacterial cell which, in addition to the properties explained above, has a phosphotransferase (PTS)-independent carbon transporter system, preferably a myo-inositol/proton symporter iolT1, particularly preferably an IolR-derepressed myo-inositol/proton Symporter P ₆ -iolT1.

The subject of the present invention is also a modified coryneform bacterial cell which has increased expression of xylose isomerase (xyIA) and xylulose kinase (xyIB) based on changes in non-coding regulatory sequences in front of or behind the coding region of xyl A and /or xylB, including the promoter region. Variants included according to the invention are also modified coryneform bacterial cells which have increased expression of xylose isomerase (xyIA) and xylulose kinase (xyIB) based on an increase in the number of copies of a nucleic acid coding for a xylA and/or xylB gene. The subject matter of the present invention is a modified coryneform bacterial cell in which an increased number of copies of a nucleic acid sequence coding for xylose isomerase and xylulose kinase is chromosomally encoded. Also included according to the invention is a modified coryneform bacterial cell in which an increased number of copies of a nucleic acid sequence coding for xylose isomerase and xylulose kinase is extrachromosomally encoded, preferably plasmid encoded or vector encoded.

1. a) die eine Xylose-Isomerase (XylA) mit einer Aminosäuresequenz gemäß SEQ ID NO. 2 oder Fragmente davon und/oder eine Nukleinsäuresequenz kodierend für eine Xylose-Isomerase (xyIA) gemäß SEQ ID NO. 5 oder Fragmente oder Allele davon aufweist,
2. b) bei der die Aktivität einer Xylulose-Kinase (XylB) mit einer Aminosäuresequenz gemäß SEQ ID NO. 3 oder Fragmente davon und/oder die Expression einer Nukleinsäuresequenz kodierend für eine Xylulose-Kinase (xyIB) gemäß SEQ ID NO. 6 oder Fragmente oder Allele davon gesteigert ist,
3. c) bei der die Pyruvat-Kinase (PK) mit einer Aminosäuresequenz gemäß SEQ ID NO: 1 teilweise oder komplett inaktiviert ist und/oder eine Nukleinsäuresequenz kodierend für die Nukleinsäuresequenz (pyk) gemäß SEQ ID NO. 4 teilweise oder komplett deletiert ist,
4. d) die eine gesteigerte Aktivität und/oder Expression der Gene kodierend für eine feedback deregulierte DAHP-Synthase (AroF*) und einer 3-Dehydroshikimate Dehydrogenase (QsuB) aufweist,
5. e) die eine gesteigerte Aktivität und/oder Expression der Gene kodierend für Phosphotransferase-(PTS)-unabhängiges Kohlenstofftransportersystem aufweist, bevorzugt einen myo-Inositol/Proton-Symporter iolT1, besonders bevorzugt eine IolR-dereprimierten myo-Inositol/Proton-Symporter P₆-iolT1, und
6. f) bei der die Aktivität der Enzyme verantwortlich für den Abbau von aromatischen Verbindungen teilweise oder komplett inaktiviert ist und/oder die Nukleinsäuresequenzen kodierend für Enzyme verantwortlich für den Abbau von aromatischen Verbindungen teilweise oder komplett deletiert sind, sowie
7. g) eine Kombination aus a) - f).

A special variant of the invention includes a modified coryneform bacterial cell,

1. a) a xylose isomerase (XylA) with an amino acid sequence according to SEQ ID NO. 2 or fragments thereof and/or a nucleic acid sequence encoding a xylose isomerase (xyIA) as shown in SEQ ID NO. 5 or fragments or alleles thereof,
2. b) in which the activity of a xylulose kinase (XylB) having an amino acid sequence as shown in SEQ ID NO. 3 or fragments thereof and/or the expression of a nucleic acid sequence encoding a xylulose kinase (xyIB) as shown in SEQ ID NO. 6 or fragments or alleles thereof is increased,
3. c) in which the pyruvate kinase (PK) with an amino acid sequence as shown in SEQ ID NO: 1 is partially or completely inactivated and/or a nucleic acid sequence encoding the nucleic acid sequence (pyk) as shown in SEQ ID NO. 4 is partially or completely deleted,
4. d) which has an increased activity and/or expression of the genes coding for a feedback deregulated DAHP synthase (AroF*) and a 3-dehydroshikimate dehydrogenase (QsuB),
5. e) which has an increased activity and/or expression of the genes coding for phosphotransferase (PTS)-independent carbon transporter system, preferably a myo-inositol/proton symporter iolT1, particularly preferably an IolR-derepressed myo-inositol/proton symporter P ₆ -iolT1, and
6. f) in which the activity of the enzymes responsible for the degradation of aromatic compounds is partially or completely inactivated and/or the nucleic acid sequences coding for enzymes responsible for the degradation of aromatic compounds are partially or completely deleted, and
7. g) a combination of a) - f).

The present invention also relates to a modified coryneform bacterial cell selected from the group containing Corynebacterium and Brevibacterium, in particular Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum.

Erfindungsgemäß besonders geeignete Stämme der Gattung Corynebacterium, insbesondere der Art Corynebacterium glutamicum, sind beispielsweise die bekannten Wildtypstämme Corynebacteriumglutamicum ATCC13032, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC13870, Brevibacterium flavum ATCC14067, Brevibacterium lactofermentum ATCC13869 und Brevibacterium divaricatum ATCC14020, sowie daraus hergestellte, überproduzierende Mutanten bzw. Strains, so-called production strains or platform strains.

The invention thus also includes coryneform bacterial cells, which in turn are already modified in their properties in such a way that they are defined and established platform strains or defined production strains of coryneform bacterial cells, which are also prepared for the production of intermediates on a large-scale or industrial scale and are therefore suitable. For example, the genus Corynebacterium is known in the art for its ability to produce L-amino acids and organic acids.

In addition, it should be noted that the biotechnological products manufactured with coryneform bacteria enjoy the "Generally Recognized As Safe" status (GRAS), which means that coryneform bacteria enjoy an extremely high acceptance for the microbial production of metabolic intermediates. Coryneform bacteria achieve high growth rates and biomass yields on defined media (Grünberger et al., 2012) and there is extensive experience in the industrial use of coryneform bacteria (Becker et al., 2012). This is general prior art information well known to those skilled in the art.

For the purposes of the present invention, the Corynebacterium glutamicum strain, for example, is suitable as a “wild-type host cell” or as a “starting strain” or “precursor strain” or as a “production strain” or as a “wild-type platform strain” for variants of a modified coryneform bacterial cell according to the invention. According to the invention, the strain Corynebacterium glutamicum DelAro ⁵ -C7 PO6 _iolT1 is advantageous as the starting strain for the variants of the present invention.

The present invention thus includes a modified coryneform bacterial cell, which is a further development according to the invention of the platform strain Corynebacterium glutamicum DelAro ⁵ -C7 P _O6 iolT1, wherein the aforementioned platform strain is also to be regarded as a kind of "wild-type platform strain", compared to which the aforementioned properties the enzyme activities or gene expressions of the coryneform bacterial cells modified according to the invention are altered.

This inventively modified coryneform bacterial cell is particularly advantageous in that it contains an unexpectedly high level of PCA (3,4-dihydroxybenzoic acid; protocatechuate) starting from D-xylose, oligosaccharides or polysaccharides containing D-xylose units, D-xylose, Lignocellulose, cellulose or hemicellulose-containing biomass whose hydrolyzate or extract obtained therefrom containing D-xylose units or starting from sulfite waste liquor, corn straw, rice straw or bagasse or their hydrolyzates or extracts obtained therefrom containing D-xylose units or combinations thereof .

The subject of the present invention is also a modified coryneform bacterial cell of the type described above for the production of 3,4-dihydroxybenzoic acid from a C5 carbon source. According to the present invention, preference is given to a C5 carbon source starting from oligosaccharides or polysaccharides containing D-xylose units, D-xylose, lignocellulose, cellulose or hemicellulose-containing biomass, whose hydrolyzate or extract obtained therefrom containing D-xylose Units or starting from sulfite waste liquor, corn straw, rice straw or bagasse, or their hydrolyzates or extracts obtained therefrom containing D-xylose units or combinations thereof.

The invention also includes a method of the type described above, in which a modified coryneform bacterial cell of the type described above is used.

The present invention also includes a use of a modified corynform bacterial cell of the type described above for the microbial production of 3,4-dihydroxybenzoic acid from D-xylose or D-xylose-containing hydrolyzates or extracts of sustainable raw materials.

The present invention also relates to a composition containing 3,4-dihydroxybenzoic acid produced with a modified coryneform bacterial cell of the type described above or by a method of the type described above.

The invention also includes the use of 3,4-dihydroxybenzoic acid, produced with a modified coryneform bacterial cell of the present invention or by a method of the type described above, and the use of a composition of the type described above for the production of plastic, plastic fibers, pharmaceuticals, cosmetics , food and/or feed.

Tables and Figures:

• Table 1 shows an overview of bacterial strains and plasmids of the present invention. The starting or platform strain Corynebacterium glutamicum DelAro ⁵ -C7 _PO6 iolT1 is to be regarded as an advantageous “wild-type starting strain” compared to which the variants of the bacterial cells or bacterial strains according to the invention are modified.
• Table 2 shows an overview of the SEQ ID NO's of the present invention

• 1a)-e) shows the plasmids pK19mobsacB_cg0344-7 ( 1a ), pK19mobsacB_cg2625-40 ( 1b ), pK19mobsacB_0502 ( 1c ), pK19mobsacB_cg1226 ( 1d ) and pK19mobsacB_cg3349-54 ( 1e ) with which the five gene clusters encoding enzymes involved in the degradation of aromatic compounds were deleted.
• 2 shows the plasmids pK19mobsacB-540-del ( 2a ) and pK19mobsacB-PgltA::PdapA-C7 ( 2 B ) with which the regulatory binding site in the promoter region of citrate synthase CS was modified by nucleotide substitutions and integration into the genome of coryneform bacterial cells. In addition to replacing the promoter region of gtlA with dapA, the promoter region PgltA::PdapA-C7 according to the invention also has nucleotide substitutions at position 70 (a->t) and 71 (g->a) before the start codon ATG.
• 3 shows the plasmid pK19mobsac8_P _O6 iolT1 for changing the regulatory binding site in the promoter region of the myo-inositol transporter IolT1 by nucleotide substitutions in C. glutamicum.
• 4 shows plasmid pMKEX2_aroF*_qsuB for the expression of the genes aroF* from Escherichia coli and qsuB from C. glutamicum.
• 5 shows plasmid pEKEx3-tkt for the expression of the tkt gene from C. glutamicum
• 6 shows plasmid pK19mobsacB_pyk with which the nucleic acid sequence coding for the pyruvate kinase was deleted according to the invention in the genome of Corynebacterium glutamicum.
• 7 shows plasmid pEKEx3_xylA-xylB for the expression of the genes xylA from Xanthomonas campestris pv.campestris ATCC33913 and xylB from C. glutamicum.
• 8th shows the growth, substrate uptake and protocatechuate formation of different variants of coryneform bacterial cells. The cultivations were carried out in shake flasks in defined CGXII medium with the addition of either 222 mM D-glucose (strains: DelAro ⁵ -C7 P _O6 -iolT1 pMKEx2_aroF*_qsuB pEKEx3_tkt and DelAro ⁵ -C7 P _O6 -iolT1 Δpyk pMKEx2_aroF*_qsuB pEKEx3_tkt) or 266 mM D-xylose (strains: DelAro ⁵ -C7 PosiolT1 pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB and DelAro ⁵ -C7 P _O6 -iolT1 Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB) as the sole carbon and energy source. Mean values and standard deviations were determined from at least three independent cultures.
• 9 shows PCA titers of C. glutamicum strains DelAro ⁵ -C7 P _O6 -iolT1 pMKEx2_aroF*_qsuB pEKEx3_tkt (PCA _GLC ), DelAro ⁵ -C7 P _O6 -iolT1 ΔpykpMKEx2_aroF*_qsuB pEKEx3_tkt (PCA _GLC Δpyk), DelAro ⁵ -C7 P _O6 -iolT1 pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (PCA _XYL ) and DelAro ⁵ -C7 P _O6 -iolT1 Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (PCA _XYL Δpyk) after 98 h of cultivation. Mean values and standard deviations were determined from at least three independent cultures.
• 10 shows the growth, substrate uptake and protocatechuate formation of different variants of coryneform bacterial cells. The cultivations were carried out in shake flasks in defined CGXII medium with the addition of 266 mM D-xylose as the sole carbon and energy source. Mean values and standard deviations were determined from at least three independent cultures.

Further advantages of the invention result from the dependent claims and from the following description of exemplary embodiments of the present invention, which are shown in the tables and figures. The subject of the invention is explained in more detail below with reference to tables and figures, without the subject of the invention being restricted thereby.

Strain construction C. glutamicum 13032 DelAro ⁵

The methodology described below was used for the construction of C. glutamicum 13032 DelAro ⁵ .

The strain C. glutamicum MB001 (DE3) is chosen as the starting strain for the construction of C. glutamicum 13032 DelAro ⁵ . This is a prophage-free C. glutamicum ATCC13032 wild-type strain (C. glutamicum MB001 strain; Baumgart et al, 2013b), https://doi.org/10.1128/AEM.01634-13), which is described below via has a chromosomally integrated T7 polymerase that allows the use of the strong and inducible T7 promoter (strain C. glutamicum MB001 (DE3); (Kortmann et al., 2015 https://doi.org/10.1111/1751-7915.12236 This promoter is also found on the pMKEx2 plasmids used for the expression of genes of plant origin involved in the synthesis of the product concerned.

Starting from C. glutamicum MB001 (DE3), the strain C. glutamicum DelAro ³ is constructed by deleting the gene (cluster) cg0344-47, cg2625-40 and cg1226 (Kallscheuer et al., 2016a, https://doi.org /10.1016/j.ymben.2016.06.003).

cg0344-47 is the phdBCDE operon, which encodes genes involved in the catabolism of phenylpropanoids such as e.g. B. p-coumaric acid is involved.

To prevent the non-specific conversion of phenylpropanoids by enzyme-catalyzed ring hydroxylation or ring-splitting reactions (the natural substrates of the respective enzymes 4-hydroxybenzoate-3-hydroxylase PobA and protocatechuate dioxygenase PcaGH show a high structural similarity to phenylpropanoids) the corresponding gene (cluster) cg1226 (pobA) and cg2625-40 (cat, ben and pca genes that are essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate) are deleted.

The 3-dehydroshikimate dehydratase QsuB catalyzes the thermodynamically irreversible conversion of the shikimate pathway intermediate 3-dehydroshikimate to protocatechuate, leading to an unwanted loss of intermediates in the aromatic amino acid pathway. The deletion of qsuB reduced the accumulation of protocatechuate. Thus, in the constructed strain C. glutamicum DelAro ³ the gene cg0502 (qsuB) is additionally deleted, resulting in the strain C. glutamicum DelAro ⁴ .

In addition, the genes for the gentisate degradation pathway were deleted. The enzymes of this catabolic pathway are encoded by genes of the gene cluster nagIKL-nagR-nagT-genH (cg3349-54). To prevent any product degradation, the entire gene cluster was deleted, ultimately resulting in the C. glutamicum DelAro ⁵ strain.

Construction pK19mobsacB-cg0344-47-del and pK19mobsacB-cg2625-40-del

For the construction of the plasmid pK19mobsac5-cg0344-47-del ( 1a ) and pK19mobsacB-cg2625-40-del ( 1b ) for the purpose of deleting the gene clusters cg0344-47 and cg2625-40 in C. glutamicum, the flanking fragments of the gene cluster to be deleted, which are required for the homologous recombination event, were amplified by PCR starting from isolated genomic C. glutamicum DNA.

For the generation of the upstream fragment the primer pair cgXXXX-XX-up-s / cgXXXX-XX-up-as was used, the downstream flank was primed with the primer pair cgXXXX-XX-down-s / cgXXXX-XX-down-as amplified. The coding XXXX-XX stands for the cg numbers of the genes to be deleted. For example, for the deletion of the gene cluster cg0344-47, the primer pair cg0344-47-up-s/ cg0344-47-up-as

used and analogously for the deletion of the gene cluster cg2625-40 the primer pair cg2625-40-up-s/ cg2625-40-up-as. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the gene to be deleted) (cgXXXX-XX-up-as / cgXXXX-XX-down-s) were chosen in such a way that the two amplified fragments up and down contain overhangs that are complementary to one another. For the gene cluster cg0344-47 this is the primer pair cg0344-47-up-as/ cg0344-47-down-s and analogously for the gene cluster cg2625-40 the primer pair cg2625-40-up-as/ cg2625-40-down-s . In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve as both primers and templates (overlap-extension PCR). The deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cgXXXX-XX-up-s / cgXXXX-XX-down-as). For the gene cluster cg0344-47 this is the primer pair cg0344-47-up-s/cg0344-47-down-as and similarly for the gene cluster cg2625-40 the primer pair cg2625-40-up-s/cg2625-40-down-as . After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of the deletion plasmids, both the deletion fragments and the pK19-mobsacB empty vector were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes XbaI and EcoRI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using the Rapid DNA Ligation Kit (Thermo Fisher Scientific), one of the two deletion fragments was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After the fragments had been ligated, the entire batch volume was used to transform chemically competent E. coli DH5α cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before being provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with kanamycin (50 µg/ml) and incubated at 37 °C overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of the respective deletion plasmid pK19mobsacB-cg0344-47-del or pK19mobsacB-cg2625-40-del were cultured overnight in LB medium with kanamycin (50 μg/mL) for the isolation of the plasmids grown. The plasmids were then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.

An aliquot of electrocompetent C. glutamicum cells was transformed with the respective deletion plasmid using the protocol described and streaked onto BHIS-Kan ¹⁵ plates. Since the pK19mobsacB plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this resistance would only develop if the deletion plasmid was successfully integrated into the genome of C. glutamicum via the homologous sequences could. In a first round of selection, the integrants obtained were plated out on BHI-Kan ²⁵ plates and BHI 10% sucrose (w/v) plates and incubated at 30° C. overnight. If the deletion plasmid is successfully integrated into the genome, levan sucrase encoded by sacB is formed in addition to kanamycin resistance. This enzyme catalyzes the polymerization of sucrose to the toxic levan, resulting in induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.

The excision of pK19mobsacB took place in a second recombination event via the now doubled DNA regions, in which the gene to be deleted from the chromosome was finally exchanged for the introduced deletion fragment. For this purpose, cells showing the described phenotype (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30° C. and 170 rpm. Subsequently, 100 μl each of a 1:10 dilution were smeared onto BHI-Kan ²⁵ plates and BHI-10% sucrose (w/v) plates and incubated at 30° C. overnight. A total of 50 clones grown on the BHI 10% sucrose (w/v) plate were picked and % sucrose (w/v) plated and incubated overnight at 30°C. Should the plasmid have been completely removed, this is reflected in a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired gene deletion, the second recombination event (excision) can also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size in the case of deletion of the gene or gene cluster using colony PCR of the clones obtained. The primers used del-cgXXXX-XX-s / del-cgXXXX-XX-as were chosen in such a way that they bind in the chromosome outside of the deleted DNA region and also outside of the amplified flanking gene regions. For the gene cluster cg0344-47 this is the primer pair del-cg0344-47-s/ del-cg0344-47-as and similarly for the gene cluster cg2625-40 the primer pair del-cg2625-40-s / del-cg2625-40-as . Primers used university: CGCCAGGGTTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTATGACCATG pK19mobsacB-cg0344-47-del cg0344-47-up-s: CTCTCTAGAGCGGTGGCGATGATGATCTTCGAG cg0344-47-up-as: AAGCATATGAGCCAAGTACTATCAACGCGTCAGGGCGACT TTTCCATTGAGAGACATTTC cg0344-47-down-s: CTGACGCGTTGATAGTACTTGGCTCATATGCTTTTCCTCAC CCGCTTCTACGCTTAAAAG cg0344-47-down-as: GACGAATTCGTGTGGCCACCACCTCAATCTGTG del-cg0344-47-s: AGAGATTCACCCTCGGCGATGAG del-cg0344-47-as: GACCCGCAATGGTGTCGCCAG pK19mobsacB-cg2625-40-del cg2625-40-up-s: ACATCTAGAGGTCGGCGAATCAAGCTCCATG cg2625-40-up-as: CGTCTCGAGTTCACATATGCAACGCGTGCTCAAGATGA CAATATCTTGAGGGTTCATTTTTTGATCCTTAATTTAG cg2625-40-down-s: TTGAGCACGCGTTGCATATGTGAACTCGAGACGGTC GGTGGAGGCGACCAGGGATAAC cg2625-40-down-as: TCTGAATTCATCAAGGCCAATCATGATGAGTGCGAAAC del-cg2625-40-s: AAGAGGAGTTGATGGGATGGTCGAACAATC del-cg2625-40-as: GTTGGCATGCCAGCTTTGTGGGATG

Construction pK19mobsacB-cg0502-del

For the construction of the plasmid pK19mojbsac6-cg0502-del ( 1c ) for the deletion of the cg0502 gene in C. glutamicum, the flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutamicum DNA.

For the generation of the upstream fragment the primer pair cg0502-up-s / cg0502-up-as was used, the downstream flank was amplified with the primer pair cg0502-down-s / cg0502-down-as. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the gene to be deleted) (cg0502-up-as/cg0502-down-s) were chosen in such a way that the two amplified fragments up and down contain mutually complementary overhangs. In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve as both primers and templates (overlap-extension PCR). The deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg0502-up-s / cg0502-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of the deletion plasmid, both the deletion fragment and the pK19-mobsacB empty vector were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes HindIII and BamHI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using Rapid DNA Ligation Kit (Thermo Fisher Scientific), the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After the fragments had been ligated, the entire batch volume was used to transform chemically competent E. coli DH5a cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before being provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with kanamycin (50 µg/ml) and incubated at 37 °C overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of the pK19mobsacB-cg0502-del deletion plasmid were grown overnight in LB medium containing kanamycin (50 μg/mL) to isolate the plasmids. The plasmids were then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.

An aliquot of electrocompetent C. glutamicum cells was transformed with the respective deletion plasmid using the protocol described and streaked onto BHIS-Kan ¹⁵ plates. Since the pK19mobsacB plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this resistance would only be formed if the deletion plas mid was successfully integrated into the genome of C. glutamicum via the homologous sequences. In a first round of selection, the integrants obtained were plated out on BHI-Kan ²⁵ plates and BHI 10% sucrose (w/v) plates and incubated at 30° C. overnight. If the deletion plasmid is successfully integrated into the genome, levan sucrase encoded by sacB is formed in addition to kanamycin resistance. This enzyme catalyzes the polymerization of sucrose to the toxic levan, resulting in induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.

The excision of pK19mobsacB took place in a second recombination event via the now doubled DNA regions, in which the gene to be deleted from the chromosome was finally exchanged for the introduced deletion fragment. For this purpose, cells showing the described phenotype (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30° C. and 170 rpm. Subsequently, 100 μl each of a 1:10 dilution were smeared onto BHI-Kan ²⁵ plates and BHI-10% sucrose (w/v) plates and incubated at 30° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w/v) plate were selected and streaked on BHI-Kan ²⁵ and BHI 10% sucrose (w/v) and overnight at 30° to verify the successful excision of pK19mobsacB C incubated. Should the plasmid have been completely removed, this is reflected in a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired gene deletion, the second recombination event (excision) can also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size in the case of deletion of the gene or gene cluster using colony PCR of the clones obtained. The primers del-cg0502-s / del-cg0502-as used were chosen in such a way that they bind outside the deleted DNA region in the chromosome and also outside the amplified flanking gene regions. Primers used cg0502-up-s: ACGAAGCTTTGTCCGGCATGCTGGCTGAC cg0502-up-as: TGCGCATATGTGGCCGTCTAGATACGCGTACGTCAAA CAAACAAGTGGCAATGGATGTACGCATG cg0502-down-s: ACGTACGCGTATCTAGACGGCCACATATGCGCAATCG AGCGGGGAATCCCAAACTAGCATC cg0502-down-as: TATGGATCCTACGCCTGTACACCGTCGCACGTC del-cg0502-s: GTGAACATTGTGTTTACTGTGTGGGCACTGTC del-cg0502-as: TGATGTTCAGGCCGTTGAAGCCAAGGTAGAG university: CGCCAGGGTTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTATGACCATG

Construction pK19mobsacB-cg1226-del

For the construction of the plasmid pK19mobsacB-cg1226-del ( 1d ) for the deletion of the cg1226 gene in C. glutamicum, the flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutamicum DNA.

For the generation of the upstream fragment the primer pair cg1226-up-s / cg1226-up-as was used, the downstream flank was amplified with the primer pair cg1226-down-s / cg1226-down-as. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the gene to be deleted) (cg1226-up-as/cg1226-down-s) were chosen in such a way that the two amplified fragments up and down contain mutually complementary overhangs. In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve as both primers and templates (overlap-extension PCR). The deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg1226-up-s / cg1226-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of the deletion plasmid, both the Deletion fragment and the pK19mobsacB empty vector linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes HindIII and BamHI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using Rapid DNA Ligation Kit (Thermo Fisher Scientific), the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After the fragments had been ligated, the entire batch volume was used to transform chemically competent E. coli DH5α cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before being provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with kanamycin (50 µg/ml) and incubated at 37 °C overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of the deletion plasmid pK19mobsacB-cg1226-del were grown overnight in LB medium containing kanamycin (50 μg/mL) to isolate the plasmids. The plasmids were then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.

An aliquot of electrocompetent C. glutamicum cells was transformed with the respective deletion plasmid using the protocol described and streaked onto BHIS-Kan ¹⁵ plates. Since the pK19mobsacB plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this resistance would only develop if the deletion plasmid was successfully integrated into the genome of C. glutamicum via the homologous sequences could. In a first round of selection, the integrants obtained were plated out on BHI-Kan ²⁵ plates and BHI 10% sucrose (w/v) plates and incubated at 30° C. overnight. If the deletion plasmid is successfully integrated into the genome, levan sucrase encoded by sacB is formed in addition to kanamycin resistance. This enzyme catalyzes the polymerization of sucrose to the toxic levan, resulting in induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.

The excision of pK19mobsacB took place in a second recombination event via the now doubled DNA regions, in which the gene to be deleted from the chromosome was finally exchanged for the introduced deletion fragment. For this purpose, cells showing the described phenotype (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30° C. and 170 rpm. Subsequently, 100 μl each of a 1:10 dilution were smeared onto BHI-Kan ²⁵ plates and BHI-10% sucrose (w/v) plates and incubated at 30° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w/v) plate were selected and streaked on BHI-Kan ²⁵ and BHI 10% sucrose (w/v) and overnight at 30° to verify the successful excision of pK19mobsacB C incubated. Should the plasmid have been completely removed, this is reflected in a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired gene deletion, the second recombination event (excision) can also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size in the case of deletion of the gene or gene cluster using colony PCR of the clones obtained. The primers del-cg1226-s / del-cg1226-as used were chosen in such a way that they bind in the chromosome outside of the deleted DNA region and also outside of the amplified flanking gene regions. Primers used up-cg 1226-s: CACAAGCTTCCACACGATGAAAATCAATCCGCAG up-cg 1226-as: TGCGGTACCCTCGCATATGATATCTCGAGAGCTAATT GCCACTGGTACGTGGTTCATG down-cg1226-s: AGCTCTCGAGATATCATATGCGAGGGTACCGCAGAC CTACCACGCTTCGAGGTATAAACGCTC down-cg 1226-as: AGTGAATTCCAAGGAAGGCGGTTGCTACTGC del-cg01226-s: TAAATGGTGGAGATACCAAACTGTGAAGC del-cg 1 226-as: CGAGTTCTTCTTCGTGTTCGCGATC university: CGCCAGGGTTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTATGACCATG

Construction pK19mobsacB-cg3349-54-del

For the construction of the plasmid pK19mobsacB-cg3349-54-del ( 1e ) for the deletion of the gene cluster cg3349-54 in C. glutamicum, the flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutamicum DNA.

The primer pair del_cg3349-54-up-s / del_cg3349-54-up-as was used to generate the upstream fragment, the downstream flank was primed with the primer pair del_cg3349-54-down-s / del_cg3349-54-down-as amplified. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the gene to be deleted) (del_cg3349-54-up-as / del_cg3349-54-down-s) were chosen in such a way that the two amplified fragments up and down contain mutually complementary overhangs. In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve as both primers and templates (overlap-extension PCR). The deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (del_cg3349-54-up-s / del_cg3349-54-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of the deletion plasmid, both the deletion fragment and the pK19-mobsacB empty vector were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes HindIII and BamHI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using Rapid DNA Ligation Kit (Thermo Fisher Scientific), the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After the fragments had been ligated, the entire batch volume was used to transform chemically competent E. coli DH5α cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before being provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with kanamycin (50 µg/ml) and incubated at 37 °C overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of the deletion plasmid pK19mobsacB-cg3349-54-del were grown overnight in LB medium containing kanamycin (50 μg/mL) to isolate the plasmids. The plasmids were then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.

An aliquot of electrocompetent C. glutamicum cells was transformed with the respective deletion plasmid using the protocol described and streaked onto BHIS-Kan ¹⁵ plates. Since the pK19mobsacB plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this resistance would only develop if the deletion plasmid was successfully integrated into the genome of C. glutamicum via the homologous sequences could. In a first round of selection, the integrants obtained were plated out on BHI-Kan ²⁵ plates and BHI 10% sucrose (w/v) plates and incubated at 30° C. overnight. If the deletion plasmid is successfully integrated into the genome, levan sucrase encoded by sacB is formed in addition to kanamycin resistance. This enzyme catalyzes the polymerization of sucrose to the toxic levan, resulting in induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.

The excision of pK19mobsacB took place in a second recombination event via the now doubled DNA regions, in which the gene to be deleted from the chromosome was finally exchanged for the introduced deletion fragment.

For this purpose, cells showing the described phenotype (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30° C. and 170 rpm. Subsequently, 100 μl each of a 1:10 dilution were smeared onto BHI-Kan ²⁵ plates and BHI-10% sucrose (w/v) plates and incubated at 30° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w/v) plate were selected and streaked on BHI-Kan ²⁵ and BHI 10% sucrose (w/v) and overnight at 30° to verify the successful excision of pK19mobsacB C incubated. Should the plasmid have been completely removed, this is reflected in a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired gene deletion, the second recombination event (excision) can also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size in the case of deletion of the gene or gene cluster using colony PCR of the clones obtained. The primers used, check-cg3349-54-s / check-cg3349-54-as, were chosen in such a way that they bind in the chromosome outside of the deleted DNA region and also outside of the amplified flanking gene regions. Primers used: del_cg3349-54-up-s: ACCAAGCTTCATTTTCTAGTTGAGATTCATTATCATAACG CTTGACAGTACAACTATGTC del_cg3349-54-up-as: GCTTCCGGGGTGAATGACGGAGCCGCTGCGGAGGTTCCA GAGCCACCGCGCTG del_cg3349-54-down-s: CGCAGCGGCTCCGTCATTCACCCCGGAAGCTGGCGCTAC GCCCTCCTCGAAC del_cg3349-54-down-as: ACCTCTAGATTTCTGTCTTGAGGGTTCGTGGGGGCTG check-cg3349-54-s: AAAGGCTCCATGAATTCCTCACGGAGGATCTC check-cg3349-54-as: ACATCACAAGTAGAAACCCGCATTTTCTGTAGTTTTTAC university: CGCCAGGGTTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTATGACCATG

Modification of the regulatory binding site in the promoter region of citrate synthase CS by nucleotide substitutions for integration into the genome of coryneform bacterial cells

Cloning pK19mobsacB-540-del and pK19mobsacB-PgltA::PdapA-C7

For the construction of the plasmid pK19moösacß-PgltA::PdapA-C7 ( 2 B ) first the plasmid pK19mobsacB-540-del ( 2a ) constructed. Here, the flanking regions were chosen in such a way that a 540 base pair chromosomal fragment carrying the native gltA promoter region with the two transcription start and operator sequences can be deleted. A 20 base pair linker, which has the NsiI and XhoI cleavage sites, was inserted between the two flanks up and down. The C7 variant of the dapA promoter was then subcloned via these interfaces.

For the cloning of pK19mobsacB-540-del, the upstream fragment was amplified up with the primer pair PgltA-up-s / PgltA-up-as, the downstream flank was amplified with the primer pair PgltA-down-s / PgltA-down-as amplified. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (PgltA-up-as / PgltA-down-s) were chosen so that the two amplified fragments up and down contain overhangs that are complementary to each other (including the described NsiI/XhoI linker. In a second PCR (without addition of DNA primers), the purified fragments attach via the complementary sequences and serve each other as both Primer as well as template (overlap-extension PCR).The Δ540 fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (PgltA-up-s / PgltA-down-as After electrophoretic separation on a 1% TAE agarose gel, the final mutation fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol.For the construction of pK19mobsacB-540 -del, both the generated Δ540 fragment and the pK19mobsacB empty vector were digested with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes XbaI and SmaI Samples of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using Rapid DNA Ligation Kit (Thermo Fisher Scientific), the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After the fragments had been ligated, the entire batch volume was used to transform chemically competent E. coli DH5α cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before being provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with kanamycin (50 µg/ml) and incubated at 37 °C overnight. The correct assembly of pK19mobsacB-540-del in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of pK19mobsacB-540-del were grown overnight in LB medium containing kanamycin (50 μg/mL) to isolate the plasmids. The plasmids were then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.

For the construction of pk19mobsac8-PgltA::PdapA-C7, the C7 variant of the dapA promoter was amplified with the primer pair PdapA-s / PdapA-as and checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The generated fragment was cleaned with the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of pk19mobsacB-PgltA::PdapA-C7, both the generated PdapA fragment and the targeting vector pK19mobsaeB-540-del were digested with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes XhoI and NsiI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). The PdapA fragment was used in a three-fold molar excess over the linearized vector backbone pK19mobsacB-540-del for the ligation of the hydrolyzed DNA fragments using the Rapid DNA Ligation Kit (Thermo Fisher Scientific). After the fragments had been ligated, the entire batch volume was used to transform chemically competent E. coli DH5α cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before being provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with kanamycin (50 µg/ml) and incubated at 37 °C overnight. The correct assembly of pk19mobsaeB-PgltA::PdapA-C7 in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. The primer pair univ / rsp was used as DNA primer for the colony PCR, which binds specifically to the pK19mobsaeB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of pk19mojbsacB-PgltA::PdapA-C7 were grown overnight in LB medium with kanamycin (50 µg/mL) to isolate the plasmids. The plasmids were then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.

An aliquot of electrocompetent C. glutamicum cells was transformed with pk19mobsacB-PgltA::PdapA-C7 using the protocol described and streaked onto BHIS-Kan ¹⁵ plates. Since the pK19mobsacB plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this resistance would only develop if the mutation plasmid was successfully integrated into the genome of C. glutamicum via the homologous sequences could. In a first round of selection, the integrants obtained were plated out on BHI-Kan ²⁵ plates and BHI 10% sucrose (w/v) plates and incubated at 30° C. overnight. If the mutation plasmid is successfully integrated into the genome, levan sucrase encoded by sacB is formed in addition to kanamycin resistance. This enzyme catalyzes the polymerization of sucrose to the toxic levan, resulting in induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.

The excision of pK19mobsacB took place in a second recombination event via the now doubled DNA regions, in which the codon to be mutated from the chromosome was finally exchanged for the introduced mutation fragment. For this purpose, cells showing the described phenotype (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30° C. and 170 rpm. Subsequently, 100 μl each of a 1:10 dilution were smeared onto BHI-Kan ²⁵ plates and BHI-10% sucrose (w/v) plates and incubated at 30° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w/v) plate were selected and streaked on BHI-Kan ²⁵ and BHI 10% sucrose (w/v) and overnight at 30° to verify the successful excision of pK19mobsacB C incubated. Should the plasmid have been completely removed, this is reflected in a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired mutation, the second recombination event (excision) can also lead to the restoration of the wild-type situation. To prove the successful exchange in the clones obtained after excision, the corresponding genomic region was amplified by colony PCR (primer pair chk-PgltA-s / chk-PgltA-as) and checked for the expected fragment size by gel electrophoresis. PCR products that indicate a promoter exchange were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and used the primers chk-PgltA-s and chk-PgltA-as to verify the exchange sequenced.

The promoter region PgltA::PdapA-C7 according to the invention has, in addition to the exchange of the promoter region from gtlA for dapA, additional nucleotide substitutions at position 70 (a->t) and 71 (g->a) in front of the start codon ATG ( 2c Sequence comparison promoter region). Primers used PgltA-up-s: TGCTCTAGAGCATGAACTGGGACTTGAAG PgltA-up-as: TATGCATGTTTCTCGAGTGGGCCGAACAAATATGTTTTGAAAGG PgltA-down-s: CCCACTCGAGAAACATGCATAGCGTTTTCAATAGTTCGGTGTC PgltA down as: CCCCCCGGGGGGCCTAGGGAAAGGATGATCTCGTAGCC PdapA-s: CCAATGCATTGGTTCTGCAGTTATCACACCCAAGAGCTAAAAAT TCA PdapA-as: CCGCTCGAGCGGCTCCGGTCTTAGCTGTTAAACCT chk-PgltA-s: ATGAGTCCGAAGGTTGCTGCAT chk-PgltA-as: TCGAGTGGGTTCAGCTGGTCC university: CGCCAGGGTTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTATGACCATG

Modification of the regulatory binding site in the promoter region of the myo-inositol transporter IolT1 through nucleotide substitutions in C. glutamicum

Construction of vector pK19mobsacB_P ₀₆ iolT1

According to Niebisch and Bott (2001) (https://doi.org/10.1007/s002030100262), C. glutamicum ATCC13032 P _O6 iolT1 were combined with the vector pK19mobsacB via double homologous recombination (Schäfer et al., 1994) (https://doi .org/10.1016/0378-1119(94)90324-7). For this purpose, in a first step, two PCR products were generated which enclose the 5' region in front of the iolT1 gene (primer: PromiolT1_fw_fw / PromiolT1fw_rev) with the two nucleotides to be exchanged or the 3' region of the gene (primer: Piolt1_rev_fw / Piolt1_rev_rev). For later homologous recombination, 500 base pairs of each of the flanking regions were amplified. In the second step, the DNA fragments were fused together with the pk19mobsacB vector, which had already been cut using the restriction endonucleases XbaI and EcoRI, using Gibson assembly (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). The resulting plasmid pK19mobsacB_P ₀₆ iolT1 ( 3 ) was transformed into E. coli DH5a by heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones that had absorbed the plasmid could grow. These were checked for the presence of the cloned insert by means of colony PCR and subsequent gel electrophoresis, and its DNA sequence was determined. After isolation of the plasmid, a 150 μL aliquot of electrocompetent C. glutamicum cells was thawed on ice, mixed with 1-4.5 μg of the plasmid and transferred to a 0.2 cm electroporation cuvette that had been pre-cooled on ice. The mixture was covered with 800 µL, 4 °C cold, 10% glycerol (v/v) and electroporated in an electroporator (2500 V, 25 µF, 200 Ω, 2 mm. After electroporation, the mixture was divided into 4 mL 46 °C prewarmed BHIS medium and incubated for 6 min at 46 °C.The cells were then incubated for two hours at 30 °C with 170 rpm and the suspension was plated on BHIS-Kan15 agar.Then the function of the sacB gene was tested by transferring the clones to BHI-Kan25 agar and to BHI-Kan25 agar with 10% sucrose To select for successful excision in a second recombination event, the cells cultured on BHI-Kan25 were cultured for about 5 h were cultured in 5 ml of BHI medium and 100 µl of the culture and a 1:10 dilution were plated onto BHI agar containing 10% sucrose The clones were transferred to BHI Kan25 agar and BHI agar containing 10% sucrose A colony PCR (Prime r: checkPromiolT1fw/checkPromiolT1rev) followed by DNA sequencing to confirm successful nucleotide substitutions.

• PromiolT1_fw_fw: TGCATGCCTGCAGGTCGACTGAAAAATTGATCAGCAAACACC PromiolT1fw_rev: GGCAGACACGATATCCCCCGTCAATCGTACATAGGGAA Piolt1_rev_fw: CGGGGGATATCGTGTCTGCCACGATTAAAG
• piolt1_rev_rev: TTGTAAAACGACGGCCAGTGGAGTCCAAGAAGCACACG checkPromiolT1fw: TACGAATGCCCACTTCGCACCCTT
• checkPromiolT1rev: CAACTCATTACGGCCAGCCAGTGAGC

Primers used:

• PromiolT1_fw_fw: TGCATGCCTGCAGGTCGACTGAAAAATTGATCAGCAAACACC PromiolT1fw_rev: GGCAGACACGATATCCCCCGTCAATCGTACATAGGGAA Piolt1_rev_fw: CGGGGGATATCGTGTCTGCCACGATTAAAG
• piolt1_rev_rev: TTGTAAAACGACGGCCAGTGGAGTCCAAGAAGCACACG checkPromiolT1fw: TACGAATGCCCACTTCGCACCCTT
• checkPromiolT1rev: CAACTCATTACGGCCAGCCAGTGAGC

Construction of the expression plasmid pMKEX2_arof*_qsuB

For the construction of the plasmid pMKEX2_aroF*_qsuB ( 4 ) for the expression of the genes aroF* from Escherichia coli and qsuB from C. glutamicum, the two genes were chemically synthesized as a C. glutamicum codon-optimized gene variant by GeneArt Gene Synthesis (Thermo Fisher Scientific) as a string DNA fragment and as a DNA template used for amplification by PCR. The genes aroF* and qsuB were amplified by PCR with the primer pair aroF*-s / aroF*-as or qsuB-s / qsuB-as, which is specific for the respective gene. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. For the construction of the plasmid pMKEX2_aroF*_qsuB, the plasmid pMKEx2 was linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes NcoI and BamHI. The genes aroF* and qsuB amplified with the given primer pairs were hydrolyzed with the restriction enzymes NcoI and KpnI or KpnI and BamHI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using the Rapid DNA Ligation Kit (Thermo Fisher Scientific), the two inserts aroF* and qsuB were used in a three-fold molar excess compared to the linearized vector backbone pMKEx2. After the fragments had been ligated, the entire batch volume was used to transform chemically competent E. coli DH5a cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before being provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with kanamycin (50 µg/ml) and incubated at 37 °C overnight. The correct assembly of the fragments used in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. As DNA Pri mer for the colony PCR, the primer pair chk_pMKEx2_s / chk_pMKEx2_as was used, which binds specifically to the pMKEx2 vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of the plasmid pMKEX2_aroF*_qsuB were grown overnight in LB medium containing kanamycin (50 μg/mL) to isolate the plasmids. The plasmids were then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned. PrimeraroF*-s used TTCGCTCTTCAAAGCTGCTTAAGGAGGCTATCTATGACCGATGA ACAGGTGCTGATGACCCCAG aroF*-as TACGCTCTTCTGATTTATGCCACGCGTGCGGTCAGCTG qsuB-s TTCGCTCTTCAATCTCTATCAAGGAGGATCGGCATGCGTACATC CATTGCCACTGTTTGTTTGTC qsuB-as TACGCTCTTCTTCGTTAGTTTGGGATTCCCCGCTCGAGGTC chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TTAATACGACTCACTATAGGGGAATTGTGAGC

Construction of the expression plasmid pEKEX3 tkt

For the construction of the plasmid pEKEx3-tkt ( 5 ) for the expression of the tkt gene from C. glutamicum, the gene was amplified by PCR. For tkt amplification by PCR, genomic DNA from C. glutamicum is isolated and specifically amplified with the primer pair tkt'-s / 'tkt-as. The generated DNA fragment is checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. For the construction of the plasmid pEKEx3-tkt, the plasmid pEKEx3 is linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes BamHI and EcoRI. The amplified tkt gene is hydrolyzed with the restriction enzymes BamHI and EcoRI. The restriction mixtures of the fragments mentioned are cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using the Rapid DNA Ligation Kit (Thermo Fisher Scientific), the tkt insert is used in a three-fold molar excess compared to the linearized vector backbone pEKEx3. After the fragments have been ligated, the entire batch volume is used to transform chemically competent E. coli DH5α cells by means of a heat shock at 42° C. for 90 seconds. Following the heat shock, the cells are regenerated on ice for 90 seconds before they are provided with 800 µL of LB medium and regenerated at 37 °C in a thermomixer (Eppendorf, Hamburg) at 900 rpm for 60 minutes. Subsequently, 100 µL of the cell suspension were smeared onto LB agar plates with spectinomycin (100 µg/ml) and incubated at 37 °C overnight. The correct assembly of the fragments used in the grown transformants is checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) is used for this. The DNA template was added to the PCR mixture by adding cells from the grown colonies. The initial denaturation step of the PCR protocol at 95°C for 3 minutes lyses the cells, releasing the DNA template and making it accessible to DNA polymerase. The primer pair chk_pEKEx3_s / chk_pEKEx3_as is used as DNA primer for the colony PCR. It binds specifically to the pEKEx3 vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which is checked by gel electrophoresis. Clones whose PCR product indicates correct assembly of the plasmid pEKEx3-tkt were grown overnight in LB medium containing spectinomycin (100 μg/mL) to isolate the plasmids. The plasmids are then isolated using the NucleoSpin plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned. The plasmid is in 5 shown. Primers used: tkt'-s: CATGGATCCAAGGAGGTTCAGCATGACCACCTTGACGCTGTC ACCTGAACTTCAG 'tkt-as: TCTGAATTCTTAACCGTTAATGGAGTCCTTGGCCGCTGCCAC chk_pEKEx3_s: GCAAATATTCTGAAATGAGCTGTTGACAATTAATCATC chk_pEKEx3_as: CGTTCTGATTTAATCTGTATCAGGCTGAAAATCTTCTC

Pyruvate kinase (PK) deletion in Corynebacterium glutamicum

C. glutamicum DelAro ⁵ -C7 P _O6 iolT1 Δpyk was constructed according to Niebisch and Bott (2001) with the vector pK19mobsacB (Schäfer et al., 1994). In the first step, two PCR products were generated containing the 5' region in front of the pyk gene with the two deleted nucleotides (primers K0115_p9 and K0115_p2) and the 3' region of the gene (primers K0115_p3 and K0115_p4). In this way, 500 base pairs of each of the flanking regions were amplified for later homologous recombination. In addition, the respective primers contained homologies to the other PCR products. In the second step, the DNA fragments were blunt-end cloned together with the previously digested pk19mobsacB vector. The resulting plasmid pK19mobsacB_pyk ( 6 ) was transformed into E. coli DH5a by heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones that had absorbed the plasmid could grow. These were checked for the presence of the cloned insert by means of colony PCR and subsequent gel electrophoresis, and its sequence was sequenced (primer dpyk_proof_fwd and dpyk_proof_rev). After isolation of the plasmid, a 150 μL aliquot of electrocompetent C. glutamicum cells was thawed on ice, mixed with 1-4.5 μg of the plasmid and transferred to a 0.2 cm electroporation cell pre-cooled on ice. The mixture was covered with 800 µL, 4 °C cold, 10 % glycerol (v/v) and electroporated in an electroporator (2500 V, 25 µF, 200 Ω, 2 mm). After electroporation, the mixture was transferred to 4 mL of BHIS medium prewarmed to 46 °C and incubated for 6 min at 46 °C. The cells were then incubated at 30° C. and 170 rpm for two hours. The suspension was then plated onto BHIS-Kan15 agar. The function of the sacB gene was then tested by transferring the clones to BHI-Kan25 agar and to BHI-Kan25 agar with 10% sucrose. To select for a second recombination event, the excision, in which the plasmid was to be removed from the genome, the clones that had grown on BHI-Kan25 were cultivated for about 5 h in 5 ml of BHI medium and 100 μl of the culture and a 1: 10-dilution plated onto BHI agar containing 10% sucrose. The grown clones were transferred to BHI-Kan25 agar and BHI agar with 10% sucrose. A colony PCR with subsequent sequencing was carried out on the sucrose-resistant and kanamycin-sensitive clones in order to check the successful deletion. K0115_p9 CGACGCGAAGGCTAACTGCATCCATG K0115_p2 AGACGGCATGGATTCACGTCCACCTTCTTG K0115_p3 ACGTGAATCCATGCCGTCTTCTACCAAAC K0115_p4 GGCATCCGAATCAACACCATC dpyk_proof_fwd GAAGAGTAGTAACTAGTCATAC dpyk_proof_rev ACAAATGCGCGTTGATGAAGC

Plasmid-based expression of xylose isomerase (XylA) and xylulose kinase (XylB) in C. glutamicum

In the first step, the genomic DNA of C. glutamicum was obtained as a PCR template for the amplification of xylB by dissolving cells in 50 µL 2% DMSO and then heating at 95 °C for 5 min. The cell suspension was centrifuged for 1 min at 11,000 rpm and 3 μL of the supernatant used as a template for the amplification of xylB (primer xylB_fw_Cgl and xylB_rv_Cgl). For the amplification of xylA, genomic DNA from Xanthomonas campestris pv.campestris ATCC33913 was used as template in the PCR reaction and the primers xylA_fw_Xcc xylA_rv_Xcc were used. The amplicons were ligated together with the previously cut pEKEx3 vector by means of restriction cloning (pEKEx3_xylA-xylB; 7 ). This plasmid obtained in this way was transformed into E. coli DH5a by means of heat shock. Due to the spectinomycin resistance gene present on the plasmid, only those clones that had absorbed the plasmid could grow. These were checked for the presence of the cloned insert by means of colony PCR and subsequent gel electrophoresis, and its sequence was sequenced (primer: pEKEx-for2 and pEKEx-rv2). After isolation of the plasmid, a 150 μL aliquot of electrocompetent C. glutamicum cells was thawed on ice, mixed with 1-4.5 μg of the plasmid and transferred to a 0.2 cm electroporation cell pre-cooled on ice. The mixture was covered with 800 µL, 4 °C cold, 10 % glycerol (v/v) and electroporated in an electroporator (2500 V, 25 µF, 200 Ω, 2 mm). After electroporation, the mixture was transferred to 4 mL of BHIS medium prewarmed to 46 °C and incubated for 6 min at 46 °C. The cells were then incubated at 30° C. and 170 rpm for two hours. The suspension was then plated onto BHI-Spc100 agar. xylB_fw_Cgl GAGAAAGGAGGCCCTTCAGATGGCTTTGGTTCTTGGAATCG xylB_rv_Cgl GATCTAGACTAGTACCAACCCTGCGTTG xylA_fw_Xcc GATCTAGAGAAAGGAGGCCCTTCAGATGAGCAACACCGTTTTCATCG xylA_rv_Xcc GAGAGCTCTCAACGCGTCAGGTACTGATT pEKEx-for2 CGGCGTTTCACTTCTGAGTTCGGC pEKEx-rv2 GATATGACCATGATTACGCCAAGC

Medium and cultivation conditions

All strains were cultivated aerobically at 30°C in BHI medium (Difco Laboratories, Detroit, USA) or defined CGXII medium with 4% D-glucose as sole carbon and energy source (Keilhauer et al., 1993). C. glutamicum was cultured for 6 - 8 h in 100 mL shake flasks with 15 mL BHI medium on a rotary shaker at 250 rpm (first preculture) and then in 50 mL defined ^CGXII medium with 4% D-glucose in 500 mL Erlenmeyer flasks inoculated with baffles (second preculture). The cell suspensions were cultured overnight on a rotary ^shaker at 250 rpm. The microbial growth during the cultivations was followed by measuring the optical density at 600 nm (OD ₆₀₀ ). The main culture was inoculated with 4% (222 mM) D-glucose or 4% (266 mM) D-xylose in defined CGXII medium to an OD ₆₀₀ of 5.0. Heterologous gene expression was induced immediately after inoculation with 1mM IPTG.

The cell-containing samples taken during the cultivation were then centrifuged (10,000×g, 4° C., 10 min) and the resulting supernatants analyzed with regard to the concentrations of D-glucose, D-xylose and PCA. The corresponding HPLC analysis was carried out on an Agilent 1200 system (Agilent Technologies, Waldbronn, Germany) using a CS Organic Acid Resin (CS Chromatographie Service GmbH, Langerwehe, Germany). The separation took place isocratically at 55° C. with 0.1 MH ₂ SO ₄ as the mobile phase and a flow rate of 0.6 ml min ^-1 . D-glucose and D-xylose were detected using an RI detector. PCA was detected using a UV detector at an absorbance of 254 nm. The quantifications were carried out using external calibrations in suitable standard solutions.

3,4 Dihydroxybenzoate (PCA) formation in the host system of coryneform bacterial cells modified according to the invention

• DelAro⁵-C7 P_O6-iolT1 pMKEx2_aroF*_qsuB pEKEx3_tkt (PCA_GLC;
  
  )
• DelAro⁵-C7 P_O6-iolT1 Δpyk pMKEx2_aroF*_qsuB pEKEx3_tkt (PCA_GLC Δpyk;
  
  )
• DelAro⁵-C7 P_O6-iolT1 pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (PCA_XYL;
  
  )
• DelAro⁵-C7 P_O6-iolT1 Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (PCA_XYL Δpyk;
  
  )
• Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (
  
  )
• DelAro⁵ Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (
  
  )

The following C. glutamicum strains were constructed and compared in terms of their growth and PCA production performance:

• DelAro ⁵ -C7 P _O6 -iolT1 pMKEx2_aroF*_qsuB pEKEx3_tkt (PCA _GLC ;
  
  )
• DelAro ⁵ -C7 P _O6 -iolT1 Δpyk pMKEx2_aroF*_qsuB pEKEx3_tkt (PCA _GLC Δpyk;
  
  )
• DelAro ⁵ -C7 P _O6 -iolT1 pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (PCA _XYL ;
  
  )
• DelAro ⁵ -C7 P _O6 -iolT1 Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (PCA _XYL Δpyk;
  
  )
• Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (
  
  )
• DelAro ⁵ Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB (
  
  )

The following statements clearly show that the expression of the genes xylA and xylB according to the invention for the use of D-xylose as a carbon and energy source in combination with the inactivation of pyruvate kinase lead to an increased formation of PCA ( 8th and 9 ).

As 8th It can be seen that the two strains PCA _GLC and PCA _GLC Δpyk show comparable growth rates of 0.21 h ^-1 and 0.20 h ^-1 on D-glucose as the carbon and energy source. The substrate uptake rate is also comparable with 15.6 C-mmol _GLC g _CDW ^-1 h ^-1 and 17.4 C-mmol _GLC g _CDW ^-1 h ^-1 . In contrast, the strain PCA _GLC Δpyk with deletion of the gene for pyruvate kinase with 1.22 C-mmol _PCA g _CDW ^-1 h ^-1 shows a greatly increased PCA formation rate compared to the precursor strain with 0.78 C-mmol _PCA g _CDW ^-1 h ^-1 . The PCA _{XYL strain} has a lower growth rate of 0.11 h ^-1 than the D-glucose-based strains. The substrate uptake is comparatively high at 13.0 C-mmol _XYL g _CDW ^-1 h ^-1 and the product formation rate at 1.43 C-mmol _PCA g _CDW ^-1 h ^-1 at a significantly higher level than the D-glucose-based strains. The _{PCA XYL} ^{Δpyk strain} , on the other hand, _shows a strongly ^ver reduced growth and substrate uptake rate. In contrast, the PCA formation rate remains at the highest level with 1.47 C-mmol _PCA g _CDW ^-1 h ^-1 . Overall, the carbon absorbed in this strain in the form of D-xylose is largely converted into the product PCA, which significantly increases the product yield.

The resulting C-molar yields, taking into account the different substrates, are 0.02, 0.04, 0.06 and 0.33 C-mol product per C-mol substrate for the strains PCA _GLC , PCA _GLC Δpyk, PCA _XYL and PCA _XYL Δpyk.

9 shows the maximum PCA titers after 98 hours of cultivation. The PCA _GLC strain has a maximum PCA titer of 3.5 ± 1.2 mM. The strain PCA _GLC Δpyk with deletion of the gene for pyruvate kinase shows a significantly increased PCA titer of 7.8 ± 1.6 mM. The PCA _{XYL strain} has an even higher PCA titer of 12.0 ± 1.1 mM. The PCA _XYL Δpyk strain with an additional deletion of the gene for pyruvate kinase shows by far the highest PCA titer of 62.1 ± 12.1 mM.

10 it can be seen that the progenitor strain Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB with intact catabolism of aromatic compounds is unable to accumulate PCA. In contrast, the strain DelAro ⁵ Δpyk pMKEx2_aroF*_qsuB pEKEx3_xylA_xylB with corresponding inactivation of the catabolism of aromatic compounds already shows a moderate PCA accumulation with a final titer of 26.6 mM.

This effect is clearly due to the deletion of the gene for the pyruvate kinase Δpyk according to the invention. The PCA _XYL Δpyk strain according to the invention with an additional deletion of the gene for pyruvate kinase according to the invention, an inactive catabolism and an additional increased activity of XylA and XylB according to the invention shows by far the highest PCA titer of 62.1±12.1 mM. Table 1: tribe reference C. glutamicum ATCC13032 wild type Abe et al ., 1967 (https://doi.org/10.2323/jgam.13.279) C. glutamicum MB001 (DE3) Kortmann et al ., 2015 (https://doi.org/10.1111/1751-7915.12236v) C. glutamicum DelAro ⁵ -C7 Kallscheuer et al ., 2018 (https://doi.org/10.1186/s12934-018-0923-x) C.glutamicum ^DelAro5 - _C7PO6iolT1 Kallscheuer et al ., 2018 (https://doi.org/10.1186/s12934-018-0923-x) C. glutamicum DelAro ⁵ -C7 P _O6 iolT1 pMKEx2_aroF*_qsuB according to the invention C. glutamicum DelAro ⁵ -C7 P _O6 iolT1 pEKEx3_xylA-xylB pMKEx2_arof*_qsuB according to the invention C. glutamicum DelAro ⁵ -C7 P _O6 i olT1 pMKEx2_arof*_qsuB Δpyk according to the invention C. glutamicum DelAro ⁵ -C7 P _O6 iolT1 pMKEx2 arof*_qsuB Δpyk pEKEx3 xylAxylB according to the invention C. glutamicum DelAro ⁵ Δpyk pEKEx3_xylA-xylB pMKEx2_aroF*_qsuB according to the invention C. glutamicum DelAro5 ^pEKEx3_tkt pMKEx2_aroF*_qsuB according to the invention C. glutamicum DelAro ⁵ Δpyk pEKEx3_tkt pMKEx2_aroF*_qsuB according to the invention C. glutamicum Δpyk pEKEx3_xylA-xylB pMKEx2_aroF*_qsuB according to the invention E. coli DH5α Thermo Fisher Scientific (Waltham, MA, USA) E. coli BL21(DE3) Merck (Darmstadt, Germany) plasmid pEKEx3 Gande et al ., 2007 (https://doi.org/10.1128/JB.00254-07) pMKEx2 Kortmann et al ., 2015 (https://doi.org/10.1111/1751-7915.12236v) pk19 mobsacB Schäfer et al ., 1994 (https://doi.org/10.101610378-1119(94)90324-7) Table 2: sequence description source SEQ ID NO. 1 Amino acid sequence of a pyruvate kinase (PK) from coryneform bacteria GenBank: ASW14474.1 SEQ ID NO. 2 Amino acid sequence of a xylose isomerase (XylA) from Xanthomonas campestris GenBank: QOF05271.1 SEQ ID NO. 3 Amino acid sequence of a xylulose kinase (XylB) from coryneform bacteria GenBank: CAF18680.1 SEQ ID NO. 4 Nucleic acid sequence encoding a pyruvate kinase (pyk) from coryneform bacteria GenBank: BA000036.3: c2207092-2205665 SEQ ID NO. 5 Nucleic acid sequence coding for a xylose isomerase (XylA) from Xanthomonas campestris GenBank: AE008922.1: 2043895-2045235 SEQ ID NO. 6 Nucleic acid sequence encoding a xylulose kinase (XylB) from coryneform bacteria GenBank: BA000036.3: 124932-126353 SEQ ID NO. 7 pK19mobsacB-cg0344-47-del univ according to the invention SEQ ID NO. 8th pK19mobsacB-cg0344-47-del resp according to the invention SEQ ID NO. 9 cg0344-47-up-s according to the invention SEQ ID NO. 10 cg0344-47-up-as according to the invention SEQ ID NO. 11 cg0344-47-down-s according to the invention SEQ ID NO. 12 cg0344-47-down-as according to the invention SEQ ID NO. 13 del-cg0344-47-s according to the invention SEQ ID NO. 14 del-cg0344-47-as according to the invention SEQ ID NO. 15 pK19 mobsacB -cg2625-40-del univ according to the invention SEQ ID NO. 16 pK19 mobsacB -cg2625-40-del rsp according to the invention SEQ ID NO. 17 cg2625-40-up-s according to the invention SEQ ID NO. 18 cg2625-40-up-as according to the invention SEQ ID NO. 19 cg2625-40-down-s according to the invention SEQ ID NO. 20 cg2625-40-down-as according to the invention SEQ ID NO. 21 del-cg2625-40-s according to the invention SEQ ID NO. 22 del-cg2625-40-as according to the invention SEQ ID NO. 23 pK19 mojbsacS -cg0502-del univ according to the invention SEQ ID NO. 24 pK19 mobsacB -cg0502-del rsp according to the invention SEQ ID NO. 25 cg0502-up-s according to the invention SEQ ID NO. 26 cg0502-up-as according to the invention SEQ ID NO. 27 cg0502-down-s according to the invention SEQ ID NO. 28 cg0502-down-as according to the invention SEQ ID NO. 29 del-cg0502-s according to the invention SEQ ID NO. 30 del-cg0502-as according to the invention SEQ ID NO. 31 pK19 mobsacB -cg 1 226-del univ according to the invention SEQ ID NO. 32 pK19 mobsacB -cg 1 226-del rsp according to the invention SEQ ID NO. 33 up-cg 1226-s according to the invention SEQ ID NO. 34 up-cg1226-as according to the invention SEQ ID NO. 35 down-cg 1226-s according to the invention SEQ ID NO. 36 down-cg 1 226-as according to the invention SEQ ID NO. 37 del-cg01226-s according to the invention SEQ ID NO. 38 del-cg 1 226-as according to the invention SEQ ID NO. 39 pK19 mobsacB -cg3349-54-del univ according to the invention SEQ ID NO. 40 pK19 mo6sacB -cg3349-54-del rsp according to the invention SEQ ID NO. 41 del_cg3349-54-up-s according to the invention SEQ ID NO. 42 del_cg3349-54-up-as according to the invention SEQ ID NO. 43 del_cg3349-54-down-s according to the invention SEQ ID NO. 44 del_cg3349-54-down-as according to the invention SEQ ID NO. 45 check-cg3349-54-s according to the invention SEQ ID NO. 46 check-cg3349-54-as according to the invention SEQ ID NO. 47 PgltA-up-s according to the invention SEQ ID NO. 48 PgltA-up-as according to the invention SEQ ID NO. 49 PgltA-down-s according to the invention SEQ ID NO. 50 PgltA down ace according to the invention SEQ ID NO. 51 pK19 mobsacB -PgltA::PdapA-C7 univ according to the invention SEQ ID NO. 52 pK19 mobsacB -PgltA::PdapA-C7 rsp according to the invention SEQ ID NO. 53 PdapA-s according to the invention SEQ ID NO. 54 PdapA-as according to the invention SEQ ID NO. 55 chk-PgltA-s according to the invention SEQ ID NO. 56 chk-PgltA-as according to the invention SEQ ID NO. 57 PromiolT1_fw_fw according to the invention SEQ ID NO. 58 PromiolT1fw_rev according to the invention SEQ ID NO. 59 Piolt1_rev_fw according to the invention SEQ ID NO. 60 checkPromiolT1fw according to the invention SEQ ID NO. 61 checkCelebrityT1rev according to the invention SEQ ID NO. 62 aroF*-s according to the invention SEQ ID NO. 63 aroF*-as according to the invention SEQ ID NO. 64 qsuB-s according to the invention SEQ ID NO. 65 qsuB-as according to the invention SEQ ID NO. 66 chk_pMKEx2-s according to the invention SEQ ID NO. 67 chk_pMKEx2-as according to the invention SEQ ID NO. 68 tkt'-s according to the invention SEQ ID NO. 69 'tkt-as according to the invention SEQ ID NO. 70 chk_pEKEx3_s according to the invention SEQ ID NO. 71 chk_pEKEx3_as according to the invention SEQ ID NO. 72 K0115_p9 according to the invention SEQ ID NO. 73 K0115_p2 according to the invention SEQ ID NO. 74 K0115_p3 according to the invention SEQ ID NO. 75 K0115_p4 according to the invention SEQ ID NO. 76 dpyk_proof_fwd according to the invention SEQ ID NO. 77 dpyk_proof_rev according to the invention SEQ ID NO. 78 xylB_fw_Cgl according to the invention SEQ ID NO. 79 xylB_rv_Cgl according to the invention SEQ ID NO. 80 xylA_fw-Xcc according to the invention SEQ ID NO. 81 xylA_rv_Xcc according to the invention SEQ ID NO. 82 pEKEx-for2 according to the invention SEQ ID NO. 83 pEKEx-rv2 according to the invention

QUOTES INCLUDED IN DESCRIPTION

This list of documents cited by the applicant was generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Patent Literature Cited

• WO 9615246 [0017]
• US4489160 [0025]
• US5158891 [0025]

Claims (18)

Process for the microbial production of 3,4-dihydroxybenzoic acid, comprising the steps: a) providing a solution containing at least water, nitrogen, mineral salts and a C5 carbon source, b) microbial conversion of the C5 carbon source in a solution according to step a) to 3,4-dihydroxybenzoic acid in the presence of a modified coryneform bacterial cell whose pyruvate kinase activity (PK) is partially or completely inactivated or whose gene encodes the pyruvate Kinase (pyk) is partially or completely deleted, c) optional isolation and/or purification of 3,4-dihydroxybenzoic acid from the solution. procedure after claim 1 , in which a modified coryneform bacterial cell is used which has increased xylose isomerase and xylulose kinase activity (XylA, XylB) or whose genes are overexpressed coding for a xylose isomerase (xyIA) and xylulose kinase (xyIB). . Procedure according to one of Claims 1 or 2 , in which a modified coryneform bacterial cell is used, whose catabolic metabolism for aromatic compounds is inactivated and which additionally has an increased activity of a DAHP synthase (AroF) and a 3-dehydroshikimate dehydrogenase (QsuB) or their genes coding for enzymes of the catabolic metabolism of aromatic Compounds (DelAro ⁵ ) are deleted and an overexpression of the genes coding for a DAHP synthase (aroF) and a 3-dehydroshikimate dehydrogenase (qsuB). Procedure according to one of Claims 1 - 3 , in which a modified coryneform bacterial cell is used which additionally has a phosphotransferase (PTS)-independent carbon transporter system, preferably a myo-inositol/proton symporter iolT1, particularly preferably an IolR-derepressed myo-inositol/proton symporter P ₆ - iolT1. Procedure according to one of Claims 1 - 4 In which a modified coryneform bacterial cell is used, selected from the group consisting of Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum. Procedure according to one of Claims 1 - 5 , characterized in that the microbial reaction in a solution proceeds from a C5 carbon source selected from the group consisting of: a) oligosaccharides or polysaccharides containing D-xylose units b) D-xylose, c) lignocellulose, cellulose -, or hemicellulose-containing biomass, its hydrolyzate or extract obtained therefrom containing D-xylose units, d) a combination of a) to c). Procedure according to one of Claims 1 - 6 , in which spent sulfite liquor, corn straw, rice straw or bagasse, or their hydrolyzates or extracts obtained therefrom containing D-xylose units, are used as the C5 carbon source. Modified coryneform bacterial cell which has partially or completely inactivated pyruvate kinase activity and increased xylose isomerase and xylulose kinase activity or whose gene coding for pyruvate kinase (pyk) is partially or completely deleted and whose genes code for a xylose isomerase (xyIA) and xylulose kinase (xyIB) are overexpressed. Modified coryneform bacterial cell after claim 8 , characterized in that it d) a partial or complete inactivation of pyruvate kinase (PK) with an amino acid sequence of at least 70% identity to the amino acid sequence according to SEQ ID NO: 1 or fragments thereof, e) a xylose isomerase activity (XylA) with an amino acid sequence of at least 70% identity to the amino acid sequence according to SEQ ID NO: 2 or fragments thereof, f) an increased activity of a xylose isomerase activity (XylB) with an amino acid sequence of at least 70% identity to the amino acid sequence according to SEQ ID NO: 3 or fragments thereof. Modified coryneform bacterial cell according to any one of Claims 8 or 9 , characterized in that they a) a nucleic acid sequence coding for a xylose isomerase (xylA) with at least 70% identity to SEQ ID NO. 5 or fragments or alleles thereof, and b) increased expression of a nucleic acid sequence coding for a xylulose kinase (xylB) with at least 70% identity to SEQ ID NO. 6 or fragments or alleles thereof, and c) a partial or complete deletion of the nucleic acid sequence coding for the pyruvate kinase according to SEQ ID NO. 4 or fragments or alleles thereof. Modified coryneform bacterial cell according to any one of Claims 8 - 10 , whose enzymes are inactive for the catabolism of aromatic compounds and which additionally has an increased activity of a DAHP synthase (AroF), preferably feedback deregulated DAHP synthase (AroF*), and a 3-dehydroshikimate dehydrogenase (QsuB) or whose genes encode for Enzymes of the catabolism of aromatic compounds are deleted and overexpression of the genes encoding DAHP synthase (AroF), preferably feedback deregulated DAHP synthase (AroF*), and a 3-dehydroshikimate dehydrogenase (qsuB). Modified coryneform bacterial cell according to any one of Claims 8 - 11 , which additionally has a phosphotransferase (PTS)-independent carbon transporter system, preferably a myo-inositol/proton symporter iolT1, particularly preferably an lolR-derepressed myo-inositol/proton symporter P ₆ -iolT1. Modified coryneform bacterial cell according to any one of Claims 8 - 12 , selected from the group containing Corynebacterium and Brevibacterium, in particular Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum. Modified coryneform bacterial cell according to any one of Claims 8 - 13 for the production of 3.4-dihydroxybenzoic acid from a C5 carbon source. procedure after claim 1 in which a modified coryneform bacterial cell according to any one of Claims 8 - 14 is used. Use of a modified corynform bacterial cell according to any one of Claims 8 - 14 for the microbial production of 3,4-dihydroxybenzoic acid from D-xylose or extracts containing D-xylose or hydrolysates of sustainable raw materials. Composition containing 3,4-dihydroxybenzoic acid produced with a modified coryneform bacterial cell according to one of Claims 8 - 14 or a method according to any of Claims 1 - 7 . Use of 3,4-dihydroxybenzoic acid produced with a modified coryneform bacterial cell according to any one of Claims 8 - 14 or by a method according to any one of Claims 1 - 7 , or the use of a composition after Claim 17 for the production of plastic, plastic fibers, pharmaceuticals, cosmetics, food and/or animal feed.

Images