DE102010001332A1

DE102010001332A1 - Producing medicament comprises imaging amplified genome segments in isolated tumor sample, reproducing and sequencing fusion area of fused amplified genome segments in amplicons and providing sample, which specifically bind to fusion area

Info

Publication number: DE102010001332A1
Application number: DE201010001332
Authority: DE
Inventors: Dr. Weber Axel; Prof. Dr. Christiansen Holger
Original assignee: Universitaet Leipzig
Current assignee: Universitaet Leipzig
Priority date: 2010-01-28
Filing date: 2010-01-28
Publication date: 2011-12-15

Abstract

Producing an individual specific medicament, comprises (a) high-resolution imaging of amplified genome segments in an isolated tumor sample using fine-tiling array, optionally after previous total genome analysis, preferably CGH (comparative genomic hybridization) analysis, (b) reproducing (preferably by PCR) and subsequent sequencing of the fusion area of the fused amplified genome segments within the amplicons with the amplicon fusion points, and (c) provision of a sample, which allows to specifically bind to the fusion areas. An independent claim is included for a sample, obtained by the above method. ACTIVITY : Cytostatic. MECHANISM OF ACTION : None given.

Description

Die Erfindung betrifft die Malignomtherapie, insbesondere die Therapie von Malignomen mit amplifizierten (in mehreren Kopien vorliegenden) Genomabschnitten, welche Onkogene enthalten können, wie z. B. MYCN (Chromosom 2p24–25) in humanen Neuroblastomen.The invention relates to malignant therapy, in particular the therapy of malignancies with amplified (in multiple copies) genome sections which may contain oncogenes, such as. B. MYCN (chromosome 2p24-25) in human neuroblastomas.

Einführungintroduction

Die Therapie von humanen Malignomen erfolgt derzeit in der Regel über zytotoxische Verfahren (Medikament oder Strahlentherapie) oder, wenn möglich, operativ. Die meisten der eingesetzten Medikamente (Chemotherapeutika) oder die Strahlentherapie sind von ihrer Wirkweise her nicht tumorzellspezifisch, sondern schädigen in gewissem Maße auch alle übrigen, gesunden Zellen des Organismus. Um Nebenwirkungen zu minimieren oder vollständig auszuschließen sind Therapieverfahren notwendig, die absolut malignomzellspezifisch sind.The treatment of human malignancies is currently usually via cytotoxic procedures (drug or radiotherapy) or, if possible, surgically. Most of the drugs used (chemotherapeutic agents) or radiation therapy are by their mode of action not tumor-cell-specific, but damage to some extent, all other healthy cells of the organism. In order to minimize or completely exclude side effects, therapy procedures are absolutely necessary, which are absolutely malignom cell-specific.

Sequenzspezifische Proben (Antisense-DNA, siRNAs, locked-nucleic-acids (LNAs), peptide-nucleic-acids (PNAs), morpholino Oligonucleotide (PMOs), etc.) werden derzeit eingesetzt um entweder die Translation von mRNA zu inhibieren (z. B. durch forcierten Abbau der Ziel-mRNA durch siRNA) ( Rapozzi et al. 2006 , Yoon et al. 2009 , Stein et al. 2010 ) oder zielen auf die Behinderung der Transkription bestimmter Promotoren von Genen mit potentieller onkogener Eigenschaft ( Cutrona et al. 2000 ). Diese Arbeiten zeigen, dass sowohl unmodifizierte, als auch modifizierte sequenzspezifische Proben in vitro und in vivo die Ziel DNA Sequenz innerhalb menschlicher Zellen erreichen können. Der Nachteil besteht darin, dass die Ziel DNA Sequenzen bei den derzeit eingesetzten Proben meist nicht malignomzellspezifisch sind. Eine Ausnahme bildet eine Probe gegen den Fusionsbereich des BRC/ABL Fusionsgenes bzw. Fusionstranskriptes, welches allerdings nur in bestimmten Formen von Leukämiezellen vorkommt und daher nur im Rahmen dieser speziellen Malignome zum Einsatz kommen kann ( Rapozzi et al. 2006 ).Sequence-specific samples (antisense DNA, siRNAs, locked nucleic acids (LNAs), peptide nucleic acids (PNAs), morpholino oligonucleotides (PMOs), etc.) are currently used to either inhibit the translation of mRNA (e.g. By forced degradation of the target mRNA by siRNA) ( Rapozzi et al. 2006 . Yoon et al. 2009 . Stein et al. 2010 ) or are aimed at hindering the transcription of certain promoters of genes with potential oncogenic property ( Cutrona et al. 2000 ). This work shows that both unmodified and modified sequence-specific probes can reach the target DNA sequence within human cells in vitro and in vivo. The disadvantage is that the target DNA sequences in the currently used samples are usually not malignom cell-specific. An exception is a sample against the fusion region of the BRC / ABL fusion gene or fusion transcript, which, however, occurs only in certain forms of leukemia cells and therefore can only be used in the context of these special malignancies ( Rapozzi et al. 2006 ).

Aufgabetask

Aufgabe der Erfindung ist ein Verfahren anzugeben, welches eine malignomzellspezifische und patientenindividuelle, gezielte Therapie von Tumorzellen erlaubt.The object of the invention is to specify a method which allows a malignoma cell-specific and patient-specific, targeted therapy of tumor cells.

Erfindunginvention

Erfindungsgemäß wird die Aufgabe gelöst durch ein Verfahren welches es ermöglicht malignomzellspezifische und patientenindividuelle Proben oder Sonden für Malignomzellen bereit zu stellen. Das erfindungsgemäße Verfahren ermöglicht es vorteilhaft absolut malignomzellspezifische und patientenindividuelle DNA Sequenzen basengenau zu detektieren und diese für therapeutische Anwendungen, z. B. Verhinderung der DNA Replikation oder gezielte Induzierung von Doppelstrangbrüchen zu nutzen.According to the invention, the object is achieved by a method which makes it possible to provide malignoma cell-specific and patient-specific samples or probes for malignant cells. The method according to the invention advantageously makes it possible to detect absolutely malignom cell-specific and patient-specific DNA sequences with base accuracy and to use them for therapeutic applications, eg. B. Prevention of DNA replication or targeted induction of double-strand breaks to use.

Die Erfindung baut dabei auf der Erkenntnis auf, dass viele Malignome amplifizierte Genomabschnitte (ampGA) enthalten. Unter ampGA werden Bereiche des Genoms (eine bestimmte DNA-Sequenz) verstanden, welche in mehr als zwei Kopien pro haploidem Genom (häufig 4 bis über 120) in einer Zelle vorliegen. Diese ampGA liegen in übergeordneten Strukturen, sogenannten „Amplikons” meist in streng hintereinander aufgereihter Form (repetitiv) vor (1). Bei der Aneinanderreihung der Genomabschnitte folgt immer auf das Ende der einen Kopie erneut der Anfang der nächsten Kopie des amplifizierten Genomabschnittes.The invention is based on the finding that many malignancies contain amplified genome segments (ampGA). By ampGA are meant regions of the genome (a particular DNA sequence) present in more than two copies per haploid genome (often 4 to more than 120) in a cell. These ampGA are in superordinate structures, so-called "amplicons" usually in a stringed (repetitive) form before ( 1 ). When juxtaposing the genome sections, the beginning of the next copy of the amplified genome section always follows the end of the one copy.

Ein Amplikon ist somit das Gesamtgebilde, das aus den vielen Kopien eines (oder mehrerer unterschiedlicher) Genomabschnittes aufgebaut ist. Falls mehrere genomische Abschnitte amplifiziert sind, können diese in unterschiedlichen Formen aneinander fusioniert sein, so dass z. T. sehr komplexe Amplikons entstehen.An amplicon is thus the overall structure made up of the many copies of one (or more different) genome section. If several genomic sections are amplified, they can be fused together in different forms, so that z. T. very complex amplicons arise.

Die Amplikons können in separaten, kleinen, zirkulären DNA Strukturen, den sogenannten „Double-minute Chromosomen (dMin)” vorliegen, oder an unterschiedlicher Stelle wieder als sogenannte „Homogenously staining regions (HSRs)” in das Genom reintegriert sein.The amplicons can be present in separate, small, circular DNA structures, the so-called "double-minute chromosomes (dMin)", or reintegrated at different sites as so-called "homogenously staining regions (HSRs)" into the genome.

Bei schätzungsweise 20–30% aller individuellen Malignomerkrankungen enthalten die Malignomzellen amplifizierte Genomabschnitte (Auswahl siehe Tabelle 1 im Anhang). In Malignomen sind häufig Genomabschnitte amplifiziert, die Onkogene enthalten (z. B. MYCN in humanen Neuroblastomen, Her-2/neu in Brustkrebs und Prostatakarzinom, AURKA in Blasenkarzinomen, etc.). Der genetische Inhalt der amplifizierten Bereiche spielt für die vorliegende Erfindung und die Etablierung einer Amplikon-Fusionsstellen gerichteten Therapie allerdings keine Rolle.In an estimated 20-30% of all individual malignancies, the malignant cells contain amplified genome sections (for selection, see Table 1 in the Appendix). Malignancies frequently amplify genome segments containing oncogenes (eg MYCN in human neuroblastomas, Her-2 / neu in breast cancer and prostate cancer, AURKA in bladder carcinomas, etc.). The genetic content of the amplified However, regions are not important to the present invention and the establishment of amplicon-fusion site-directed therapy.

Der oder die ampGA sind bei jedem Malignom und damit auch bei jedem Patienten unterschiedlich groß und haben dementsprechend unterschiedliche telomerseitige und centromerseitige Grenzen. Ein Amplikon enthält zwischen 4 bis zu > 120 Kopien der ampGA. Die Amplikon-Fusionsstellen (AFS) sind die Sequenzabschnitte innerhalb eines Amplikons, an denen die Kopien der ampGA aufeinander folgen. D. h. die Amplikon-Fusionsstelle (AFS) ist die Stelle in der Sequenz eines Amplikons, an der auf das letzte Nukleotid eines ampGA wieder das erste Nukleotid des nächsten ampGA folgt. Dadurch entsteht aber diese AFS eine DNA Sequenzfolge (Fusionsbereich), die in keiner Zelle zu finden ist, die diese ampGA nicht enthält. Der Fusionsbereich ist der Sequenzbereich (bevorzugt mit einer Länge von 30 bis 300 Nukleotiden), welcher die AFS umgibt und diese beinhaltet. Da es sich bei Tumorerkrankungen vornehmlich um klonale Erkrankungen handelt, sind die AFS und damit die Fusionsbereiche in jeder Malignomzelle, aber nicht in gesunden Zellen zu finden. Die AFS und damit die Fusionsbereiche sind in jedem Malignom unterschiedlich und damit absolut malignomspezifisch und patientenindividuell.The or the ampGA are different in each malignancy and thus also in each patient and therefore have different telomerseitigen and centromeric boundaries. An amplicon contains between 4 to> 120 copies of the ampGA. The amplicon fusion sites (AFS) are the sequence segments within an amplicon where the copies of the ampGA follow one another. Ie. the amplicon fusion site (AFS) is the site in the sequence of an amplicon where the last nucleotide of an ampGA is followed by the first nucleotide of the next ampGA. However, this AFS results in a DNA sequence sequence (fusion region) that can not be found in any cell that does not contain this ampGA. The fusion region is the sequence region (preferably 30 to 300 nucleotides in length) surrounding and including the AFS. Since tumors are predominantly clonal diseases, the AFS and thus the fusion areas are found in every malignant cell, but not in healthy cells. The AFS and thus the fusion areas are different in each malignancy and therefore absolutely malignom-specific and patient-specific.

Die Insertionsstellen, an denen ein Amplikon potentiell wieder in das Genom reintegriert ist, sind zwar genauso spezifisch und patientenindividuell, wie die AFS der hintereinander geschalteten DNA Abschnitte, jedoch lassen diese sich nur schwer identifizieren, da diese nur einmal in der Zelle vorliegen. Die AFS liegen jedoch in mehreren Kopien vor, so dass durch Bestimmung der telomer- und centromerseitigen Grenzen der ampGA mittels CGH und Tiling-Array auf die AFS gescreent werden kann.Although the insertion sites on which an amplicon is potentially reintegrated into the genome are indeed as specific and patient-specific as the AFS of the DNA segments connected in series, they are difficult to identify because they are present only once in the cell. However, the AFS are available in multiple copies, so that by determining the telomere and centromeric boundaries of the ampGA can be screened for the AFS using CGH and tiling array.

Das erfindungsgemäße Verfahren setzt die spezifischen Detektion malignomzellspezifischen AFS eines Individuums voraus und stellt darauf aufbauend ein malignomzellspezifisches und patientenindividuelles Therapieverfahren bereit.The method according to the invention requires the specific detection of malignoma cell-specific AFS of an individual and, based on this, provides a malignoma cell-specific and patient-specific therapeutic method.

Das erfindungsgemäße Verfahren zeichnet sich durch folgende Schritte aus:

a.) Hochauflösende Darstellung amplifizierter Genomabschnitte (ampGA) in einer isolierten Tumorprobe mittels Fine-Tiling Array, bevorzugt nach Detektion des/der ampGA durch Gesamtgenomanalyse, bevorzugt durch CGH (Comparative Genomic Hybridization), falls diese nicht schon zuvor bekannt sind;
b.) Vervielfältigung, bevorzugt per PCR und anschließende Sequenzierung der Fusionsbereiche (AFS);
c.) Bereitstellen einer Probe, welche es erlaubt spezifisch den Fusionsbereich zu binden und damit vorteilhaft die DNA Replikation der Malignomzellen beeinflussen kann, bzw. als Vehikel dient, mit dem an die AFS malignomzellspezifisch Therapeutika gebracht werden können, die zielgerichtet die dortige DNA Struktur beeinflussen und/oder zerstören.

The method according to the invention is characterized by the following steps:

a.) High-resolution representation of amplified genome segments (ampGA) in an isolated tumor sample by means of a fine-tiling array, preferably after detection of the ampGA by total genome analysis, preferably by CGH (Comparative Genomic Hybridization), if these are not previously known;
b.) amplification, preferably by PCR and subsequent sequencing of the fusion regions (AFS);
c.) Providing a sample which specifically binds the fusion region and thus can advantageously influence the DNA replication of the malignant cells, or serves as a vehicle with which AFS malignom cell-specific therapeutics can be brought which specifically affect the local DNA structure and / or destroy.

Die Probe ist eine unmodifizierte oder modifizierte Nukleinsäuresonde, welche spezifisch mit dem Fusionsbereich durch komplementäre Basenpaarung hybridisiert. Eine solche Sonde hat bevorzugt eine Länge von 12 bis 35 Nukleotiden, bevorzugt 14 bis 22 Nukleotiden. Die Sonde kann nur dann an die DNA binden, wenn diese den malignomspezifischen Fusionsbereich (AFS) enthält.The sample is an unmodified or modified nucleic acid probe that specifically hybridizes to the fusion region by complementary base pairing. Such a probe preferably has a length of 12 to 35 nucleotides, preferably 14 to 22 nucleotides. The probe can bind to the DNA only if it contains the malignancy-specific fusion region (AFS).

Voraussetzung für das erfindungsgemäße Verfahren ist das Vorhandensein von amplifizierten Genomabschnitten. Diese können in einem vorbekannten, definierten Bereich liegen. Wenn über die mögliche Amplifikation noch nichts bekannt ist, erfolgt in Schritt a.) zunächst eine Gesamtgenomanalyse, bevorzugt durch Gesamtgenom-CGH(Comparative Genomic Hybridization)-Array, d. h. einem DNA-Chip, der Proben für das gesamte Genom enthält.The prerequisite for the method according to the invention is the presence of amplified genome segments. These can lie in a previously known, defined range. If nothing is yet known about the possible amplification, a total genome analysis, preferably by total genome CGH (Comparative Genomic Hybridization) array, is carried out in step a). H. a DNA chip containing samples for the entire genome.

Ist der Genomabschnitt, in dem die Amplifikation vorkommt, bekannt oder durch die zuvor beschriebene Gesamtgenomanalyse ermittelt, wird der entsprechende Genomabschnitt bevorzugt in einer Fine-Tiling-CGH-Arrayuntersuchung hochauflösend abgegrenzt. Dazu erfolgt in Schritt b.) bevorzugt eine Hybridisierung mit einem sogenannten Tiling Array, d. h. einem DNA-Chip, der Proben für einzelne Chromosomen oder Chromosomabschnitte enthält.If the genome section in which the amplification occurs is known or determined by the total genome analysis described above, the corresponding genome section is preferably distinguished in a high-resolution manner in a fine-tiling CGH array examination. For this purpose, in step b.) Is preferably carried out a hybridization with a so-called tiling array, d. H. a DNA chip containing samples for single chromosomes or chromosome segments.

Durch die höhere Auflösung der Tiling-Array Untersuchung werden durch die genaue Beschreibung der telomer- und centromerseitigen Grenzen der ampGA auch die potentiellen AFS innerhalb des Amplikon ermittelt.Due to the higher resolution of the tiling-array examination, the exact description of the telomere and centromere-side limits of the ampGA also identifies the potential AFS within the amplicon.

In Schritt b.) wird der in Schritt a.) ermittelte Fusionsbereich sequenziert. Dazu erfolgt bevorzugt zunächst eine Vervielfältigung des Fusionsbereichs. Bevorzugt wird dazu eine konventionelle PCR über den in Schritt a.) ermittelten Fusionsbereich gelegt. Bevorzugt nach Erhalt eines spezifischen PCR-Fragmentes wird der Fusionsbereich durch Sequenzierung basengenau beschrieben. Nach ggf. notwendiger Optimierung der den Fusionsbereich übergreifenden PCR bzgl. Sensitivität und Anwendbarkeit für semiquantitative Verfahren (z. B. Real-Time PCR) erhält man eine patientenindividuelle und 100% malignomzellspezifische PCR. Je nach Aufbau des Amplikon kann die PCR dabei auch mehrere (z. B. sehr kurze) ampGA und damit ggf. mehrere Fusionsbereiche überbrücken, zwischen denen auch nicht amplifizierte Bereiche liegen können.In step b.), The fusion range determined in step a.) Is sequenced. For this purpose, a duplication of the fusion region preferably takes place first. Preference is given to a conventional PCR on the in Step a.) Established fusion area. Preferably after obtaining a specific PCR fragment, the fusion region is described by sequencing. After possibly necessary optimization of the PCR across the fusion range with regard to sensitivity and applicability for semiquantitative methods (eg real-time PCR), a patient-specific and 100% malignoma-cell-specific PCR is obtained. Depending on the structure of the amplicon, the PCR can also bridge several (eg, very short) ampGAs and, thus, possibly several fusion regions between which unamplified regions may also lie.

Das Bereitstellen der Probe in Schritt c.) erfolgt basierend auf der in Schritt b.) erhaltenen Sequenz des Fusionsbereichs. Dies kann durch manuelles Sondendesign oder auch computergestützt mit Programmen erfolgen (wie z. B. Beacon Designer^TM, Premier Biosoft, Palo Alto CA, USA oder PrimerQuest, Integrated DNA Technologies, Inc., Coralville, IA, USA).The provision of the sample in step c.) Is based on the sequence of the fusion region obtained in step b.). This may be done by manual probe design or computerized programs (such as Beacon Designer ^™ , Premier Biosoft, Palo Alto CA, USA or PrimerQuest, Integrated DNA Technologies, Inc., Coralville, IA, USA).

Der Begriff Nukleinsäuren im Sinne der Erfindung umfasst neben Desoyribonukleinsäuren (DNA) und Ribonukleinsäuren (RNA) auch alle anderen linearen Polymere, in denen die Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) oder Uracil (U) (oder andere komplementär zu verwendenden, modifizierten Basen) in entsprechender Abfolge angeordnet sind, insbesondere Nukleinsäuren mit verändertem Rückgrat oder 3' oder 5'-Terminus, wie z. B. einem Phosphothioat-, Phosphoramidat- oder O-Methyl-derivatisierten Rückgrat, Peptid-Nukleinsäuren (PNA) ( Cutrona et al. 2000 ), und locked nucleic acids (LNA) ( Rapozzi et al. 2006 ) oder gemischtem Rückgrat. Dabei kann auch eine Linkersequenz integiert sein (Zorro-LNA ( Ge et al. 2007 )). Der Begriff „modifizierter 3' oder 5' Terminus” umfasst dabei sowohl Modifikationen, die der Stabilisierung der Sonde oder dem Sondentransfer in den Zellkern dienen ( Bendifallah et al. 2006 ), als auch das Anbinden von Chemotherapeutika ( Duca et al. 2006, Arimondo et al. 2005 ).The term "nucleic acids" in the sense of the invention encompasses not only desoyribonucleic acids (DNA) and ribonucleic acids (RNA) but also all other linear polymers in which the bases adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil ( U) (or other complementary to be used, modified bases) are arranged in a corresponding sequence, in particular nucleic acids with altered backbone or 3 'or 5'-terminus, such as. A phosphothioate, phosphoramidate or O-methyl derivatized backbone, peptide nucleic acids (PNA) ( Cutrona et al. 2000 ), and locked nucleic acids (LNA) ( Rapozzi et al. 2006 ) or mixed backbone. In this case, a linker sequence can also be integrated (Zorro-LNA ( Ge et al. 2007 )). The term "modified 3 'or 5'terminus" includes both modifications which serve to stabilize the probe or probe transfer into the nucleus ( Bendifallah et al. 2006 ), as well as the binding of chemotherapeutic agents ( Duca et al. 2006, Arimondo et al. 2005 ).

Bevorzugt kommen in der Erfindung Nukleinsäurensonden mit verändertem Rückgrat zur Anwendung, d. h. in denen das Zucker-Phosphat-Rückgrat einzelner oder aller Nukleotide derivatisiert ist oder durch ein anderes Rückgrat ersetzt ist. Bevorzugt ist das Zucker-Phosphat-Rückgrat einzelner oder aller Nukleotide Phosphothioat-, Phosphoramidat-, Phosphorodiamidat- oder O-Methyl-derivatisiert oder durch ein Peptid-(PNA) und/oder locked nucleic acid-(LNA)-Rückgrat ersetzt.Preferably, nucleic acid probes with altered backbones are used in the invention, i. H. in which the sugar-phosphate backbone of any or all nucleotides is derivatized or replaced by another backbone. Preferably, the sugar-phosphate backbone of any or all of the nucleotides is phosphorothioate, phosphoramidate, phosphorodiamidate or O-methyl derivatized or replaced by a peptide (PNA) and / or locked nucleic acid (LNA) backbone.

Die mit dem erfindungsgemäßen Verfahren erhaltene Probe kann vorteilhaft (beispielsweise durch intravenöse Injektion, Injektion direkt in einen Malignomherd (Primärtumor oder Metastase), Injektion in eine von dem Malignom befallene Körperhöhle (Pleurahöhle, Bauchhöhle, Artikulär, Liquorraum)) zur Therapie von Malignomzellen eingesetzt werden.The sample obtained by the method according to the invention can advantageously be used (for example by intravenous injection, injection directly into a malignantoma (primary tumor or metastasis), injection into a body cavity affected by the malignancy (pleural cavity, abdominal cavity, articular, cerebrospinal fluid)) for the treatment of malignant cells ,

Das erfindungsgemäße Verfahren bzw. die damit erhaltenen Proben ermöglichen vorteilhaft, die hochspezifische Therapie von Malignomzellen. Das Verfahren ist absolut malignomzell- und patientenspezifisch. Damit sollten die Nebenwirkungen auf die gesunden Zellen des entsprechenden Organismus minimiert werden bzw. völlig entfallen.The method according to the invention or the samples obtained therewith advantageously enable the highly specific therapy of malignant cells. The procedure is absolutely malignomzell- and patient-specific. Thus, the side effects on the healthy cells of the corresponding organism should be minimized or completely eliminated.

Gegenstand der Erfindung ist auch die mit dem erfindungsgemäßen Verfahren erhaltene malignomzell- und patientenspezifische Probe, sowie deren Verwendung für die Therapie von Malignomen.The invention also relates to the malignoma cell and patient-specific sample obtained by the method according to the invention, as well as their use for the therapy of malignancies.

Die erfindungsgemäße malignomzell- und patientenspezifische Probe eignet sich vor allem zum Zerstören von Malignomzellen, in Geweben und/oder Körperflüssigkeiten, insbesondere im Knochenmark und/oder im peripherem Blut ex vivo oder in vivo. Eine ex vivo Anwendung ist das Zerstören von Malignomzellen in von Patienten gewonnenen Stammzellpräparaten oder Knochenmarkpräparaten, insbesondere vor einer autologen Stammzell- oder Knochenmarktransplantation mit diesen Präparaten.The malignoma cell- and patient-specific sample according to the invention is particularly suitable for destroying malignant cells, in tissues and / or body fluids, in particular in the bone marrow and / or in the peripheral blood ex vivo or in vivo. One ex vivo application is the destruction of malignant cells in patient-derived stem cell preparations or bone marrow preparations, particularly prior to autologous stem cell or bone marrow transplantation with these preparations.

Die erfindungsgemäße malignomzell- und patientenspezifische Probe eignet sich weiter zur Behandlung von Metastasen oder einer minimalen Resterkrankung (Minimal Residual Disease (MRD)).The malignoma cell- and patient-specific sample according to the invention is also suitable for the treatment of metastases or a minimal residual disease (Minimal Residual Disease (MRD)).

Die einzelnen bevorzugten Schritte des erfindungsgemäßen Verfahrens werden näher durch das Schema in 1 erläutert.The individual preferred steps of the process according to the invention are described in more detail by the scheme in FIG 1 explained.

Ein Malignom ist eine Erkrankung, bei der Zellen des Körpers autonom und grenzüberschreitend, teilweise destruierend wachsen und ohne Behandlung zum Tod des Organismus führen können. Dieses beinhaltet Erkrankungen des blutbildenden Systemes (Leukämien und Lymphome) sowie Erkrankungen, die aus Zellen aller anderen Organe hervorgehen können (solide, bösartige Tumore)A malignancy is a disease in which the cells of the body grow autonomously and cross-border, sometimes destructive and can lead to the death of the organism without treatment. This includes diseases of the hematopoietic system (leukemias and lymphomas) as well as diseases that can arise from cells of all other organs (solid, malignant tumors)

Der Begriff Malignom umfasst alle bösartigen Neoplasien, insbesondere Leukämieen, Lymphome und solide maligne Tumore. Im Folgenden wird die Erfindung am Beispiel der in humanen Neuroblastomen amplifizierten Region des Chromosomes 2 (Chr. 2p24–25) näher erläutert. Die Erfindung ist jedoch auf alle Formen maligner Erkrankungen, die ampGA aufweisen, anwendbar, unabhängig von der Sequenz und der Lokalisation der ampGA innerhalb des Gesamtgenomes. Für viele Malignome sind ampGA bekannt (Tabelle 1). In transformierten Zellen finden sich zudem häufig ampGA, die nicht regelmäßig bei diesen Erkrankungen vorkommen und, anders als z. B. beim Neuroblastom, somit keine Aussage über eine prognostische Bedeutung per se zulassen (z. B. Magenkarzinom). Alle diese ampGA können mit dem erfindungsgemäßen Verfahren als Ziel des Therapieverfahrens benutzt werden, um hochselektiv Malignomzellen zu erreichen. Die Erfindung ist grundsätzlich auf alle Malignome anwendbar, welche amplifizierte Genomabschnitte enthalten. The term malignancy includes all malignant neoplasms, especially leukemia, lymphoma and solid malignant tumors. In the following, the invention is explained in more detail using the example of the region of chromosome 2 amplified in human neuroblastomas (Chr. 2p24-25). However, the invention is applicable to all forms of malignant diseases having ampGA, regardless of the sequence and location of the ampGA within the whole genome. For many malignancies ampGA are known (Table 1). In transformed cells, there are also frequently ampGA, which do not occur regularly in these diseases and, unlike z. As in neuroblastoma, thus no statement about a prognostic significance per se (eg, gastric carcinoma). All of these ampGA can be used with the method according to the invention as the target of the therapy method to achieve highly selective malignant cells. The invention is basically applicable to all malignancies containing amplified genome segments.

In einer Variante werden die Proben ohne weitere Anbindung von Carriersubstanzen eingesetzt. Vorteilhaft können die erfindungsgemäßen Proben ex vivo das Zellinnere ohne weitere Carriersubstanzen erreichen (wie zuvor durch Stein et al., 2010 , Cutrona et al., 2000 für andere Proben gezeigt).In one variant, the samples are used without further binding of carrier substances. Advantageously, the samples according to the invention can reach the cell interior ex vivo without further carrier substances (as described above) Stein et al., 2010 . Cutrona et al., 2000 shown for other samples).

Zur Verbesserung der zellulären Aufnahme für ex vivo und in vivo, insbesondere für die Anwendung in vivo, erfolgt bevorzugt eine Modifizierung der erfindungsgemäßen Proben durch Konjugation von Peptiden, bevorzugt zell-penetrierenden Peptide (CPP, cell penetrating peptides), bevorzugt ausgewählt aus Penetratin, Tat-Peptiden (wie pTat), amphipathischen Modell-Peptiden (model amphipathic peptides), Transportan (bevorzugt abgeleitet von Galanin), Oligo-Arginin, pTat, Penetratin, KFF, SynB (bevorzugt abgeleitet von Protegrin) insbesondere SynB3, cis-γ-amirio-L-Prolin-haltigen Peptiden und NLS-Peptiden (NLS = ”Nuclear Localization Sequence”) (siehe z. B. Bendifallah et al., 2006 , Cutrona et al., 2000 ).To improve the cellular uptake for ex vivo and in vivo, in particular for use in vivo, it is preferred to modify the samples according to the invention by conjugation of peptides, preferably cell penetrating peptides (CPP), preferably selected from penetratin, Tat Peptides (such as pTat), amphipathic model peptides, transportan (preferably derived from galanin), oligo-arginine, pTat, penetratin, KFF, SynB (preferably derived from protegrin), in particular SynB3, cis-γ-amirio -L-proline-containing peptides and NLS peptides (NLS = "nuclear localization sequence") (see, for example, US Pat. Bendifallah et al., 2006 . Cutrona et al., 2000 ).

Die erfindungsgemäß verwendeten Zell-penetrierenden Peptidsequenzen sind bevorzugt 8 bis 20 Aminosäurereste lang, wobei 30% bis 90% der Reste Seitenketten aufweisen, die unter physiologischen Bedingungen positiv geladen sind. Die verbleibenden Reste sind bevorzugt neutral.The cell-penetrating peptide sequences used according to the invention are preferably 8 to 20 amino acid residues long, wherein 30% to 90% of the residues have side chains which are positively charged under physiological conditions. The remaining radicals are preferably neutral.

Weitere bevorzugte Zell-penetrierende Peptidsequenzen werden in den oben zitierten Literaturstellen genannt, welche diesbezüglich als Referenzen einbezogen werden.Further preferred cell-penetrating peptide sequences are mentioned in the references cited above, which are incorporated herein by reference.

Die Anbindung des Peptids erfolgt bevorzugt über den N-Terminus oder C-Terminus des Peptids an den 5'- oder 3' Terminus der Probe. Linker und Reagenzien für die Kupplung sind dem Fachmann bekannt.The attachment of the peptide is preferably via the N-terminus or C-terminus of the peptide at the 5 'or 3' terminus of the sample. Linkers and reagents for the coupling are known in the art.

Alternativ oder zusätzlich erfolgt zur Verbesserung der zellulären Aufnahme ex vivo und in vivo eine Komplexierung mit einem oder mehreren Substanzen, die nicht direkt (kovalent) an die Proben gebunden sind, jedoch mit diesen Komplexe eingehen oder anderweitig als Träger (Carrier) funktionieren (für Übersichten siehe Juliano 2008 und Fattal 2008). Bevorzugt sind diese Substanzen ausgewählt aus den Gruppen:

1) Kationische Lipide/Liposomen (z. B. DOTAP, Fa. Roche) ( Carbone et al. 2004 )
2) Kationische Polymere (z. B. Polyethylenimin (PEI), Fa. Bender MedSystems)
3) Nanopartikelkomplexe/kationische Nanospheren (Juliano 2008 und Fattal 2008)
4) Ein kurzes, amphipathisches Peptid (Pep-3), in dem eine Tryptophan/Phenylalanin Domäne mit einem Lysin/Arginin reichen, hydrophilen Motiv kombiniert ist ( Morris et al., 2007 ).

Alternatively or additionally, to enhance cellular uptake ex vivo and in vivo, complexation will occur with one or more substances that are not directly (covalently) bound to the samples, but that will undergo these complexes or otherwise function as carriers (for reviews see Juliano 2008 and Fattal 2008). These substances are preferably selected from the groups:

1) cationic lipids / liposomes (eg DOTAP, Roche) ( Carbone et al. 2004 )
2) cationic polymers (eg polyethyleneimine (PEI), Bender MedSystems)
3) Nanoparticle complexes / cationic nanospheres (Juliano 2008 and Fattal 2008)
4) A short, amphipathic peptide (Pep-3) in which a tryptophan / phenylalanine domain is combined with a lysine / arginine rich, hydrophilic motif ( Morris et al., 2007 ).

Weitere Substanzen werden in den oben zitierten Literaturstellen genannt, welche diesbezüglich als Referenzen einbezogen werden.Other substances are mentioned in the references cited above, which are incorporated herein by reference.

Die oben genannten Peptide und Substanzen, die nicht direkt (kovalent) an die Proben gebunden sind, werden nachfolgend auch Vehikelsubstanzen genannt.The abovementioned peptides and substances which are not directly (covalently) bound to the samples are also referred to below as vehicle substances.

Die erfindungsgemäßen Proben (AntisenseDNA, siRNAs, locked-nucleic-acids (LNAs), Peptide-nucleic-acids (PNAs), morpholino Oligonucleotide (PMOs), etc.) werden eingesetzt, um durch ihre DNA bindende Eigenschaft selbst die DNA Replikation zu beeinflussen und/oder als Vehikel um DNA schädigende Pharmaka oder Radionukleotide direkt an die AFS zu bringen, wo diese nach Bindung ihre Wirkung entfalten können.The samples according to the invention (antisense DNA, siRNAs, locked nucleic acids (LNAs), peptide nucleic acids (PNAs), morpholino oligonucleotides (PMOs), etc.) are used to influence DNA replication by their DNA-binding property and / or as a vehicle to bring DNA-damaging drugs or radionucleotides directly to the AFS, where they can exert their effect after binding.

Die Erfindung umfasst daher Proben, an die Pharmaka oder Radionuklide mit oder ohne Linker gebunden sind.The invention therefore comprises samples to which drugs or radionuclides are bound with or without linker.

Bevorzugte Pharmaka zur Bindung an die Proben (mit oder ohne Linker) sind Daunomycin, Camptothecin, Etoposid (s. z. B. Carbone et al., 2004 , Duca et al. 2006 , Arimondo et al. 2005 ). Weiter bevorzugt sind Pharmaka, mit oder ohne Linker, die zytotoxische Eigenschaften durch Beeinflussung der DNA Struktur besitzen. Diese sind bevorzugt ausgewählt aus Anthrazyklinen, wie Doxorubicin, Daunorubicin, Mitoxanthrone und Epirubicin) oder Platinderivaten, wie Cisplatin oder Carboplatin, und Alkylantien, wie Cyclophosphamid, Ifosfamid, Busulfan und Procarbazin.Preferred drugs for binding to the samples (with or without linkers) are daunomycin, camptothecin, etoposide (see, eg, US Pat. Carbone et al., 2004 . Duca et al. 2006 . Arimondo et al. 2005 ). Also preferred are drugs, with or without linker, the cytotoxic properties by influencing the DNA structure have. These are preferably selected from anthracyclines, such as doxorubicin, daunorubicin, mitoxanthrones and epirubicin) or platinum derivatives, such as cisplatin or carboplatin, and alkylating agents, such as cyclophosphamide, ifosfamide, busulfan and procarbazine.

Bevorzugte Radionukleotide sind ausgewählt aus den radioaktiven Isotopen des Rhenium (insbesondere ¹⁸⁶Re und ¹⁸⁸Re), des Ytrium (⁹⁰Y), des Samarium (¹⁵³Sm), des Thallium (²⁰⁴Tl), des Lutetium (¹⁷⁷Lu), Iod (insbesondere ¹³¹I), und Strontium (⁸⁹Sr).Preferred radionucleotides are selected from the radioactive isotopes of rhenium (in particular ¹⁸⁶ Re and ¹⁸⁸ Re), yttrium ( ⁹⁰ Y), samarium ( ¹⁵³ Sm), thallium ( ²⁰⁴ Tl), lutetium ( ¹⁷⁷ Lu), iodine (in particular ¹³¹ I), and strontium ( ⁸⁹ Sr).

Die Radionukleotide können direkt an die Probe (wie z. B. im Falle des ¹³¹I) oder auch über ein üblichen Chelator an die Sonde gebunden sein. Bevorzugte Chelatoren sind ausgewählt aus pyrazolyl-basierten N4-, N3S – oder N2S2-Donor Chelatoren, insbesondere Dimercaptobernsteinsäure (DMSA), Diethylentriaminpentaessigsäure (DTPA), Diphosphonate, sowie von den vorgenannten Verbindungen abgeleiteten Chelatoren.The radionucleotides can be bound directly to the sample (as in the case of the ¹³¹ I) or via a conventional chelator to the probe. Preferred chelators are selected from pyrazolyl-based N4, N3S or N2S2 donor chelators, especially dimercaptosuccinic acid (DMSA), diethylenetriamine pentaacetic acid (DTPA), diphosphonates, as well as chelators derived from the aforementioned compounds.

Die mit dem erfindungsgemäßen Verfahren erhabene Probe wird bevorzugt durch intravenöse Injektion, Injektion direkt in einen Malignomherd (Primärtumor oder Metastase), Injektion in eine, den Malignomherd versorgende Arterie, Injektion in eine von dem Malignom befallene Körperhöhle (insbesondere Pleurahöhle, Bauchhöhle, Artikulär, Liquorraumzur Therapie von Malignomzellen verabreicht.The sample raised by the method according to the invention is preferably obtained by intravenous injection, injection directly into a malignantoma (primary tumor or metastasis), injection into an artery supplying the malignantoma, injection into a body cavity affected by the malignancy (in particular pleural cavity, abdominal cavity, articular, CSF space Therapy of malignant cells administered.

Eine direkte Injektion in den primären Tumor/Malignom kommt bevorzugt bei niedrigen Stadien, d. h. lokalisierter Erkrankung ohne nachgewiesene Metastasierung, zum Einsatz. Dabei wird bevorzugt unter Zuhilfenahme geeigneter bildgebender Verfahren die Probe in geeigneter Lösungsform (z. B. physiologische Kochsalzlösung (NaCl 0,9%)) und ggf. eine Vehikelsubstanz (s. o.) direkt in den primären Tumor/Malignom injiziert. Die Injektion kann auch in eine den Primärtumor/-malignom versorgende Arterie stattfinden, wenn die entsprechenden Gefäße zuvor durch geeignete bildgebende Verfahren dargestellt werden konnten. Die Menge der eingebrachten Probe und die Häufigkeit der Anwendung hängt dabei von Art und Größe des primären Malignomes ab und wird bevorzugt zuvor für jede Malignomentität separat austitriert.Direct injection into the primary tumor / malignancy is preferred at low stages, i. H. localized disease without proven metastasis. In this case, preferably with the aid of suitable imaging methods, the sample is injected in suitable solution form (eg physiological saline solution (NaCl 0.9%)) and optionally a vehicle substance (see above) directly into the primary tumor / malignancy. Injection may also take place in an artery supplying the primary tumor / malignancy, if the corresponding vessels could previously be visualized by appropriate imaging techniques. The amount of sample introduced and the frequency of application depend on the type and size of the primary malignancy and is preferably previously titrated separately for each malignancy.

Bei weiter fortgeschrittenen Erkrankungen bzw. Rezidiverkrankungen (vorzugsweise im Stadium einer minimal residual disease (MRD)) kann die Probe auch systemisch verabreicht werden. Dabei wird die Probe in geeigneter Lösungsform (z. B. physiologische Kochsalzlösung (NaCl 0,9%)) und ggf. eine Vehikelsubstanz (s. o.) über das Blutgefäßsystem (intravenös) oder in eine den Malignomzellen angrenzende Körperhöhle (z. B. Bauchhöhle, Pleurahöhle, Liquorraum, Gelenkspalt) eingebracht. Die Anwendung kann auch inhalativ bzw. oral (per os) erfolgen. Dabei ist die Probe in einer entsprechenden Galenik zur Verfügung zu stellen.In more advanced disease or recurrent disease (preferably at the stage of minimal residual disease (MRD)), the sample may also be administered systemically. The sample is administered in a suitable solution form (eg physiological saline (NaCl 0.9%)) and optionally a vehicle substance (see above) via the blood vessel system (intravenously) or into a body cavity adjacent to the malignant cells (eg abdominal cavity, Pleural cavity, CSF space, joint space) introduced. The application can also be made by inhalation or oral (per os). The sample must be provided in appropriate galenics.

Die antiproliferative Wirkung erfolgt nach Aufnahme der Probe in die Malignomzellen und spezifische Bindung an den genomischen Fusionsbereich. Da dieser Bereich, welcher die AFS-enthält, absolut tumorzellspezifisch ist, kann eine Wirkung nach Aufnahme der Proben in eine gesunde Zelle keine oder nur eine deutlich schwächere Wirkung entfalten. Die Menge der eingebrachten Probe und die Häufigkeit der Anwendung hängen dabei von Art und Größe des primären Malignomes und dem Ausmaß der Verbreitung (z. B. Metastasierungsgrad) ab und wird bevorzugt zuvor für jede Malignomentität separat austitriert.The antiproliferative effect is carried out after incorporation of the sample into the malignant cells and specific binding to the genomic fusion region. Since this area, which contains the AFS, is absolutely tumor cell-specific, an effect after taking the samples into a healthy cell can have no or only a significantly weaker effect. The amount of sample incorporated and the frequency of administration depend on the type and size of the primary malignancy and the extent of the spread (eg degree of metastasis) and is preferably previously titrated separately for each malignancy.

Ex vivo kann die Anwendung der unmodifizierten oder modifizierten Proben zur Elimination minimaler Mengen Malignomzellen in Stammzellpräparaten stattfinden, für die eine Retransfusion nach Hochdosischemotherapie im Sinne einer autologen Stammzelltransplantation geplant ist. Wenn der Nachweis von Restmalignomzellen mit spezifischer AFS erfolgt ist, kann die Probe direkt, mit oder ohne Vehikel, zu dem Stammzellpräparat gegeben werden. Die Proben werden von den Malignomzellen aufgenommen und binden an die malignomzellspezifischen Fusionsbereiche mit den AFS und entfalten dort ihre Wirkung. Nach Elimination der Malignomzellen wird das Stammzellpräparat dem Patienten retransfundiert.Ex vivo may be the use of unmodified or modified samples for the elimination of minimal amounts of malignant cells in stem cell preparations for which a retransfusion after high dose chemotherapy in the sense of an autologous stem cell transplantation is planned. If detection of residual malignant cells with specific AFS has occurred, the sample may be added directly to the stem cell preparation, with or without a vehicle. The samples are taken up by the malignant cells and bind to the malignoma cell-specific fusion areas with the AFS and unfold their effect there. After elimination of the malignant cells, the stem cell preparation is retransfused to the patient.

Die Erfindung wird nachfolgend anhand von Figuren und Ausführungsbeispielen näher erläutert, ohne auf diese beschränkt zu sein.The invention will be explained in more detail below with reference to figures and exemplary embodiments, without being limited thereto.

Die prinzipielle Vorgehensweise des erfindungsgemäßen Verfahrens zur Etablierung eines AFS spezifischen Therapeutikums wird anhand zweier primärer, humaner Neuroblastomzellinien beschrieben, die eine Amplifikation des genomischen Bereiches um MYCN aufweisen.The basic procedure of the method according to the invention for establishing an AFS-specific therapeutic agent is described by means of two primary, human neuroblastoma cell lines which have an amplification of the genomic range around MYCN.

Da das Vorhandensein der Amplifikation des genomischen Berreiches um MYCN in beiden Zellinien bekannt, ist konnte die DNA gleich auf einem Tiling-Array hybridisiert werden, der den genomischen Bereich um das MYCN-Gen entsprechend hoch auflöst.Since the presence of MYCN amplification in the genomic area is known in both cell lines, the DNA could be readily hybridized to a tiling array that resolves the genomic region around the MYCN gene to high levels.

1: A) Graphische Darstellung eines genomischen Abschnittes (GA). B) Liegt dieser Abschnitt in mehreren Kopieen hintereinander aufgereiht vor, kann dieser als amplifizierter genomischer Abschnitt (ampGA) bezeichnet werden. Die übergeordnete Struktur entspricht dem Amplikon. C) Der Fusionsbereich zweier ampGA wird als Amplikon-Fusions-Stelle (AFS) bezeichnet. Diese bietet einen Angriffspunkt für sequenz- und damit malignomzellspezifische Proben (z. B. PNAs oder LNAs). Diese können zum einen: D) durch ihre Bindung die DNA Replikation in dem amplifizierten Bereich beeinträchtigen oder E) als Vehikel dienen, um DNA schädigende Substanzen sequenzspezifisch an das Amplikon heranzubringen. 1 : A) Graphical representation of a genomic segment (GA). B) If this section is lined up in several copies one after the other, this can be called an amplified genomic segment (ampGA). The parent structure corresponds to the amplicon. C) The fusion region of two ampGA is called amplicon fusion site (AFS). This provides a target for sequence- and thus malignancy-specific samples (eg PNAs or LNAs). These can on the one hand: D) interfere with DNA replication in the amplified region due to their binding or E) serve as a vehicle for bringing DNA-damaging substances sequence-specifically to the amplicon.

2: Dargestellt ist der mögliche Ablauf der Etablierung einer AFS gezielten Malignomtherapie im Falle einer neu diagnostizierten Malignomerkrankung. Sind für die entsprechende Erkrankung bereits ampGA vorbeschrieben, kann direkt mit einer Fine-Tiling Array Untersuchung begonnen werden. Sind keine Gen-Amplifikationen bekannt, kann zuvor im Gesamtgenom mittels CGH Untersuchung gescreent werden. Folgend sind die weiteren Schritte zur Etablierung einer die AFS nutzenden malignomzellspezifischen Therapie beschrieben. Die Proben, bzw. die die Proben enthaltenden Lösungen/Präparate können in vivo als auch ex vivo Anwendung finden. 2 : Shown is the possible course of establishing an AFS-targeted malignancy therapy in the case of a newly diagnosed malignancy. If ampGA is already prescribed for the corresponding disease, a fine tiling array examination can be started directly. If no gene amplifications are known, screening can be performed beforehand in the whole genome by means of CGH examination. The following steps are described for the establishment of a malignoma cell-specific therapy using AFS. The samples or the solutions / preparations containing the samples can be used in vivo as well as ex vivo.

3: Dargestellt sind die Ergebnisse der Fine-Tiling Array Untersuchung von genomischer DNA aus den Neuroblastomzellinien KELLY und IMR-32. In beiden Fällen ist die Amplifikation des Bereiches um MYCN (genomische Lokalisation um 16Mb) darstellbar und gut nach telomer- und centromerwärts hin abgrenzbar. Die Amplifikationshöhe ist als Log2-Ratio bezogen auf die Basallinie dargestellt 3 : The results of the fine-tiling array examination of genomic DNA from the neuroblastoma cell lines KELLY and IMR-32 are shown. In both cases, the amplification of the region around MYCN (genomic localization by 16Mb) can be represented and well demarcated by telomere and centromere. The amplification level is shown as the Log2 ratio relative to the basal line

4: A) Tiling-Array Darstellung des ampGA der KELLY Zellinie und dessen virtuellen telomerseitigen und centromerseitigen Grenzen. B) Virtuelle Fusionierung der ampGA-Grenzen. Damit wird die Aneinanderreihung „simuliert”, ohne die basengenaue Grenze zu kennen. C) Mit Abstand zu der virtuellen Fusionsstelle werden die Primer für die nachfolgende PCR designt. In Einzelfällen kann es notwendig sein mehrere Primerpaare zu designen, abhängig von der Qualität der Arrayuntersuchung und der Arrayauflösung an den Grenzbereichen (s. Haupttext). Nach erfolgreichem Primerdesign erhält man eine spezifische PCR Bande. D) Nach Sequenzierung des PCR Produktes erhält man die basengenaue Amplikonfusionsstelle (AFS) und den Fusionsbereich, anhand derer eine malignomzellspezifische, die AFS übergreifende Probe designt werden kann. 4 : A) Tiling Array Representation of the ampGA of the KELLY cell line and its virtual telomere-side and centromeric boundaries. B) Virtual fusion of ampGA boundaries. Thus, the sequence is "simulated" without knowing the base-exact limit. C) At a distance from the virtual fusion site, the primers are designed for subsequent PCR. In individual cases it may be necessary to design several primer pairs, depending on the quality of the array examination and the array resolution at the boundary areas (see main text). After successful primer design, a specific PCR band is obtained. D) Following sequencing of the PCR product, the base-specific amplicon fusion site (AFS) and the fusion region are obtained, by means of which a malignoma-cell-specific sample covering AFS can be designed.

5: A) Tiling-Array Darstellung der ampGA der IMR-32 Zellinie und deren virtuellen telomerseitigen und centromerseitigen Grenzen. B) Darstellung der durch PCR validierten AFS. Für drei der vier im Array dargestellten ampGA konnte eine direkte Fusion gezeigt werden. Dabei ist interessant, daß in diesem Fall die ampGA auch in inverser Richtung fusioniert sein können. Für ein ampGA konnte keine direkte Fusion mit den übrigen, auf dem Array dargestellten ampGA gezeigt werden. Mögliche Ursache ist das Vorhandensein weiterer ampGA in Bereichen des Genomes, die von der Tiling-Array Untersuchung nicht erfasst wurden und noch zwischen diese ampGA fusioniert sind. Für die Etablierung einer tumorspezifischen AFS-PCR reicht jedoch der Nachweis einer einzelnen AFS aus. C) Nach Sequenzierung des PCR Produktes erhält man die basengenaue Amplikonfusionstelle (AFS) und den Fusionsbereich, anhand derer eine malignomzellspezifische, die AFS übergreifende Probe designt werden kann. 5 : A) Tiling Array Representation of the ampGA of the IMR-32 cell line and its virtual telomere-side and centromeric boundaries. B) Representation of the AFS validated by PCR. For three of the four ampGA shown in the array a direct fusion could be shown. It is interesting that in this case the ampGA can also be fused in the inverse direction. For an ampGA, no direct fusion could be shown with the other ampGA shown on the array. Possible cause is the presence of further ampGA in areas of the genome, which were not detected by the tiling array investigation and are still fused between these ampGA. However, the detection of a single AFS is sufficient for the establishment of a tumor-specific AFS-PCR. C) After sequencing of the PCR product, the base-specific amplicon fusion site (AFS) and the fusion region are obtained, by means of which a malignoma-cell-specific sample covering the AFS can be designed.

6: Darstellung der Spezifität der AFS-PCRs für die Neuroblastomzellinien KELLY und IMR-32. Durchgeführte PCRs mit den jeweiligen Primern führen nur mit den DNAs der jeweiligen Zellinien zu spezifischen PCR Fragmenten. Die Zelllinien SH-EP, SY5Y, SK-N-BE(2) und CHP126 sowie natives gesundes Plazentagewebe sind Vergleichsproben. 6 : Representation of the specificity of the AFS PCRs for the neuroblastoma cell lines KELLY and IMR-32. Performed PCRs with the respective primers lead only to the DNAs of the respective cell lines to specific PCR fragments. The cell lines SH-EP, SY5Y, SK-N-BE (2) and CHP126 as well as native healthy placental tissue are comparative samples.

7a/7b: Dargestellt sind die Ergebnisse der Fine-Tiling Array Untersuchung von genomischer DNA aus 40 unterschiedlichen, primären, MYCN amplifizierten Neuroblastomen. In allen Fällen ist die Amplifikation des/der ampGA um MYCN (genomische Lokalisation um 16Mb) darstellbar und gut nach temomer- und centromerwärts hin abgrenzbar. Die Amplifikationshöhe ist als Log2-Ratio bezogen auf die Basallinie dargestellt. 7a / 7b : The results of the fine-tiling array examination of genomic DNA from 40 different, primary, MYCN amplified neuroblastomas are shown. In all cases, the amplification of the ampGA by MYCN (genomic localization by 16Mb) can be represented and well demarcated by temomer and centromere. The amplification level is shown as the Log2 ratio relative to the basal line.

Material und Methoden:Material and methods:

Zellen und ZellkulturCells and cell culture

Für die Untersuchung wurden die humanen Neuroblastomzelllinien „IMR32” (DSMZ No. ACC 165) und „KELLY” (DSMZ No. ACC 355) mit vorbekannter MYCN Amplifikation, sowie die humane Neuroblastomzellinie SH-EP (keine DSMZ No. Vorhanden) ohne MYCN Amplifikation in Kultur genommen. Die Zellen wurden unter Standardzellkulturbedingungen kultiviert (5% CO2, 37°C, RPMI-Medium mit 10% Fetalem Kälberserum, Penicillin [100 U/ml], Streptomycin [100 μg/ml] und Glutamin [2 mmol/L]). Vitale, in Teilung befindliche Zellen wurden bei Erreichen einer Konfluenz von ca. 80% trypsinisiert, geerntet und abzentrifugiert und bis zur DNA Isolation bei –20°C gelagert.For the investigation, the human neuroblastoma cell lines "IMR32" (DSMZ No. ACC 165) and "KELLY" (DSMZ No. ACC 355) with previously known MYCN amplification, as well as the human neuroblastoma cell line SH-EP (no DSMZ No. present) without MYCN amplification taken in culture. Cells were cultured under standard cell culture conditions (5% CO2, 37 ° C, RPMI medium with 10% fetal calf serum, Penicillin [100 U / ml], streptomycin [100 μg / ml] and glutamine [2 mmol / L]). Vital, in dividing cells were trypsinized when reaching a confluency of about 80%, harvested and centrifuged and stored at -20 ° C until DNA isolation.

DNA IsolationDNA isolation

Dazu wurde mittels eines Säulenaufreinigungsverfahrens die genomische DNA aus jeweils 5 × 10⁶ Zellen isoliert (QIAGEN DNA-Blond an Tissue Kit; nach Anleitung des Herstellers). Die DNA-Konzentration und -Qualität wurden photospektrometrisch gemessen (Nanodrop, Fa. Amersham). Ausgangsbedingung für eine Arrayhybridisierung war eine DNA-Konzentration von 250 ng/μl, eine DNA Gesamtmenge von 5 μg DNA und eine 280/260 nm Ratio von 1,85–1,95 (Angaben der Firma ImaGenes, Berlin).For this purpose, the genomic DNA was isolated from each 5 × 10 ⁶ cells by means of a column purification method (QIAGEN DNA-Blond on Tissue Kit, according to the manufacturer's instructions). The DNA concentration and quality were measured by spectrophotometry (Nanodrop, Amersham). The initial condition for array hybridization was a DNA concentration of 250 ng / μl, a DNA total amount of 5 μg DNA and a 280/260 nm ratio of 1.85-1.95 (data from ImaGenes, Berlin).

Arrayarray

Die DNA wurde zusammen mit einer Kontroll-DNA (DNA eines gesunden, humanen, gleichgeschlechtlichen Individuums) auf den entsprechenden Arrayslide hybridisiert. Die Färbung der Proben DNA erfolgte mit dem Fluoreszenzfarbstoff Cy5, die Färbung der Kontroll DNA erfolgte mit Cy3. Das Arraydesign und die Arrayhybridisierung erfolgte als Auftragsleistung bei der Firma ImaGenes (Berlin, Deutschland).The DNA was hybridized to a control DNA (DNA of a healthy, human, same-sex individual) on the corresponding array slide. The staining of the samples DNA was carried out with the fluorescent dye Cy5, the staining of the control DNA was carried out with Cy3. The array design and the array hybridization took place as commissioned by ImaGenes (Berlin, Germany).

Auf dem Arrayslide wurden DNA-Oligos (16–20 Basen Länge) des zu untersuchenden Bereiches geprintet. Die Auflösung errechnet sich dabei aus der möglichen Anzahl der zu hybridisierenden Oligos und der gewünschten Ausdehnung des zu untersuchenden Bereiches. In unserem Fall wurde ein Arrayslide mit 384.599 DNA-Oligos bestückt. Die Ausdehnung des zu untersuchenden Bereiches auf Chromosom 2p (inklusive der Kontrollbereiche) umfasste 24.913.401 Basen. Daraus ergibt sich eine Auflösung unseres Array von durchschnittlich 65 Basen Abstand zwischen 2 aufeinander folgenden DNA-Oligos. Zu beachten ist dabei, dass in Bereichen des Genomes mit hochspezifischen Sequenzfolgen (z. B. für Gene kodierendes Euchromatin) die spezifischen DNA-Oligos in einer höheren Auflösung (kleinerer Abstand zueinander) designt werden können. In Bereichen des Genomes, in denen z. B. längere Repeatfolgen vorkommen, ist die Auflösung entsprechend niedriger. Die Ergebnisse der Arrayhybridisierung der beiden Zelllinien-DNAs sind in 3 dargestellt.On the Arrayslide DNA oligos (16-20 bases in length) of the area to be examined were printed. The resolution is calculated from the possible number of oligos to be hybridized and the desired extent of the area to be examined. In our case, an arrayslide was populated with 384,599 DNA oligos. The extent of the area to be examined on chromosome 2p (including the control areas) comprised 24,913,401 bases. This results in a resolution of our array of on average 65 bases distance between 2 consecutive DNA oligos. It should be noted that in areas of the genome with highly specific sequence sequences (eg euchromatin coding for genes) the specific DNA oligos can be designed in a higher resolution (smaller distance from one another). In areas of the genome in which z. B. longer repeat sequences occur, the resolution is correspondingly lower. The results of array hybridization of the two cell line DNAs are in 3 shown.

PrimerdesignPrimerDesign

Die Angabe der exakten Position der auf den Array geprinteten Oligos ermöglicht es per Datenbanksuche (z. B. BLAT – The BLAST-Like Alignment Tool, Genome Res 12:4 656–664 . http://genome.ucsc.edu/cgi-bin/hgBlat?command=start ) die Sequenzen der telomerseitigen und zentromerseitigen Grenzen des ampGA zu erhalten.Specifying the exact position of the oligos printed on the array makes it possible by database search (eg. BLAT - The BLAST-Like Alignment Tool, Genome Res 12: 4, 656-664 , http://genome.ucsc.edu/cgi-bin/hgBlat?command=start ) to obtain the sequences of the telomeric and centromeric boundaries of the ampGA.

Die jeweils ersten und letzten 1000 Basen des auf dem Array als ampGA dargestellten Bereiches wurden in eine Textdatei kopiert und so aneinandergereiht, dass jeweils an das Ende eines ampGA ein neuer Anfang des nächsten ampGA folgt. Damit wird virtuell der Fusionsbereich simuliert, in dem, in gleichgerichteter Orientierung, die amplifizierte Sequenz wieder aufeinander folgt. Diese Amplikonfusionsstelle (AFS) und damit der Fusionsbereich sind absolut spezifisch für das Tumorzellgenom und in keiner anderen Zelle zu finden, da ausschließlich die Tumorzellen die Amplifikation des exakt gleichen Bereiches aufweisen. Der so ermittelte Fusionsbereich dient nun zum Primerdesign für die nachfolgenden AFS-PCR Reaktionen. Die Primer werden so designt, dass jeweils ein Primer im telomerseitigen und ein Primer im centromerseitigen Sequenzbereich des ampGA liegt. Eine PCR kann also nur zu einem Produkt führen, wenn diese Bereiche aneinander fusioniert sind. Ein Beispiel bietet das MYCN-Amplikon der KELLY Zellinie (4).The first and last 1000 bases of the area shown on the array as ampGA were copied to a text file and strung together so that each end of an ampGA is followed by a new beginning of the next ampGA. This virtually simulates the fusion region in which, in the same direction, the amplified sequence follows one another again. This amplicon fusion site (AFS) and thus the fusion region are absolutely specific for the tumor cell genome and can not be found in any other cell, since only the tumor cells have the amplification of the exact same area. The fusion region determined in this way now serves as a primer design for the subsequent AFS-PCR reactions. The primers are designed in such a way that one primer is located in the telomere side and one primer in the centromere-side sequence region of the ampGA. A PCR can therefore only lead to a product if these areas are fused together. An example is the MYCN amplicon of the KELLY cell line ( 4 ).

Eine weitere Möglichkeit zum Design einer malignomzellspezifischen AFS-PCR besteht in der Überbrückung von nicht amplifizierten Bereichen, die auf der Arraydarstellung wie Lücken innerhalb eines amplifizierten Genomabschnittes wirken. Hier besteht die Möglichkeit, dass die einzelnen ampGA in gleicher, oder in inverser Richtung miteinander fusioniert sind. (D. h., dass zwei aufeinander folgende, ampGA so angeordnet sein können, dass an ampGA-1 in „Telomer → Centromer” Ausrichtung der nächste ampGA-2 in „Centromer → Telomer” Ausrichtung fusioniert ist. Dies kommt dadurch zustande, dass es sich bei genomischer DNA um einen Doppelstrang handelt, der sowohl in gleicher, als auch in inverser Richtung (dann allerdings mit vertauschten Strängen) aneinander fusioniert werden kann.) Ein Beispiel bietet das MYCN-Amplikon der IMR32 Zellinie. Dieses Amplikon zeigt einen sehr komplexen Aufbau, da noch weitere amplifizierte Genomabschnitte aus einer Entfernung von 50 Megabasen (um das MEIS1-Gen) in die Amplikonstruktur integriert sind.Another way to design a malignancy cell-specific AFS PCR is to bridge unamplified regions that act on the array representation as gaps within an amplified genome segment. Here it is possible that the individual ampGAs are fused together in the same or in inverse direction. (That is, two consecutive, ampGAs can be arranged such that at ampGA-1 in "telomere → centromere" alignment the next ampGA-2 is fused in "centromeric → telomere" orientation Genomic DNA is a duplex that can be fused together in both the same and inverse directions (but then with interchanged strands). An example is provided by the MYCN amplicon of the IMR32 cell line. This amplicon shows a very complex structure, since even more amplified genome segments from a distance of 50 megabases (around the MEIS1 gene) are integrated into the amplicon structure.

(5) Am Beispiel des IMR32 Amplikons wird deutlich, dass die Lokalisation, die Ausdehnung und der genomische „Inhalt” des amplifizierten Bereiches zur Etablierung einer AFS-PCR unerheblich sind. Primer für die Zellinien PCRs SEQ ID No. Zellinie Sequenz (5'→3') Zellinien AFS-PCR (vor Sequenzierung): IMR32 F GGTTGTTGAGAGGATAATGGA 1 R TAGGAAAGGCTTTGGGTTAT 2 Kelly F TCTACCCAAGACACATGCTAA 3 R GCTGTCTGGTGCTACTCAA 4 ( 5 ) Using the example of the IMR32 amplicon, it becomes clear that the localization, the extent and the genomic "content" of the amplified region are irrelevant for the establishment of an AFS-PCR. Primer for cell lines PCRs SEQ ID no. cell line Sequence (5 '→ 3') Cell lines AFS-PCR (before sequencing): IMR32 F GGTTGTTGAGAGGATAATGGA 1 R TAGGAAAGGCTTTGGGTTAT 2 Kelly F TCTACCCAAGACACATGCTAA 3 R GCTGTCTGGTGCTACTCAA 4

PCRPCR

Die PCR zur Validierung der virtuellen Fusionsbereiche erfolgte unter folgenden Bedingungen: QIAGEN-HotStarTaq Plus PCR Mastermix 12,5 μl, DNA der entsprechenden Zellinie/Tumor 200 ng, je 2 amplikonspezifische Primer oder 2 Kontrollprimer (je [25 pMol]), DMSO 1,5 μl, Aqua-dest. ad 25 μl.PCR for the validation of the virtual fusion regions was carried out under the following conditions: QIAGEN-HotStarTaq Plus PCR master mix 12.5 μl, DNA of the corresponding cell line / tumor 200 ng, 2 amplicon-specific primers or 2 control primers (each [25 μmol]), DMSO 1, 5 μl, aqua dest. ad 25 μl.

Cyclerbedingungen: 5 Minuten initiale Denaturierung bei 95°C, anschließend 38 Zyklen mit 20 Sekunden Denaturierung bei 95°C, 20 Sekunden Annealing bei 57°C, 60 Sekunden Elongination bei 72°C, danach Abkühlen auf 4°C bis zum Auftragen auf des Agarose Gel.Cycler conditions: 5 minutes initial denaturation at 95 ° C, then 38 cycles with 20 seconds denaturation at 95 ° C, 20 seconds annealing at 57 ° C, 60 seconds elongation at 72 ° C, then cooling to 4 ° C until applied to the Agarose gel.

Agarosegelelektrophorese in 1%–3% Agarosegel (je nach Produktlänge). Anschließend erfolgte die Färbung der Gele mit Ethidiumbromid. Die Banden wurden unter UV Durchleuchtung sichtbar gemacht und dokumentiert. (4c und 6)Agarose gel electrophoresis in 1% -3% agarose gel (depending on product length). The gels were then stained with ethidium bromide. The bands were visualized and documented under UV fluoroscopy. ( 4c and 6 )

Isolation der DNA der PCR BandenIsolation of the DNA of the PCR bands

Im Anschluß wurden die PCR-Fragmente unter UV-Durchleuchtung aus dem Agarosegel ausgeschnitten und mit dem QIAGEN DNA Gel Extraktion Kit nach Herstellerangaben isoliert.Subsequently, the PCR fragments were excised from the agarose gel under UV transillumination and isolated with the QIAGEN DNA Gel Extraction Kit according to the manufacturer's instructions.

Sequenzierungsequencing

Die Sequenzierung der PCR-Fragmente erfolgte von beiden Seiten mit den entsprechenden, zuvor in der PCR eingesetzten Primern. (Einsatz in die Reaktion: 20 ng/100 bp DNA-Fragment, je 10 pmol Primer. Ansatz der Sequenzierreaktion mit dem „ABI Prism BigDye Terminator 3.1 Ready Reaktion Cycle Seq. Kit” von Applied Biosystems. Reaktionsablauf unter Bedingungen nach Angaben des Herstellers. Als Sequenzer benutzten wir einen „16 Capillary Sequenzer Genetic Analyzer 3100” von Applied Biosystems.The sequencing of the PCR fragments was carried out from both sides with the corresponding primers previously used in the PCR. (Reagent Assay: 20 ng / 100 bp DNA fragment, 10 pmol each, primer Sequencing Reaction with Applied Biosystems ABI Prism BigDye Terminator 3.1 Ready Reaction Cycle Seq.) Reaction procedure under conditions as specified by the manufacturer. As sequencer we used a "16 Capillary Sequencer Genetic Analyzer 3100" from Applied Biosystems.

Testung der Spezifität des Verfahrens 1 (Spezifität der AFS-PCR Primer)Testing the Specificity of Method 1 (Specificity of AFS-PCR Primer)

Die Spezifität der AFS-PCR wurde überprüft, indem die AFS spezifischen Primer mit DNA der jeweiligen amplifizierten Zellinien und weiteren Kontrollzellinien/Geweben eingesetzt wurden. Dabei können AFS spezifische PCR-Fragmente nur aus DNA der entsprechenden Zellinien generiert werden. (6)The specificity of the AFS-PCR was tested by using the AFS-specific primers with DNA of the respective amplified cell lines and other control cell lines / tissues. In this case, AFS-specific PCR fragments can only be generated from DNA of the corresponding cell lines. ( 6 )

Testung der Spezifität des Verfahrens 2 (Hybridisierung von DNA aus 40 primären MYCN amplifizierten Neuroblastomen)Testing the Specificity of Method 2 (Hybridization of DNA from 40 primary MYCN amplified neuroblastomas)

Die Spezifität der AFS wird Anhand einer Untersuchung von DNA aus 40 primären, MYCN amplifizierten Neuroblastomen dargestellt (7a, 7b). Für jedes Amplikon finden sich individuelle telomer- und centromerseitige Grenzen der ampGA. Damit sind die Fusionsbereiche nicht nur innerhalb eines Individuums malignomzellspezifisch, sondern auch interindividuell einzigartig. Die etablierten AFS-PCRs sind somit sowohl malignomzellspezifisch als auch patientenindividuell.The specificity of AFS is demonstrated by examination of DNA from 40 primary MYCN amplified neuroblastomas ( 7a . 7b ). For each amplicon, individual telomere and centromeric limits of the ampGA are found. Thus, the fusion regions are not only malignom cell-specific within an individual, but also unique in their individuality. The established AFS PCRs are thus both malignoma cell-specific and patient-specific.

Anwendung der „anti-AFS” Proben: Application of "anti-AFS" samples:

Nach Identifizierung der malignomzellspezifischen AFS und Synthetisierung der unmodifizierten oder modifizierten Probe, die auf diese AFS zielt, können für diese Proben verschiedene Einsatzmöglichkeiten angenommen werden.After identifying the malignancy-cell-specific AFS and synthesizing the unmodified or modified sample targeting this AFS, various potential applications can be assumed for these samples.

Für die untersuchten Zelllinien könnten folgende Proben zum Einsatz kommen: Probenbeispiele für die Zellinien IMR-32 und Kelly SEQ ID No. Zellinien Sequenz (5'→3') Zellinien AFS IMR32 (AFS-1) (vergl. Figur 5) Tel → Cent AAACTCAGCCATTACATTTAAGTG (kursiv = zusätzlich sequenzierte Basen) Cent → Tel CACTTAAATGTAATGGCTGAGTTT 6 Kelly (vergl. Figur 4) Tel → Cent ACTTGCTCTTGCTCTTTACT 7 Cent → Tel AGTAAAGAGCAAGAGCAAGT 8 The following samples could be used for the investigated cell lines: Sample Examples for Cell Lines IMR-32 and Kelly SEQ ID no. cell lines Sequence (5 '→ 3') Cell lines AFS IMR32 (AFS-1) (see Figure 5) Tel → cents AAACTCAGCCATTACATTTAAGTG (italic = additionally sequenced bases) Cents → Tel CACTTAAATGTAATGGCTGAGTTT 6 Kelly (see Figure 4) Tel → cents ACTTGCTCTTGCTCTTTACT 7 Cents → Tel AGTAAAGAGCAAGAGCAAGT 8th

In der AFS-1 Sequenz der IMR-32 Zelllinie ist zwischen der telomerseitigen und der centromerseitigen Grenzsequenz noch eine 10 Basen lange Zwischensequenz bei der Sequenzierung identifiziert worden. Aufgrund der Kürze ist eine eindeutige Zuordnung zu einem bestimmten genomischen Bereich nicht möglich. Diese muss jedoch bei dem Design der Probe mit berücksichtigt werden, da sie fester Bestandteil der entsprechenden AFS ist. Die Länge der Probe wurde daher mit 24 Basen gewählt, um auch die telomer- und centromerseitigen Grenzen weit genug mit einzubeziehen.In the AFS-1 sequence of the IMR-32 cell line, a 10-base intermediate sequence has been identified in the sequencing between the telomere-side and the centromere-side border sequence. Due to the brevity, a clear assignment to a specific genomic area is not possible. However, this must be taken into account in the design of the sample, since it is an integral part of the corresponding AFS. The length of the sample was therefore chosen to be 24 bases, to include the telomere and centromere boundaries well enough.

Für die Kelly Zelllinie konnte eine AFS sequenziert werden, in der die telomer- und centromerseitigen Grenzen direkt, ohne weitere Zwischensequenz miteinander fusioniert sind. Hier wurde eine Probe mit 20 Basen Länge gewählt.For the Kelly cell line, an AFS could be sequenced, in which the telomere and centromere-side boundaries are fused directly, without further intermediate sequence. Here, a sample of 20 bases in length was chosen.

Die Herstellung der Proben oder der die Proben enthaltenden Lösungen, die zum ex vivo bzw. in vivo Einsatz geplant sind, erfolgen nach den Richtlinien der „Good Manufactoring Practice (GMP)” (einzusehen z. B. unter:
http://ec.europa.eu/enterprise/sectors/pharmaceuticals/documents/eudralex/index_en.htm )The preparation of the samples or the solutions containing the samples, which are planned for ex vivo or in vivo use, are carried out according to the guidelines of the "Good Manufacturing Practice (GMP)" (see, for example, under:
http://ec.europa.eu/enterprise/sectors/pharmaceuticals/documents/eudralex/index_en.htm )

Die Anwendung der Proben oder der die Proben enthaltenden Lösungen soll nach den Richtlinien der „Good Clinical Practice (GCP)” (einzusehen bei dem BfArM unter http://www.bfarm.de/cln_012/nn_1198682/DE/Arzneimittel/1_vorDerZul/klinPr/klinprnode.html_nnn=true ) erfolgen. Der Einsatz außerhalb klinischer Studien kann dabei als individueller Therapieversuch/Heilversuch erfolgen. Der Einsatz erfolgt mit dem Einverständnis des/der Patienten/-in bzw. dessen/deren Eltern oder Angehörigen.The application of the samples or solutions containing the samples should be carried out according to the guidelines of the "Good Clinical Practice (GCP)" (available from the BfArM under http://www.bfarm.de/cln_012/nn_1198682/DE/Arzneimittel/1_vorDerZul/klinPr/klinprnode.html_nnn=true ) respectively. The use outside of clinical studies can be done as an individual therapy attempt / healing attempt. The application is made with the consent of the patient or his / her parents or relatives.

ZITATE ENTHALTEN IN DER BESCHREIBUNG QUOTES INCLUDE IN THE DESCRIPTION

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Zitierte Nicht-PatentliteraturCited non-patent literature

Rapozzi et al. 2006 [0003]
Yoon et al. 2009 [0003]
Stein et al. 2010 [0003]
Cutrona et al. 2000 [0003]
Rapozzi et al. 2006 [0003]
Cutrona et al. 2000 [0020]
Rapozzi et al. 2006 [0020]
Ge et al. 2007 [0020]
Bendifallah et al. 2006 [0020]
Duca et al. 2006, Arimondo et al. 2005 [0020]
Stein et al., 2010 [0030]
Cutrona et al., 2000 [0030]
Bendifallah et al., 2006 [0031]
Cutrona et al., 2000 [0031]
Carbone et al. 2004 [0035]
Morris et al., 2007 [0035]
Carbone et al., 2004 [0040]
Duca et al. 2006 [0040]
Arimondo et al. 2005 [0040]
BLAT - The BLAST-Like Alignment Tool, Genome Res 12: 4 656-664 [0062]
http://genome.ucsc.edu/cgi-bin/hgBlat?command=start [0062]
http://ec.europa.eu/enterprise/sectors/pharmaceuticals/documents/eudralex/index_en.htm [0077]
http://www.bfarm.de/cln_012/nn_1198682/DE/Arzneimittel/1_vorDerZul/klinPr/klinprnode.html_nnn=true [0078]

Claims

A method of making an individual specific drug comprising the steps of: a.) High-resolution representation of amplified genome sections in an isolated tumor sample by means of a fine-tiling array, possibly after previous total genome analysis, preferably a CGH analysis (Comparative Genomic Hybridization), b.) amplification (preferably by PCR) and subsequent sequencing of the fusion regions of the fused-together amplified genome segments within the amplicon with the amplicon fusion sites (AFS), c.) providing a sample which allows to specifically bind the fusion regions.

A method according to claim 1, characterized in that the sample is a nucleic acid probe with an altered backbone.

A method according to claim 2, characterized in that the sugar-phosphate backbone of any or all nucleotides phosphothioate, phosphoramidate or O-methyl derivatized or replaced by a peptide (PNA) and / or locked nucleic acid (LNA) backbone is.

Method according to one of claims 1 to 3, characterized in that the sample is bound to a radionuclide or a drug.

Sample obtained by a method according to any one of claims 1 to 4.

Use of a sample according to claim 5 for the treatment of malignancies.

Use of a sample according to claim 5 for destroying malignant cells, in tissues and / or body fluids, in particular in the bone marrow and / or in the peripheral blood.

Use of a sample according to claim 5 for the treatment of metastases or a minimal residual disease (MRD).

Use of a sample according to claim 5 for destroying maligoma cells in patient-derived stem cell preparations or bone marrow preparations ex vivo, in particular prior to an autologous stem cell or bone marrow transplantation with these preparations.