DE10113781A1 - New DNA encoding synthetic spider silk protein, useful e.g. for closing wounds, comprises modules that encode repeating units of spirodoin proteins - Google Patents

Abstract

DNA sequence (I), encoding a synthetic spider silk protein (II), comprising modules, each comprising a group of sequentially arranged oligonucleotides (ON), each ON encoding a repeating unit of a spidroin protein (III), is new. DNA sequence (I), encoding a synthetic spider silk protein (II), comprising modules, each comprising a group of sequentially arranged oligonucleotides (ON), each ON encoding a repeating unit of a spidroin protein (III). (II) has at least 84, best 94,% homology with (III), especially the spidroin-1 protein of Nephila clavipes. Independent claims are also included for the following: (a) recombinant nucleic acid (Ia) comprising (I) and a ubiquitously active promoter; (b) vector containing (Ia); (c) microorganisms containing (Ia) or the vector of (b); (d) recombinant (II); (e) preparation of a plant, or plant cell, that produces (II); (f) transgenic plant cell containing (Ia) or the vector of (b), or produced by method (e); (g) transgenic plants containing the cells of (Ia), also their parts, harvested products or replicative material; (h) method for producing plant-derived or otherwise recombinant (II); and (i) plant-derived (II) produced by method (h).

Description

The invention relates to a DNA sequence which codes for a synthetic spider silk protein, recombinant spider silk proteins which are coded by the DNA sequence according to the invention, methods for the production of plants or plant cells which contain recombinant spider silk protein and transgenic plant cells and plants which have a DNA Sequence included, which codes for a synthetic spider silk protein. Furthermore, the invention relates to a method for obtaining vegetable spider silk protein from transgenic plants and vegetable spider silk proteins which have been produced by such a method.
RN: MH: uh

Spider silk has excellent mechanical properties that many well-known surpasses natural and artificial materials. The main components of spider silk are Fiber proteins such as fibroin from the silk spinner and spidroin 1 and Spidroin 2 from Nephila clavipes. The strength and elasticity of the silk is based on the Presence of short repetitive amino acid units found in these natural proteins available. These mechanical properties predestine the spider silk for a number of various technical applications such as the production of stable threads or silk. Furthermore, the spider silk threads have because of their protein chemical properties over a low immunogenic and allergenic potential, which is why in combination with the mechanical properties an application in the Medicine, for example, as a natural thread for sewing wounds, as Attachment areas for cultivated cells, as scaffolds for artificial organs and the like offers.

The prerequisite for such technical or medical use of the spider silk is however, the production of spider threads or spider silk proteins on a large scale. To this end, attempts have been made to produce spider silk to express responsible spidroin or fibroin genes in E. coli. Which is common however, repeating sequences in the corresponding genes go into reproduction gradually lost in bacteria. Another problem is the size of the genetic Information that appears to be too extensive for the bacterium so that the spider silk Genes cannot always be read completely.

Attempts at expression in yeast cells have shown more stable and longer silk proteins that However, threads spun therefrom do not have the same advantageous Properties of natural silk, so that for example a medical application such a synthetically produced silk is not possible. There is therefore a need for  synthetic silk proteins that can be produced on an industrial scale and after spinning into threads have mechanical properties that match those of natural silk are comparable.

The object of the present invention is therefore to provide DNA sequences which are suitable for encode a synthetic spider silk protein that resembles as closely as possible the previously known natural sequences of fiber proteins of spider silk. It is also an object of the present invention to provide a method with which synthetic spider silk proteins can be produced on a large scale.

Further objects of the present invention will become apparent from the following description.

The above-mentioned tasks are characterized by the characteristics of the independent protection claims solved.

Advantageous configurations are defined in the subclaims.

In the context of the present invention, a DNA sequence is now disclosed, which for a synthetic fiber protein, in particular a synthetic spider silk protein that encodes an at least 80%, preferably at least 84%, more preferably at least 88%, particularly preferably at least 90% and 92%, most preferred at least 94% homology to spidroin and / or fibroin proteins, especially to the spidroin 1 protein, particularly preferably the spidroin 1 protein from Nephila clavipes having.

In the context of this invention, homology means similarity between amino acids sequences based on identical or homologous amino acid components. Which Amino acids are to be regarded as homologous, the person skilled in the art is known, for B. (i) isoleucine,  Leucine and valine among themselves, (ii) asparagine and glutamine, (iii) aspartic acid and Glutamic acid.

The DNA sequence according to the invention is made up of modules which are a group of include lined up oligonucleotide sequences, the oligonucleotide sequences each code for repetitive units made from spidroin and / or fibroin proteins.

The structure of the DNA sequence according to the invention from different modules, which again from different short amino acid residues typical of spidroins or fibroins Repeats are constructed using the principle of stringing the corresponding ones together Oligonucleotide sequences or the modules on natural spidroin and / or fibroin Sequence-oriented, ensures a very high degree of homology to previously known ones natural spidroin or fibroin sequences. This ensures that the DNA sequence according to the invention encoded spider silk proteins after spinning Threads have excellent mechanical properties in terms of their strength and elasticity exhibit that with the mechanical properties of natural spider threads are comparable.

Furthermore, the modular structure of the DNA sequence according to the invention enables one simple genetic modification of the synthetic genes so that multimers of synthetic spider silk proteins of any size made to order can be. Furthermore, the encoded by the DNA sequence according to the invention Spider silk proteins due to the modular structure with others Fiber protein sequences are fused. A particular advantage of the invention DNA sequence is that due to its modular structure, it can easily be used for Cleaning elements or solubility-changing peptide coding sequences fused can be.  

In a particularly preferred embodiment of the present invention, this spider silk protein encoded by the DNA sequence according to the invention contains at least one 84%, preferably at least 90% and particularly preferably at least 94% Homology to the Spidroin 1 protein from Nephila clavipes. Spidroin 1 out Nephila clavipes is essential to the construction of a mechanically particularly stable and elastic carrying thread involved.

Due to the modular structure of the DNA sequence according to the invention, the Construction of genes encoding very large spider silk proteins is straightforward possible, the high homology to spidroin and / or fibroin proteins, in particular to spidroin 1, particularly preferably to spidroin 1 from Nephila clavipes is always preserved. The size distribution of the DNA sequences according to the invention that can be achieved in this way encoded proteins corresponds to the spectrum of spider silk proteins, which according to the Dissolution of natural spider silk can be observed. This identical The size spectrum and the high sequence homology define the invention synthetic genes as genes that code for spider silk proteins. In contrast to natural spider silk, which consists of a mixture of spider silk proteins, are provided by the present invention spider silk protein genes that are associated with high homology represent a gene class and a simple genetic engineering Allow manipulation.

The modules for constructing the DNA sequence according to the invention comprise a group of strung oligonucleotide sequences, which are preferably selected from the group consisting of:

• a) TATGAGCGCTCCCGGGCAGGGT;
• b) AGCTTTTAGGTACCAATATTAATCTGGCCGGCTCCACC;
• c) TATGGTCTGGGG;  
• d) GGCCAGGGTGCTGGCCAA;
• e) GGTGCAGGAGCWGCWGCWGCWGCTGCAGGTGGA;
• f) GCCGGCCAGATTAATATTGGTACCTAAA;
• g) CTGCCCGGGAGCGCTCA;
• h) ACCACCATAACCTCC;
• i) AGCACCCTGGCCCCCCAG;
• j) TGCAGCWGCWGCWGCWGCTCCTGCACCTTGGCC;
• k) TATGAGATCTGGCCAAGGAGGT;
• l) TTGGCCAGATCTCA;
• m) AGTCAGGGTGCTGGTCGTGGAGGCCAA;
• n) TCCACGACCAGCACCCTGACTCCCCAG;
• o) AGTCAGGGCGCTGGTCGTGGGGGACTGGGTGGCCAA;
• p) ACCCAGTCCCCCACGACCAGCGCCCTGACTCCCCAG;
• q) CTGGGAGGGCAGGGAGCGGGCCAA;
• r) CGCTCCCTGCCCTCCCAGACCTCC; and
• s) sequences which are at least 80%, preferably to sequences a) to r) have at least 90%, particularly preferably at least 94% sequence identity.

The modules preferably comprise at least four oligonucleotide sequences that are preferably differentiate the natural spider silk proteins to authentic ones Way to recreate. The DNA sequence according to the invention is again preferably from built at least four of the modules described above.

The structure of the DNA sequence according to the invention is exemplified below. First, the oligonucleotides shown in FIG. 1 are provided, which code for amino acid sequences which correspond to short amino acid repeats typical of spidroin. These oligonucleotides are combined with one another by genetic engineering methods, the combination being based on the natural spidroin sequence (see FIG. 2). The resulting modules A, B, C, D, E and F are combined again (see Fig. 3). In this way, DNA sequences according to the invention are provided which, at the amino acid level, show at least 85%, preferably at least 90% and particularly preferably at least 94% homology to spidroin proteins.

In a further embodiment, the DNA sequence according to the invention additionally comprises to the modules described above nucleic acid sequences that are for repetitive Units of fibroin proteins, preferably of the silk spinner's fibroin protein encode.

The sequences have particularly preferred DNA sequences according to the invention SEQ ID No. 19 to 29.

According to the invention, it has also surprisingly succeeded for the first time in synthetic To produce spider silk proteins in transgenic plants. That way you can synthetic spider silk proteins can be produced on a large scale. To be stable To ensure expression of the DNA sequence according to the invention in plants According to the invention, a recombinant nucleic acid molecule is provided which has the above described DNA sequence according to the invention and a ubiquitous promoter, preferably comprises the CaMV35S promoter. The provision of the invention recombinant nucleic acid molecule enables the expression and accumulation of synthetic spidroin or fibroin sequences in transgenic plants.

To ensure that the DNA sequence according to the invention in suitable compartments is expressed and accumulated by transgenic plants includes the invention Nucleic acid molecule in addition to the DNA sequence according to the invention and a  ubiquitous promoter preferably at least one nucleic acid sequence for encodes a plant signal peptide.

In a preferred embodiment, the target compartment for the expression or Accumulation of the synthetic spider silk protein the endoplasmic Reticulum (ER) selected. This compartment is for the stable accumulation of Foreign proteins particularly suitable in plants. To transport to the ER too ensure, the nucleic acid molecule according to the invention preferably comprises corresponding ones Signal peptides, particularly preferably the LeB4Sp sequence.

The retention in the ER, if desired, is ensured according to the invention in that the nucleic acid molecule according to the invention additionally comprises a nucleic acid sequence which for encodes an ER retention peptide. The retention in ER is preferably by the C-terminally attached amino acid sequence KDEL reached.

It may also be advantageous to place the DNA sequence according to the invention on the plasma membrane, ie the cell membrane. Therefore, in an alternative embodiment, the recombinant nucleic acid molecule according to the invention comprises the DNA sequence according to the invention, fused to the N-terminus of a transmembrane domain. This transmembrane domain is preferably the transmembrane domain of the PDGF receptor, the so-called HOOK sequence (see FIG. 4).

In a particularly preferred embodiment of the present invention, the nucleic acid molecule according to the invention is fused with ELPs (elastin-like polypeptides). ELP's are oligomeric repeats of the pentapeptide Val-Pro-Gly-Xaa-Gly (where Xaa is any amino acid except proline and preferably Gly) and are subject to a reversible inverse temperature transition. They are very soluble in water below the inverse transition temperature (T _t ), but are subject to a sharp phase transition in the range from 2 ° C to 3 ° C if the temperature is raised above T _t , which leads to the precipitation and aggregation of the polypeptide. DE Meyer and A. Chilkoti, Nat. Biotech. 1999, 17, 1112-1115, have described that ELP fusions with recombinant proteins specifically change the solubility behavior of these recombinant proteins at different temperatures and concentrations. In the present invention, this is used to establish cleaning strategies for the spider silk protein encoded by the DNA sequence according to the invention, which are described in detail below. The ELPs encoded by the nucleic acid sequence in the nucleic acid molecule according to the invention preferably comprise from 10 to 100 of the pentamer units described above (see FIG. 5).

The preparation of the chimeric gene constructs or recombinant described above Nucleic acid molecules are made using conventional cloning techniques (see for example Sambrok et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York)). By means of this common molecular biological techniques it is possible to construct desired constructs for the Prepare or produce transformation of plants. The one for genetic engineering Manipulation in prokaryotic cells usually used cloning, Mutagenization, sequence analysis and restriction analysis methods and others Biochemical-molecular biological methods are well known to the person skilled in the art. So can not only suitable chimeric gene constructs with the desired fusion of Promoter, DNA sequence according to the invention, coding for a plant signal peptide Sequence, coding sequence for an ER retention peptide, for a transmembrane domain coding sequence and / or for cleaning elements or solubility-changing Sequences encoding peptides can be produced. Rather, the person skilled in the art can Routine techniques, if desired, various mutations or deletions in the introduce respective genes.  

The invention further relates to vectors and microorganisms, the invention Contain nucleic acid molecules and their use in the production of plant cells or plants that produce spider silk proteins. It is about the vectors in particular plasmids, cosmids, viruses, bacteriophages and others in the Genetic engineering common vectors. The microorganisms are primarily Bacteria, viruses, fungi, yeast and algae.

Since the DNA sequences according to the invention have hardly any unique restriction sites due to their repetitive character, the vectors according to the invention or the genes encoding the synthetic spider silk protein were adapted accordingly by various strategies (see FIGS. 6 to 8). When the DNA sequences according to the invention are amplified by PCR, owing to the extremely repetitive nature of the DNA sequences according to the invention, oligonucleotides are preferably first ligated, which then serve as templates for the subsequent PCR reactions (see FIG. 7).

Furthermore, in the present invention, a recombinant spider silk protein provided, which is encoded by the DNA sequence according to the invention. This synthetic spider silk protein according to the invention, preferably with a Molecular weight in the range from 10 to 160 kDa, has an at least 85%, preferably at least 90% and particularly preferably at least 94% homology Spidroin and / or Fibroin proteins. Due to this high homology with the natural Fiber proteins of the spider and the silk spinner ensure that the outstanding mechanical properties of natural spider threads can be achieved when the proteins according to the invention are spun into threads.

Furthermore, the proteins according to the invention surprisingly have novel ones physicochemical properties. So the solubility of this invention remains  synthetic fiber proteins in aqueous solutions even after long cooking extremely well preserved. Together with the solubility also occurring in organic solutions and the precipitation behavior at high salt concentrations these new properties of the synthetic spider silk proteins according to the invention thus for the development of technically feasible extraction and cleaning processes be used. These properties are further enhanced when the invention synthetic spider silk proteins in specific compartments, especially in ER can be accumulated by transgenic plants.

Examples of amino acid sequences of the recombinant synthetic according to the invention Spider silk proteins have the sequences SEQ ID No. 30 to 40. The Spider silk proteins according to the invention can alternatively also by chemical, the Methods known to those skilled in the art are synthesized, which is a recombinant preparation however preferred.

The invention further relates to a method for producing spider silk protein-producing plants or plant cells, comprising the following steps:

• a) Preparation of a recombinant according to the invention as described above Nucleic acid molecule;
• b) transfer of the nucleic acid molecule from a) to plant cells; and
• c) if appropriate, the regeneration of fertile plants from the transformed Plant cells.

Furthermore, the invention relates to plant cells that the invention Contain nucleic acid molecules or the vector according to the invention. The invention relates  furthermore harvest products and propagation material of transgenic plants as well as the transgenic Plants themselves that contain a nucleic acid molecule according to the invention.

Prepare for the introduction of foreign genes into higher plants or their cells a large number of cloning vectors are available which provide a replication signal for E. coli and contain a marker gene for the selection of transformed bacterial cells. examples for such vectors are pBR322, pUC series, M13mp series, pACYC184 and so on Most sequence can be inserted into the vector at a suitable restriction site become. The plasmid obtained is then used for the transformation of E. coli cells det. Transformed E. coli cells are grown in a suitable medium and an finally harvested and lysed, and the plasmid is recovered. As an analytical method de to characterize the plasmid DNA obtained are generally restrictions analyzes, gel electrophoresis and other biochemical-molecular biological methods set. After each manipulation, the plasmid DNA can be cleaved and DNA Fragments can be linked to other DNA sequences.

A variety of tech are available for the introduction of DNA into a plant host cell techniques are available, the person skilled in the art finding the appropriate method without difficulty can determine. These techniques include the transformation of plant cells T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as a transformation medium, the fusion of protoplasts, injection, electroporation, the direct gene transfer of isolated DNA in protoplasts, the introduction of DNA by means of the biolistic method and other possibilities that have been good for several years are established and to the usual repertoire of the specialist in the vegetable Molecular biology or plant biotechnology belong.

In the injection and electroporation of DNA into plant cells, no per se The demands placed on the plasmids used. The same applies to the direct one  Gene transfer. Simple plasmids such as e.g. B. pUC derivatives can be used. Should but whole plants are regenerated from such transformed cells, is the property recommended selectable marker gene. The experts are familiar Selection marker known, and it is no problem for him, a suitable marker to select.

Depending on the method of introducing desired genes into the plant cell, additional DNA Sequences may be required. Are z. B. for the transformation of the plant cell the Ti or Ri plasmid is used, at least the right boundary, but often the right and left borders of the T-DNA contained in the Ti and Ri plasmid as flanks linked to the genes to be introduced. Be for transformation If agrobacteria are used, the DNA to be introduced must be cloned into special plasmids the, either in an intermediate or in a binary vector. The interme diary vectors may be due to sequences homologous to sequences in the T-DNA are integrated into the Ti or Ri plasmid of the agrobacteria by homologous recombination become. This also contains the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate in agrobacteria. Using a helper plasma mids the intermediate vector can be transferred to Agrobacterium tumefaciens (Kon jugation). Binary vectors can replicate in E. coli as well as in Agrobacteria. They contain a selection marker gene and a linker or polylinker, which is from the right and left T-DNA border region are framed. You can go straight into the agro bacteria are transformed. The agrobacterium serving as the host cell is said to be a plasmid, that carries a vir region. The vir region is for the transfer of the T-DNA into the Plant cell necessary. Additional T-DNA may be present. The transfor that way mated Agrobacterium is used to transform plant cells. The use The development of T-DNA for the transformation of plant cells has been intensively investigated and sufficient in well-known overview articles and manuals for plant trans formation has been described. Plants can be used to transfer the DNA into the plant cell  zen explants expediently with Agrobacterium tumefaciens or Agrobacterium rhizogenes are cultivated. From the infected plant material (e.g. leaf pieces, stems segments, roots, but also protoplasts or suspension-cultivated plant cells) can then in a suitable medium, which antibiotics or biocides for selection can contain transformed cells, whole plants can be regenerated again.

Once the introduced DNA is integrated in the genome of the plant cell, it is there in the Usually stable and remains in the progeny of the originally transformed cell receive. It usually contains a selection marker that corresponds to the transformed plants cell resistance to a biocide or an antibiotic such as kanamycin, G 418, Bleomycin, hygromycin, methotrexate, glyphosate, streptomycin, sulfonylurea, genta mycin or phosphinotricin u. a. mediated. The individually selected marker should therefore be the Selection of transformed cells over cells that lack the introduced DNA allowed Alternative markers are also suitable for this, such as nutretive markers and screening markers (like GFP, green fluorescent protein). Of course you can also choose Selek tion markers are dispensed with, but this does require a fairly high need for screening goes along. If marker-free transgenic plants are desired, the expert is also available Strategies are available that allow subsequent removal of the marker gene, e.g. B. Cotransformation, sequence-specific recombinases.

The regeneration of the transgenic plants from transgenic plant cells is carried out according to übli Chen regeneration methods using known nutrient media. The so obtained Plants can then be grown using standard techniques, including molecular biological Methods such as PCR, blot analysis, for the presence of the introduced nucleic acid, the one synthetic spider silk protein encoded, are examined.

The transgenic plant or the transgenic plant cell can be any one act monocotyledonous or dicotyledonous plant or plant cell. It is preferably  around crop plants or cells of crop plants. It is particularly preferred transgenic plants selected from the group consisting of the tobacco plant (Nicotiana tabacum) and the potato plant (Solanum tuberosum).

The expression of the synthetic spider silk protein according to the invention in the Plants according to the invention or in the plant cells according to the invention can with the help conventional molecular biological and biochemical methods are proven and be followed. These techniques are known to the person skilled in the art and can be used without problems Able to choose a suitable detection method, for example a Northern blot Analysis or a Southern blot analysis.

An example of the production of transgenic spider silk protein-producing plants is given in Fig. 9. The sequences amplified by PCR may contain frameshift mutations. The sequences according to the invention must therefore be checked before the generation of transgenic plants. This can be done by sequence analysis from the flanking vector sequences. Longer constructs over 1 kB cannot be tested in this way, since due to the repetitive properties of the DNA sequences according to the invention, internal sequencing primers do not provide any evaluable, safe sequences. For this reason, amplified spidroin sequences were preferably cloned into the pet23a bacterial expression vector (Novagen, Madison, USA). Frame shift mutations can then be excluded by immunochemical detection of the expression.

The nucleic acid molecules or expression cassettes according to the invention are according to the invention usually as HindIII fragments in shuttle vectors such as pBIN, pCB301 and / or pGSGLUC1 cloned. These shuttle vectors are preferably in Agrobacterium tumefaciens transformed. The transformation of Agrobacterium  tumefaciens is usually detected by Southern blot analysis and / or PCR screening checked.

The invention also relates to propagation material and crop products of the Invention appropriate plants, for example fruits, seeds, tubers, rhizomes, seedlings, Cuttings etc.

The invention further relates to a method for obtaining vegetable spider silk protein, comprising the following steps:

• a) the transfer of a recombinant nucleic acid molecule according to the invention or Vector that receives a DNA sequence necessary for a synthetic spider silk protein encoded, on plant cells;
• b) if appropriate, the regeneration of plants from the transformed plant cells;
• c) the processing of the plant cells from a) or the plants from b) for extraction of vegetable spider silk protein.

In a further essential aspect of the present invention, methods for Obtaining recombinantly produced spider silk proteins that the Transfer of a recombinant nucleic acid molecule or vector according to the invention, which contains a DNA sequence which codes for a synthetic spider silk protein any cells, d. H. In addition to plant cells, for example, bacterial or animal cells Cells. An essential feature of this method according to the invention is the step of purifying the recombinantly produced spider silk proteins, in which u. a. their special properties with regard to solubility when heated and / or Acid addition can be used.  

Thus, in one embodiment of the method according to the invention, the recombinantly produced spider silk protein by heat treatment of the cell extract, e.g. B. a plant seed extract, and subsequent separation of the denatured cell's own, e.g. B. the plant's own proteins, for example by centrifugation. there the property of the recombinantly produced spider silk proteins is exploited that they remain soluble when heated to boiling point. Remain against it for example synthetic fiber proteins of the spider and the silk spinner after expression in Pichia pastoris when heated only up to a temperature of 63 ° C and then only for 10 Minutes in solution.

In a further embodiment of the method according to the invention for obtaining Recombinantly produced spider silk proteins are cleaned by adjustment an acidic pH by adding acid, preferably hydrochloric acid, to the cell extract, for example to the plant extract. The acidic pH, especially a pH in the range of 1.0 to 4.0, particularly preferably in the range from 2.5 to 3.5, most preferably a pH of 3.0, is preferably preferred for a period of several minutes about 30 minutes, at a temperature below room temperature, preferably about 4 ° C, maintained. Again, an unexpected property of the Proteins obtained according to the method used, namely that they are Acidify, especially in solution up to a pH of 3.0 at 4 ° C. The cell's own for example, plant proteins fail and are particularly affected by Centrifugation separated.

The solubility properties described above according to the invention Processes recombinantly produced spider silk proteins are very surprising and were not predictable in this form and enable efficient, fast and Cost-effective cleaning when extracting them from cells, especially plant cells.  

In a further embodiment of the method according to the invention, a Nucleic acid molecule transferred to the cells, which also has a nucleic acid sequence which encodes for ELP's. In this case, the recombinant is cleaned spider silk protein produced in the following way: In a first step, the Spider silk-ELP fusion protein enriched by heat treatment of the crude extract. Surprisingly, the fusion proteins retain the extraordinary solubility of the Spider silk proteins at high temperatures. Much of the cell's own proteins fails at this temperature increase. In the next step, the spider silk ELP Fusion proteins by further increasing the temperature, preferably to a temperature of at least 60 ° C, failed. Precipitation preferably takes place with a suitable salt Concentration, for example an NaCl concentration of at least 0.5 M, preferably in the range of 1 M to 2 M. Finally, the ELP fragment, preferably by Digestion with CNBr, split off.

By the method according to the invention for obtaining Recombinantly produced spider silk protein can increase the proteins in plants Concentrations, preferably up to an expression level of about 4% of the total soluble protein can be enriched. This is the first time that procedures are provided that for the technically feasible enrichment of recombinant spider silk protein can be used.

The spider silk proteins according to the invention can be used in a further aspect of Present invention for the production of synthetic threads and films and Membranes are used. In particular, such products are for medical Applications, in particular for sewing wounds and / or as scaffolding or as Cover for artificial organs, suitable. Furthermore, those from the invention  Spider silk proteins produced films and membranes u. a. as attachment areas for cultivated cells and used for filtering.

The present invention is illustrated in the following examples, which are illustrative serve the invention and are in no way to be understood as limiting.

Examples example 1

Expression and stable accumulation of synthetic fiber proteins Spider and silk spinner in the endoplasmic reticulum of leaves or tubers transgenic tobacco and potato plants.

In Figs. 10a and b amino acid sequences of synthetic spider silk proteins with high homology to the spidroin 1 protein from Nephila clavipes are shown, wherein the C-terminal and not repetitive constant region are not shown. These synthetic spider silk proteins consist of modules, which in turn comprise strung together oligonucleotide sequences. The various synthetic genes were assembled by combining several modules, whereby hybrid forms with sequences based on fibroin 1 were also generated.

Various plant expression cassettes are listed in Table 1 below. those for the various synthetic fiber proteins according to the invention with the sequences SEQ ID No. Code 30 to 40.  

Table 1

By an N-terminal signal peptide sequence and a C-terminal ER retention sequence (KDEL) was the targeted transport and accumulation of the invention Sequences in the endoplasmic reticulum of cells of transgenic plants reached. A Detection sequence in the form of a c-myc tag at the C-terminal end of the transgenic synthetic fiber proteins allows the detection of transgenic products in Plant extracts.

The cassettes SO1 and FA2 are shown in detail in FIGS. 10a and 10b. The plant expression cassettes SB1, SD1, SA1, SE1, SF1, SM12, SO1SM12, SO1SO1 and SO1SO1SO1 were created according to the same construction principle. By varying the basic module repetitions, synthetic fiber proteins of different amino acid numbers and correspondingly different molecular weights are formed (see Table 1).

Fig. 2 schematically describes the way to set the above-mentioned constructs. The interfaces SmaI and NaeI were introduced for direct cloning of the synthetic fiber protein genes according to the invention. For this purpose, a PCR product containing the corresponding interfaces was cloned with the primer combination 5'-pRTRA-SmaI and 3'-pRTRA-NotI into the plasmid pRTRA ScFv SmaIΔ / BamHIΔ via BamHI and NotI. Synthetic fiber protein genes were cloned from the fiber protein gene derivatives of plasmids 9905 or 9609 into the vector pRTRA.7 / 3 placeholder. By selecting the restriction endonuclease recognition sequences at the 5 'and 3' ends of the synthetic fiber protein genes (SmaI and NaeI), these can be freely combined with one another, and larger fiber protein genes can be assembled according to the invention in a cloning step.

In this way, transgenic synthetic spider silk proteins were accumulated to high concentrations in the endoplasmic reticulum of transgenic tobacco and potato plants (see Fig. 12a and 12b). The following table 2 shows the maximum accumulation level of synthetic spider silk proteins according to the invention in the ER of leaves of transgenic tobacco and potato plants. The accumulation of the transgenic synthetic fiber proteins was estimated by comparison with transgenic recombinant antibodies which were given the same tag in an identical manner. This is the first time an accumulation of spider silk proteins in plants is described using the example of potatoes and tobacco.

Table 2

A defined amount of the total protein extract containing fiber protein (40 µg) and a defined amount of a reference protein with c-myc immunotag (50 ng ScFv) were separated by SDS gel electrophoresis, and synthetic fiber proteins and reference proteins were Western blotted by an anti-myc antibody proven (see Fig. 12 and 13). The percentages result from the comparison between the band intensity of the reference proteins and the band intensity of the synthetic spider silk proteins according to the invention and represent estimated values. Differences in size of the synthetic fiber proteins and the reference protein were taken into account. Possible differences in marking efficiency can almost be excluded.

Fig. 13 shows the heat stability of various synthetic spider silk proteins according to the invention in plant extracts. Surprisingly, the spider silk proteins according to the invention remain in solution even after a longer heat treatment of 3 h (comparison of reference sample R with samples H-60 min. H-120 min and H-180 min). The remaining vegetable proteins are denatured to more than 90% and can be easily separated by centrifugation ( Fig. 13a: Comparison of sample R to H-60 min). These unusual properties of the synthetic spider silk proteins according to the invention, which are due, among other things, to their amino acid sequence and their folding in the vegetable ER, enable the development of large-scale, cost-effective purification strategies.

Fig. 14 shows the solubility of synthetic fiber proteins from transgenic plants. In contrast to the bacterially expressed synthetic fiber proteins described in the prior art, the spider silk proteins according to the invention have a surprisingly good solubility in aqueous buffers (R1, R2 = Tris buffer; T1, T2 = phosphate buffer). These properties are also based, among other things, on the amino acid sequence and in particular on the folding in the endoplasmic reticulum of plant cells.

Example 2

Expression and stable accumulation of synthetic spider silk proteins in the plasma lemma of leaves of transgenic tobacco and potato plants.

In this example, the membrane-associated accumulation of spider silk proteins according to the invention in transgenic tobacco and potato plants is described. Based on the constructs described in Example 1, fusion genes were produced which code for a spider silk protein and for a membrane domain. The general scheme of these constructions is shown in Fig. 15. A NotI fragment was isolated from the plasmid pRT-HOOK, which codes both for the HOOK domain and for a c-myc immunotag, which was then cloned into derivatives of the vector pRTA.7 / 3 carrying spider silk protein genes. By selecting the restriction endonuclease recognition sequences at the 5 'and 3' ends of the synthetic spider silk protein genes (SmaI and NaeI), these can in turn be combined with one another, as a result of which larger fiber protein genes can be assimilated in one cloning step.

Fig. 16 shows the expression of the genes described above in transgenic tobacco and potato plants. As can be seen from the comparison of samples 1, 2 and 3 in this figure, in contrast to the proteins according to the invention described in Example 1, these transgenic spider silk proteins are not soluble in the aqueous phase. This property can also be used for the development of cleaning strategies.

Example 3

Targeted change in the solubility of spider silk proteins through fusion with elastin-like peptides.

In a first step it was shown that fusions with elastin-like peptides also bacterially expressed spider silk proteins for a targeted change in the Solubility behavior depending on temperature and concentration.

A corresponding expression cassette is shown in Fig. 5. Examples of ELP with 10, 20, 30, 40, 60, 70 and 100 pentamer units can be found in the sequences SEQ ID No. 41 to 47 specified. Examples of DNA sequences and amino acid sequences in the form of the construct SM12-70xELP as a plant expression cassette or as an expression cassette for E. coli are shown in the sequences SEQ ID No. 48-51 or shown in Fig. 19 to 22.

Fig. 17 shows the gel electrophoretic analysis of such a cleaning process. The spider silk-ELP fusion protein was enriched by heat treatment of the crude extract. Surprisingly, the fusion proteins retained the extraordinary solubility of the spider silk proteins at high temperatures. Most of the E. coli proteins were precipitated at these temperatures.

After high concentration of the enriched spider silk protein extract, this became Extract exposed to a temperature of 60 ° C, whereupon the ELP spider silk protein failed and was pelletized. The pellet was dissolved in water at room temperature, and insoluble matter was removed by pelleting.

The spider silk protein fraction was then lyophilized and by Digested cyanogen bromide. The cyanobromide cleavage was caused by the methionine residue between the spider silk protein and the ELP peptide.

The mixture was then lyophilized again and dissolved in aqueous buffer. Then a strong concentration took place, whereby the split-off ELP fragment (ELP (TR); see Fig. 2) precipitated and was removed by pelleting. The spider silk protein remained in solution (SM12 (TR); see Fig. 17). Solubility was maintained for an extended period of time at SM12 at 4 ° C for 24 H. The identity of the spider silk protein purified in this way was demonstrated by peptide sequencing of the N-terminal end.

In a second step, spider silk proteins were accumulated as ELP fusions in the endoplasmic reticulum of transgenic tobacco plants. The basic structure of these expression cassettes is also shown in Fig. 5. These fusion proteins with molecular weights of 35,000 daltons to 100,000 daltons were all enriched in plants at high concentrations with an expression level of about 4% of the total soluble protein.

Illustrations Fig. 1

Oligonucleotide sequences which code for short amino acid repeats typical of spidroin.

Fig. 2

Sequence of oligonucleotide sequences to build modules of the DNA sequences according to the invention.

Fig. 3

Structure of the DNA sequences according to the invention from modules.

Fig. 4

Cloning of the gene of the transmembrane domain from HOOK with NotI from (pRT-HOOK) in (pRTA.73 syn.spidroin).

Fig. 5

Schematic representation of the Spidroin-ELP expression cassettes. xELP units: 10, 20, 30, 40; 60, 70 or 100 pentamers (Val-Pro-Gly-Val-Gly). The methionine between that Spider silk protein and the ELP peptide enable cyan bromide cleavage.

Fig. 6

Change of a base in the recognition sequence of BamHI (position 1332) by targeted Mutagenesis.

Fig. 7

Prepare (pRTRA.73, BamHIΔ) for direct cloning of the synthetic Spidroingenes from p9905 or p9609 - cancellation of the SmaI recognition sequence (position 463).  

Fig. 8

Introduction of the restriction recognition sequences of SmaI and NaeI into the vector (pRTRA.73, BamHIΔ + SmaIΔ) for the cloning of synthetic spidroin genes.

Fig. 9

General description of the production of transgenic spider silk protein-producing Plants.

Fig. 10

(a) Representation of the modular structure of the spider silk proteins according to the invention on Example of the SO1 sequence. Amino acids 1-28: LeB4 signal peptide; Amino acids 29-659: synthetic spider silk protein sequence; Amino acids 660-672: c-myc tag; Amino acids 673-676 ER retention signal.

Arrangement of the sequence modules according to that in Simmons et al., 1996. Molecular orientation and two-component nature of the crystalline fraction of spider dragline silk. Science 271: 84-87 specified original sequence.

(b) Representation of the modular structure of the synthetic fiber hybrid protein FA2. Amino acids 1-28: LeB4 signal peptide; Amino acids 28-130: synthetic Spider's fiber protein sequence; Amino acids 131-247: synthetic fiber protein sequence the silk spinner; Amino acids 248-260: c-myc tag; Amino acids 261-264: ER retention signal.  

Fig. 11

Schematic representation of the creation of gene cassettes for the accumulation of synthetic fiber proteins of spider and silk spinner in the ER of transgenic Plants.

Fig. 12

(a) Expression of the synthetic fiber proteins of the spider (SD1, SM12, SO1) or the Hybrids from spider and silk spinner (FA2) in leaves of transgenic tobacco plants. 40 µg of total protein were analyzed in SDS sample buffer. SD1: 13 kDa; FA2: 20 kDa; SM12: 31 kDa; SO1: 52 kDa; K: positive control 50 ng ScFv.

(b) Expression of the synthetic fiber proteins of the spider (SD1, SM12, SO1) or the Hybrids from spider and silk spinner (FA2) in transgenic potato plants.

40 µg of total protein in SDS sample buffer were also analyzed. SD1: 13 kDa; FA2: 20 kDa; SM12: 31 kDa; SO1: 52 kDa; K: positive control 50 ng ScFv.

Fig. 13

Representation of the heat resistance of the synthetic fiber proteins of the spider and Silk spinners based on constructs SD1 and FA2. A: Coomassie stained gel. B: Immunochemical detection of synthetic fiber proteins SD1 and FA2 using anti c-myc antibody. PM: protein marker; ScFv: 50ng ScFv; R: aqueous plant extract from Leafing of transgenic plants for SD1 and FA2; H: heat step 60 min, 120 min, 180 min, 24 h and 48 h at 90 ° C.

Plant extract components which had failed during the heat treatment were removed by Centrifugation separated.  

Fig. 14

Investigation of the solution properties and stability of the synthetic Spider silk protein SO1 after ammonium sulfate precipitation.

10 g of leaf material were snap-frozen in nitrogen, ground in a mortar, taken up in 20 ml of crude extract buffer, shaken for 30 min at 38 ° C., and insoluble constituents were removed by centrifugation (30 min. 10,000 rpm). The supernatant (R) was then heated to 90 ° C. for 10 min and the precipitate was removed by centrifugation (30 min. 10,000 rpm). The supernatant (H) was mixed with 20% ammonium sulfate, rolled for 4 h at room temperature and the precipitate was removed by centrifugation for 60 min at 4000 rpm and 4 ° C. The supernatant was adjusted to 30% final ammonium sulfate concentration and rolled overnight at room temperature. The solution was separated into 5 aliquots and the precipitate was removed by centrifugation (60 min. 4000 rpm, 4 ° C.). The supernatants were discarded and the remaining pellets were taken up in the following solutions: R1: crude extract buffer (50 mM Tris / HCl pH 8.0; 100 mM NaCl, 10 mM MgSO ₄ ); S: SDS sample buffer; G: 0.1 M phosphate buffer, 0.01 M Tris / HCl, 6 M guanidinium hydrochloride / HCl pH 6.5; T: 1x PBS, 1% TritonX-100; L: LiBr.

The batches were shaken at 37 ° C for 1 h and became insoluble by centrifugation Components removed (30 min. 10,000 rpm). An aliquot of each batch was then made removed and prepared for SDS gel electrophoresis (R1, S1, G1, T1, L1). The Batches were then left to stand at room temperature for 36 h. By centrifugation insoluble constituents removed (30 min, 10,000 rpm). Again an aliquot of each Approach taken and prepared for SDS gel electrophoresis (R2, S2, G2, T2, L2). Comparable volumes were analyzed in each case.  

Fig. 15

Schematic representation of the construction of gene cassettes for the accumulation of Plasma spider and silkworm synthetic fiber proteins in the transgenic plants.

Fig. 16

Expression of the fiber fusion proteins SM12-HOOK, SO1-HOOK and FA2-HOOK in leaves of transgenic potato plants.

Fig. 17

Gel electrophoretic analysis of the enrichment of bacterially expressed Spider silk proteins after fusion with ELP's. Spider silk protein: 30,000 daltons.

Fig. 18

Western blot analysis of the expression of spider silk-ELP fusion proteins in transgenic tobacco plants. 2.5 µg of total plant protein were separated and the Spider silk proteins detected on the Western blot by ECL. By comparison with the standard is the spider silk protein concentration to at least 4% of the total soluble protein is estimated.

Fig. 19

DNA sequence of SM12-70xELP as a plant expression cassette.

Fig. 20

Protein sequence of SM12-70xELP from plant expression (SM12, c-myc-Tag, 70xELP, KDEL - each identified by paragraph).  

Fig. 21

DNA sequence of SM12-70xELP as an expression cassette for E. coli.

Fig. 22

Protein sequence of SM12-70xELP from bacterial expression (SM12, c-myc-Tag, 70xELP, c-myc-Tag, HisTag - each identified by paragraph).  

SEQUENCE LOG

Claims (36)

1. DNA sequence which codes for a synthetic spider silk protein, characterized in that the DNA sequence is constructed from modules which comprise a group of strung together oligonucleotide sequences, the oligonucleotide sequences coding in each case for repetitive units of spidroin proteins, with the proviso that the protein encoded by the DNA sequence has at least 84%, preferably at least 90%, particularly preferably at least 94% homology to spidroin proteins, in particular to the spidroin 1 protein, particularly preferably to the spidroin 1 protein from Nephila clavipes. 2. DNA sequence according to claim 1, characterized in that the oligonucleotide sequences are selected from the group consisting of:

• a) TATGAGCGCTCCCGGGCAGGGT;
• b) AGCTTTTAGGTACCAATATTAATCTGGCCGGCTCCACC;
• c) TATGGTCTGGGG;
• d) GGCCAGGGTGCTGGCCAA;
• e) GGTGCAGGAGCWGCWGCWGCWGCTGCAGGTGGA;
• f) GCCGGCCAGATTAATATTGGTACCTAAA;
• g) CTGCCCGGGAGCGCTCA;
• h) ACCACCATAACCTCC;
• i) AGCACCCTGGCCCCCCAG;
• j) TGCAGCWGCWGCWGCWGCTCCTGCACCTTGGCC;
• k) TATGAGATCTGGCCAAGGAGGT;
• l) TTGGCCAGATCTCA;
• m) AGTCAGGGTGCTGGTCGTGGAGGCCAA;
• n) TCCACGACCAGCACCCTGACTCCCCAG;
• o) AGTCAGGGCGCTGGTCGTGGGGGACTGGGTGGCCAA;
• p) ACCCAGTCCCCCACGACCAGCGCCCTGACTCCCCAG;
• q) CTGGGAGGGCAGGGAGCGGGCCAA;
• r) CGCTCCCTGCCCTCCCAGACCTCC; and
• s) sequences which have at least 80%, preferably at least 90%, particularly preferably at least 94% sequence identity to sequences a) to r).

3. DNA sequence according to claim 1 or 2, characterized in that the modules comprise at least 4 oligonucleotide sequences. 4. DNA sequence according to one of the preceding claims, characterized in that it is made up of at least 4 modules. 5. DNA sequence according to one of the preceding claims, characterized in that it additionally comprises nucleic acid sequences which are suitable for repetitive units from fibroin proteins, preferably from the fibroin protein of Coding silk spinners. 6. DNA sequence according to one of the preceding claims, comprising one of the in SEQ ID No. 19-29 specified sequences. 7. Recombinant nucleic acid molecule, comprising a DNA sequence after a of the preceding claims and a ubiquitous promoter, preferably the CaMV 35S promoter. 8. The nucleic acid molecule according to claim 7, additionally comprising at least one Nucleic acid sequence encoding a plant signal peptide.   9. nucleic acid molecule according to claim 8, characterized in that the vegetable signal peptide transport in the endoplasmic reticulum (ER) ensured. 10. nucleic acid molecule according to claim 8 or 9, characterized in that the coding for the plant signal peptide Nucleic acid sequence is a LeB4Sp sequence. 11. Nucleic acid molecule according to one of claims 7 to 10, additionally comprising a nucleic acid sequence encoding an ER retention peptide. 12. nucleic acid molecule according to claim 11, characterized in that the ER retention peptide comprises the sequence KDEL. 13. Nucleic acid molecule according to one of claims 7 to 10, additionally comprising a nucleic acid sequence encoding a transmembrane domain. 14. nucleic acid molecule according to claim 13, characterized in that the nucleic acid sequence for the transmembrane domain of PDGF receptor encoded. 15. Nucleic acid molecule according to one of claims 7 to 14, additionally comprising a nucleic acid sequence encoding ELP's. 16. nucleic acid molecule according to claim 15, characterized in that the ELP's comprise from 10 to 100 pentamer units.   17. A nucleic acid molecule according to claim 15 or 16, comprising one of the SEQ ID No. 48 and 50 specified sequences. 18. A vector comprising a recombinant nucleic acid molecule according to one of the Claims 7 to 17. 19. Microorganism containing a recombinant nucleic acid molecule or Vector according to one of claims 7 to 18. 20. Recombinant spider silk protein, encoded by a DNA sequence one of claims 1 to 6. 21. spider silk protein according to claim 20, characterized in that it has a molecular weight in the range of 10 to 160 kDa having. 22. Recombinant spider silk protein, comprising one of those shown in SEQ ID No. 30 to 40 specified amino acid sequences. 23. A method for producing spider silk protein-producing plants or plant cells, comprising the following steps:

• a) production of a recombinant nucleic acid molecule according to one of claims 7 to 17;
• b) transfer of the nucleic acid molecule from a) to plant cells; and
• c) if necessary, the regeneration of fertile plants from the transformed plant cells.

24. Transgenic plant cells containing a recombinant nucleic acid molecule or a vector according to any one of claims 7 to 18, or produced by a method according to claim 23. 25. Transgenic plants containing a plant cell according to claim 24 or produced according to claim 23, and parts of these plants, transgenic crop products and transgenic propagation material of these plants, such as protoplasts, plant cells, calli, Seeds, tubers, cuttings, and the transgenic progeny of these plants. 26. Transgenic plants according to claim 25, selected from the group consisting of from tobacco plant and potato plant. 27. A method for obtaining vegetable spider silk protein, comprising the following steps:

• a) the transfer of a recombinant nucleic acid molecule or vector according to any one of claims 7 to 18 to plant cells;
• b) if appropriate, the regeneration of plants from the transformed plant cells; and
• c) the processing of the plant cells from a) or the plants from b) to obtain vegetable spider silk protein.

28. A method for obtaining recombinantly produced spider silk protein, comprising the following steps:

• a) the transfer of a recombinant nucleic acid molecule or vector according to any one of claims 7 to 18 to cells;
• b) the purification of the spider silk protein by heat treatment of the cell extract and subsequent separation of the denatured cell's own proteins.

29. A method for obtaining recombinantly produced spider silk protein, comprising the following steps:

• a) the transfer of a recombinant nucleic acid molecule or vector according to any one of claims 7 to 18 to cells;
• b) the purification of the vegetable spider silk protein by setting an acidic pH, preferably a pH in the range from 2.5 to 3.5, by adding acid, preferably hydrochloric acid, to the cell extract and subsequent separation of the denatured cell's own proteins.

30. A method for obtaining recombinantly produced spider silk protein, comprising the following steps:

• a) the transfer of a recombinant nucleic acid molecule according to any one of claims 15 to 17 to cells;
• b) the purification of the spider silk protein in the following way:
  • - enrichment of the spider silk-ELP fusion protein by heat treatment of the cell extract;
  • Precipitation of the spider silk-ELP fusion protein by further increasing the temperature, preferably to a temperature of at least 60 ° C., and preferably at a salt concentration of 1 M to 2 M; and
  • Elimination of the ELP fragment, preferably by digestion with CNBr.

31. The method according to any one of claims 28 to 30, characterized in that the cells are selected from plant cells, animal Cells and bacterial cells. 32. Vegetable spider silk protein, produced by a process according to a of claims 27 to 31.   33. spider silk protein according to claim 32, characterized in that it has a molecular weight in the range of 10 to 160 kDa having. 34. Use of the spider silk proteins according to one of claims 20 to 22 or according to claim 32 or 33 for the production of synthetic threads, films and / or Membranes. 35. Use according to claim 34, wherein the threads, foils and / or membrane for medical applications, in particular for suturing wounds and / or as scaffolds or as a cover for artificial organs. 36. Use according to claim 35, wherein the films and / or membrane as Attachment areas for cultivated cells and / or for filtering can be used.