DE10120798B4 - Method for determining gene expression - Google Patents

Abstract

Method for analyzing gene expression in which
provides single-stranded gene products, man
the gene products binds randomly with one or more different primers in the form of gene product-primer hybridization products on a reaction surface;
performs a cyclic assembly reaction of the complementary strand of the gene products using one or more primers and one or more polymerases by
a) to the immobilized gene products, a solution containing one or more polymerases and one to four modified nucleotides (NTs ^* ), which are labeled with fluorescent dyes, wherein the simultaneous use of at least two NTs ^* each on the NTs ^* fluorescent dyes are chosen such that the NTs used ^* can be distinguished from one another by measuring different fluorescence signals, wherein the NTs ^{* are} structurally modified at the base in such a way that the polymerase is unable after incorporation of such an NT ^* in a growing complementary strand to install another NT ^* in the same string, ...

Description

The Invention describes a method for parallel analysis of expression a big one Number of genes. This method is based on the analysis of sequences on many immobilized nucleic acid chains. These will be short Sequence sections from each of these chains determined. The subsequent evaluation and the comparison with gene sequences in databases allows statements about the expressed genes and the strength of their genes Expression.

 Abbreviations and term explanations

• DNA

  - Deoxyribonucleic acid different Origin and different length: (genomic DNA, cDNA, ssDNA, dsDNA)

  RNA

  - Ribonucleic acid (usually mRNA)

  gene

  - mRNA transcripts or from the mRNA-derived nucleic acid chains (eg single-stranded cDNAs, double-stranded cDNAs, cDNA-derived RNA or DNA amplified from cDNA).

  cDNA

  - complementary DNA

  polymerases

  - Enzymes that are complementary nucleotides in a growing DNA or RNA strand can incorporate (z. DNA polymerases, reverse transcriptases, RNA polymerases)

  dNTP

  2'-deoxy nucleotide triphosphates for DNA polymerases and reverse transcriptases

  NTP

  - Nucleotide triphosphates for RNA polymerases

  NT

  - natural nucleotide, mostly dNTP, if not express otherwise marked.

Abbreviation "NT" is also used in the length specification a nucleic acid sequence used, for. B. 1,000 NT. In this case, "NT" stands for nucleoside monophosphates.

NT^*

– modifiziertes Nukleotid, meist dNTP, wenn nicht ausdrücklich anders gekennzeichnet. NTs^* bedeutet: modifizierte Nukleotide

In the text, the majority of abbreviations are formed by using the suffix "s", "NT" stands for "nucleotide", for example, "NTs" stands for several nucleotides.

NT ^*

- modified nucleotide, usually dNTP, unless expressly indicated otherwise. NTs ^* means: modified nucleotides

Plans Surface: Surface, which preferably has the following features: 1) It allows several individual molecules preferably more than 100, more preferably more than 1000, with the respective given lens surface distance to detect simultaneously at a lens position. 2) The immobilized single molecules are in the same focal plane, which are reproducible can be.

Steric hindrance: Sterically demanding group that, by virtue of its chemical structure, alters the properties of the NTs ^* coupled to this group such that they can not be consecutively incorporated by a polymerase in an extension reaction.

definition Termination: Termination in this application is reversible Stop the installation of modified unsplit NTs.

This Term is from the usual Use of the word "Termination" by Dideoxy-NTP to separate in a conventional sequencing.

SNP

– Single nucleotide polymorphism

PBS

– Primerbindungsstelle

Termination comes about after the installation of a modified NT ^* . The modified incorporated NT ^* carries a steric group reversibly coupled to the base, which results in the inhibition of incorporation of a next complementary NT ^* into the growing strand by a polymerase.

SNP

- Single nucleotide polymorphism

PBS

Primer binding site

The analysis of the gene expression spectrum has become an important tool in science. The comparison of gene expression spectra between different cell lines, tissues or stages of development allows conclusions to be drawn on the specific biological processes occurring therein. So you can z. B. expect that the comparison between tumor cells and healthy cells of the same origin Aus about the genes involved in the tumor. It is important that the activity of as many or all genes is analyzed simultaneously.

The Analysis of gene expression is a complex task: the number the gene that is active in a cell type can be several thousand. The analysis should be as possible all genes contained in the genome of the species in question (about 32,000 in humans). In addition, the In the respective cell type, active genes are not completely complete are known and secondly express different degrees.

It Many methods for gene expression analysis have already been developed so z. B. Differential Display (Nature 1984, v. 308 p. 149, Science 1992 v. Chr. 257, p. 967), Expressed Sequence Tags (EST) (Science 1991 v. 252, p. 1656, Nature Genetics 1992, v. 2 p. 173), Northern blotting or RT-PCR (PNAS 1977, v. 74, p 5350, Cell 1983 v. 34 p 865, "The PCR Technique, RT-PCR "1998, Ed. Paul Suebert, Eaton Publishing). All these methods can only analyze a very limited number of genes per reaction and are sometimes very labor intensive.

The most widely used method for parallel analysis of gene expression patterns is the hybridization of a mixture of cDNA molecules to be analyzed with to a surface bound oligonucleotides that in a particular arrangement, mostly fixed in miniaturized form as "microarray" ("Microarray Biochip Technology" 2000, Ed. M. Schena, Eaton Publishing, Zhao et al. Gene 1995, v. 156, p. 207, Schena et al. Science 1995 v. Chr. 270, p. 467, Lockhart et al. US Patent 6,040,138, Wang U.S. Patent 6,004,755, Arlinghaus et al. US Patent 5,821,060, Southern US Patent 5,700,637, Fodor et al. US Patent 5,871,928).

To the big one Disadvantages of the hybridization method include: The production of the surface bound Oligonucleotides are expensive. The analysis is limited to genes whose sequences already are known. Multiple mismatch controls increase the number of oligonucleotides, which must be immobilized.

• 1) Die Genprodukte können in einer beliebigen Anordnung auf der Oberfläche binden. Eine vorherige aufwendige Synthese von verschiedenen Oligonukleotiden an bestimmten Positionen (wie beispielsweise bei der Hybridisierungsmethode) ist somit nicht notwendig.
• 2) Das Material kann auf einer standardisierten Oberfläche analysiert werden.
• 3) Auch die Expression noch unbekannter Gene kann ermittelt werden, weil alle im Ansatz enthaltenen Genprodukte analysiert werden.
• 4) Die große Anzahl der analysierten Moleküle erlaubt auch die Detektion schwach exprimierter Gene.
• 5) Kleinste Mengen an Ausgangsmaterial können eingesetzt werden: mRNA aus einer einzelnen Zelle kann für die Analyse ausreichend sein.
• 6) Sämtliche Schritte des Verfahrens können weitgehend automatisiert werden.

The present invention describes a method for the parallel analysis of a large number of nucleic acid chain molecules. It is based on the detection of fluorescence signals from single molecules. By simultaneous sequencing of individual gene product molecules, the method has several advantages over the prior art:

• 1) The gene products can bind in any order on the surface. A previous complex synthesis of different oligonucleotides at certain positions (such as in the hybridization method) is therefore not necessary.
• 2) The material can be analyzed on a standardized surface.
• 3) The expression of yet unknown genes can be determined because all gene products contained in the approach are analyzed.
• 4) The large number of analyzed molecules also allows the detection of weakly expressed genes.
• 5) Smallest amounts of starting material can be used: mRNA from a single cell may be sufficient for analysis.
• 6) All steps of the process can be largely automated.

 Short description:

• a) zu den immobilisierten Genprodukten eine Lösung zugibt, die eine oder mehrere Polymerasen und ein bis vier modifizierte Nukleotide (NTs^*) enthält, die mit Fluoreszenzfarbstoffen markiert sind, wobei die bei gleichzeitiger Verwendung von mindestens zwei NTs^* jeweils an den NTs befindlichen Fluoreszenzfarbstoffe so gewählt sind, daß sich die verwendeten NTs^* durch Messung unterschiedlicher Fluoreszenzsignale voneinander unterscheiden lassen, wobei die NTs^* strukturell so modifiziert sind, daß die Polymerase nach Einbau eines solchen NT^* in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres NT^* in denselben Strang einzubauen, wobei der Fluoreszenzfarbstoff abspaltbar ist und die strukturelle Modifikation ein abspaltbarer sterisch anspruchsvoller Ligand ist, man
• b) die in Stufe a) erhaltene stationäre Phase unter Bedingungen inkubiert, die zur Verlängerung der komplementären Stränge geeignet sind, wobei die komplementären Stränge jeweils um ein NT^* verlängert werden, man
• c) die in Stufe b) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung nicht in einen komplementären Strang eingebauter NTs^* geeignet sind, man
• d) die einzelnen, in komplementäre Stränge eingebauten NTs^* durch Messen des für den jeweiligen Fluoreszenzfarbstoff charakteristischen Signals detektiert, wobei man gleichzeitig die relative Position der einzelnen Fluoreszenzsignale auf der Reaktionsoberfläche bestimmt, man
• e) zur Erzeugung unmarkierter, (NTs oder) Genprodukte die Fluoreszenzfarbstoffe und die sterisch anspruchsvollen Liganden von den am komplementären Strang angefügten NTs^* abspaltet, man
• f) die in Stufe e) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung der Fluoreszenzfarbstoffe und der Liganden, geeignet sind, man

die Stufen a) bis f) gegebenenfalls mehrfach wiederholt,
wobei man die relative Position einzelner Genprodukte auf der Reaktionsoberfläche und die Sequenz dieser Genprodukte durch spezifische Zuordnung der in Stufe d) in aufeinanderfolgenden Zyklen an den jeweiligen Positionen detektierten Fluoreszenzsignale zu den NTs bestimmt und man aus den ermittelten Teilsequenzen die Identität der Genprodukte bestimmt.The invention describes a method for analyzing gene expression in which
provides single-stranded gene products, man
the gene products immobilized on a reaction surface at a density of 10 to 100 gene products per 100 μm ² (stationary phase), man
performs a cyclic assembly reaction of the complementary strand of the gene products using one or more primers and one or more polymerases by

• a) to the immobilized gene products, a solution containing one or more polymerases and one to four modified nucleotides (NTs ^* ), which are labeled with fluorescent dyes, wherein the simultaneous use of at least two NTs ^* each located on the NTs fluorescent dyes so are chosen such that the NTs used ^* can be distinguished from each other by measuring different fluorescence signals, wherein the NTs ^* structurally modified so that the polymerase after incorporation of such NT ^* in a growing complementary strand is not able to another Incorporate the NT ^* in the same strand, wherein the fluorescent dye is cleavable and the structural modification is a cleavable sterically demanding ligand, one
• b) the stationary phase obtained in step a) is incubated under conditions suitable for extending the complementary strands, the complementary strands being extended by one NT ^* each;
• c) washing the stationary phase obtained in stage b) under conditions which are suitable for the removal of non-complementary NTs ^*
• d) the individual NTs ^* incorporated in complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, at the same time determining the relative position of the individual fluorescence signals on the reaction surface;
• e) for the production of unlabeled, (NTs or) ^* gene cleaves the fluorescent dyes and the bulky ligands of the appended on the complementary strand NTs, one
• f) washing the stationary phase obtained in step e) under conditions suitable for removing the fluorescent dyes and the ligands

if necessary, the steps a) to f) are repeated several times,
whereby the relative position of individual gene products on the reaction surface and the sequence of these gene products are determined by specific assignment of the fluorescence signals to the NTs detected in step d) in successive cycles at the respective positions and the identity of the gene products is determined from the determined partial sequences.

at The gene products are the primary gene products of the genes whose Expression should be analyzed. Essentially, it is thereby to RNA transcripts of said genes, which also as target sequences (or target nucleic acid sequences) be designated. These target sequences also include mRNA derived therefrom single and double-stranded cDNA, cDNA-derived RNA or cDNA amplified DNA.

The Gene products or target sequences can be either as mRNAs directly from a biological sample (eg cell extract, tissue extract or Extract of whole organisms) isolated or as cDNAs by reverse Transcription of the mRNAs can be obtained.

• a) in jedem Zyklus nur jeweils ein markiertes NT^*,
• b) in jedem Zyklus jeweils zwei unterschiedlich markierte NTs^* oder
• c) in jedem Zyklus jeweils vier unterschiedlich markierte NTs^*

einsetzt.According to a particular embodiment of the invention, the process can be carried out by repeatedly repeating steps a) to f) of the cyclic synthesis reaction, wherein

• a) in each cycle only one marked NT ^* ,
• b) in each cycle two different marked NTs ^* or
• c) four differently marked NTs in each cycle ^*

starts.

The process can also be carried out by repeating steps a) to f) of the cyclic synthesis reaction several times, alternately using in each case two differently labeled NTs ^* and two unlabelled NTs, and the identity of the gene products by comparison with the reference sequences determined.

The present invention also relates to the in the 6e . 6f and 6g represented nucleotides and the corresponding labeled nucleotides, which have, for example, attached to the terminal amino function fluorescent dyes, or in the 6h . 6i or 6y shown labeled nucleotides.

• 1. Kurze Nukleotidsequenzen (10–50 NTs) enthalten genügend Informationen zur Identifizierung des korrespondierenden Gens, wenn die Gensequenz selbst bereits in einer Datenbank enthalten ist. Eine Sequenz aus beispielsweise 10 NTs kann mehr als 10⁶ verschiedene Kombinationen bilden. Das ist z. B. für die meisten Gene im menschlichen Genom, das nach heutiger Schätzung 32000 Gene enthält, ausreichend. Für Organismen mit weniger Genen kann die Sequenz noch kürzer sein.
• 2. Der Methode liegt die Sequenzierung einzelner Nukleinsäurekettenmoleküle zugrunde.
• 3. Es können Nukleinsäureketten-Gemische untersucht werden.
• 4. Die Sequenzierungsreaktion läuft an vielen Molekülen gleichzeitig ab, wobei die Sequenz jeder einzelnen immobilisierten Nukleinsäurekette analysiert wird.

The method is based on several principles:

• 1. Short nucleotide sequences (10-50 NTs) contain enough information to identify the corresponding gene if the gene sequence itself is already in a database. A sequence of, for example, 10 NTs can form more than 10 ⁶ different combinations. This is z. B. for most genes in the human genome, which contains 32000 genes according to the current estimate, sufficient. For organisms with fewer genes, the sequence can be even shorter.
• 2. The method is based on the sequencing of individual nucleic acid chain molecules.
• 3. Nucleic acid chain mixtures can be examined.
• 4. The sequencing reaction proceeds simultaneously on many molecules, analyzing the sequence of each immobilized nucleic acid sequence.

It is known that the Examination of gene expression mRNAs or mRNA derived nucleic acid chains (eg single-stranded cDNAs, double-stranded cDNAs, cDNA-derived RNA or cDNA amplified DNA) be used. Independently of the exact composition, they are referred to below as gene products designated. Subsequences of these gene products will be discussed below referred to as gene products.

These Gene products are a mixture of different nucleic acid chains represents.

she be according to the invention on a suitable flat surface in random Arrangement fixed. After fixing you start with everyone the surface immobilized gene products the sequencing reaction.

• a) Zugabe einer Lösung mit markierten Nukleotiden (NTs^*) und Polymerase zu immobilisierten Nukleinsäureketten,
• b) Inkubation der immobilisierten Nukleinsäureketten mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind,
• c) Waschen,
• d) Detektion der Signale von einzelnen modifizierten, in die neu synthetisierten Stränge eingebauten NTs^*-Molekülen,
• e) Entfernung der Markierung von den eingebauten Nukleotiden,
• f) Waschen.

The basis of the sequencing is the synthesis of a strand complementary to the immobilized gene product. In this case, marked NTs ^{* are} incorporated into the newly synthesized strand. The signals of the built-in marked NTs ^* are detected. The sequencing reaction proceeds in several cycles. Only one marked NT ^{* is incorporated} into the growing strand per cycle. A cycle includes the following steps:

• a) addition of a solution with labeled nucleotides (NTs ^* ) and polymerase to immobilized nucleic acid chains,
• b) incubating the immobilized nucleic acid chains with this solution under conditions suitable for extending the complementary strands around an NT,
• c) washing,
• d) detection of signals from individual modified NTs ^* molecules incorporated into the newly synthesized strands,
• e) removal of the label from the incorporated nucleotides,
• f) washing.

This Cycle can be repeated several times, so that of each immobilized Gene product, preferably 10 to 50 NTs. After that takes place the reconstruction of the nucleic acid sequences from the detected signals. The determined sequences of the immobilized Gene products are compared to determine the abundances and by comparison with gene sequences in databases of particular genes assigned.

These general principles of the reaction are explained by way of example ( 1 ):
The starting material is a mixture of mRNA molecules. The material to be analyzed (1) is fixed on a suitable plane surface (2). The surface carries immobilized polydT oligonucleotides which serve as a primer for initiating the reaction and as a linker for immobilization (oligo dT primer). The unbound mRNA molecules are removed by a washing step. Thereafter, the sequencing reaction is carried out on the entire reaction surface. This reaction is cyclic. In the first step of the cycle, a labeled NT ^{* is incorporated} into the growing strand: the reaction is controlled so that in each cycle only one labeled NT ^* from a polymerase (reverse transcriptase) can be incorporated into the growing strand. This is achieved through the use of NTs bearing a reversibly coupled, terminal-leading group. The installation of another marked NT ^* is prevented. The polymerase and the labeled NTs are used simultaneously in the reaction (3). Thereafter, the reaction mixture is removed and the surface is washed in a suitable manner (4). Now follows a detection step (5). The surface is scanned with a device suitable for single-molecule detection (consisting of eg light source, microscope, camera, scanning table, computer with control and image recognition or image processing software) and the signals of the individual, incorporated labeled NTs ^* identified. After the detection step, the label and termination group are removed from all incorporated NTs ^* (6). The removal can be done chemically, physically or enzymatically. After a subsequent washing step, a new cycle can begin.

Short description the figures

1 General Principle of Sequencing a Long Nucleic Acid Chain (Schematic)

• 1) Starting material - mixture of mRNA molecules
• 2) Immobilized mRNA - planar surface-bound gene product-primer hybridization product te, in this embodiment, binding is via oligo-dT primer
• 3) Addition of a solution with polymerases and NT ^* s as a first step in a cycle of the sequencing reaction
• 4) Washing step - after the installation step, the surface is washed
• 5) Detection - the signals from individual built-in NT ^* s are detected
• 6) Removal of the mark and that leading to the termination Group - to Continuing the sequencing reaction, the label and removed the steric barrier

2 : Examples of the general structure of immobilized gene products

This figure shows a single-stranded gene product ( 3 ), at the 3 'end of which a single primer binding site (PBS; 2) is coupled, to which a primer ( 1 ) has hybridized.

3 : Nucleotide tailing

• a) Several nucleoside monophosphates are linked to the 3 'end of a single-stranded DNA fragment (NSKF) by so-called "tailing" with the aid of a terminal deoxynucleotidyltransferase (adenine monophosphates and the so-called (A) _n -tailing are shown) Use of uniform nucleoside monophosphates produces a uniform PBS at the 3 'end.
• b) Preparation of the gene product-primer hybridization product after hybridization of the primer (shown is a (T) _n primer).

4 : Examples of the binding of gene products to a gel-like reaction surface

• a) On a solid surface ( 1 ) a gel ( 2 ), z. B. a polyacrylamide gel. At its continuous surface bind via groups bound to the gel ( 3 ) (eg streptavidin or avidin) gene products ( 4 ) with a functional group suitable for immobilization ( 3 ), z. B. biotin.
• b) arrangement as in 4b However, the binding of the gene products via a discontinuous surface composed of a number of gel beads ( 5 ), z. B. agarose beads, to the solid surface.

5 : Example of a flow system

A gel-like reaction surface ( 1 ) is on a permeable to the excitation and fluorescent light solid support ( 2 ) attached. Together it forms the lid of the reaction chamber (eg flow cell). The liquids in the reaction chamber can be exchanged controlled, the reaction chamber together with the reservoir ( 3 ), the pump ( 4 ) and the valve ( 5 ) form a flow system. The signals of the NT ^* s incorporated into the gene product-primer hybridization products bound on the reaction surface (not shown here) are transmitted via the objective of the microscope belonging to the detection apparatus (FIG. 6 ) detected.

6 General Structures of NT ^* (Labeled 2'-Deoxynucleoside Triphosphates)

• a) Schematic representation of the NT structure semiterminators, where at the base via a cleavable linker (A-E) a steric group (D) and the fluorescent marker (F) bound are. A, C, E connectors in the linker; A - linker residue after the split; B - fissile Compound / group; D - sterically demanding group leading to termination; F - fluorescent dye (Marker).
• b) Schematic representation of the NT structure in which the Fluorescent dye simultaneously the function of sterically demanding Group takes over. A, C - linker; A - linker residue after the split; B - fissile Compound / group; D - sterically demanding group leading to termination; F - fluorescent dye (Marker).
• c) Schematic representation of the structure of incorporated NT ^* s after the cleavage step. Shown are two NT ^* s with the remaining linker residue (A).
• d) Schematic representation of the NT structure in which the fissile group, which at the same time the sterically demanding, leading to termination Group is, represents a part of the linker. This steric group may be a photolabile group. A, C - linker; A - linker residue after the split; B - fissile Compound / group; D - sterically demanding group leading to termination; F - fluorescent dye (Marker).
• e) Representation of preferred NT structures in which a short linker is coupled to the 5-position in the pyrimidine ring (e-1, e-3 & e-4: uracil; e-2, e-5 & e-6: Cytosine).
• f) Representation of further preferred NT structures in which a long linker coupled to the 5-position in the pyrimidine ring (f-1 and f-2 are each uracil, f-3 and f-4 are each cytosine).
• g) Representation of preferred NT structures in which a long linker is coupled to the 7-position in the purine ring (g-1: adenine; g-2: guanine). h-j) Examples of the coupling of dyes to the linker coupled to the base of the nucleotide. (7h) dNTP-SS-TRITC (short linker); 7i) dNTP-SS-Cy3 (short linker); 7j) dNTP-SS-TRITC (long linker))

7 Example of a detection device

Shown is a wide-field optical detection device with a light source for excitation of fluorescence ( 1 ), a light-conducting part ( 2 ), a scanning table ( 3 ), a device for selecting the spectra ( 4 ), a detection device ( 5 ), a computer with control and analysis function ( 6 ) and a surface with immobilized gene products ( 7 ), which is scanned after incorporation of labeled NT ^* s, detecting fluorescence signals from individual dye molecules coupled to the NTs.

8th Representation of the discontinuous scanning process

• a) Schematic representation of a section the reaction surface (gray), which is scanned step by step. The circles correspond each recording a 2D image and represent the areas of where the fluorescence signals are detected.
• b) Representation of a photograph (a 2D image) with fluorescence signals of the individual, built-in NT ^* s. It is possible to register several signals of single molecules at the same time per recording.
• c) detail from 8b , The section shows signals from built-in NT ^* s. Each of the identified signals are assigned the corresponding X, Y coordinates. Each signal has characteristic properties and can be identified by it (preferably by means of a computer program).

9 : Sequencing reaction on two separate surfaces

Of the Throughput is achieved by using two separate flow systems (eg flow cells (microfluidic channels, MFK)) elevated. While on the one surface Biochemical and chemical reactions take place on the other the detection performed. Subsequently swap the surfaces their positions in the flow cells.

 detailed description

The Abbr. "M", "mM" and "μM" stand for the units mol / l, mmol / or μmol / l.

Selection of the material:

gene can come from different biological objects, such. B. of individual Cells, cell populations, a tissue or whole organisms. Also biological fluids like blood, sputum or cerebrospinal fluid serve as a source of gene products. The methods for obtaining the Gene products from the various biological objects are recordable following sources of literature: "Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology "1999, v303, "cDNA library Protocols "1997, Ed. I.G. Cowell, Humana Press Inc ..

It can be both the totality of the isolated gene products and a selected by a preselection Part of it can be used in the sequencing reaction. By Preselection can be the amount of gene products to be analyzed to reduce. The preselection can, for example, by molecular biology Procedures such. As PCR amplification, gel separation or hybridization with other nucleic acid chains carried out ("Molecular cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Methodology in Enzymology" 1999, v303, "cDNA library protocols" 1997, Ed. I.G. Cowell, Humana Press Inc.)

Preferably the whole of the gene products is chosen as starting material.

Preparation of the material:

The aim of the preparation of the material is to immobilized from the starting material, single-stranded and to form hybridized gene products with a primer. These then preferably have the in 2 illustrated structure.

 Primer binding site:

each Gene product preferably has only one primer binding site. A Primer binding site is a sequence section that is a selective To allow binding of the primer to the gene product.

When Primary binding sites can Sections in the nucleic acid sequence serve naturally in the sequences to be analyzed occur (eg, polyA tracts in mRNA). A primer binding site can also be additional introduced into the gene product (Molecular cloning 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Methodology in Enzymology" 1999, v303, "cDNA library protocols" 1997, Ed. I.G. Cowell, Humana Press Inc.).

Out establish To simplify the analysis, it may be important to have one as possible uniform primer binding site present in all gene products is. Then can Primers with a uniform structure can be used in the reaction.

The Composition of the primer binding site is not restricted. Your Length is preferably between 10 and 100 NTs. The primer binding site may be a functional Carrying group for the immobilization of the gene product. This functional Group can z. B. be a biotin or digoxigenin group.

When example for the introduction a primer binding site into the gene products becomes nucleotide tailing of antisense cDNA fragments described.

First, single-stranded cDNA is synthesized from mRNA. The result is a population of cDNA molecules that represent a copy of the mRNA population, so-called antisense cDNA. (Molecular cloning 1989, Ed Maniatis, Cold Spring Harbor Laboratory, Method in Enzymology 1999, v303, cDNA Library Protocols 1997, Ed., Cowell, Humana Press Inc.) With a terminal deoxynucleotidyltransferase one can obtain several ( eg between 10 and 20) nucleoside monophosphates to the 3 'end of this antisense cDNA, eg several adenosine monophosphates (called (A) n-tail).) The resulting fragment is used to bind the primer, in this example of a (T) n primer used ("Molecular cloning" 1989 J. Sambrook et al., Cold Spring Harbor Laboratory Press, "Method in Enzymology" 1999 v. 303, pp. 37-38) ( 3 ).

Primer for the sequencing reaction

This has the function of starting at a single point of the gene product to enable. Preferably, it binds to the primer binding site in the gene product. The composition and the length of the primer are not restricted. Except In the startup function, the primer can also perform other functions, such as z. B. to create a connection to the reaction surface. Primer should so long and composition of the primer binding site, that the Primer the start of the sequencing reaction with the respective polymerase allows.

Preferably is the length of the primer between 6 and 100 NTs, optimally between 15 and 30 NTs. The primer may carry a functional group that belongs to the Immobilization of the gene product is used, preferably one functional group is a biotin group (see section Immobilization). It should not disturb the sequencing. The synthesis of such Primers can z. B. with the DNA synthesizer 380 A Applied Biosystems accomplished or as an order synthesis from a commercial supplier, z. B. MWG-Biotech GmbH, Germany.

Of the Primer may be pre-hybridized to the fragments to be analyzed on the surface fixed with different techniques or synthesized directly on the surface (McGall et al., U.S. Patent 5,411,087, Barrett et al., U.S. Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays "1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v. Chr. 285, p. 767, Timofeev et al. Nucleic Acid Research (NAR) 1996, v. 24 p. 3142, Ghosh et al. NAR 1987 v. Chr. 15,555,353, Gingeras et al. NAR 1987 v. Chr. 15,55637, Maskos et al. NAR 1992 v. 20 p. 1679).

The primer or primer mixture is incubated with gene products under hybridization conditions that selectively bind it to the primer binding site of each gene product. This primer hybridization can be done before, during or after the immobilization of the gene products. If gene products as dop pelsträngige nucleic acids, they are denatured by heat before hybridization ("Molecular cloning" 1989 Sambrook S et al., Cold Spring Harbor Laboratory Press). The optimization of the hybridization conditions depends on the exact structure of the primer binding site and the primer and can be according to Rychlik et al. (NAR 1990 v. 18 p. 6409). Hereinafter, these hybridization conditions are referred to as standardized hybridization conditions.

If the starting material has a poly A stretch or a polyd A stretch (eg mRNA, sense cDNA or antisense cDNA with (A) _n tail) one can use an oligo dT primer. Preferably, however, a primer mixture consisting of 12 different primers with the following general structure 5 '(K) _n MN3' is used. Where (n) is between 10 and 50, preferably between 20 and 30. "K" is dT or dU, "M" and "N" are each dA, dT or dU, dC, dG (e.g. '-dTdTdTdTdTdTdTdTdT ₁₀ dTdTdTdTdTdTdTdTdTT ₂₀ dAdG-3'). Such a primer mix allows an exact start of the sequencing reaction at the end of the polyA stretch or the polydA stretch.

immobilization

aim Immobilization is to plan gene products on a suitable basis surface in a manner to fix a cyclic enzymatic Sequencing reaction can proceed. Surface and reaction surface are to be understood as equivalent terms in this application, except when explicitly referred to another meaning. Serves as a reaction surface the surface a solid phase of any material. This material is preferably enzymatic reactions to inert and causes no disorders the detection. Silicon, glass, ceramics, plastics (eg polycarbonates or polystyrenes) or any other material containing this functional Requirements are sufficient can be used. Preferably, the surface is not deformable, because otherwise is with a distortion of the signals in the to expect repeated detection.

If a gel-like solid phase is used, this gel may be e.g. As an agarose or polyacrylamide gel. The gel is preferably freely passable for molecules having a molecular mass below 5000 Da (for example, a 1 to 2% agarose gel or 5 to 15% polyacrylamide gel may be used). Such a gel surface has the advantage over other solid surfaces that the labeled gene products are retained on the surface as opposed to free NTs ^* . The immobilization of the gene products on the surface makes it possible to detect the fluorescence signals of incorporated NTs ^* . The signals of free NTs ^* are not detected because they do not bind to the material of the gel and thus are not immobilized. The gel is preferably attached to a solid support ( 4 ). The thickness of the gel is preferably not more than 0.1 mm. However, the money must be greater than the simple depth of field of the lens, so nonspecifically bound to the solid surface NTs ^* do not reach the focal plane and thus detected. If the depth of field z. B. is 0.3 microns, so the thickness is preferably between 1 micron and 100 microns. The surface can be prepared as a continuous surface or as a discontinuous surface composed of individual small components (eg agarose beads) ( 4a , b). The reaction surface must be large enough to be able to immobilize the necessary number of gene products with appropriate density. The reaction surface should preferably be no larger than 20 cm ² .

The various cycle steps require an exchange of the different reaction solutions above the surface. The reaction surface is preferably part of a reaction vessel. The reaction vessel is again preferably part of a reaction apparatus with a flow device. The flow device allows an exchange of the solutions in the reaction vessel. The replacement can be done with a computer-controlled pumping device or manually. It is important that the surface does not dry out. The volume of the reaction vessel is preferably less than 50 μl. Ideally, its volume is less than 1 μl. An example of such a flow system is in 5 given.

The immobilization of the gene products is preferably carried out at one of the two ends of the chain. This can be achieved by appropriate covalent, affine or other bonds. Many examples of immobilization of nucleic acids are known (McGall et al., U.S. Patent 5,421,087, Nikiforov et al., U.S. Patent 5,610,287, Barrett et al., U.S. Patent 5,482,867, Mirzabekov et al., U.S. Patent 5,981,834, Microarray biochip technology, 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al., Analytical Biochemistry v. 198, p 138, Allemand et al., Biophysical Journal 1997, v. 73, p 2064, Trabesinger et al. Analytical Chemistry 1999, v. 71, p.279, Osborne et al., Analytical Chemistry 2000, v. 72, p3678, Timofeev et al Nucleic Acid Research (NAR) 1996, v. 24 p.3142, Ghosh et al NAR 1987 v. 15 p. 5353, Gingeras et al. NAR 1987 v. Chr. 15 pp. 5373, Maskos et al. NAR 1992. v. 20 p. 1679).

The gene products are preferably immobilized on the surface at a density between 10 and 100 gene products per 100 μm ² . By way of example, two methods for immobilization are described in more detail below: In a preferred embodiment, the immobilization of the gene products is carried out via biotin-avidin or biotin-streptavidin binding. In this case, avidin or streptavidin is covalently bound on the surface, the 5 'end of the primer is labeled with biotin. After hybridization of the labeled primers with the gene products, they are fixed on the avidin / streptavidin-modified surface. The concentration of biotin-labeled hybridization products and the time of incubation of this solution with the surface are chosen to achieve a density suitable for sequencing.

In another preferred embodiment, the primers suitable for the sequencing reaction are fixed on the surface by suitable methods before the sequencing reaction (see above). The single-stranded gene products with one primer binding site per gene product molecule are thus incubated under hybridization conditions. They bind to the fixed primer and are thereby immobilized. The concentration of the single-stranded gene products is chosen so as to achieve a suitable immobilization density of 10 to 100 gene products per 100 μm ² for the sequencing. After immobilization, unbound gene products are removed by a wash step. If the surface of a solid phase (eg silicone or glass) is used for immobilization, preferably a blocking solution is applied to the surface prior to step (a) in each cycle to avoid nonspecific adsorption of NTs ^* to the surface serves. These conditions for a blocking solution, for example, meets an albumin solution (BSA) with a pH between 8 and 10.

Choice of polymerase

In choosing the polymerase, the type of immobilized nucleic acid used (RNA or DNA) plays a crucial role:
If RNA is used as a gene product (eg mRNA) in the sequencing reaction, commercially available RNA-dependent DNA polymerases can be used, eg. AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity. All reverse transcriptases must be largely free of RNAse activity ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory).
If DNA is used as gene product (eg cDNA), all DNA-dependent DNA polymerases without 3'-5 'exonuclease activity (DNA replication "1992 Ed A. Kornberg, Freeman and company NY), eg, "Sequenase Version 2" modified T7 polymerase (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I without 3'-5 'exonuclease activity (Amersham Pharmacia Biotech), polymerase beta of various origins (Animal Cell DNA Polymerases "1983, Fry M., CRC Press Inc., commercially available from Chimerx) thermostable polymerases such as Taq polymerase (GibcoBRL), proHA DNA polymerase (Eurogentec).

nucleotide structure

General principle

• 1) einzelne Zugabe von NT, so daß die Polymerase nur einen einzigen Schritt macht und stoppt (Substrat Limitierung),
• 2) Änderungen der äußeren Bedingungen (Temperatur, pH, Salz usw.), so daß die Polymerasen ihre Funktion anders ausüben (s. Optimierung der Reaktionsbedingngen),
• 3) durch bestimmte kompetetive und nichtkompetetive Inhibitoren (als Beispiel seien antivirale Medikamente genannt)
• 4) durch bestimmte Mutationen und andere Veränderungen an der Polymerase als solcher,
• 5) durch die Struktur der NT. Diese Strukturänderungen können sein: a) irreversibel (wie z. B. bei dideoxyNTPs) b) reversibel.

It is important for the sequencing reaction that each incorporated NT ^{* be} identified. A prerequisite for this is that only a single NT ^* per cycle is incorporated into the nucleic acid chain. If a polymerase incorporates several NTs ^{* in} succession in the same cycle, this leads to an error in the sequence determination. For this reason, one must control the installation of NTs ^* . In this context, various ways of controlling the enzymatic reaction are conceivable, such. B.

• 1) single addition of NT, so that the polymerase only makes a single step and stops (substrate limitation),
• 2) changes in the external conditions (temperature, pH, salt, etc.), so that the polymerases perform their function differently (see Optimization of Reaktionsbedingngen),
• 3) by certain competitive and non-competitive inhibitors (for example antiviral drugs)
• 4) by certain mutations and other changes to the polymerase as such,
• 5) through the structure of the NT. These structural changes may be: a) irreversible (such as in dideoxyNTPs) b) reversible.

The control is preferably carried out by a specific structure of the NTs ^* , with reversible structural changes being particularly preferred. The reversible structural changes take place, for example, by attachment of a sterically demanding ligand, ie a ligand which prevents the polymerase from incorporation of another NT. Control due to steric blocking of the enzymatic reaction by reversible semiterminators is described in more detail below. According to a preferred embodiment of the invention, the bases are structurally modified or modified by coupling a fluorescent dye.

There are several principal variants of the NT ^* structure which hinder or stop the extension reaction: For example, reversible 3'-OH modified NTs have been described in the BASS method (Dower US Patent 5,547,839, Canard et al., US Pat Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v. 18 p 1021, Metzker et al NAR 1994, v. 22, p 4259, Welch et al Nucleosides & Nucleotides 1999, v. 18, p. , The split is under. mild conditions are photochemically (Dower US Patent 5,547,839, Welch et al Nucleosides & Nucleotides 1999, v. 18, p197) or chemically (Canard et al US Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v. 18 P. 1021).

The synthesis of the 3'-OH-modified photochemically cleavable NTs ^* is very complicated. The polymerases have a very different affinity for these nucleotide analogues, so that the nucleic acid synthesis is very uneven or even absent at some DNA sites (Metzker et al., NAR 1994 v. 22 S.4259, Welch et al., Nucleosides & Nucleotides 1999 , v. 18 p. 197). For this reason, these analogs are only partially suitable for the sequencing reaction. A cleavable 3'-ester linkage (Canard et al., US Patent 5,798,210) is also out of the question as a basis for a reversible termination of the synthesis. Most polymerases cleave upon the availability of a next complementary NT 3'-OH ester compounds, so that the label attached to the 3'-OH group is released into the solution and can no longer act as a terminator (Rasolonjatavo et al., Nucleosides & Nucleotides 1999, v. 18 p.1021, Canard et al PNAS 1995 v.92 p.10859). In positions where a polymerase can incorporate several equal NTs ^* one after another, this leads to a faulty signal.

According to the invention, NTs ^* having a bulky group at the base are used for the sequencing. A sterically demanding group coupled to the base may interfere with further synthesis. Biotin, digoxigenin and fluorescent dyes such as fluorescein, tetramethylrhodamine and Cy3 dye are examples of such a bulky group (Zhu et al., Cytometry 1997, v. 28, p 206, Zhu et al., NAR 1994, v. 22, p. 3418, Gebeyehu et al., NAR 1987, v. 15, p4513, Wiemann et al., Analytical Biochemistry 1996, v. 234, p.166, Heer et al., BioTechniques 1994 v. 16 p. Although the polymerases can incorporate such NTs ^* at longer intervals, they have difficulties in installing these NTs ^* one after the other.

In the sequencing reaction in the process according to the invention, labeled NTs ^{* are} incubated with a polymerase and nucleic acid chains. The NTs ^* carry a reversibly coupled to the base sterically demanding group. If a reaction mixture containing only modified NTs ^{* is used} in the reaction, then the polymerase can incorporate only a single NT ^* . The installation of a next NT ^* is sterically inhibited. These NTs ^* thus appear as terminators of the synthesis. After removal of the sterically demanding group, the next complementary NT ^{* can be} installed. Because these NTs ^{* are} not an absolute obstacle to further synthesis, but only for the incorporation of another labeled NT ^* , they are called semiterminators.

General structure of the NT ^*

Semiterminators can have different structures. Their common features are in 6a shown. This structure is characterized in that a steric group (D) and the fluorescent label (F) are bound to the base via a cleavable linker (A-E).

The NTs ^* are based on deoxynucleoside triphosphates with adenosine (A), guanosine (G), cytidine (C) and uridine (U) as the nucleoside residue. Inosin can be used instead of guanosine.

Markers, fluorophores

• a) Die verwendete Detektionsapparatur muß diesen Marker als einziges Molekül gebunden an DNA unter milden Bedingungen (vorzugsweise Reaktionsbedingungen) identifizieren können. Die Farbstoffe haben vorzugsweise große Photostabilität. Ihre Fluoreszenz wird vorzugsweise von der DNA nicht oder nur unwesentlich gequencht.
• b) Der an das NT gebundene Farbstoff darf keine irreversible Störung der enzymatischen Reaktion verursachen.
• c) mit dem Farbstoff markierte NTs^* müssen von der Polymerase in die Nukleinsäurekette eingebaut werden.
• d) Bei einer Markierung mit verschiedenen Farbstoffen sollen diese Farbstoffe keine beträchtlichen Überlappungen in ihren Emissionsspektren aufweisen.

Each base is labeled with a marker (F) characteristic for it ( 6 ). The marker is a fluorescent dye. Several factors influence the choice of fluorescent dye. The choice is not limited if the dye meets the following requirements:

• a) The detection apparatus used must be able to identify this marker as a single molecule bound to DNA under mild conditions (preferably reaction conditions). The dyes preferably have high photostability. Their fluorescence is preferably not or only insignificantly quenched by the DNA.
• b) The dye bound to the NT must not cause irreversible disruption of the enzymatic reaction.
• c) NTs ^* labeled with the dye must be incorporated by the polymerase into the nucleic acid chain.
• d) When labeled with different dyes, these dyes should not have significant overlaps in their emission spectra.

in the Fluorescent dyes which can be used according to the present invention are in "Handbook of Fluorescent Probes and Research Chemicals "6th ed. 1996, R. Haugland, Molecular Probes assembled with structural formulas. According to the invention preferably the following classes of dyes used as markers: cyanine dyes and their descendants (e.g., Cy2, Cy3, Cy5, Cy7 Amersham Pharmacia Biotech, Wagoner US Patent 5,268,486), rhodamines and their derivatives (eg TAMRA, TRITC, RG6, R110, ROX, Molecular Probes, s. Manual), xanthene derivatives (e.g., Alexa 568, Alexa 594, Molecular Probes, Mao et al U.S. Patent 6130101). These dyes are commercially available.

there you can depending on the spectral properties and existing equipment select appropriate dyes. The dyes are added to the linker z. B. via thiocyanate or ester bond coupled ("Handbook of Fluorescent Probes and Research Chemicals "6th ed. 1996, R. Haugland, Molecular Probes, Jameson et al. Methods in Enzymology 1997 v. Chr. 278 p. 363, Wagoner Methods in Enzymology 1995 v. Chr. 246 p. 362), s. Examples 1 and 2.

Nature of the sterically demanding group

The group (D) ( 6 ) represents an obstacle to the incorporation of another complementary labeled NT ^* by a polymerase.

Biotin, digoxigenin and fluorescent dyes such as fluorescein, tetramethylrhodamine and Cy3 dye are examples of such a bulky group (Zhu et al., Cytometry 1997, v. 28, p 206, Zhu et al., NAR 1994, v. 22, p. 3418, Gebeyehu et al., NAR 1987, v. 15, p.4513, Wiemann et al., Analytical Biochemistry 1996, v. 234, p166, Heer et al., BioTechniques 1994 v. 16 p. The chemical structure of this group is not limited provided that it does not significantly interfere with the incorporation of the labeled NT ^* to which it is attached and does not cause irreversible interference with the enzymatic reaction.

This group can be used as an independent part in the linker ( 6a ) or with the dye ( 6b ) or the cleavable group ( 6d ) be identical. Cleavage of the linker removes this sterically bulky group (D) upon detection of the signal, allowing the polymerase to incorporate another labeled NT ^* . In a structure as in 6d, the steric group is eliminated by the cleavage.

In a preferred embodiment, the fluorescent dye performs the function of such a sterically demanding group, so that a labeled nucleotide a in 6b having shown structure.

In another preferred embodiment, the photolabile cleavable group assumes the function of such a sterically demanding group ( 6d ).

left

The marker is preferably bound to the base via a spacer of different lengths, a so-called linker. Examples of linkers are in 6e , f, g, h, i, j. Examples of coupling of a linker to the base can be seen from the following sources (Hobbs et al., U.S. Patent 5,047,519, Khan et al., U.S. Patent 5,821,356, Klevan et al., U.S. Patent 4,828,979, Hanna M. Method, et al Enzymology 1996 v. 274, p 403, Zhu et al NAR 1994 v. 22 p 3418, Herman et al., Methods in Enzymology 1990 v. 184 p 584).

The entire length of the linker may vary. It corresponds to the number of carbon atoms in sections A, C, E and is preferably between 3 and 20. Optimally, it is between 4 and 10 atoms. The chemical composition of the linker (Sections A, C, E in 6a ) is not limited if it remains stable under reaction conditions and does not cause interference with the enzymatic reaction.

Splittable compound, cleavage

Of the Left carries a cleavable or cleavable group (B). This fissile Connection allows the removal of the marker and the steric obstruction at the end every cycle. Your choice is not limited, unless under the conditions the enzymatic sequencing reaction remains stable, not irreversible disorder caused the polymerase and cleaved under mild conditions can be. Under "mild Conditions "are to understand such conditions as the gene product-primer complex do not destroy, where z. B. the pH preferably between 3 and 11, the temperature is between 0 ° C and one Temperature value (x). This temperature value (x) depends on the Tm of the gene product-primer complex (Tm is "melting Point ") and will calculated as Tm (gene product-primer complex) minus 5 ° C (eg Tm is 47 ° C, then lies the maximum temperature at 42 ° C; Disulfide compounds are particularly suitable under these conditions and photolabile compounds as cleavable compounds).

Preferably, said compound belongs to chemically or enzymatically cleavable or photolabile compounds. As examples of chemically cleavable groups, ester and disulfide compounds are preferred (Herman et al., Method in Enzymology 1990 v. 184 p 584, Lomant et al., J. Mol. Biol., 1976 v. 104 243, "Chemistry of carboxylic acid and esters "S. Patai 1969 Interscience Publ.). Examples of photolabile compounds can be found in the following references: "Protective groups in organic synthesis" 1991 John Willey & Sons, Inc., V. Pillai Synthesis 1980 p. 1, V. Pillai Org. Photochem. 1987 v. Chr. 9 p. 225, furthermore, those in US Pat. No. 6,136,543 (US Pat. 16 to 19 ) suitable photolabile compounds.

The Position of the cleavable compound / group in the linker is preferred not more than 10 atoms away from the base, more preferably not more than 3 atoms. Particularly preferred is the cleavable Compound or group directly at the base.

Of the Cleavage and removal step is present in each cycle and must under mild conditions (see above) so that the nucleic acids are not damaged or modified.

The Splitting is going on preferably chemically (eg in mild acidic or basic environment for one Ester compound or by addition of a reducing agent, for. B. Dithiothreitol (Sigma) in the cleavage of a disulfide compound), see Example 1, or physically (eg, by illuminating the surface with light of a certain wavelength for the cleavage of a photolabile Group).

After cleavage, a linker residue (A) remains at the base ( 6c ).

The Synthesis of a cleavable linker is shown by way of examples (cf. Examples 1 and 2).

Combination of polymerase and NT ^*

Overall, the size, the charge and the chemical structure of the marker, the length of the cleavable linker and the linker residue as well as the choice of polymerase play an important role. Together, they determine whether the tagged NT ^* is incorporated into the growing nucleic acid chain by the polymerase and whether it prevents the next labeled NT ^* from being incorporated. Two conditions must be taken into account:
On the one hand, it is important that the polymerase can further extend the nucleic acid chain with the incorporated modified NT ^* after cleavage of the linker. So it is important that the linker residue "A" ( 6c ) after cleavage is not a significant disruption to further synthesis. On the other hand, built-in, non-split NTs ^* must be an obstacle. Many NTs ^* suitable for the reaction can be synthesized. More specifically, for each combination of polymerase and NTs ^*, a series of preliminary experiments must be performed in which the suitability of a specific NT ^* type for sequencing is tested.

The buffer conditions are chosen according to the polymerase manufacturer. The reaction temperature is chosen for non-thermostable polymerases according to the manufacturer's instructions (eg 37 ° C. for Sequenase version 2), for thermostable polymerases (eg Taq polymerase) the maximum reaction temperature is the temperature value (x). This temperature value (x) depends on the Tm of the gene product-primer complex and is calculated as Tm (gene product-primer complex) minus 5 ° C (eg Tm is 47 ° C, then the maximum reaction temperature is 42 ° C). These buffer conditions and reaction temperature are further than "optimal buffer and temperature conditions".

The Reaction time (corresponds to the duration of the installation step in a Cycle) preferably less than one hour, ideally the reaction time is between 10 sec and 10 min.

As examples of suitable combinations between NT ^* and polymerase, the following combinations may be mentioned:
If DNA (eg cDNA) is used as gene product in the reaction, NT ^* with a short linker residue (synthesis see Example 2, 6e , h, i): dNTP-SS-TRITC (L7), dNTP-SS-Cy3 (L11) and / or NT ^* with a long linker radical (for synthesis see Example 1, 6f , g, j): dNTP-SS-TRITC (L14) in combination with Sequenase version 2 , Taq polymerase (GibcoBRL), ProHA DNA polymerase (Lurogentec) or Klenow fragment of DNA polymerase I from E. coli without 3'-5 'exonuclease activity (Amersham Pharmacia Biotech).

If RNA (eg mRNA) is used as gene product in the reaction, NT ^* with a short linker residue (synthesis see Example 2, 6e , h, i): dNTP-SS-TRITC (L7), dNTP-SS-Cy3 (L11) and / or NT ^* with a long linker radical (for synthesis see Example 1, 6f , g, j): dNTP-SS-TRITC (L14) in combination with AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity.

The suitability of a linker residue on the base (A) for the reaction can be tested in a test system. In this case, split NTs ^* are inserted successively into a nucleic acid chain. One uses z. B. dUTP ^* with the desired cleaved linker residue, poly-dA as a template for DNA polymerases such. Sequenase version 2, Taq polymerase, or poly-A as a template for reverse transcriptases such. For example, AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), oligo-dT20 primer, the desired polymerase (see above) and performs under suitable for the particular polymerase optimal buffer and temperature conditions by a reaction. The NT ^* concentration is preferably between 5 μM and 200 μM. After the reaction, the number of NTs ^* incorporated into the nucleic acid chain is analyzed, e.g. B. by the separation of the length in a gel. The following information can be used to determine the suitability of the linker residue: If the polymerase can incorporate more than 20 NTs ^* , this linker residue is suitable for a sequencing reaction. When incorporating less than 20 cleaved NTs ^* , this combination of NT ^* and polymerase is not optimal for the sequencing reaction.

If a suitable linker remainder is established, it must be checked in another test system whether the marked, uncleaved NTs ^* function as semiterminators. This is checked by incubating the labeled NTs ^* with the polymerase and a template under optimal optimal buffer and temperature conditions for the reaction. The NT ^* concentration is preferably between 5 μM and 200 μM. The die is to be chosen so that the installation of several NTs ^* would be expected in succession, z. For example, for dUTP ^* , one can use polydA or poly-A as in the example shown above. Ideally, the polymerase incorporates only a single NT ^* .

If, given the optimum buffer and temperature conditions, several NTs ^{* are} successively incorporated by a polymerase, the reaction parameters (eg NT ^* concentration, reaction temperature) can be changed and adapted to the particular combination of polymerase and NT ^* . The most important thing is that the polymerase does not incorporate a second NT ^* in the given time (preferably between 10 sec and 10 min).

According to the invention this adaptation in one embodiment through the change the reaction temperature. The other parameters of the reaction will be kept constant.

If DNA as gene product (eg cDNA) used in the sequencing reaction will, can As polymerases, for example, polymerases are used which DNA polymerases without 3'-5'-exonuclease activity are, preferably from Group consisting of Sequenase-type viral DNA polymerases, bacterial DNA polymerases I, thermostable DNA polymerases and their modifications. In particular, come Sequenase Version 2, Klenow fragment of DNA polymerase I from E. coli without 3'-5 'exonuclease activity, Taq polymerase or ProHA DNA polymerase.

If RNA used as gene product (eg mRNA) in the sequencing reaction will, can commercial RNA-dependent DNA polymerases are used, for. B. AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNase activity.

The NT ^* concentration in these experiments is usually between 5 μM and 200 μM, preferably between 10 and 100 μM. The concentration of the polymerase and the buffer conditions are chosen according to the manufacturer's instructions. The duration of the reaction may vary and is preferably between 10 seconds and 10 minutes, which would be the duration of incorporation step (b) in one cycle. For non-thermostable polymerases such. Sequenase version 2 (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I without 3'-5 'exonuclease activity (Amersham Pharmacia Biotech), AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV Reverse transcriptase without RNase activity, the reaction temperature of conventional 37 ° C is preferably reduced to 20 ° C to 30 ° C. In thermostable polymerases such. For example, Taq polymerase (GibcoBRL), ProHA DNA polymerase (Eurogentec), the reaction temperature of conventional 70-75 ° C is preferably reduced to values between 30 ° C and the temperature value (x). This temperature value (x) depends on the Tm of the gene product-primer complex and is calculated as Tm (gene product-primer complex) minus 5 ° C (eg Tm is 47 ° C, then the temperature value (x) is included 42 ° C).

In another preferred embodiment of the invention, the adaptation of the reaction conditions by the reduction of the NT ^* concentration to below 5 uM, the other parameters of the reaction (buffer conditions, temperature conditions) are kept constant. The concentration of NT ^* s is preferably between 0.5 and 5 μM for this adaptation. The duration of the reaction is between 10 sec and 10 min. The most important factor in choosing the NT ^* concentration is that the polymerase does not incorporate a second NT ^* in the given time (preferably between 10 sec and 10 min).

After optimizing the reaction conditions for the incorporation of a single NT ^* one must repeat the reaction with cleaved NTs ^* . Under correspondingly changed reaction parameters, polymerase must be able to incorporate the cleaved NTs ^{* in} succession.

The optimization reaction correlates with the incorporation step, step (b), in one cycle. The conditions determined for the optimization reaction, the temperature, the concentration of NT ^* , the buffer conditions, the duration of the reaction are taken over for the reaction on the surface.

Under these reaction conditions, the incorporation of NT ^* into the gene products is preferably carried out so that over more than 50% of the gene products involved in the sequencing reaction are incorporated in one cycle a labeled NT ^* , preferably greater than 90%. This is related to the fact that the reaction proceeds very slowly on some nucleic acid chains. It is desirable to include the NTs ^* at each complementary position in each cycle, but it is not required because only the successful incorporation reactions are detected and evaluated; a delayed reaction in the following cycle does not lead to a sequencing error.

Preferably, the same polymerase is used for all NTs ^* . However, it is also possible to use different polymerases for different NTs ^* .

Colored coding scheme, Number of dyes

• a) vier verschieden markierten NT^*s
• b) zwei verschieden markierten NT^*s
• c) einem markierten NT^*
• d) zwei verschieden markierten NT^*s und zwei unmarkierten NTs,

d. h.

• a) Man kann alle 4 NTs mit verschiedenen Farbstoffen markieren und alle 4 gleichzeitig in die Reaktion einsetzten. Dabei erreicht man die Sequenzierung einer Nukleinsäurekette mit einer minimalen Anzahl von Zyklen. Diese Variante der Erfindung stellt allerdings hohe Anforderungen an das Detektionssystem: 4 verschiedene Farbstoffe müssen in jedem Zyklus identifiziert werden.
• b) Zur Vereinfachung der Detektion kann eine Markierung mit zwei Farbstoffen gewählt werden. Dabei werden 2 Paare von NTs gebildet, die jeweils verschieden markiert sind, z. B. A und G tragen die Markierung "X", C und U tragen die Markierung "Y". In die Reaktion in einem Zyklus (n) werden 2 unterschiedlich markierte NTs^* gleichzeitig eingesetzt, z. B. C^* in Kombination mit A^*, und im darauffolgenden Zyklus (n + 1) werden dann U^* und G^* zugegeben.
• c) Man kann auch nur einen einzigen Farbstoff zur Markierung aller 4 NTs^* verwenden und pro Zyklus nur ein NT^* einsetzen.
• d) In einer technisch vereinfachten Ausführungsform werden pro Zyklus zwei unterschiedlich markierte NT^*s eingesetzt und zwei unmarkierte NTs (sogen. 2NT^*s/2NTs-Methode).

One cycle can be done with:

• a) four differently labeled NT ^* s
• b) two different marked NT ^* s
• c) a marked NT ^*
• d) two differently labeled NT ^* s and two unlabelled NTs,

ie

• a) One can mark all 4 NTs with different coloring materials and insert all 4 at the same time in the reaction. It achieves the sequencing of a nucleic acid chain with a minimum number of cycles. However, this variant of the invention makes high demands on the detection system: 4 different dyes must be identified in each cycle.
• b) To simplify the detection, a label with two dyes can be selected. In this case, 2 pairs of NTs are formed, each marked differently, z. B. A and G carry the mark "X", C and U carry the mark "Y". In the reaction in one cycle (s), 2 differently marked NTs ^* are used simultaneously, e.g. C ^* in combination with A ^* , and then in the next cycle (n + 1) then U ^* and G ^{* are} added.
• c) It is also possible to use only one dye to mark all 4 NTs ^* and use only one NT ^* per cycle.
• d) In a technically simplified embodiment, two differently marked NT ^* s are used per cycle and two unmarked NTs (so-called 2NT ^* s / 2NTs method).

detection apparatus

Separate molecules on a surface can be examined with different methods. There are several Method known: z. B. AtomForce Microscopy, Electron Microscopy, Near-field fluorescence Mikroscopie, Wide-field fluorescence microscopy, TIR microscopy, etc. (Science 1999 v. 283 1667, Unger et al. BioTechniques 1999 v. Chr. 27 p.1008, Ishijaima et al. Cell 1998 v. Chr. 92 p. 161, Dickson et al. Science 1996 v. Chr. 274 p. 966, Xie et al. Science 1994 v. Chr. 265 p.361, Nie et al. Science 1994 v. 266 p. 1018, Betzig et al. Science 1993 v. Chr. 262 p. 1422).

According to the invention fluorescence signals of individual built-in the nucleic acid chain NTs ^* are preferably provided with a wide-field fluorescence microscope or a laser scanning microscope or a TIRF microscope (Total Internal Reflection Fluorescence Microscope).

Various variants of the construction of such an apparatus are possible (Weston et al., J. Chem. Phys., 1998, 109, p., 7474, Trabesinger, et al., Anal. Chem., 1999, 71, 279, Adachi et al., Journal 195, 125, Unger et al., BioTechniques 1999, v. 27, p. 1008, Ishijaima et al., Cell, 1998, v. 92, p.161, Dickson et al., Science, 1996, v. 274, pp. 966, Tokunaga et al., Bichem, Biophys., Res. Com., 1997, v. 235, p. 47, "Confocal Laser Scanning Microscopy" 1997, Ed., Sheppard, BIOS Scientific Publishers, "New Techniques of Optical Microscopy and Microspectroscopy," 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998. 2. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenary Press). Differences in their concrete structure arise from the variation of their individual parts. The device for the excitation light may, for. B. on the basis of a laser, a lamp or diodes work. Both CCD cameras and PMTs can serve for the detection device. Other examples of technical details see "Confocal Laser Scanning Microscopy" 1997 Ed Sheppard, BIOS Scientific Publishers, "New Techniques of Optical Microscopy and Microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc. "Fluorescence microscopy" 1998 2. ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenary Press). It is not the object of this invention to enumerate all possible technical variants of a detection device. The basic structure of a suitable apparatus is shown in a diagram 7 explained. It consists of the following elements:
Light source for excitation of fluorescence ( 1 )
Light guiding part ( 2 )
Scantisch ( 3 )
Device for selecting spectra ( 4 )
Detection device ( 5 )
Computer with control and analysis functions ( 6 )
These elements of the apparatus can be purchased commercially (microscope companies: Zeiss, Leica, Nikon).

In the following, for example, a combination of these elements suitable for the detection of individual molecules is to be presented:
Wide field fluorescence microscope Axioplan 2 (Zeiss) with mercury vapor lamp
Lens Planneofluar 100x, NA 1.4 (Zeiss)
Camera SenSysTM (Photometrix)
Computer with software for control and analysis

following the procedure for the detection should be explained. Please note the general rules of fluorescence microscopy ("Confocal Laser Scanning Microscopy "1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of Optical Microscopy and microspectroscopy "1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy "1998 2.ed. Herman BIOS Scientific Publishers, "Handbook of Biological Confocal Microscopy" 1995 J. Pawley Plenary Press).

• 1) Vorbereitung zur Detektion
• 2) Durchführung eines Detektionsschrittes in jedem Zyklus, wobei jeder Detektionsschritt als Scanvorgang abläuft und folgende Operationen umfaßt: a) Einstellung der Position des Objektivs (X,Y-Achse), b) Einstellung der Fokusebene (Z-Achse), c) Detektion der Signale einzelner Moleküle, Zuordnung des Signals zu NT^* und Zuordnung des Signals zum jeweiligen Genprodukt, d) Verschiebung zur nächsten Position auf der Oberfläche.

The detection comprises the following phases:

• 1) Preparation for detection
• 2) carrying out a detection step in each cycle, each detection step being carried out as a scanning operation and comprising the following operations: a) adjustment of the position of the objective (X, Y-axis), b) adjustment of the focal plane (Z-axis), c) detection of the Signals of single molecules, assignment of the signal to NT ^* and assignment of the signal to the respective gene product, d) shift to the next position on the surface.

The signals from NTs ^* incorporated into the strands complementary to the gene products are registered by scanning the surface. Scanning may be accomplished in a variety of ways ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of Optical Microscopy and Microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2. Herman BIOS Scientific Publishers, "Handbook of Biological Confocal Microscopy" 1995 J. Pawley Plenary Press). Preferably, a discontinuous scan is selected. The lens is moved stepwise over the surface ( 8a ), so that a two-dimensional image (2D image) arises from each surface position ( 8b , c).

This 2D image can be created using several methods: B. by the laser scan of a position of the microscope field (laser scanning microscopy) or by a camera recording at a position (see manuals of the Microscopy). As an example, the detection of single molecules with a CCD camera described.

1) Preparation for detection:

At the The beginning will determine how many copies of the gene products for expression analysis necessary. Several factors play a role here. The exact Number hangs z. From relative presence the gene products in the approach and the desired accuracy of the analysis from. The number of gene products analyzed is preferably between 1000 and 10,000,000. For Strongly expressed genes can increase the number of gene products analyzed be low, z. B. 1000 to 10,000. In analysis weakly expressed Gene has to do it elevated be, for. For example, 100,000 or even more.

It For example, 100,000 individual gene products are analyzed simultaneously. It also weakly expressed genes (with, for example, about 100 mRNA molecules / cell, which corresponds to approximately 0.02 total mRNA) in the average reaction 20 identified gene products represented.

2) implementation of a Detection step in each cycle

For sequencing, the positions of the gene products must be determined in order to have a basis for assigning the signals. The knowledge of these positions allows a statement as to whether the signals of individual molecules originate from built-in NTs ^* or from randomly bound NTs ^* . These positions can be identified by different methods.

In a preferred embodiment, the positions of immobilized gene products are identified during sequencing. It uses the fact that the signals from the NTs ^* built into the nucleic acid chain always have the same coordinates. This is ensured by the fixation of the nucleic acid chains. The nonspecifically bound NTs bind randomly at different sites of the surface.

to Identification of the positions of fixed gene products the signals to match checked their coordinates from several consecutive cycles. The can z. B. at the beginning of the sequencing. The matching Coordinates are evaluated as coordinates of the gene products and saved.

The Scan system must be reproducible over several Cycles the surface can scan. X, Y and Z-axis settings at each surface position can be from controlled by a computer. Stability and reproducibility of the Setting lens positions in each scan decide on the quality the detection and thus over the identification of the signals of individual molecules.

a) Setting the position of the lens (X, Y axis)

The mechanical instability of commercially available scaffolds and the low reproducibility of repetitive adjustment of the same X, Y positions make precise analysis of single molecule signals over several cycles difficult. There are many ways to improve the consistency of the coordinates in repeated settings or to control possible deviations. As an example, a check option is given. After a rough mechanical adjustment of the lens position, a control image is made of a pattern firmly bonded to the surface. Even if the me chanic setting does not have exactly the same coordinates (deviations of up to 10 μm are quite possible), you can make a correction by means of optical control. The control image of the pattern serves as a coordinate system for the image with signals from built-in NTs ^* . A prerequisite for such a correction is that no further movements of the surface are made between these two shots. Signals from individual molecules are set in relation to the pattern, so that an X, Y deviation in the pattern position means the same X, Y deviation in the position of the signals of individual molecules. The control image of the pattern can be made before, during or after the detection of individual molecules. Such a control image must be made accordingly at each setting on a new surface position.

b) Setting the focal plane (Z-axis) of

The surface is not absolutely flat and has various bumps. This is changing the surface-to-object distance when scanning neighboring sites. These differences in distance can do this to lead, that individual molecules leave the focal plane and thus escape the detection.

Out For this reason, it is important that when Scan the surface a reproducible adjustment of the focal plane at each lens position is reached.

It are different ways to adjust the focal plane reproducibly. For example, can The following method can be used: Since the excitation of individual molecules to extinguish their Lead to fluorescence can, will on the surface a marker applied, which serves to adjust the focal plane. Thereafter, the detection of the signals of individual molecules. Of the Marker can be of any nature (eg dye or pattern), but must not interfere with the detection and the reaction.

c) Detection of the signals of individual molecules, assignment of the signal to NT ^* and assignment of the signal to the respective gene product.

• 1. Durch Verwendung von geeigneten Filtern (Zeiss-Filtersätze) wird für jeden Fluoreszenzkanal ein Grauwertbild erzeugt.
• 2. Aus einem aufgenommenen Mehrkanal-Farb-Bild werden mit Hilfe eines geeigneten Algorithmus durch ein Bildverarbeitungsprogramm die relevanten Farbkanäle extrahiert und jeweils als Grauwertbild einzeln weiterverarbeitet. Zur Kanalextraktion wird dabei ein für den jeweiligen Kanal spezifischer Farb-Schwellwertalgorithmus eingesetzt. So entstehen zunächst aus einem Mehrkanal-Farbbild einzelne Grauwertbilder 1 bis N. Diese Bilder definieren sich wie folgt: GB_N = (s(x, y)) einkanaliges Grauwertbild N = {1,..., Anzahl der Fluoreszenzkanäle}. M = {0,1,..., 255} Grauwertmenge S = (s(x, y)) Bildmatrix des Grauwertbildes x = 0,1,..., L-1 Bildzeilen y = 0,1,..., R-1 Bildspalten (x, y) Ortskoordinaten eines Bildpunktes s(x, y) ∈ M Grauwert des Bildpunktes.

The two-dimensional image of the reaction surface generated with the aid of the detection system contains the signal information of NT ^* s incorporated into the gene products. These must be extracted from the total data volume of the image information with suitable methods before further processing. The necessary algorithms for scaling, transforming and filtering the image information belong to the standard repertoire of digital image processing and pattern recognition (Haberäcker P. "Practice of Digital Image Processing and Pattern Recognition." Hanser-Verlag, Munich, Vienna, 1995; Galbiati LJ "Machine vision and digital image processing fundamentals. "Prentice Hall, Englewood Cliffs, New Jersey, 1990). The signal extraction preferably takes place via a gray scale image, which images the brightness distribution of the reaction surface for the respective fluorescence channel. If several nucleotides with different fluorescent dyes are used in the sequencing reaction, a separate gray scale image can first be generated for each fluorescently labeled nucleotide (A, T, C, G or U) used. In principle, 2 methods can be used:

• 1. By using suitable filters (Zeiss filter sets), a halftone image is generated for each fluorescence channel.
• 2. From a recorded multichannel color image, the relevant color channels are extracted by means of a suitable algorithm by an image processing program and further processed individually as a gray value image. For channel extraction, a color threshold algorithm specific to the respective channel is used. Thus, first of all, gray-scale images 1 to N result from a multichannel color image. These images are defined as follows: GB _N = (s (x, y)) single-channel gray value image N = {1,..., Number of fluorescence channels}. M = {0,1, ..., 255} Gray value set S = (s (x, y)) Image matrix of the gray scale image x = 0,1, ..., L-1 Image lines y = 0,1, ... , R-1 image columns (x, y) spatial coordinates of a pixel s (x, y) ∈ M gray value of the pixel.

• I. Vorverarbeitung des Bildes, so zum Beispiel gegebenenfalls Reduktion des durch die Digitalisierung der Bildinformation entstandenen Bildrauschens, etwa durch Grauwertglättung.
• II. Prüfung jedes Bildpunkt (x, y) des Grauwertbildes, ob dieser Punkt im Zusammenhang mit den ihn umgebenden unmittelbaren und weiter entfernten Nachbarbildpunkten die Eigenschaften eines Fluoreszenzpunktes erfüllt. Diese Eigenschaften hängen unter anderem von der verwendeten Detektionsapparatur und der Auflösung des Grauwertbildes ab. Sie können beispielsweise ein typisches Verteilungsmuster von Helligkeits-Intensitätswerten über einer den Bildpunkt umgebenden Matrix darstellen. Die dazu verwendbaren Methoden der Bildsegmentierung reichen von einfachen Schwellwertverfahren bis hin zur Verwendung neuronaler Netze.

From this data set, the relevant image information is now extracted by a suitable program. Such a program should realize the following steps:
Perform for GB ₁ to GB _N :

• I. preprocessing of the image, so for example, if necessary, reduction of the digitization of the Image information resulting image noise, such as gray scale smoothing.
• II. Examination of each pixel (x, y) of the gray value image, whether this point fulfills the properties of a fluorescence spot in connection with the immediate and more distant neighboring pixels surrounding it. Among other things, these properties depend on the detection apparatus used and the resolution of the gray value image. For example, they can represent a typical distribution pattern of brightness intensity values over a matrix surrounding the pixel. The methods of image segmentation that can be used range from simple threshold procedures to the use of neural networks.

Meets one Pixel (x, y) these requirements, then follows a comparison with the coordinates of previously performed sequencing cycles identified gene products. If there is a match, the Assignment of the signal with that from the respective fluorescence channel resulting nucleotide to this gene product. Signals with mismatched Coordinates are scored as background signals and discarded. The analysis of the signals can be carried out parallel to the scanning process.

In an exemplary embodiment became an eight-bit gray scale image with a resolution of 1317 × 1035 pixels used. The changes that have come about as a result of digitization To reduce the image, was initially a preprocessing of Overall picture: Each pixel was the average of the brightnesses assigned to its 8 neighbors. At the selected resolution this creates one for one Fluorescent dot typical pattern of a central pixel with the largest brightness value and neighboring pixels with decreasing brightnesses on all sides. fulfilled one pixel these criteria and crossing the centrifugal Brightness drop a certain threshold (to the exclusion to weak fluorescence spots), then this central pixel became as the coordinate of a fluorescence point.

d) Move the lens to the next one Position on the surface. After the detection of the signals of individual molecules, the lens is above a other position of the surface positioned.

All in all For example, a sequence of recordings with the control of X, Y position, focal plane adjustment and detection single molecules be done with every new lens position. These steps can be controlled by a computer.

Timeline of the steps

The scanning process and the biochemical reaction take some time. By switching these processes one after another, one can achieve optimal performance of the apparatus. In a preferred embodiment, the reaction is carried out on two separate surfaces ( 9 ).

When Example can be a surface with immobilized gene products separated into 2 spatially isolated parts so that reactions independent on these two parts can run away from each other. In another example Gene products can be immobilized from the outset on 2 separate surfaces.

After that the reaction is started. The principle is that while on a part of the surface the Reaction and washing steps take place, the second part is scanned becomes. This allows one to have a continuous process of analysis achieve and increase the speed of sequencing.

The Number of surfaces, on which the reaction takes place, can also be bigger than Be 2. This makes sense if the reaction is timed limiting step occurs, d. H. the detection of the signals the surface faster than the reaction and washing steps. Around adjust the total duration of the reaction to the detection duration, Every single step of the reaction can be on a single surface with a time delay compared to the next surface expire.

analysis

The obtained data (short sequences) are using a program compared with known gene sequences. Such a program can z. For example, a BLAST or FASTA algorithm is used ("Introduction to computational Biology "1995 M. S. Waterman Chapman & Hall).

By choosing the method for preparing the material, it is determined, among other things, in which sections of the gene products the sequences are determined and to which strand (sense or antisense) they belong. For example, when using the polyA tracts as primer binding site in mRNA sequences from NTRs (non-translating regions) are determined. When using the method with antisense cDNA as a template, the sequences determined, inter alia, from the protein-coding regions of the gene products.

at A preferred simple variant of the invention is gene expression only qualitatively determined. Here's just the fact of expression of particular genes of importance.

at another preferred embodiment is a quantitative determination of the relationships between individuals Gene products in the approach of interest. It is known that the activity of a Gene in a cell represented by a population of identical mRNA molecules is. In a cell, many genes are and will be active at the same time thereby expressing different degrees, resulting in the presence of many various differently represented mRNA populations leads.

In the following, the quantitative analysis of gene expression is described in more detail:
For a quantitative analysis of gene expression, the abundances (abundances) of individual gene products are determined in the sequencing reaction. The products of strongly expressed genes are more frequently represented in the sequencing reaction than the weakly expressed genes.

To the assignment of the sequences to certain genes is the proportion or the number of sequences determined for each individual gene or gene product certainly. Genes with strong expression have a higher proportion on the total population of gene products as low expression genes.

The Number of analyzed gene products is preferably between 1000 and 10,000,000. The exact number of gene products to be analyzed depends on the task. For it may be low for heavily expressed genes, e.g. B. 1000 to 10,000. In the analysis of weakly expressed genes, it must be increased, for. For example, 100,000 or higher.

Become for example, 100,000 individual gene products analyzed simultaneously, are also weakly expressed genes, such as. B. about 100 mRNA molecules / cell (which corresponds to approximately 0.02% total mRNA) in the average reaction 20 identified gene products represented.

When internal control of hybridization, immobilization and the Sequencing reaction can be the following Use method: It can one or more nucleic acid chains be used with known sequences as a control (quantitative Marker). The composition of these control sequences is not limited, provided they do not interfere with the identification of the gene products. at Sequence analysis of the mRNA samples will be RNA control samples, in the analysis of the cDNA samples used according to DNA control samples. These samples are preferably carried in all steps. You can z. B. added after mRNA isolation become. In general, the control samples become the same prepared for sequence analysis as the gene products to be analyzed.

The Control sequences are stored in known, fixed (predetermined) Concentrations were added to the gene products to be analyzed. Concentrations of control samples may be different Preferably, these concentrations (i.e., the total concentration the control sequences) between 0.01% and 10% of the total concentration the sample to be analyzed (100%). Is the concentration of mRNA for example 10ng / μl, then the concentrations of control samples are between 1pg / μl and 1ng / μl.

at The quantitative analysis of gene expression must also be the general metabolic activity considered by the cells in particular, when comparing the expression of certain Genes in different external conditions is sought. The change in the expression level of a particular gene may be as a result of change in the transcription rate of this gene or as a result of a global change gene expression in the cell. To observe the metabolic conditions in the cell one can analyze the expression of the so-called "housekeeping genes". At the Lack of important metabolites, for example, is the general one Expression level in the cell low, so that constitutively expressed Genes have a low level of expression.

in the Principle can all constitutively expressed genes serve as "housekeeping genes". As examples, the transferrin receptor gene or called the beta-actin gene.

The Expression of these housekeeping genes thus serves as a reference for analysis the expression of other genes. Sequence determination and quantification the expression of the housekeeping genes is preferably an ingredient of the analysis program for the Gene expression.

The The invention is illustrated below by way of examples.

Examples

Example 1:

Modified dUTP with a long cleavable linker ( 6f-1 ) Starting materials used are 5- (3-aminoallyl) -2'-deoxyuridine-5'-triphosphate, AA-dUTP, (Sigma), 3,3'-dithio-bis (propionic acid N-hydroxysuccinimide ester), DTBP-NHS, (Sigma), 2-mercaproethanolamine, MEA, (Sigma). To 100 μl of 50 mM solution of AA-dUTP in 100 mM borate buffer pH 8.5, 3 equivalents of DTBP-NHS in DMF (25 μl 0.4 M solution) are added. The reaction mixture is at RT for 4 hours. incubated. Subsequently, conc. Ammonium acetate solution (pH 9) is added until the total concentration of CH ₃ COONH ₄ in the reaction solution is 100 mM, and the reaction is incubated for an additional hour. Thereafter, 200 .mu.l of 1M MEA solution, pH 9, are added to this mixture and incubated for one hour at RT. Subsequently, a saturated solution of I ₂ in 0.3 M KI solution is added dropwise to this mixture until the iodine color persists. The modified nucleotides are separated on a DEAE cellulose column in ammonium carbonate gradient (pH 8.5) from other reaction products. Isolation of the nucleotide with the cleavable linker is carried out on RP-HPLC. Dyes can now be coupled to this linker by various methods ("Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996, R. Haugland, Molecular Probes, Wagoner Method in Enzymology 1995 v. 246, p. 362, Jameson et al Method in Enzymology 1997, v. 278, p. 363).

Other nucleotide analogs (eg, according to Hobbs et al., US Patent 5,047,519, Khan et al., US Patent 5,821,356) can also be used in the reaction such that nucleotide analogues having structures in 6f-2 , 3, 4 and 6g-1 , 2 can be generated.

As an example of the coupling of a dye to the linker, the coupling of TRITC (tetramethylrhodamine-5-isothiocyanate, Molecular Probes) is indicated (NT ^* structure 6y ):
The dNTP (300 nmol) modified with the cleavable linker is dissolved in 30 μl of 100 mM sodium borate buffer pH 9 (10 mM NT ^* ). For this purpose, 10 μl of 10 mM TRITC in DMF are added and incubated at RT for 4 h. The dye-modified NT ^* is purified by RP-HPLC in methanol-water gradient. Similarly, other dyes can be coupled to the amino group of the linker.

Example of Cleavage of Disulphide Compound in the Modified NT ^* . The cleavage is carried out by adding 20 to 50 mM DTT (Sigma) solution pH 8 to the reaction surface. The surface is 10 min. incubated with this solution, then the solution is removed and the surface washed with a buffer solution to remove DTT residues.

Example 2

Modified dUTP (dUTP-SS-CH ₂ CH ₂ NH ₂ ) with a short cleavable linker ( 6e-1 ). The starting substances used are: bis-dUTP, synthesized according to Hanna (Method in Enzymology 1989, v. 180, p. 383), 2-mercaptoethanolamine, MEA, (Sigma).

To 400 μl of 100 mM Bis-dUTP in 40 mM borate buffer pH 8.5, 100 μl of 100 mM MEA solution pH 8.5 in H ₂ O are added and the mixture is incubated for 1 hour at RT. Subsequently, a saturated solution of I ₂ in 0.3 M KI solution is added dropwise to this mixture until the iodine color persists. The nucleotides (bis-dUTP and dUTP-SS-CH ₂ CH ₂ NH ₂ ) may e.g. B. by ethanol precipitation or on a DEAE-cellulose column in ammonium carbonate gradient (pH 8.5) separated from other reaction products. Bis-dUTP does not interfere with the subsequent coupling of a dye to the amino group of the linker, so that the separation of the dUTP-SS-CH ₂ CH ₂ NH ₂ from bis-dUTP can take place in the final purification step.

In a similar way, dCTP ( 6-e2 ), whereby bis-dCTP serves as the starting substance (synthesized according to Hanna et al., Nucleic Acid Research 1993, v. 21, p.

Further NT ^* (dUTP ^* and dCTP ^* ) with a short linker residue can be synthesized in a similar manner, where NT ^{* have the} following structures ( 6e ):
dUTP-SS- (CH ₂ ) _n -NH ₂ , 6e-1 .
dCTP-SS- (CH ₂ ) _n -NH ₂ , 6e-2 .
where n is between 2 and 6, preferably between 2 and 4,
dUTP-SS- (CH ₂ ) _n -X-CO- (CH ₂ ) _m -Z, 6e-3 .
dUTP-SS- (CH ₂ ) _n -X-CO-Y- (CH ₂ ) _m -Z, 6e-4 .
dCTP-SS- (CH ₂ ) _n -X-CO- (CH ₂ ) _m -Z, 6e-5 .
dCTP-SS- (CH ₂ ) _n -X-CO-Y- (CH ₂ ) _m -Z, 6e-6 .
X = NH, O, S
Y = NH, O, S
Z = NH ₂ , OH, dye
where (n + m) is between 4 and 10, preferably between 4 and 6.

At the linker can now dyes can be coupled with different methods ("Handbook of Fluorescent Probes and Research Chemicals "6th ed. 1996, R. Haugland, Molecular Probes, Wagoner Method in Enzymology 1995 v. 246, p. 362, Jameson et al. Method in Enzymology 1997, v. Chr. 278, p. 363).

An example of the coupling of a dye to the linker is the coupling of the FluoroLink ™ Cy3 monofunctional dye (Amersham Pharmacia biotech) (NT ^* structure 6i ). This is a monofunctional NHS ester fluorescent dye. The reaction is carried out according to the manufacturer's instructions:
The cleavable linker-modified dNTP (300 nmol) is dissolved in 300 μl of 100 mM sodium borate buffer pH 8.5. For this purpose, dye (300 nmol) is added and incubated for 1 h at RT. The dye-modified NT ^* is purified by RP-HPLC in a methanol-water gradient.

Another example of the coupling of a dye to the linker is the coupling of TRITC (tetramethylrhodamine-5-isothiocyanate, Molecular Probes) (dUTP-SS-TRITC 6h ).

The dNTP (300 nmol) modified with the cleavable linker is dissolved in 30 μl of 100 mM sodium borate buffer pH 9 (10 mM NT ^* ). For this purpose, 10 μl of 10 mM TRITC in DMF are added and incubated at RT for 4 h. The dye-modified NT ^* is purified by RP-HPLC in a methanol-water gradient.

Example 3:

Sequence analysis with 4 labeled NTs ^*

In a preferred embodiment of the invention, all four NTs ^* used in the reaction are labeled with fluorescent dyes.

there one uses one of the above colored coding schemes. The number of detected NTs for each sequence of one gene product is between 5 and 100, ideally between 20 and 50. These detected sequences are using a program compared with known sequences in gene databases and associated genes. Such a program can z. B. the BLAST or FASTA algorithm are based ("Introduction to computational Biology "1995 M. S. Waterman Chapman & Hall).

• a) Zugabe einer Lösung mit markierten Nukleotiden (NTs) und Polymerase zu immobilisierten Nukleinsäureketten,
• b) Inkubation der immobilisierten Nukleinsäureketten mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind,
• c) Waschen
• d) Detektion der Signale von einzelnen Molekülen,
• e) Entfernung der Markierung von den eingebauten Nukleotiden,
• f) Waschen.

A cycle has the following steps:

• a) addition of a solution with labeled nucleotides (NTs) and polymerase to immobilized nucleic acid chains,
• b) incubating the immobilized nucleic acid chains with this solution under conditions suitable for extending the complementary strands around an NT,
• c) washing
• d) detection of the signals of individual molecules,
• e) removal of the label from the incorporated nucleotides,
• f) washing.

Example 4:

Sequence analysis with 2 labeled NTs ^* and 2 unlabelled NTs (2NTs ^* / 2NTs method).

In another embodiment, for the analysis of the sequences, 2 modified NTs ^* and 2 used unmodified NTs.

This embodiment is based on the principle that a sequence of 2 signals (labeled NT ^* s) can contain enough information to identify a sequence. The determined sequence is compared with the reference sequence and assigned to a specific position, eg. B .:
ACCAAAACACCC - determined sequence (dCTP ^* and dATP ^* are marked)
ATCATCGTTCGAAATATCGATCGCCTGATGCC reference sequence
ACC-AAA-ACAC-CC (assigned determined sequence)
ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence)

Preferably the sequences determined are determined by means of a program of the reference sequence assigned. Such a program can, for. B. the BLAST or FASTA Underlying algorithm ("Introduction to computational Biology "1995 M. S. Waterman Chapman & Hall).

The gene products are prepared for sequencing as described above and sequenced by 2NTs ^* / 2NTs method. Sequence segments of gene products are obtained, each sequence representing a sequence of 2NTs ^* . Known gene sequences serve as reference sequences. In order to allow an unambiguous assignment of the determined sequence to a known reference sequence, this sequence must be long enough. The length of the sequences determined is preferably more than 20 NT ^* s. Since 2 labeled NTs ^{* represent} only a part of the sequence, the total length of the synthesized complementary strand is about twice as long as the sequence of detected NTs ^* (for 20 detected NTs ^* , the total length is for example 40 NTs on average).

For the synthesis of a complementary strand 4 nucleotides are needed. Since the fluorescent dye-labeled NTs ^* in the present invention appear as semiterminators, ie, termination occurs only with the availability of modified NTs, unmodified NTs must be added to the reaction in an additional step in each cycle. The exact position of this step in the cycle may vary. It is important that the marked NTs ^* and the unmodified NTs are used separately.

• a) Zugabe einer Lösung mit modifizierten NTs^* und Polymerasen auf die Oberfläche mit den bereitgestellten Genprodukten
• b) Inkubation der immobilisierten Nukleinsäureketten mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind,
• c) Waschen
• d) Detektion der Signale von einzelnen, modifizierten und in die den Genprodukten komplementären neusynthetisierten Strängen eingebauten NTs^*-Molekülen
• e) Entfernung der Markierung und der terminierenden Gruppe bei den eingebauten Nukleotiden
• f) Waschen
• g) Zugabe von 2 unmodifizierten NTs und Polymerasen
• h) Waschen.

A cycle in this embodiment may look like this, for example:

• a) Addition of a solution containing modified NTs ^* and polymerases to the surface with the provided gene products
• b) incubating the immobilized nucleic acid chains with this solution under conditions suitable for extending the complementary strands around an NT,
• c) washing
• d) Detection of the signals of individual, modified and incorporated into the gene products complementary neusynthetisierten strands NTs ^* molecules
• e) Removal of the label and the terminating group in the incorporated nucleotides
• f) washing
• g) addition of 2 unmodified NTs and polymerases
• h) washing.

The Concentration of the NTs is preferably below 1 mM, ideally below 10 μM.

SEQUENCE LISTING

Claims (45)

A method of analyzing gene expression by providing single-stranded gene products, randomly assembling the gene products with a single or multiple different primers in the form of gene product-primer hybridization products on a reaction surface, performing a cyclic assembly reaction of the complementary strand of gene products using a or more primers and one or more polymerases by a) adding to the immobilized gene products a solution containing one or more polymerases and one to four modified nucleotides (NTs ^* ) labeled with fluorescent dyes, which may be used with simultaneous use of at least two NTs ^* fluorescent dyes each located on the NTs ^* are selected so that the NTs used ^* can be distinguished from each other by measuring different fluorescence signals, wherein the NTs ^{* are} structurally modified at the base so ß the polymerase after incorporation of such NT ^* in a growing complementary strand is not able to incorporate another NT ^* in the same strand, wherein the fluorescent dye is cleavable and the structural modification is a cleavable sterically demanding ligand, b) the in Stage a) stationary incubated under conditions suitable for extending the complementary strands, wherein the complementary strands are each extended by an NT ^* , c) washing the stationary phase obtained in step b) under conditions that do not remove for removal in a com tary strand built NTs are suitable ^*, d) reacting the individual, built-in complementary strands NTs ^* detected by measuring the characteristic for each fluorescent dye signal, determining at the same time the relative position of the different fluorescent signals on the reaction surface, to e) for generating unlabeled NTs or gene products which cleave the fluorescent dyes and sterically demanding ligands from the NTs ^* attached to the complementary strand, f) washing the stationary phase obtained in step e) under conditions suitable for removing the fluorescent dyes and the ligands, the steps a) to f) optionally repeated several times, wherein the relative position of individual gene products on the reaction surface and the sequence of these gene products by specific assignment of the detected in step d) in successive cycles at the respective positions fluorescence signals to the NTs determined and determined from the determined partial sequences, the identity of gene products te. Process according to Claim 1, characterized in that the gene products are bound to a reaction surface at a density of 10 to 100 gene products per 100 μm ² . A method according to claim 1, characterized in that the steps a) to f) of the cyclic synthesis reaction are repeated several times, wherein in each cycle only one labeled NT ^{* is} used. Process according to Claim 1, characterized in that steps a) to f) of the cyclic synthesis reaction are repeated several times, using in each cycle two differently marked NTs ^* . Process according to Claim 1, characterized in that the steps a) to f) of the cyclic synthesis reaction are repeated several times, using four differently labeled NTs ^* in each cycle. A method according to claim 1, characterized in that already known genes serve as reference sequences and the steps a) to f) of the cyclic synthesis reaction are repeated several times, wherein in the cycles alternately two differently marked NTs ^* and two unlabelled NTs are used and the Identity of the gene products determined by comparing the sequences obtained with those of the reference sequences. Process according to claims 1 to 5, characterized that he in each case a primer binding site (PBS) is introduced into the gene products, wherein the primer binding sites for all gene products each have the same or different sequences. Process according to claims 1 to 7, characterized marked, that he the gene products are in contact with primers in a solution under conditions which leads to the hybridization of the primer to the primer binding sites (PBSs) of the gene products are suitable, the primers with each other have the same or different sequences, and the formed Gene product-primer hybridization products subsequently the reaction surface binds. Process according to claims 1 to 7, characterized that he the gene products initially on the reaction surface immobilized and only afterwards with primers under conditions that bring about hybridization the primer to the primer binding sites (PBSs) of the gene products suitable are, thereby gene product primer Hynridisierungsprodukte are formed, wherein the primers with each other the same or different Have sequences. Process according to claims 1 to 7, characterized that he the primer first on the reaction surface immobilized and only afterwards with gene products under conditions for hybridization the primer to the primer binding sites (PBSs) of the gene products suitable whereby gene products are bound to the surface and gene product-primer hybridization products are formed, wherein the primers with each other the same or different Have sequences. Process according to claims 1 to 10, characterized that the used for structural modification sterically demanding Ligand of the fluorescent dye used for labeling. Process according to claims 1 to 11, characterized that the reaction surface from the group consisting of silicone, glass, ceramics, plastics, Gels selected is. Method according to claim 12, characterized in that that the Plastics polycarbonates or polystyrenes are. Method according to claim 12, characterized in that that the Gels are agarose or polyacrylamide gels. Method according to claim 14, characterized in that that the Gels are 1 to 2% agarose gels or 5 to 15% polyacrylamide gels. Process according to claims 1 to 15, characterized that the Polymerase is a polymerase without 3'-5 'exonuclease activity. Method according to claim 16, characterized in that that the Polymerase from the group consisting of Sequenase-type viral DNA polymerases, bacterial DNA polymerases, reverse transcriptases, thermostable DNA polymerases or their modifications is selected. Method according to claim 17, characterized in that that the Polymerase Sequenase Version 2 is Method according to claim 17, characterized in that that the Polymerase Taq polymerase is Method according to claim 17, characterized in that that the Polymerase ProHa DNA polymerase is Method according to claim 17, characterized in that that the Polymerase Klenow fragment of DNA polymerase I from E. coli without 3'-5 'exonuclease activity Method according to claim 17, characterized in that that the Polymerase AMV reverse transcriptase without RNase activity Method according to claim 17, characterized in that that the Polymerase M-MLV is reverse transcriptase Method according to claim 17, characterized in that that the Polymerase is HIV reverse transcriptase without RNase activity Process according to claims 1 to 24, characterized in that the NT ^{* is} a nucleotide of the formula

is. Process according to claims 1 to 24, characterized in that the NT ^{* is} a nucleotide of the formula

is. Process according to claims 1 to 24, characterized in that the NT ^{* is} a nucleotide of the formula

is. Process according to claims 25 to 27, characterized that on the terminal amino group of the nucleotide is a fluorescent dye is attached. Process according to claims 1 to 24, characterized in that the NT ^{* is} a nucleotide of the formula

is. Process according to claims 1 to 24, characterized in that the NT ^{* is} a nucleotide of the formula

is. Process according to claims 1 to 24, characterized in that the NT ^{* is} a nucleotide of the formula

is. Process according to claims 1 to 31, characterized that the Fluorescent dyes selected from the group consisting of cyanine dyes, Rhodamine, xanthene and their derivatives are selected. Method for the quantitative analysis of gene expression, characterized in that the method according to the claims 1 to 32 performs and then you determines the number of sequences determined for each gene product. Method according to claim 33, characterized that he additionally in addition to the gene products, one or more control sequences in used known concentrations, the total concentration the control sequences between 0.01 and 10% of the total concentration the sample to be analyzed is located. Kit for carrying out the process according to claims 1 to 34, characterized in that it contains a reaction surface (a solid support), reaction solutions required for carrying out the process, one or more polymerases, and nucleotides (NTs), of which one to four are labeled with fluorescent dyes, wherein the labeled NTs are further structurally modified (NT ^* or NTs ^* ) such that, upon incorporation of such NT ^* into a growing complementary strand, the polymerase is unable to insert another NT ^* into the same strand incorporated, wherein the fluorescent dye is cleavable and the structural modification is a cleavable sterically demanding ligand. Kit according to claim 35, characterized in that the structural modification used bulky ligand the fluorescent dye used for labeling is. Kit according to claim 35 or 36, characterized that it further contains components: a) Oligonucleotide primers b) for cleaving the fluorescent dyes and sterically demanding ligands required reagents, and / or c) Washing solutions. Kit according to claims 35 to 37, characterized that the reaction surface from the group consisting of silicone, glass, ceramics, plastics, Gels selected is. Kit according to claim 38, characterized in that the plastics Polycarbonates or polystyrenes are. Kit according to claim 38, characterized in that the gels Agarose or polyacrylamide gels. Kit according to claim 40, characterized in that the gels 1 to 2% agarose gels or 5 to 15% polyacrylamide gels. Kit according to claims 35 to 41, characterized that the DNA polymerase is a DNA polymerase without 3'-5 'exonuclease activity. Kit according to claim 41, characterized in that the polymerase from the group consisting of Sequenase-type viral DNA polymerases, bacterial DNA polymerases, reverse transcriptases and thermostable DNA polymerases. Kit according to claim 43, characterized in that the polymerase Sequenase Version 2, Klenow Fragment of DNA polymerase I from E. coli without 3'-5 'exonuclease activity, AMV reverse Transcriptase without RNase activity, M-MLV reverse transcriptase, HIV reverse transcriptase without RNase activity, Taq polymerase or ProHa DNA polymerase. Kit according to claims 35 to 44, characterized that the Fluorescent dyes selected from the group consisting of cyanine dyes, Rhodamine, xanthene and their derivatives are selected.