DD297448A5 - FUNGAL EXPRESSION SYSTEM - Google Patents

Abstract

The invention relates to a recombinant DNA molecule coding for a polygalacturonase expression cassette (PG expression cassette) which comprises the structural gene of a PG and / or corresponding regulatory sequences, or hybrid vectors comprising a PG gene-derived DNA as well as being transformed Hosts, especially filamentous fungi, methods for producing these recombinant DNA molecules and transformed hosts and for producing polypeptides by means of said DNA and these hosts, purified single PG of natural or transformed hosts, the production of mixtures of PG, optionally with others Enzymes, and the use of PG or their mixtures in industry {recombinant DNA molecule; Coding for a polygalacturonase expression cassette; Structural gene of a polygalacturonase; Hybrid vectors; transformed hosts; Filamentous fungi; polypeptides; Method; manufacture; Use; Industry}

Description

For this 8 pages drawings

Field of application of the invention

The invention relates to the field of genetic engineering and provides novel DNA molecules comprising DNA sequences encoding polygalacturonase activity proteins and / or the promoter, signal and / or transcription termination sequences which are naturally coupled thereto. The novel DNA molecules are useful in the creation of expression cassettes for the production of polygalacturonases or the expression of foreign genes in filamentous fungi.

-6- 297 448 characteristic of the known prior art

Although in the field of genetic engineering already numerous polypeptide expression systems for prokaryotic and eukaryotic Hosts are known to continue the need for novel systems, which are advantageous over the previous Systems are. Very widespread hosts are the Prokaryot Escherlchia coil and the eukaryotic yeasts, e.g. B. Saccharomyces cerevlslae, for

a large number of different expression hybrid vectors, mostly plasmids, have been developed. The disadvantages of

E. coli hosts are such that they can not glycosylate polypeptides and that the intracellular expression of Foreign peptides can lead to accumulation within the host cell and prevent further growth. The yeasts

glycosylation, but just like E. coil, they secrete the polypeptides, apart from small ones, not into the nutrient medium but into the periplasmic space. Higher eukaryotic hosts, such as mammalian cancer cells, are useful for glycosylation and

Secretion into the nutrient medium is capable, but their cultivation is slow and expensive, and there is a risk that

isolated together with the desired peptide oncogene nucleic acids.

Filamentous fungi, such as Neurospora crassa, Aspergillus nidulans and Aspergillus niger, have also been used to search for other hosts.

examined. Their application in genetic engineering was slower, mainly due to the lack of appropriate

Transformation systems. In contrast to Saccharomyces cerevisiae, filamentous fungi do not contain any plasmids that are suitable for the Introduction of foreign genes and phenotypic selection could be used. However, it is possible to use filamentous fungi Foreign plasmids containing a selectable marker gene to transform. Most previously for filamentous fungi

The vectors described do not replicate autonomously, like the yeasts, but are integrated into the fungal chromosome. This

Event generally occurs at a lower frequency. However, the integrative transformation makes the Transformants are mitotically very stable, even under nonselective conditions. It was about the stable integration of more

reported as a hundred copies.

The first vector described for filamentous fungi contained the qa-2 gene of Neurospora crassa as a selectable marker (Case, M.E. Swiss, M., Kushner, S.R. and Giles, N.H. (1979) Proc. Natl. Acad. Be. USA 76,5259-5263; Case, M.E. (1982) in Genetic Engineering of Microorganisms for Chemicals [Genetic Engineering of Microorganisms for Chemicals] [Hollander, A., De-Moss, D., Kaplan, S., Konisky, J., Savage, D. and Wolfe, R.S., eds.), P.87-100, Plenum). In Aspergillus nidulans, which has a sexual cycle and is therefore accessible to classical genetic manipulation

both negative and positive selection systems have been described (Bailance et al., BBRC112,284,1983; Tilburn et al., Gene 26,205,1983; Yelton et al., PNAS 81,1470,1984; Yelton and Timberlake, J. Cell Biochem. Suppl. 9C, 173) , 1985; Johnstone et al.,

EMBOJ 4, 1307, 1983; Tilburn et al., Gene 26, 205, 1983; Wernarsu.a "Curr.Genet.9,361,1985; Kelly, J.M.u.a., EMBOJ.4,475, Compared with N. crassa or A. nidulans, A. nlger is by far the more important organism, since it is widespread among industrialists Products of enzymes is used, for. For use in the food industry. It is known that A, niger one Series of hydrolytic enzymes secreted, z. Glucoamylase, α-amylase, pectinase, cellulase, β-glucanase, β- Galactosidase, naringinase, pentosanase, acid protease and lignase, with glucoamylase and the pectinase complex

most important are.

A. niger has no known sexual cycle. Therefore, mutations can not be introduced via meiotic recombination. Classical mutation and selection procedures, however, have been found to enhance the secretion of

achieved hydrolytic enzymes.

Of the genes of the A. niger enzymes, only those of glucoamylase (Boel et al., EMBO J. 3,1581,1984) and alcohol and Aldehyde dehydrogenase (WO 86/06097) together with their promoter and signal sequences characterized and in Transformation experiments with A. nidulans and A. niger used. The selection markers for A. nlger were the heterologous amds gene (Kelly and Hynes, EMBO J. 4,475,1985) and the argB gene

(Buxton et al., Gene 37, 207, 1985; EP 184438; WO 86/06097), both of which were obtained from A. nidulans.

A. nlger is the most important organism for the industrial production of pectin degrading enzymes, eg. B. polygalacturonases, Pectin lyases or pectin esterases. Pectins are high molecular weight polygalacturonides (20000-40000 D) made from

a-i / i-glycosidically bound D-Galacturonsäurepolymeren exist. Some of the uronic acid groups are esterified with methanol, which can be cleaved off by pectinesterase. Pectins are found in nature as constituents of higher plants, where they are bound to cellulose molecules, which are found mainly in the primary cell wall and the middle lamella. The richest sources of pectin include lemon and orange peel containing about 30% of this polysaccharide. Pectin enzymes assemble the carbohydrate polymer substrate either by hydrolysis of the α-1,4-glycosidic linkage (endo- and exo-polygalacturonases) or by trans-lemination (pectin lyases) resulting in a saturated and a-4,5-unsaturated poly- or oligogalacturonide. from. The systematic name of endo-polygalacturonase is (poly (1,4-aD-galacturonide)) glycan hydrolase (EC 3.2.1.15) and of exo-polygalacturonase (poly (1,4-aD-galacturonide)) galacturonone hydrolase (EC 3.2.1.67). Another relevant pectin degrading galacturonase enzyme is

Rhamnogalacturonase, which hydrolyzes bonds between α-D-galacturonate and L-rhamnose. While pectin lyases are specific for highly esterified pectins, polvgalacturonases hydrolyze low ester pectins. The combined action of pectin esterases and polygalacturonases can also double-polymerize highly esterified pectins. The use of polygalacturonase and their enzyme mixtures in fruit and vegetable processing (Table 1) has emerged

the original use of pectinone enzymes for the treatment of soft fruits to ensure a high

Yield of juice and pigments during pressing and developed for the clarification of the raw pressed fruits. Technical Enzyme preparations used for such procedures include pectin esterase, polygalacturonases and pectin lyases in

various amounts, together with other enzymes, such as arabinanases, galactanases, xylanases, β-1,4-glucanases,

Glycosidases and proteases. Fungal pectinase preparations containing predominantly endopolygalacturonase and free of pectinesterase become successful

used as macerating enzymes for the production of more fruity nectars, which have a smoother consistency and a higher content of soluble solids, pigments and nutrients than products made by a mecanane thermal process.

Table 1 (from Ref. 32) Use of polygalacturonases and their mixtures in the fruit and vegetable industry Enzymes use Polygalacturonase maceration, stabilization of lemon juice / viscosity reduction Pectinesterase + polygalacturoase

and / or pectin lyase clarifying juices, juice / oil extraction, lemon peel oil,

Washing of citrus pulp pectinesterase / polygalacturonase / pectinase + (hemi) cellulase liquefaction, clear / cloudy juices

Enlargement of natural product extraction Upgrading biomass / feedstock The presence of pectinesterase can easily increase the maceration activity of a pure polygalacturonase Cell break-down activity since the pectinesterase-polygalacturonase combination is a general Has depolymerization activity Through the use of poetic and cellulolytic enzymes, the cell walls of fruit pulp can easily reach up to one Phase of almost complete liquefaction. Essential is the presence of endo- and exo-ß-1,4- Glucanases (cellulases) as well as poetic enzymes (Ref. 31). Polygalacturonase and its enzyme mixtures are also used in the liquefaction and saccharification of biomass,

for example, for the production of termentable polysaccharides from plant cells (Ref. 33) or for the modification of

Pectins (a review in Ref. 32) are useful. Polygalacturonases are also known in association with xylanases Pulp industry, to give just one example (ref. 44). In A. nlger, the proteins of the pectin complex are not constitutively expressed. Under inducing conditions A.

niger using pectin or its decomposition products, the above-mentioned enzymes, if others

Bulk substances, such as glucose or sucrose, are growth-limiting. In surface cultures, the poetic tend Enzymes to stay associated with the outer cell wall. Both Rexovä-Benkovä and Markovic (ref 29) and Rombouts and Pilnik (ref 1i) reveal a number of Polygalacturonases obtained from Aspergillus niger and other fungi as well as from bacterium and plants known as

be described cleaned. However, given no structural data, the need remains

Single polygalacturonases with high specific activity. They should advantageously be sufficiently pure that the determination

their amino acid sequences is possible.

Subsequently, polygalacturonases are also referred to as PG. Object of the invention Objects of the present invention are purified single PGs of natural or transformed hosts. The present invention is based on the purification and the partial structure determination of single PG, z. PGI, II, HIA, IHB, IV,

especially PGI or PGII, allowing the synthesis of DNA probes encoding the relevant parts of the protein.

An object of the present invention is to read and isolate with DNA probes of DNA sequences with the Coding for PGII or PGI, possibly together with pre- and postsequences of the mentioned, from a Genbank of A. niger. Another objective is to further PG-gones by hybridizing parts of the PGII gene (referred to as pgall) or the PGI gene

(designated pgal) with a library of a fungal strain, e.g. B. A. nlger to identify.

Further targets are recombinant DNA molecules encoded for polygalacturonase gene expression cassettes, which include Structural gene of a polygalacturonase, optionally with inconssequences, and / or regulatory sequences of a PG gene, e.g. Promoter, signal and / or transcription terminator sequences. Further recombinant DNA molecules of the For example, the invention includes hybrid vectors which comprise DNA derived from a PG gene of the invention. Other goals are hosts, especially filamentous fungi, z. Aspergillus hosts transformed with these vectors. Methods for producing the recombinant DNA molecules and the transformed hosts and the use of the recombinant DNA molecules for the production of novel expression cassettes or hybrid vectors. An object of the present invention is also the overproduction of PG, for example in Asperglllus species, and the Production of single PGs that are not contaminated by other PG's or their specified artificial mixtures. Another object is the production of any heterologous protein whose structural gene is under the control of

present recombinant PG-DNA can be expressed.

The various objects of the invention will become more apparent from the following detailed description of the invention. Detailed description of the invention The recombinant DNA molecules The present invention relates to a recombinant DNA molecule which comprises a DNA sequence around St selected from

a) the Aspergillus niger DNA insert of pGW1800 or pGW1900,

b) a DNA sequence which hybridizes to the coding region for the mature PGII or PGI encompassed by a DNA insert of a) and which comprises a structural gene for a polypeptide having polygalacturonase activity and optionally a promoter, a coding gene Range for a signal or leader peptide and / or a transcription terminator thereof,

c) a derivative of a DNA sequence as defined in a) or b), or

d) a DNA sequence coding for a mature PG or its signal peptide or leader peptide and degenerate in the sense of the genetic code with respect to a DNA sequence of a), b) or c).

In particular, the invention relates to a recombinant DNA molecule comprising a DNA sequence selected from

a) the AspergillusNlger DNA insert from pGW 1800,

b) a DNA sequence which hybridizes to the coding region for the mature PGII encompassed by the DNA insert of a) and which comprises a structural gene for a polypeptide having polygalacturonase activity and optionally a promoter, a coding region for a signal or leader peptide and / or a transcription terminator thereof,

c) a derivative of a DNA sequence defined in a) or b) or

d) a DNA sequence coding for a mature PG or its signal peptide or leader peptide and which is diereneriert in terms of the genetic code with respect to a DNA sequence of a), b) or c), or a recombinant DNA Molecule comprising a DNA sequence selected from

a) the Asperglllusniger slot of pGW 1900,

b) a DNA sequence which hybridizes to the coding region for the mature PGI encompassed by the DNA insert of a) and which comprises a structural gene for a polypeptide having polygalacturicase activity and optionally a promoter, coding region for comprises a signal or leader peptide and / or a transcription terminator thereof

c) a derivative of a DNA sequence defined in a) or b) or

d) a DNA sequence which codes for a mature PG or its signal peptide or leader peptide and which is degenerate in the sense of the genetic code with respect to a DNA sequence of a), b) or c).

The plasmids pGW1800 and pGW1900 are contained in the E. coli strains JM 109 / pGW1800 and DH5aF / pGW 1900, respectively

the German Collection of Microorganisms and Cell Cultures (DSM).

Polygalacturonase activity polypeptides are also referred to herein as polygalacturonase (PG). This term concludes

also fragments or mutants of the naturally occurring polygalacturonases which have retained their enzymatic activity. The terms polygalacturonase or PG ₁ used herein also include other galacturonases having as substrate an oligo- or polysaccharide having galacturonate, e.g. B. oligogalacturonase, the one

Oligogalacturonate, or rhammogalacturonase, which cuts a copolymer of rhamnose and galacturonate, or

their fragments or mutants that have retained their enzymatic activity. A "leader peptide" is to be understood as a sequence of a prepro-PG that is cleaved during the formation of a mature PG. A "signal peptide" is clipped by the "signal peptidase" in the endoplasmic reticulum in a first step.

For example, a recombinant DNA molecule of the present invention includes asperglomerate DNA insert of

pG W1800 or pG W1900.

The 4.1 kb A. nlger N 400 insert of pGW 1800 (see Figure 2) extends from the XbaI restriction site (maple site 1).

to the EcoRI restriction site (map position 4100). This insert includes the promoter and the

Transcriptional terminator region of the PGII gene pgall and the coding region for prepro-PGil, including the introns. The DNA sequence of the A. nlger insert fragment, which includes pgall, starting at the XbaI site in the approximated one Map position 1 and ending at the Pvull location in approximate map position 3050 shown in Figure 2 became

and is shown in the Sequence Listing under the sequence identification number (SEQ ID NO) 2.

The promoter region of pgall extends to position 1357 of this DNA sequence with the sequence identification number

(SEQ ID NO) 2. The coding region for the prepro PGII leader peptide extends from position 1357 to position

1437. The signal peptide is encoded by nucleotides 1357 to 1419. The coding region for the mature PGII extends from position 1438 to position 2494. This is followed by the transcription terminator region beginning at position 2499.

The 8.6kbp A. nlger N-400 slot of pGW 1900 (see Figure 3) extends from the BamHI location in card position 1 to

to the BamHI location in the approximate map position 8600 shown in FIG. The DNA sequence extending from approximately map position 6280 to about 3880 is shown in the Sequence Listing under SEQ ID NO. 1 given.

The promoter region of the 8.6 kbp insert extends to position 910 of the DNA sequence with SEQ ID NO. 1. The

coding region for the 31 amino acid leader peptide of prepro PGI extends from position 910 to

Position 1002. The signal peptide is encoded by nucleotides 910 to 963. The coding area for the mature PGI begins

at position 1003 and extends up to 2127. The transcription terminator area begins at position 2131.

DNA sequences coding for PGI or PGII derived from the A.nlger N400 inserts of pGW1900 or pGW1800

hybridize under "homologous conditions" with the coding region of the PGI or PGII gene or a fragment of these derived from A. niger N 400. DNA sequences which are at least partially homologous to the

A. niger-N 400 PGI or PGII coding region and encode a protein with PG activity are members of the PG gene family. DNA sequences that are only partially homologous hybridize with the A. niger N 400 PGI or PGII-derived sequences

under so-called "heterologous conditions," which are less stringent than the "homologous conditions." A member of the

PG gene family that hybridizes only under "heterologous" conditions, another PG gene from A.nlger N400 may be used as the PGI gene.

or PGII gene or a PGI, PGII or different PG gene of another PG-producing fungal strain than A.nlger

Be N400. Such fungal strains can be derived, for example, from Aspergillus spec., E.g. A.japonlcus, A.oryzae, A. nldulans, or another A. nlger strain as N400, Trichoderma spec., Botrytis spec., Scletotlnia spec., Fusarlum spec.

or other phytopathogenic fungi as well as yeast, for example of PG-producing Kluyveromyces spec

K.fragilis. A preferred example of such a strain is A. niger NW756. Alsu includes the PG gene family of the invention Genes comprising PGI, PGII, PGIIIA, PGIIIB, PGIV and other PG, preferably from Asperglllus spec, or better still from A. nlger and, if appropriate, derived from the strain N400 or NW756, but also from other PG-producing fungal strains

are. Members of the PG gene family are referred to as "PG genes".

The protein products of the members of the PG gene family include enzymes ("galacturonases"), the oligo- or polysaccharides,

which have galacturonate, can cleave, for. As oligogalacturonase, rhamnogalacturonase or in particular

Polygalacturonase. A conventional hybridization method is z. Benton and Davis (reference 7). In it are homologues and

heterologous hybridization conditions defined in more detail.

When the term "derivative" is used in conjunction with the novel DNA sequences of the present invention, it is meant to be

larger derivatives containing flanking sequences, fragments of these DNA sequences and mutants, especially artificial mutants.

Larger derivatives of the novel DNA sequences are those that can be excised from the A. niger genome,

and they include DNA sequences which hybridize to the coding region for mature PGII or PGI produced by the

Asperglllus nlger DNA insert for pGW 1800 or pGW 1900 are formed, which for a polypeptide with Polygalacturonase activity, and which the same or different promoter, signaling and / or May contain transcription terminator sequences such as the Aspergillus nlger DNA insert of pGW1800 or pGW1900. Such derivatives can be found in a genomic library of A. nlger N400 or NW756 by fragmentation

of the nucleic acids, treatment of the fragments with a suitable restriction enzyme, e.g. EcoRI, BamHI or Hindill,

Ligation into a suitable vector, e.g. As the lambda phage or the plasmid pBR322, cloning in z. B. E.coil and again Excision is made with a suitable restriction enzyme. A preferred example of a derivative of a DNA sequence encoding the coding region of A. niger-N 400-PGI or

PGG gene hybridized under "heterologous" conditions is an insert of a vector or its fragment derived from the

Group of vectors selected from XPG-A9, ^ 10, ^ 43, -84, -835, -836, -01, -016, -016, -020, -037, -08, -011, -012 .

-E6, -E38, -F5, -G17, -G27, -X31 and -Y33, pGW1756 and pGW1910. The latter comprises the structural gene pgaC, which

A. nlger N 400 PGC, derived from XPG-C20. pGW 1766 (Figure 6) comprises the A. nlger-NW756-derived gene encoding a Restriction pattern and a DNA sequence (see SEQ ID NO. 3), which differ from that of the A. nlger N400 PGII gene

differ. The strains NW756 and NW400 are therefore not closely related and could be too different

Species of the filamentous fungi belong. Accordingly, the A.nlger N400 PGI or PGII structural gene may be heterologous Conditions also specifically hybridize with PG genes of other species. Plasmid pGW 1756 is composed of an approximately 4000 bp pEMBL 18 vector fragment and an approximately 5 500 bp A. nlger fragment. NW756 DNA fragment together. The PGII-encoding gene pgall is located in an about 3300 bp long Hincll Restriction fragment. pGW 1756 was deposited with the DMS. The promoter region of A. niger NW756 pgall extends before nucleotide 889 in the DNA sequence of SEQ ID NO. 3, the in

the sequence listing is given. The coding region for the leader peptide, prepro PGII, presumably extends from position 890 to position 970, while the signal peptide is encoded by nucleotides 890 to 952. The coding

Range for the mature protein begins with nucleotide 971, ends with the stop codon at position 2028 and presumably contains

an intron. The coding region is followed by the transcription terminator region beginning at position 2031.

Plasmid pGW1910 (Fig. 7) consists of an approximately 7800bp insert derived from XPG-C20, and from the Vector pUC9. In the A. nlger N 400 insert the polygalacturonase gene pgaC is located. The DNA sequence of approximately the

Whole pgaC gene is shown in the Sequence Listing under SEQ ID NO. 4 given.

The promoter of A. nlger-N 400 pgaC is located before nucleotide 663. The leader peptide of prepro-PG which encodes pgaC

presumably extends from nucleotide 663 to 782 and includes the DNA sequence from 663 to 710, which includes the

Signal peptide encoded. The mature PG is encoded by the sequence extending from nucleotide 738 to 1995 and several Including introns. The transcription terminator area starts after the stop codon in position 1999. Derivatives of hybridizing DNA sequences encompassed by the present invention include

same promoter, signal and / or transcription terminator sequence as in pGW1800 or as in pGW 1900 or another

Promoter, signal and / or transcription terminator sequence derived from another gene of the polygalacturonase gene family

can be derived. In addition, depending on the host in which the desired PG is to be expressed, any other promoter, signal and / or transcription terminator sequence may be added to the hybridizing DNA sequences.

A wide variety of promoters, signal sequences and transcription terminators can be used. promoters

are generally available from O'-non-coding regions of prokaryotic, eukaryotic or viral genes, while transcription terminators are available from 3'-non-coding regions. Signal sequences can be obtained from the 5 'coding regions of preproteins which are introduced into the secretory pathway of the cell.

Examples of promoters are given below. In the context of the present invention, a signal sequence is a DNA sequence which is a signal peptide or a Leader peptide of a prepro-PG of the invention encoded. Flanking sequences within the meaning of the invention are also DNA fragments which have not been derived from sequences which

flank a PG gene in the genome. These flanking sequences have, for example, regulatory functions, e.g. a

Promoter function, or they encode a polypeptide, e.g. A structural gene, or they are linkers, which regulatory sequences and Place structural gene in the correct reading frame or distance, or sequences derived from a vector, e.g. As a phage or Plasmid used in the construction of an expression plasmid. Such flanking Sequences can lead to the formation of expression cassettes or fusion genes. If the term "fragment" is used in connection with the novel 'jNA, it should be understood that fragments of

larger derivatives are included, especially those which promoter, signal, or structural

Preserve transcription terminator functions. You can extend between two restriction sites. Preferred DNA fragments are those containing a promoter region, a leader or signal peptide of a prepro-PG

encode or encode a polypeptide having polygalacturonase activity or contain a transcriptional terminator region.

Accordingly, the one DNA sequence of the invention which contains any combination of these fragments, e.g. For example,

which contain a promoter and / or a coding region for a leader or signal peptide and / or for a PG and / or a transcription terminator and the like.

A fragment comprising a PG promoter region extends in the DNA sequence before a prepro PG structural gene to

at about 2000, preferably up to about 500 to 1400 nucleotides upstream. A promoter region binds RNA polymerase as well as regulatory proteins.

A fragment comprising a promoter region of the PGI gene pgal extends, for example, from position 1 to Position 909 of the sequence with SEQ ID NO. 1. A fragment containing a promoter of the PGII gene pgall from A. niger N400

includes, for example, from position 1 to position 1356 of the sequence of SEQ ID NO. 2. In an A. nlger NW756 insert of pGW1756, a fragment comprising the promoter region of pgall, for example, from position 1 to position 889 of the sequence having SEQ ID NO. 3. In the A. niger insert of pGW 1910, a fragment comprising the promoter region of pgaC extends from position 1 to position 662 of the sequence of SEQ ID NO. 4. A fragment containing the DNA sequence coding for a leader peptide of a prepro-PG, for example, extends between the end of the promoter and the beginning of the sequence encoding mature protein. A coding region for a signal peptide is shorter than that for the corresponding leader peptide. It also begins at the end of the promoter and extends to a coding region for a signal peptidase cleavage site. In an A. niger N 400 prepro PGII, the leader peptide comprises 27 amino acids. For example, a DNA fragment encoding the leader peptide extends from the ATG coon at position 1357 to the Xho I cleavage site at position 1429 of the DNA sequence of SEQ ID NO. 2. In prepro PGI, the leader peptide has 31 amino acids. For example, a DNA fragment coding for this leader peptide extends between positions 910 and 1002 of the DNA sequence of SEQ ID NO. 1. The leader peptide of A. nlger NW756 prepro PGII is thought to have 27 amino acids, and thus the DNA fragment encoding the leader peptide is the 81 bp DNA fragment located between positions 889 and 971 in the DNA sequence having SEQ ID NO. 3 extends. The DNA fragment encoding the presumably 40 amino acid leader peptide of the A. niger N400 pgaC gene product extends from base position 663 to 782 of the sequence of SEQ ID NO. 4. The coding regions for the corresponding signal peptides are, for example, on the following DNA fragments: Base positions 911 to 963 in SEQ ID NO. 1,1358 to 1419 in SEQ ID NO. 2,890 to 962 in SEQ ID NO. 3 and 663 to 710 in SEQ ID NO. 4th

For example, a fragment comprising the entire coding region for the mature PGI extends from position 1003 to position 2127 of the sequence of SEQ ID NO. 1. A fragment comprising the entire coding region for the mature A. niger N 400 PGII extends, for example, from position 1430 to 2497 of the sequence having the SEQ ID NO. 2. Mature A.nlgar-NW756-PGII is encoded, for example, by the DNA fragment which extends from position 953 to 2027 of the sequence of SEQ ID NO. 3, and the mature pgaC gene product is encoded, for example, by the DNA fragment extending between bases no. 782 and 1996 of the sequence with the SEQ ID NO. 4 extends. But even shorter fragments can encode polypeptides that retain PG activity.

The structural genes of PGII or PGI as well as other PGs, like many fungal genes, may contain introns. However, the scope of the present invention also includes intron-free structural genes of PG, e.g. those that do not contain introns as a genomic DNA sequence or even those that can be obtained from cDNA.

For example, a fragment comprising a transcription terminator region extends from a stop codon, e.g. As TAA, TAG or TGA, at the end of the coding region for a PG, up to about 300 to 2000, preferably up to about 500 to 1000 base pairs downstream.

Such a fragment extends, for example, from base position 2131 to 2495 of the sequence of SEQ ID NO. 1, from 2498 to 3031 in the sequence of SEQ ID NO. 2, from 2031 to 3047 in the sequence of SEQ ID NO. 3 and from 1999 to 2304 in the sequence with the SEQ ID NO. 4th

However, the above-mentioned fragments may be extended by the naturally 5 'flanking sequences, or they may be truncated at the 5' or 3 'end and yet retain their promoter or transcriptional terminator activity, or the encoded polypeptides may be signal peptide or galacturonase Keep activity. These fragments are also included in the scope of the invention.

The aforementioned fragments may contain linkers or be flanked by linkers which provide for successful coupling to other DNA molecules and / or DNA fragments having regulatory functions or coding for a polypeptide, e.g. As promoter and structural gene, in the correct reading frame or distance can bring.

Suitable linkers for the above-mentioned fragments have a DNA sequence which fits into the restriction site of the DNA with which the fragment is to be coupled. They may contain a predetermined site of restriction. Mutants of a DNA sequence of the invention are e.g. B. naturally occurring mutants. The invention also encompasses natural or synthetic co-domain mutants for the signal or titer peptides having a similar or identical hydrophobicity profile, e.g. For example, those in which the codons for the polar amino acids histidine (H ⁶⁺ ), tyrosine (Y ⁹ ') and arginine (R ⁵⁺ ) are replaced by codons for other amino acids with similar charges, and the hydrophobic amino acids alanine (A ), Leucine (L) and (T) threonine are replaced by codons for other hydrophobic amino acids. For example, the codon for the positively charged lysine can be replaced by a codon for arginine and vice versa, the codon for the negatively charged tyrosine by a codon for glutamate or aspartate and / or the codon for the nonpolar, hydrophobic alanine by one of the codons for Threonine, proline, valine, isoleucine, leucine, methionine or phenylalanine and the like. A recombinant DNA molecule of the invention comprises cloth DNA sequences that are degenerate in the sense of the genetic code such that an infinite number of nucleotides are replaced by other nucleotides without altering the amino acid sequence which they encode. Such degenerate DNA sequences may be useful because of their different restriction sites or preferred codon usage in a particular host.

A recombinant DNA molecule of the present invention preferably comprises the Aspergillus nlger DNA insert of a hybrid vector selected from the group of hybrid vectors consisting of pGW1800, pGW1900, pGW1756, pGW1910, XPG-A9, XPG-A10, XPG- A43, XPH-B4, XPG-B35, APG-B36, XPG-C1, XPG-C16, XPG-C20, XPG-C37, XPG-D8, XPG-D11, XPG-D12, XPG-E6, XPG-E38, XPG-F5, XPG-G17, XPG-G27, XPG-X31 and XPG-Y33 or a fragment thereof comprising a promoter region of a PG gene, or a coding region for a signal peptide, leader peptide, prepro-PG, PG or a fragment of a PG with polygalacturonase activity or a transcriptional terminator region sinos PG gene. The inserts themselves are also covered by the present invention.

The invention also relates to recombinant DNA molecules which are expression cassettes comprising a promoter region, a DNA fragment encoding a leader or signal peptide, a structural gene and / or a transcriptional terminator region of the invention, preferably those derived from a vector which was selected from the above group of vectors

 By the term "expression cassette" is meant a DNA sequence capable of expressing a polypeptide

and a promoter, optionally a signal sequence, also a structural gene, optionally a transcription terminator and optionally a transcriptional enhancer, ribosomal binding site and / or further regulatory sequences. In an expression cassette of the invention, the PG gene-derived functional fragments can be combined with functional fragments derived from other genes.

A wide variety of promoter sequences can be employed depending on the nature of the host cell. Most useful are promoters that are strong and well regulated at the same time. Sequences for the initiation of translation are, for example, Shine-Dalgarno sequences. Sequences which are necessary for the initiation and termination of transcription and for the stabilization of the mRNA are generally composed of the non-coding 5'-regions or 3'-regions of viral or eukaryotic cDNA, e.g. B. from the expression host available.

Examples of promoters are AP _L , XPr, E. coli coli, trp, tac, yeast TRP 1, ADHI, ADHII, PHO 3, PHO 5 or glycolytic promoters, such as the promoter of enolase, glyceraldehyde-O phosphate dehydrogenase, 3-phosphogrycerate kinase (PGK), hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-e-phosphate isomerase, S-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase genes, or promoters derived from eukaryotic viruses, e.g. SV40, Rous sarcoma virus, adenovirus 2, bovine papilloma virus, papovavirus, cytomgalovirus-derived promoters, or mammalian cell-derived promoters, e.g. As the actin, collagen, myosin or ß-globin gene. The eukaryotic promoters can be combined with enhancing sequences, such as yeast upstream activating sequences (UAS), or viral or cell enhancement elements, such as the cytomegalovirus IE enhancer elements, SV40 enhancer, immunoglobulin amplification elements, or others. Enhancers are transcription-stimulating DNA sequences, the z. Derived from viruses such as simian virus, polyoma virus, bovine papilloma virus or Moloney sarcoma virus, or of genomic origin. An enhancer sequence can also be derived from the extra chromosomal ribosomal DNA of Physarum polycephalum (PCT / EP 8500278), or it can be the upstream activating site of the acid phosphatase PHO 5 gene (EP ApI No. 86111820.6) or the PHO 5, trp , PHO5-GAPDH hybrid (EP Appl. No. 86111820.6) or a similar promoter. Signal sequences may be, for example, a pre-sequence or a secretory leader element that direct secretion of the polypeptide, or the like. A signal sequence is, for example, a signal or a leader peptide of prepro PGI, propro PGII or prepro PGC. Further signal sequences are known from the literature, for. For example, that of Heijne, G., Nucleic Acids Res. 14,4683 (1986).

Structural genes in this context, in addition to those coding for PGI or PGII, include those coding for other PGs or derivatives, in particular fragments, PG activity or other Aspergillus genes and structural genes originating in viruses, prokaryotic cells or eukaryotic genes Have cells and that can be derived from genomic DNA or cDNA which have been prepared via the mRNA route or can be synthesized chemically, with the coding for a wide variety of useful polypeptides, including glycosylated polypeptides, especially higher eukaryotic, especially Mammalian, animal or, more particularly, human origin, such as enzymes which can be used, for example, for the production of foods and for the performance of enzymatic reactions in chemistry, or polypeptides which are useful and valuable for the treatment of human and animal diseases or f r are the prevention, for example, hormones, polypeptides with immunomodulatory, anti-virus and Antitumoreigenschafton, antibodies, virus antigens, vaccines, clotting factors, foodstuffs and the like. Examples of such structural genes are, for. Hormone coding such as secretin, thymosin, relaxin, calcitonin, luteinizing hormone, parathyroid hormone, adrenocorticotropin, melanocyte stimulating hormone, β-lipotropin, urogastrone or insulin, growth factors such as epidermal growth factor, insulin-like growth factor (IGF), e.g. , IGF-I and IGF-I), mast cell growth factor, nerve cell growth factor, glial derived nerve cell growth factor, or transforming growth factor (TGF) such as TGFβ, growth hormones such as human or bovine growth hormone, interleukin such as interleukin-1 or -2, human macrophage migration inhibitory factor ( MIF), interferons, such as human α-interferon, for example interferon-aA, -aB, -aD or aF, β-interferon, y-interferon or a hybrid interferon, for example a ciA-aD or aB-aD hybrid interferon, especially the hybrid interferon BDBB, proteinase inhibitors such as a, antitrypsin, SLOI and the like, hepatitis virus antigens such as the hepatitis B virus surface or core antigen or the hepatitis A viral antigen or the hepatitis non-A non-B Antigens, plasminogen activators, such as tissue plasminogen activator or urokinase, tumor necrosis factor, somatostatin, renin, beta-endophin, immunoglobulins, such as the light and / or heavy Ke of immunoglobulin D, E or G, or human-mouse hybrid immunoglobulins, immunoglobulin binding factors such as immunoglobulin E-binding factor, calcitonin, human calcitonin-related peptide, blood coagulation factors such as factor IX or VIIIc, erythropoietin, eglin such as eglin C, hirudin, desulfathirudin, such as desulfathirudin variant HV1, HV2 or PA, human superoxide dismutase, virus thymidine kinase, β-lactamase, glucose isomerase. Preferred genes are those coding for a human alpha interferon or hybrid interferon, especially hybrid interferon BDBB, human tissue plasminogen activator (t-PA), hepatitis B virus surface antigen (HBVsAg), insulin-like growth factors I and II, eglin C and desulfathirudin, e.g. B. Variant HV1. In the hybrid vectors of the present invention, the present promoter and / or signal sequence is operably linked to the polypeptide coding region so as to ensure the effective expression of the polypeptide. The invention also relates to recombinant DNA molecules which are recombinant vectors, also referred to as hybrid vectors, comprising a DNA sequence selected from t

a) the Aspergillus nlger DNA insert of pGW 1800 or pGW 1900,

b) a DNA sequence which hybridizes to the coding region for the mature PGII or PGI encompassed by a DNA insert of a),

c) a derivative of a DNA sequence defined in a) or b) or

d) a DNA sequence of a), b) or c), which encodes a mature PG or its signal peptide or leader peptide and which is degenerate within the meaning of the genetic code.

They are useful for cloning and / or expression in hosts such as bacterial, fungal or animal cells. These hybrid vectors can be derived from any vector useful in the field of genetic engineering, such as viruses, Phages, cosmids, plasmids or chromosomal DNA, such as the derivatives of SV40, herpesviruses, papillomaviruses, retroviruses,

Baculovirus, phage λ, e.g. NM 939 or EMBLM, or phage M13, e.g. M13mp8 phage DNA (Ref. 15), linearized by BamHI digests, bacterial plasmids, ζ. PBR322, pUC 18, or yeast plasmids, e.g. Yeast 2μ plasmid or chromosomal DNA, e.g. derived from filamentous fungi such as Asperglllus spec, e.g. A.niger, for example those described by EP 184438, or a defective virus, phage or fiasmid in the presence of a helper virus, phage or plasmid, which allows the replication of defective virus, phage or plasmid, z. B. M13 (+) KS vector in the presence of e.g. an M14KO7 helper phage · »

The hybrid vectors of the invention allow replication and optionally expression of a desired DNA in a suitable host, either as an extrachromosomal element or by integration into the host chromosome. Various possible vector systems are available for the integration and expression of the cloned DNA of the invention. In principle, all vectors which replicate and / or express a desired polypeptide gene contained in an expression cassette of the invention in the chosen host are suitable. The vector is selected depending on the host cells intended for transformation. In general, these host cells may be prokaryotic or eukaryotic microorganisms, such as bacteria, piires, yeasts or filamentous fungi, or cells of higher eukaryotic origin, such as vertebrate cells, ζ. B. mammalian cells. Suitable host cells are discussed in detail below. In principle, the hybrid vectors of the invention comprise the DNA as defined above, an origin of replication or an autonomously replicating sequence, dominant marker sequences, optionally expression control sequences essential for the transcription and translation of the desired DNA and optionally for the secretion of the desired product and optionally additional restriction sites.

An origin of replication or an autonomously replicating sequence (a DNA element that confers autonomous replication capability on extrachromosomal elements) is either by such a construction of the vector that it has an exogenous origin, such as the Simian virus (SV40) or a derived from other virus source, or created by chromosomal mechanisms of the host cell.

A hybrid vector of the molecules of the present invention may contain selective markers depending on the host to be transformed, selected and cloned. Any marker gene can be used which facilitates the selection of transformants due to the phenotypic expression of the marker. Suitable markers are especially those which antibiotic Resistors: express, z. Against tetracycline or ampicillin, or in auxotrophic fungal mutants, genes that complement host damage. Corresponding genes, for example, confer resistance to the antibiotic cycloheximide or provide prototrophy in an auxotrophic yeast mutant, for example the ure 3, leu 2, hls3 or trp 1 gene. It is also possible to use as structural markers structural genes associated with an autonomously replicating segment, provided that the host to be transformed is auxotrophic for the product expressed by the marker. Of particular interest are marker genes that complement A. nlger host damage, such as the argB gene encoding ornithine carbamoyl transferase, e.g. Derived from A. nlger or A. nidulans (EP 184438) or A. nidulans DNA fragments that are homologous to the N.crassa pyr4 gene (Ref. 27).

Preferred embodiments of the present invention are hybrid vectors comprising an expression cassette of the invention, e.g. Those comprising the structural gene and / or the promoter and / or the DNA sequence coding for a leader or signal peptide and / or the transcription terminator derived from a PG gene of the invention. Examples of hybrid vectors comprising an expression cassette of the invention are pGW 1800, pGW1900, pGW1910, pGII-IFNAMmpGlsss-IFNAmigig.pGWyee, XPG-AIO, XPG-A43, XPG-D8 and XPG-D11.

The subject of the invention is not only a recombinant DAN molecule comprising a PG-derived insert as defined above, but also a DNA molecule comprising a PG gene or a functional fragment thereof; eg those comprising a promoter, the coding region for a signal peptide, leader peptide or a protein having PG activity, or the transcriptional terminator region itself, which can be isolated from a PG-producing fungal strain, e.g. B. AsperglUus »{wc, for example, A. japonlcus, A. oryzae, A. nidulans, A. niger, Trlchoderma spec, Botrytls spec, Sclerotinla spec, Fusarlum spec or other phytopathogenic fungi and yeast, such as PG-producing Kluyveromyces spec, like K.fragills. Preference is given to DNA molecules isolated from A. nlgor.

The DNA molecules of the invention and their derivatives, including the fragments, can be used to read DNA gene banks or mRNA for other similar DNA or mRNA.

Process for the preparation of recombinant DNA molecules Another object of the invention is a method for the production of a recombinant DNA molecule as described above

which comprises cultivating a host transformed with such a recombinant DNA molecule, or producing it by an in vitro synthesis.

The breeding of the hosts takes place in a conventional nutrient medium, supplemented with chemical compounds or the

chemical compounds that allow the negative or positive selection of the transformants,

d. h., The hosts containing the desired DNA molecule together with a selection marker, from the

Non-transformants, i. the hosts lacking the desired DNA molecule. Any suitable 'transformable host in this field can be used, e.g. B. bacteria, such as E. coil. Mushrooms, like Aspergillus, e.g. A. nidulans, A. oryzaa, A. carbonar lus, A. awarori and especially A. nlger. A preferred host is A. nlger an 8,

a mutant lacking the pyrA gene, as described below, or A. nlgar N 593. Host transformation is by conventional methods.

A DNA sequence contained in a recombinant DNA molecule of the invention may be derived from the genome of a

or can be prepared, for example, by cultivating a host which can be transformed with a recombinant DNA molecule of the invention and, if necessary, isolated from this desired DNA sequence, or by chemical synthesis by nucleotide condensation.

In particular, these DNA can be prepared by

a) Isolation of genomic DNA from suitable fungal cells and selection of the desired DNA, e.g. Using a DNA probe or using a suitable expression system and reading for expression of the desired polypeptide, or

b) Isolation of mRNA from appropriate fungal cells, selection of the desired mRNA, e.g. by hybridization with a DNA probe or by expression in a suitable expression system and reading after expression of the desired polypeptide, production of single-stranded cDNA which is complementary to this mRNA, then double-stranded cDNA therefrom, or

c) isolating cDNA from a cDNA library and selecting the desired cDNA, e.g. Using a DNA probe or using a suitable expression system and reading after expression of the desired polypeptide, and / or

d) incorporation of the double-stranded DNA from step a), b) or c) into an appropriate vector,

e) transformation of suitable host cells with the obtained hybrid vector,

f) selecting transformed host cells containing the desired DNA from untransformed host cells and replicating the transformed host cell and, if necessary,

g) isolating the desired DNA and / or converting the DNA into one. Mutants or its fragment.

Genomic DNA can be isolated and assayed for the desired DNA (step a). Genomic DNA is isolated from suitable fungal strain expression proteins with PG activity. From this, a genomic DNA library is prepared by digestion with suitable restriction endonucleases and incorporation into suitable vectors by known methods. The genomic DNA library is probed with a DNA probe, as described later, or expressed in a suitable expression system, and the resulting polypeptides tested in a conventional manner. A detailed description of the isolation of a DNA molecule of the invention from a genomic library is given below. Polyadenylated messenger RNA (step b) is isolated from the appropriate cells by known methods. The isolation methods include, for example, homogenization in the presence of a detergent and a ribonuclease inhibitor, e.g. Heparin, guanidinium isothiocyanate or mercaptoethanol, the extraction of the mRNA with suitable chloroform-phenol mixtures, optionally in the presence of salt and buffer solutions, detergents and / or cation chelating agents, and precipitating the mRNA from the remaining aqueous, salt-containing phase with ethanol, isopropanol or similar one. The isolated mRNA can be further purified by centrifugation in a gradient of cesium chloride, followed by ethanol precipitation, and / or by chromatographic methods, e.g. As affinity chromatography, for example chromatography on OligofdT j-cellulose or oligo (U) -Sepharose. Preferably, this purified total mRNA will be size-cen- trifuged by gradient, e.g. in a linear sucrose gradient, or by chromatography on suitable size fractionation columns, e.g. B. on agarose gels, fractionated.

The desired mRNA is selected by directly assaying the mRNA with a DNA probe or by translation into appropriate cells or cell-free systems and assaying the recovered polypeptides.

Selection of the desired mRNA is preferably achieved using a DNA hybridization probe, thereby avoiding the extra step of translation. Suitable DNA probes are DNA of known nucleotide sequence consisting of at least 17 nucleotides, for example synthetic DNA, cDNA derived from mRNA encoding the desired polypeptides, or genomic DNA fragments, e.g. B. include adjacent DNA sequences isolated from a natural source or from a genetically engineered microorganism. Synthetic DNA probes are symbolized by known methods, as described in more detail below, preferably by stepwise condensation using the solid phase phosphotriester, phosphite triester or phosphoramidite method, e.g. For example, the condensation of dinucleotide coupling moieties by the phosphotriester method. These methods are adapted to the synthesis of mixtures of the desired oligonucleotides by using mixtures of two, three or four nucleotides dA, dC, dG and / or dT in protected form or the corresponding dinucleotide coupling units in the appropriate condensation step as described by Y. Ike et al (Nucleic Acids Research 11,477,1983).

For hybridization, the DNA probes are labeled, e.g. B. radiolabeled by the well-known kinase reaction. The hybridization of size-fractionated mRNA with DNA probes containing a label is carried out according to known methods, ie in buffer and saline solutions containing additives, e.g. Calcium chelating agents, viscosity regulating compounds, proteins, non-homologous DNA and the like, at temperatures which favor selective hybridization, e.g. B. between O ⁰ C and 80 ° C, for example between 25 ⁰ C and 50 ⁰ C or around 65 ° C, preferably at about 20 ° C below the double-stranded hybrid DNA melting temperature.

Fractionated mRNA can be expressed in cells, e.g. As frog oocytes, or in cell-free systems, eg. B. in Raticulocytlysate or wheat germ extracts are translated. The recovered polypeptides are assayed for enzymatic activity or for reaction with antibodies raised relative to the native polypeptide, e.g. As in an immunoassay, tested, for example, radioimmunoassay, enzyme immunoassay and immunoassay with fluorescent markers. Such immunoassays and the production of polyclo-and monoclonal antibodies are well known in the art and are used accordingly.

The production of a single-stranded complementary DNA (cDNA) from the selected mRNA template is well known in the art, as is the preparation of a double-stranded DNA from a single-stranded DNA. The mRNA template is treated with a mixture of deoxynucleoside triphosphates, optionally radioactively labeled deoxynucleoside triphosphates (to be able to test the result of the reaction), a starter sequence such as an oligo-dT residue linked to the poly (A ) Tail of the mRNA, and a suitable enzyme, such as a reverse transcriptase, e.g. From the avian myeloblastosis virus (AMV). After degradation of the template mRNA, e.g. By alkaline hydrolysis, the cDNA is incubated with a mixture of deoxynucleoside triphosphates and a suitable enzyme to give a double stranded DNA. Suitable enzymes include, for example, a reverse transcriptase, the Klenow fragment of E. coli DNA polymerase I or T4 DNA polymerase. As a rule, a hairpin loop structure,

which is formed spontaneously from the single-stranded cDNA, as a starter for the synthesis of the second strand. This hairpin structure is removed by digestion with S1 nuclease. Alternatively, the 3'-end of the DNA einzelsträngiyen is extended by homopolymeric Deoxynucleotidschwänze before the hydrolysis of the mRNA template and subsequent synthesis of the second cDNA St ^r anges first.

In the alternative, double-stranded cDNA is isolated from a cDNA library and assayed for the desired cDNA (step c). The cDNA library is constructed by isolating mRNA from appropriate cells and preparing these single-stranded and double-stranded cDNAs as described above. This cDNA is digested with appropriate restriction endonuclease and incorporated into a λ phage, e.g. λ Charon 4A or Xgt 11 using the conventional methods. The cDNA library replicated on nitrocellulose membranes is assayed using a DNA probe as described above or expressed in an appropriate expression system, and the recovered polypeptides are assayed for rr '. an antibody specific for the desired compounds.

A variety of methods for the inclusion of double-stranded cDNA or genomic DNA in an appropriate vector are known in the art (step d). For example, complementary homopolymer tracts may be added to the double-stranded DNA and the vector DNA by incubation in the presence of the corresponding deoxynucleoside triphosphates and an enzyme such as terminal deoxynucleotidyltransferase. The vector and double-stranded DNA are then joined by base pairing between the complementary homopolymeric ends and finally ligated by specific joining enzymes, such as ligases. Other possibilities are the addition of synthetic linkers to the ends of the double-stranded DNA or the inclusion of the double-stranded DNA in the vector by ligating blunt or staggered ends. Appropriate vectors are discussed in detail below.

The transformation of the appropriate host cells with the recovered hybrid vector (step e) and the selection and amplification of the transformed host cells (step f) are well known in the art. Examples of these methods are given below. Hybrid vectors and host cells may be particularly suitable for the production of DNA or for the production of otherwise desired polypeptides.

The isolation of the desired DNA, of the mutants and fragments according to the invention is carried out according to the known in the art mothodes, for. B. by extraction with phenol and / or chloroform. Optionally, the DNA can be further manipulated, eg. By treatment with mutagenic agents to make mutants, or by digesting with restriction enzyme enzymes to obtain fragments, to modify one or both termini to facilitate inclusion in the vector, to eliminate intervening sequences, and the like.

The nucleotide sequence of a DNA according to the invention can be determined by the known methods, e.g. For example, according to the Maxam-Gilbert method, which works with end-labeled DNA, or according to the Dideoxykettenterminationsmethode of Sanger. PG gene sequences of the present invention may also be prepared by in vitro synthesis by conventional methods. The in vitro synthesis can be used especially for the preparation of small fragments of a PG expression cassette, e.g. The DNA sequences of a PG gene coding for a promoter or a signal peptide, for example the PGI, PGII or pgaC gene, of a PG gene expressed in a DNA molecule as defined above was contained, in particular in the λ clones or a mutant thereof.

Suitable methods for the synthesis of DNA have been summarized by S.A. Narang (Tetrahedron 39, 3, 1983). The known synthesis methods allow the preparation of polynucleotides up to 120 bases in length, with good yield, high purity, and in a relatively short time. Suitably protected nucleotides are conjugated with each other according to the phosphodiester method (KL Agarwal et al., Angew. Chemie 84, 489, 1972), the more effective phosphotriester methoxy (CB Resse, Tetrahedron 34, 343, 1972), the phosphite triester method (RL Letsinger et al., J. Am. Chem Soc., 98, 36565, 1976) or the phosphoramidite method (SL Beaucage and MH Curruthers, Tetrahedron 22, 1859, 1981). The simplification of the synthesis of the oligonucleotides and polynucleotides is made possible by the solid phase method in which the nucleotide chains are attached to a suitable polymer. H. Rink u. a. (Nucl. Acids Research 12, 6369, 1984) use trinucleotides instead of single nucleotides and join them by the phosphotriester method in solid phase synthesis. In this way, a polynucleotide can be prepared in a short time and in good yield. The actual double-stranded DNA is prepared enzymatically from chemically produced, overlapping oligonucleotides from both strands of DNA, which are held together in the correct arrangement by base pairing and then chemically linked by the enzyme DNA ligase.

Another approach involves incubation of overlapping single oligonucleotides from the two DNA strands in the presence of the four required deoxynucleoside triphosphates with a DNA polymerase, e.g. DN A polymerase I, the 'Klenow fragment of polymerase I or T% DNA polymerase, or with an AMV reverse transcriptase (avian myeloblastosis virus reverse transcriptase). The two oligonucleotides are thereby held in the correct alignment by base pairing and supplemented with the required nucleotides by the enzyme to give a complete duplex DNA (S.A. Narang et al., Anal. Biochem., 121, 56, 1952).

Hereinafter, the production of a recombinant DNA molecule of the present invention from a genomic library and homologous and heterologous hybridization conditions for the identification of the members of the PG gene family will be described in more detail.

A genomic library can be made e.g. By partially digesting the genomic DNA of an A. nlger strain, eg, NW756 or N401) with, for example, Sau3AI or Mbol and cloning the high molecular weight DNA fragments into a suitable host vector, e.g. the E. coli plasmid pUB121 or a lambda filter, e.g. B. EMBLA4. Other fungal strains producing the desired PG, e.g. Aspergillus sp., Ζ. BA japonlcus, A.orvzae, A. nldulans, A. niger, Trlchoderma spec., Botivtls spec, sclerotin. »Spec, Fusarlum spec., Or other phytopathogenic fungi, as well as yeast, for example PG-producing Kluyveromycea spec., Such as K. fragilis. may serve as source for the genomic library, and other suitable vectors, e.g. As the above, can be used as recipients for the fragments. In order to be able to successfully test the genome bank for D ₁ JA sequences encoding the PG, a hybridizing DNA probe is necessary. This may be a synthetic DNA probe if the amino acid sequence or part of it is known for the desired PG, or another PG gene or its part that hybridizes to the desired PG gene. Since prior to the invention, neither a PG sequence nor a PG gene or its part were known, the problems of purification of PG, structure determination of the N-terminal sequence of a PG and production of useful DNA probes were first solved.

For the purification of the present PG any source in which they are contained can be used. For example, crude sources, such as the enzyme mixtures derived from Aspergillus niger, such as Rapidase®, a commercially available mixture of pectinolytic enzymes, can serve as a source.

The cleaning is carried out by conventional cleaning methods, such as salting out, desalting, reprecipitation in the form of a different salt, chromatography, z. B. affinity chromatography, such as on a crosslinked alginate, ion exchange chromatography, e.g. On a DEAE Sephadex or Sepharose column, gel permeation chromatography, e.g. On a Sephacryl column, electrophoresis, e.g. With SDS-polyacrylamide gel, isoelectric focusing, and the like, or any combination thereof.

In the present invention, PGI, PGII, PGIIIA, PHIIIB and PGIV were isolated in pure form from rapidase. The PGs mentioned are endo-polygalacturonases (EC 3.2.1.15) with the following physicochemical properties: PGI has a Mr value of 55 K, an isoelectric point (IEP) between 3.2 and 3.5, and a pH value. Optimum for the enzymatic activity of 4.9. The values for PGII are Mr of 38K, IEP between 4.6 and 5.9, pH optimum of 4.8; PGIIIA has the values of Mr equal to 57 K, IEP of 3.3, and pH optimum of 4.3; PGIIIB also has 57 K and an IEP of 3.3, but the pH optimum is 4.5. Finally, PGIV has a Mr value of 59K, an IEP of 3.7, and a pH optimum of 4.8. The given Mr values are determined by SDS-polyacrylamide gel electrophoresis, the IEP values by isoelectric thin film focusing. The N-terminal sequencing of PGI showed the following sequence:

ala'-ser-thr-X ⁴ -thr ^e -phe-thr-ser-ala ⁹ N-terminal sequencing of a 21 kDa BrCN fragment of PGI revealed this sequence:

ala-ser-thr-X ⁴ -thr-phe-thr-ser-ala-ser-glu, ie, the N-terminal sequence of PGI and the sequencing of a 5.5kDa BrCN fragment revealed the sequence

ala-asp-gyl-ala-vaMle-asp-gly-asp-gly-ser

 N-terminal sequencing of PGII revealed the sequence

asp'-ser-X ³ -thr-phe ⁶ -thr-thr ala-ala-ala ¹⁰ -ala-lys-ala ¹² and a BrCN fragment of 17kDa for the sequence

ala-phe-ser-val-gln-ala-asn-asp-ile-thr-phe.

X ³ and X * in the sequences were not identified at this time.

Based on the amino acid sequence of the BrCN fragment to 5, SkDa of PGl, the following oligonucleotide mixture was synthesized:

metalaaspglyalsval

HR 6298 5 '(d) ATGGCIGAr ₁ GGIGCIGTI ileaspglyaspgly ATR ₃ GAR ₁ GGIGAR ₁ GG 3'

Based on the amino acid sequence of the 17 kDa BrCN fragment of PGII, the following two oligonucleotide mixtures were synthesized:

with ala phe ss val gin ala HR 6195 5 '(d) ATG GCITTR ₁ TCIGTICAR ₂ GCI KR 6196 5' (d! ATG GCITTR, AGIGTI CARj GCI

asnn asp he

HR 6195 AAR, GAR, AT 3 'HR 6196 AAR, GAR, AT 3'

In the sequences of the oligonucleotides I is inosine, R ₁ is T or C, R ₂ is A or G and R ₃ is T, C or A.

The mixtures were radioactively labeled and used to test a genome bank of Aspergillus niger N400 for PGI and PGII, respectively.

The identified genes or gene fragments are then sequenced by conventional means. The sequences of the PGf and PGII genes of A. niger N 400 are represented by the sequences of SEQ ID NO. 1 and 2, respectively, which are given in the Sequence Listing.

For testing purposes, the DNA probes are radioactively labeled according to methods known in the art, e.g. By using Y ³² P-ATP and T4 kinase or a ³² P-dATP and E. coli DNA polymerase I, depending on the type of probe used. Host organisms carrying nucleic acids of the present invention as an insert are identified by hybridization with the labeled DNA probe to filter replicas of the Genbank.

Clones that hybridize to one or more DNA probes are isolated and amplified.

The hybridization conditions used are the conventional ones, they can be more or less severe.

Strict conditions are those under which only DNA sequences can hybridize to a higher degree of homology ("homologous" hybridization conditions.) Under "heterologous" or less stringent conditions, related DNA sequences can also hybridize with a lower degree of homology. The severity of the hybridization is influenced, for example, by hybridization and washing temperature, formamide or salt concentration, G + C content of the DNA, length of the

Hybridization time and length of the DNA probe. Illustrative but non-limiting examples of "homologous" and "heterologous" hybridization conditions are given below in the Examples.

Using one or more of the DNA probes derived from the PGI or PGII gene, particularly those comprising at least a portion of their coding regions, hybridizing clones derived from a genomic library, e.g. Derived from A. niger, preferably A. niger N400 or A. niger NW756, and classified into different classes based on their degree of homology and on the observed hybridizing restriction fragments. Examples of preferred clones derived from an A. nlger N400 library are XPG-A9, -A10, -A43, -64, -635, -836, -01, -016, -C20, -C 37, -D8, -D11, -D12, -E6, -E38, -F5, -G17, -X31 and -Y33.

Their preparation will be described below in more detail with reference to the examples. An example of a preferred clone used by

A. niger NW756 derived, the plasmid pGW 1756.

These clones as well as plasmids pGW1800, pGW1803, pGW1900, pGW1902 and pGW1910 can be used to prepare other recombinant DNA molecules of the invention, especially those containing fragments of the PG gene sequences included therein. These other recombinant DNA molecules are prepared in a conventional manner using conventional restriction enzymes, linkers, ligation, amplification and isolation processes.

Preferably, expression vectors are prepared which may be pro- or eukaryotic vectors or bifunctional plasmids for propagation in pro- and eukaryotic cells. Examples of the construction of such bifunctional plasmids are well known in the art. The expression vectors may contain homologous or heterologous genes. Examples of such genes are given below.

The inserts of the recombinant DNA molecules of the invention or fragments thereof can be obtained in a conventional manner, e.g. After cleaving the recombinant DNA with appropriate restriction enzymes and isolating the desired DNA fragments after agarose gel electrophoresis.

Mutants of the DNA molecules of the invention, particularly the PG gene sequences containing new restriction sites, can also be produced, for example, in vitro by site-directed mutagenesis, by conventional methods (see review by MJ "" and M. Smith, Methods Enzymol 100,468 [1983], D. Botstein and D. Shortle, Science 229,1193 [1985] or K. Norri: -άά, duel Acids Res. 11,5103 [1983]).

The invention also relates to the use of the recombinant DNA molecules of the invention for the production of hybrid vectors for the expression of a structural gene.

Transformed hosts

In addition, the invention relates to transformed host cells for amplifying the recombinant DNA molecules of the invention or particularly to the expression of an expression cassette included in a recombinant DNA molecule of the invention.

Examples of suitable hosts, in particular for amplifying the recombinant DNA molecules of the invention, are microorganisms whose restriction enzymes or modification enzymes are absent or only poorly endowed, for example bacteria, especially strains of Escherichia coli, for example E.culi W3110, E coll HB101 / LM1035, E.coll JA221, E. coil DH5a or preferably E. coil DH5O.F ', JM109, MH1 or HB101, or E. coli strain K12, Bacillus subtilis.

Bacillus stearothermophilus, Pseudomonas, Haemophilus, Streptococcus and others, and yeasts, for example Saccharomyces cerevisiae, such as S.cerevlslaeGRF18. In addition, suitable host cells are cells of higher organisms, in particular fixed continuous human or animal cell lines, e.g. Human lung L132 lung fibroblasts, human melanoma Bowes cells, HeLa cells, COS-7 African green monkey kidney cells transformed by the SV40 virus, or Chinese hamster ovary (CHO) cells.

Examples of suitable hosts for expressing an expression cassette of the invention are the cells mentioned above, and in particular they are filamentous fungi, for example Penicillum, Cephalosporium or, preferably, Asperglllus spec. Β.

A. carbonarlus, A. awamori or preferably A. nlger, A. nldulans or A. oryzae.

Preferred transformed hosts are E.coll MH1 transformed with pGW 1800 or pGW1803, E. coil JM109 transformed with pGW1800 or pGW1803, E.coll DH5 F ', transformed with pGW 1900,1902,1657 or 1910, pGII-IFN AM 119 or pGllss-IFN AM 119, Asperglllus niger An8 or N593 or Asperglllus nldulans, transformed with pGII-IFN-AM 119 or pGllss-iFN AM 199 and optionally with the selection marker plasmid pCG 59D.

The invention also relates to a method of producing such transformants, which comprises treating a suitable host cell under transforming conditions with a recombinant DNA molecule of the invention, in particular a hybrid vector of the invention optionally together with a selection marker gene, and optionally selecting the transformants.

The transformation of microorganisms is carried out according to conventional methods as described in the literature, for example for S. cerevisiae (A.Hinnen et al., Proc. Natl. Acad. Sci. USA, 75, 1929, 1978), for B.subtilis (Anagnosiopoulos et al., J. Bacteriol 81, 741, 1961) and E. coli (M. Almond et al., J. Mol. Biol., 53, 159, 1970).

Accordingly, the transformation process of E. coli cells, for example, involves the Ca ²⁺ pretreatment of the cells to allow DNA uptake and incubation with the hybrid vector. The subsequent selection of the transformed cells can be achieved, for example, by transferring the cells to a selective growth medium which allows separation of the transformed cells from the parent cells depending on the nature of the vector DNA marker sequence. Preferably, a growth medium is used which does not allow the growth of cells which do not contain the vector. The transformation of yeast includes, for example, the steps of enzymatically removing the yeast cell wall by glucosidases, treating the obtained spheroplasts with the vector in the presence of polyethylene glycol and Ca ²⁺ ions, and regenerating the cell wall by embedding the spheroplasts in agar. Preferably, the agar is prepared in a manner that permits regeneration and selection of the transformed cells as described above at the same time.

The transformation of cells of higher eukaryotic origin, for example mammalian cell lines, is preferably achieved by transfection. Transfection is carried out by conventional methods, for example, calcium phosphate precipitation, microinjection, protoplast fusion, electroporation, d. H. Introduction of the DNA by a short electrical pulse, which temporarily increases the permeability of the cell membrane, or in the presence of helper compounds, such as diethylaminoethyldextran, dimethyl sulfoxide, glycerol or polyethylene glycol, and the like. To

the transfection procedure, the transfected cells are identified and selected, e.g. By culturing in a selective medium selected depending on the nature of the selection marker, for example, standard culture media such as Dulbecco's modified Eagle's medium (DMEM), minimal medium, RPMI 1640 medium and the like, e.g. B. contain the corresponding antibiotic.

The transformed host cells are cultured by the methods known in the art in a liquid medium containing assimilable carbon sources, e.g. Carbohydrates, such as glucose or lactose, nitrogen, e.g. As amino acids, peptides, proteins or their degradation products, such as peptones, ammonium salts or the like, and inorganic salts, eg. As sulfates, phosphates and / or carbonates of sodium, potassium, magnesium and calcium. The medium also contains, for example, growth-promoting substances, such as trace elements, for example iron, zinc, manganese and the like. The medium is preferably chosen such that it exerts selective pressure and prevents the growth of cells that have not been transformed or have lost the hybrid vector. For example, an antibiotic is added to the medium when the hybrid vector contains an antibiotic resistance gene as a marker. For example, if a host cell is used which is auxotrophic in an essential amino acid while the hybrid vector contains a gene coding for an enzyme which complements the host defect, a minimal medium lacking this amino acid is used to culture the transformed cells.

Cells of higher eukaryotic origin, such as mammalian cells, are grown under tissue culture conditions using commercially available media, for example, the above-mentioned modified Eagle's medium of Dulbecco (DMEM), Minimalmediiim, RPMI 1640 medium and the like, optionally completed with growth promoting substances and / or mammalian serums. Techniques for cell culture under tissue culture conditions are well known in the art and include the homogeneous suspension culture, e.g. In an airlift reactor or in a continuous stirred reactor, or the immobilized or entrapped cell culture, e.g. In hollow fibers, microcapsules, on agarose microbeads, porous glass beads, ceramic sleeves or other microcarriers.

The culture follows processes known in the art. Culture conditions, such as temperature, pH of the medium and fermentation time, are chosen to provide maximum titre of the polypeptide or derivative of the invention. Thus, an E. coil or a yeast strain, preferably under aerobic conditions by submerged culture with shaking or stirring at a temperature of about 20 ° C to 40 ^e C, preferably at about 3O ⁰ C, and a pH of 4-8 preferably at a pH of about 7, for a period of about 4 to 30 hours, preferably until a maximum yield of the polypeptide or derivative of the invention is reached.

To enable selection of the transformed from untransformed cells, the DNA molecules of the invention carry a selection marker or, alternatively, the cells are cotransformed with a second vector containing such a marker. As in other systems, such a selection marker is an expressible structural gene whose distinct polypeptide (an enzyme) confers resistance to compounds that are toxic to the recipient organism or that supplements the enzyme system of a mutant lacking such an essential polypeptide. Such marker genes which are suitable for the selection of transformed filamentous fungus cells are, for example, the known qa-2, pyrG, pyr4, trpC, amdS, or argB genes.

as described in EP278355, a marker gene named pyrA was isolated from the genome bank of A. niger, which is related to and has a similar function to pyrG of A. nldulans and pyr 4 of N. crassa, namely the production the enzyme orotidine-o'-phosphate decarboxylase. This enzyme catalyzes the decarboxylation of orotidine-5'-phosphate to uridylic acid (uridine-5'-phosphate) and also from fluoro-orotic acid to the toxic fluorouridine. By hybridization with the 1.1 kb Hind III fragment of pDJB2 (ref 25) containing part of the pyr4 gene, an E. coli clone containing the pyrA gene was identified. However, DNA from any other pyr gene coding for Orodin 5'-phosphate decarboxylase can be used. From a positive clone designated E. coli B75183 / pCG59D7, the plasmid pCG59D7, which comprises the pyrA gene, was isolated and used for the coir transformation of an A.nlger-pyrA mutant. This pyrA'-substrate is lacking the orotidine 5'-phosphate decarboxylase gene and therefore unable to produce the corresponding enzyme. Such a mutant was prepared by treating conidiospores of A. niger N 756 under mutant UV irradiation and selecting colonies that survive in the presence of fluoro-orotic acid and uridine. Colonies that survive in the presence of fluoro-orotic acid and absence of uridine are eliminated. The remaining uridine-requiring mutants, according to their ability to be transformable, belong to two complementation groups, pyrA and pyrB, represented by the mutants An8 and An10, respectively. They are treated in the form of their protoplasts under transforming conditions with the pyrA-containing plasmid pCG 59D7. It was found that only the An 8 colonies were transformed and contained the pyrA gene as evidenced by the hybridizing ability of their digested DNA with pUN 121 DNA.

Production of polypeptides

The invention also relates to a method of producing polypeptides, characterized in that a homologous or heterologous structural gene, for example as defined above, inserted into an expression cassette of the invention is expressed by conventional methods in a suitably transformed host. If necessary, the polypeptide is isolated in a conventional manner. Depending on the construction of the expression cassette, the products are either produced or, if a signal sequence is present, produced and secreted. In general, the expression cassette is contained in a hybrid vector, but it can also be integrated into the host genome after the transformation.

For example, a suitable host is a fungus, e.g. A filamentous fungus, especially an Aspergillus strain, when a promoter derived from a PG gene of the invention or another promoter derived from filamentous fungi is used for the expression of a homologous or heterologous structural gene. However, when other promoters are used, for example, those derived from prokaryotes or higher eukaryotes, other hosts are suitable, for example, bacteria such as E. coli and higher eukaryotic cells, respectively.

The promoters of A.nlger PG genes are inducible in the A. niger cell, i. h., the expression of the structural gene bound thereto, e.g. Of the structural gene coding for a PG or a foreign gene is induced by the addition of pectin or pectin degradation products to the medium. However, in the presence of sufficient glucose, the promoter is not inducible when an A. niger strain, e.g. B. An8 or N 593, is used as a host. That is, genes under the control of an A. niger PG promoter are " catabolite-repressed " in A. However, if another Aspergillus strain is used, preferably

A. oryzae, or better still A. nldulans, a gene is constitutively expressed under the control of a niger PG promoter, i. H. even in the absence of pectin and / or in the presence of glucose. It may therefore be advantageous to express genes under the control of an A. niger PG promoter in an Aspergillus host other than A. nlger, preferably A.oryzae or better still A. nldulans, because, for example, the nutrient medium is glucose instead of pectin can be added as an energy and carbon source during expression of a desired gene.

When used to construct an expression cassette of the invention, a promoter not derived from a PG gene of the present invention, e.g. For example, if a structural gene encodes a PG, other hosts may be used as expression hosts. Such suitable hosts are dependent on the promoter used and are z. B. bacteria, such as E. coil, or yeast, such as S. cerevlslae or Kluyveromyces lactis. Suitable hosts and promoters for the production of polypeptides according to the invention are also those specified above for the transformation. It is now possible to override one or more desired PGs, for which various methods can be used. A purified single PG can be prepared so that pectinolytic enzyme mixture containing a PG is subjected to conventional purification methods. Another method for producing a single PG, preferably PG I, PG II or the product of the pgaC gene, is characterized in that a suitable host that is unable to express a PG, or the PG in a small Amounts or does not express the PG under the induced conditions for the introduced PG gene induction conditions, is transformed with a hybrid vector, which is a structural gene encoding the PG, z. PG I, PG II or the pgaC gene product or a fragment of PG having PG activity, and that this structural gene is expressed. If a host incapable of ever printing a PG is used, the corresponding single PG can be recovered in a pure form, i. H. not contaminated by another PG. It is also possible to prepare in advance certain mixtures of PG, optionally together with other enzymes, by virtue of the fact that in a transformed host not only a single, but more than one desired PG gene, optionally together with genes encoding other enzymes, be pronounced. Pre-determined mixtures may also be obtained by having one or more desired genes for PG and / or other enzymes, e.g. For pectin esterases, pect.inlyases, cellulases, mixed endoglucanases, hemicellulases, xylanases, arabinases, galactanases, α- and β-glycodidases and the like, in a host strain, optionally one with some background in enzyme production. Pre-determined mixtures of enzymes can also be obtained by disruption of certain PG genes in the host by "gene disruption", a technique well known in the art using the isolated PG genes of the invention.

A host who is unable to express a PG at all is either a microorganism without a corresponding gene, e.g. A PC Aspergillus strain, another PG ~ non-Aspergillus fungus or any other PG ~ eukaryotic or prokaryotic cell, or an Aspergillus strain, e.g. B. A. oryzae or A. nidulans, the expression of which is suppressed by endogenous PG genes in a suitably conditioned growth medium, e.g. "Catabolite-repressed" and / or uninduced while the exogenous PG promoter is operably linked to the desired PG structural gene, e.g., an A. niger-derived promoter, and is active under these conditions, or when the PG Gene is fused with another promoter.

Other promoters and strains suitable for the production of the PG are the same as those given above in the description of the expression cassettes.

The polypeptides and compositions

The individual PGs purified from a pectinolytic enzyme mixture, preferably from a pectinolytic enzyme mixture derived from Aspergillus niger and in particular from rapeseed *, and PG which are encoded by a DNA sequence according to the invention and their derivatives having PG activity in particular when produced in a suitable host transformed with an expression hybrid vector encoding such PG or its derivative having PG activity, and physiologically acceptable salts thereof are also provided by the present invention. Particularly preferred are PG I, PGII, PG III A, PG III B and PGIV of Aspergillus niger in purified form. The present invention relates to these polypeptides when prepared by a method of the present invention. The invention also relates to enzymatic compositions comprising one or more of these individual PGs and / or derivatives thereof having PG activity and / or their biologically acceptable salts, optionally in a predetermined combination with one or more suitable enzymes having other than PGs. Activity, include. Enzymes having other than PG activity suitable for the preparation of these enzymatic compositions are degradative and modifying plant cell wall polymers. Such enzymes are for. As pectin esterases, pectin lyases, mixed endoglucanases, hemicellulases, xylanases, arabinases, galactanases, α- and ß-glycodidases and the like. The present invention also relates to the preparation of these enzymatic compositions in a conventional manner.

The use of these individual PGs and / or derivatives thereof with PG activity and / or enzymatic compositions in the processing of plant material is also provided by the present invention. Individual PGs of the invention and / or their derivatives having PG activity or enzymatic compositions comprising these PGs or derivatives are e.g. B. useful in the clarification of vegetable or fruit juice, in increasing the juice yield in the vegetable or fruit juice production and the Preßertrages of oily seeds or fruits, in the stabilization of vegetable or fruit juice, in reducing the viscosity of vegetables or Fruit juice, in the liquefaction of biomass, in maceration, in increasing the extraction of natural products, such as natural pigments, flavorings and flavorings, in the upgrading of biomass, food or feed, to improve the recovery of cellulose fibers in pulp production and similar

 Most preferred are the embodiments of the invention which are described below in the examples.

Brief description of the illustrations

Fig. 1: Partial restriction maps of the EcoRI fragments of the phage XD and λ E obtained from a genomic library of A. niger by hybridization with the combined DNA probes HR 6195 and HR 6196 encoding part of the PG II gene were. The numbers indicate the approximate distances in kbp from the right EcoRI sites.

FIG. 2: Partial restriction map of pGW 1800. The plasmid contains DNA of the vector pEMBL 18 and the 4.1 kbp Xba I-EcoRI Insert obtained from phage AE containing the A.nlger N400 PGII gene. Ap is that

Ampicillin resistance gene, and the arrows indicate A. nlger-derived DNA

 Fig. 3: Partial restriction map of pGW 1900. Composed of the pUC9 vector and an 8.6kbp BamHI fragment of phage PGI-A7.

Fig.4: Cloning strategy for the plasmids pG IUFN AM 119 and pG Ilss-IFN AM 119

 Fig. 5: Stepwise preparation of DNA inserts DNA5 and DNA6 for the assembly of pG H-IFN AM 119 and pG Ilss IFN, respectively

AM 119 according to the method of polymerase chain reaction (PCR method)

 FIG. 6: Partial restriction map of pGW 1756. pGW 1756 is the 5.5 kbp Xho I Bgl II fragment which contains the A. nlger NW756 fragment.

Polygalacturonase II gene inserted into the vector pEMBL 18 carries. Restriction sites in the vector are not shown. Shown are also the earlier Xhol and BGI Il places of the fragment, but these were by inserting into the

Sail or BamHI sites of the vector destroyed

 Fig. 7: Partial restriction map of pGW 1910. pGW1910 is the 7.8 kbp BglII fragment of lambda phage PG-C20.

inserted into the BamHI site of the vector pUC9. The approximate location of the A. nlger N400 gene is indicated.

which encodes the PGC (pgaC) gene.

The following examples serve to illustrate the invention but are not intended to limit it in any way. The abbreviations have the following meaning: Amp ampicillin

bis Tris bis (2-hydroxyethyl) imino-tris (hydroxymethyl) -methane

BSA bovine serum albumin DTT 1,4-dithiothreitol EDTA ethylenediaminetetraacetic acid, disodium salt IPTG isopropyl-β-D-thiogalactopyranoside

kbp kilobase pairs

PEG Polyethylene glycol PTH phenylthiohydantoin SDS sodium dodecyl sulfate Tet tetracycline TFA trifluoroacetic acid TP tryptic peptide Tris tris (hydroxymethyl) aminomethane X-gal 5-bromo-4-chloro-3-indolyl-β-galactoside Buffers, media, reagents SM 100 mM NaCl, 8.1 mM MgSO ₄ , 50 mM Tris-HCl, pH 7.5, 0.01% gelatin LB 1% trypticase peptone (BBL), 0.5% yeast extract (BBL), 1% NaCl, and 0.5 mM Tris-HCl, pH 7.5 LM 1% Trypticase Peptone (BBL), 0.5% Yeast Extract (BBL), 10 mM NaCl and 10 mM MgCl ₂ PBS 0.37 g NoH ₂ PO ₄ , 2.7 g NSjHPO ₄ .. 8.5 g NaCl per liter H ₂ O. SSC 0 ,. 5M NaCl, 0.015M trisodium citrate PSB 10 mM Tris-HCl, pH 7.6.10 mM NaCl, 10 mM MgCl ₂ , 0.05 4 (w / v) gelatin TE 10 mM Tris-HCl, pH 8.0, 0 mM EDTA, pH 8.0. Minimal medium 1 liter contains 1.5 g KH ₂ PO ₄ , 0.5 g KCl, 0.5 g MgSO ₄ .7 H ₂ 0.09 mg ZnSO ₄ .7H ₂ .0.2 mg MnCl _2. 4 H ₂ 0.0.06 mg CoCI ₂ 6H ₂ 0,0,06mg CuSO ₄ · 5 H ₂ 0,0,29 mg CaCl ₂ · 62 H ₂ 0,0,2 mg FeSO ₄ · 7 H ₂ O, nitrogen and Carbon sources as indicated in the text or 6 g of NaNO ₃ and 10 g of glucose per liter, if these sources are not

explicitly mentioned, adjusted to a pH of 6.0 with NaOH

Complete medium minimal medium with 6 g NaNO ₃ and 10 g glucose per liter, plus 2 g trypicazepone (BBL), 1 g casamino acids (Difco), 1 g yeast extract (BBL), 0.5 g yeast ribonucleic acid sodium salt (ICN, Cleveland, USA), 2 ml

Vitamin solution per liter, adjusted to a pH of 6.0 with NaOH

 Vitamin solution per 100 ml 10 mg thiamine, 100 mg riboflavin, 10 mg pantothenic acid, 2 mg biotin, 10 mg p-aminobenzoic acid, 100 mg nicotinamide, 50 mg pyridoxine-HCl

TBE 1 liter contains 4 ml of a 0.5 M EDTA solution, pH 8.0, 10.8 g Tris and 5.5 g H ₃ BO ₃ Phenol phenol, which is described in the Maniatis et al. (Ref 6, p. 438).

Sample buffer 10% (v / v) glycerol, 10 mM EDTA, pH 8.0, and 0.01% bromophenol blue RNase A RNase A, which was synthesized by the method described by Maniatis et al. a. (Ref 6, p. 451)

The following strains are used: A. niger N 400 wild-type A. nlger N 402 cspA A. niger N W 756 pectinase high performance strain A. nlger N 756 pectinase high performance strain A. niger To 8 DSM 3917, uridine auxotrophic mutant of pectinase complex high performance strain A. nlger N 756 A. ng N 593 cspA, pyrA E. coll NM 539 metB, supE, hsdM ⁺ , hsdR ~, supF, (P 2 cox 3) E. coll LE 392F ", hsdR 514 (rk ~, mk ⁺ ), supE 44, laoY 1 or (Iac 1 ZY) 6, galK 2, galT 22, metB 1, trpR 55, A ~ E.collDHöaF 'F, endA1, hsdR17, (r | ₍ ", mι ₍ ⁺ ), 5upE44, thl * 1, recA1, gyrA _/ relA1, (8O0lac) M15Δ (lacZYA-argF) U169, λ" E. coli JM109 endA1, recA1, gyrA96, thi, hsdR17 (rk ~, mk "), relA1, supE44, λ", (lac-proAB),

(F ', traD 36, proAB, laclqZ M15]

E. coli JM 110 rp * L, thr, leu, thl, lacY, galT, ara, to η A, tsx, dam, tupE 44, (lac-proAB), [F ', traD 36, proAB, laclqZ M15 ]

Ε »the following vectors are used:

pGW613

This plasmid was developed by Goosen et al. (Ref. 13).

M13 mp phage

The M13mp18 and Mi3mp19 vectors (Norranderu. A., Ref. 24) are derivatives of the single-stranded DNA bacterial phage M13

and are designated for ease of DNA sequencing because they permit the cloning of DNA fragments at a versatile polylinker site and the cloning of the same restriction fragment in both possible orientations.

Monierte sequences in these vectors can easily be used as templates for sequencing reactions or for the production of

single-stranded probes using the standard oligodeoxyribonucleotide starter and Klenow fragment

E. coli DNA polymerase I can be used. The vector DNA carries the E. coli Lac operon promoter and the genetic Information of the first 145 amino acids of β-galactosidase. The polylinker sequences, which are multiple restriction sites

are inserted into the lacZ sequence. The polylinker retains the lacZ reading frame and the vector gives complete complementation of a LacZa host strain, resulting in blue plaques on plates containing IPTG and X-gal.

Recombinant phage containing inserts which destroy the reading frame or otherwise express the expression of the

lacZa peptide are shown as colorless plaques.

pGW635

This plasmid is a shorter version of pGW613. It also contains the pyrA gene. It is from Goosen u. a. (Ref.42)

described.

EMBL4 is a lambda substitution vector with a cloning capacity of 9-23 kbp (Frischauf et al., Ref. 9). He contains

a multiple cloning region between the lambda arms and the nonessential stuffer region. That allows

Perform multiple restriction enzyme digestions in a manner that relieves the stuffer region

the vector arms are reduced as the foreign DNA of interest is inserted. The vector also uses the

Spl phenotype to allow for direct selection for recombinants (Zissler et al., Ref. 21).

pEMBL18undpEMBL19

These plasmids were obtained from Dente et al. a. described

(Ref 10,22,23).

example 1 Isolation and characterization of polygalacturonase Example 1.1 Purification of the Polygalacturonases I, II, HIA, HIB and IV The enzyme activity is determined in the enzyme fractions obtained below, wio that elsewhere (Rozie

et al., Ref. 2) using a modified ferricyanide test (Robyt et al., Ref. 3).

The polygalacturonases I, II, III A, III B and IV are purified from Rapidase, a commercially available mixture of

pectinolytic enzymes obtained from Aspergillus niger (Gist-brocades, Soclin, France). There will be 50g of the

Egg white crude powder (Lot No. K2B078) in 190 ml of a 20 mM sodium acetate buffer, pH 3.6, dissolved for 10 min at

Centrifuged to remove the solids and desalted on a Sephadex G-50 column (5cm x 90cm) equilibrated in the same buffer.

The first step in the purification process is a step of affinity chromatography using cross-linked Alginate based on Rombouts u.a. (Ref. 1) was prepared. The cross-linked alginate, the one Bed volume of 5.2 ml / g is also equilibrated with 20 mM sodium acetate buffer, pH 3.6 (column dimensions

2.5cm x 30cm). The desalted enzyme is placed on this column and then washed by using a 100 mM sodium acetate buffer, pH 4.2 and 5.6 (400 ml each). While PGI and PGII adsorb to the alginate matrix, PG III A, III B and IV are not.

Example 1.1.1: Purification of PGI and PGII

The adsorbed PGI and PG II proteins from the cross-linked alginate column are eluted by a linear sodium chloride gradient (0-1 M) in a 100 mM sodium acetate buffer at pH 5.6, which is a minor modification of the hitherto employed method ! (Rombouts et al. Ref. 1). PGI co-elutes with PG II at about 0.5M NaCl.

The enzyme fraction containing PGI and PG II is dialysed from a 20 mM sodium acetate buffer, pH 5.7, and added to a DEAE Sephadex A-50 column (2.5 cm 3 Oom) in the same buffer had been equilibrated. The enzymes are eluted using a linear NaCl gradient (0-0.6M). PGI elutes at about 0.3 M NaCl, PG II at about 0.2 M. The enzyme fractions containing PGI and PG II are picked up separately using a 20 mM Tris-HCl buffer, pH 5.8. and on a DEAE-Sepharose fast flow column, chromatographies which had been equilibrated in the same buffer. Using a NaCl gradient, PG II is eluted at about 120 mM sodium chloride, PGI at about 25 mM. Active enzyme fractions containing PGI or PG II, after dialysis, are eluted with a 2MM sodium acetate buffer, pH 5.7, to a final volume of 25 ml on a small DEAE-Sepharose fast flow column (1.6 cm x 10 cm) Concentrated 1M sodium chloride in this buffer. The final purification of each of the two enzymes PGI and PG II is achieved by gel permeation chromatography on Sephacryl S200 (1.6 cm × 90 cm) in 0.1 M sodium acetate, pH 4.2.

PG II has a single band on SDS-polyacrylamide gel electrophoresis and has an apparent molecular mass of 38 kDa. The specific activity is 2760 units / mg protein, determined in a 0.075 M sodium acetate buffer, pH 4.2. In isoelectric focusing, the enzyme exhibits microheterogeneity. Besides a pronounced major component at a pH of about 5.2, a large number of smaller bands are observed in the pH range of 4.6 to 5.9.

PGI also has a band on SDS-polyacrylamide gel electrophoresis. This enzyme has an apparent molecular mass of 55kDa. The specific activity is 555 units / mg of protein, determined in a 0.075 M sodium acetate buffer, pH 4.2. In isoelectric focusing, the enzyme also has microheterogeneity. In the pH range of 3.2 to 3.5, multiple bands are observed.

Example 1.1.2: Purification of PGIIIA, PQIIIB and IV The effluent of the cross-linked alginate column (Example 1.1) containing the unbound PG is assayed 1M Sodium hydroxide adjusted to pH 5.7 and placed on a DEAE Sephadex A-50 column (2.5 cm χ 30 cm),

which had been equilibrated in 0.02 M sodium acetate buffer, pH 5.7. The enzymes are eluted from the DEAE-Sephadex column with a linear sodium chloride gradient (0-1 M). PGIII eluted at 0.38M sodium chloride, PG III A and PJG III Bcoeluate in O, 5M.

5ml of each of the two enzyme fractions are loaded onto a Sephacryl S-200 column (1.6cm x 90cm) in 0.1M

Sodium acetate buffer, pH 4.2, desalted. The active fractions are pooled, five times with distilled water

and MONO Q column (Pharmacia Fine Chemicals, Uppsala, Sweden) equilibrated in 0.02 M bis-Tris / HCl buffer, pH 5.8. Eluted using a linear sodium chloride gradient of 20ml (0.1-0.4M)

PGIV at 0.32 M sodium chloride, while PG III A and III B coelute at 0.4 M sodium chloride. Both enzyme fractions are separated again under the conditions described above on a MONO Q column

Chromatograph. Fractions having PG activity are pooled, dialyzed from a 0.025M piperazine / HCl buffer, pH 6.0, and fed to a MONO P column (Pharmacia Fine Chemicals, Uppsala, Sweden) which is in the same

Buffer had been equilibrated. The column is filled with 10% Polypuffer 74 (Pharmacia Fine Chemicals, Uppsala, Sweden),

pH 3.0, eluted at a flow rate of 0.75 ml / min.

The final cleaning is carried out by gel permeation chromatography on a column TSK G 3000 SW (0.75cm χ 30cm)

(LKB, Bromna, Sweden) equilibrated in 0.05M sodium phosphate buffer, pH 6.2,

Flow rate 0.5ml / min. The column is calibrated with the following protein standards: barker serum albumin (68kDa); Egg Albumin (45kDa) and Chymotrypsinogen A (25kDa). An apparent molecular mass of 53 kDa is determined for PGIV by gel permeation chromatography. PGIV shows one

single band on SDS-polyacrylamide gel electrophoresis and has an apparent molecular mass of 59 kDa as determined by

Electrophoresis on a 15% polyacrylamide gel. The specific activity is 780 units / mg protein, determined in

0.075M sodium acetate buffer, pH 4.2. In isoelectric focusing, the enzyme shows a single, sharp band at a pH of 3.7.

Gel permeation chromatography of the active fractions containing PG III A and PG III B on the TSK G 3000 calibrated column SW gives the separation of the two enzymes with one under the same conditions as described for PGIV

apparent molecular mass of 32 or 52 kDa. However, in SDS-polyacrylamide gel electrophoresis (15% polyacrylamide gel), both enzymes have a single band with an identical molecular mass of 57 kDa. PG III A and PG III B have a specific

Activity of 150 and 250 units / mg protein, respectively, determined in 0.075M sodium acetate buffer, pH 4.2. At isoelactric Focusing, both enzymes show a single sharp band at a pH of 3.3. Example 1.2: Comparison of the properties of the polygalacturonases and their immunological ratio Starting from 50g Rapidase (Gist-brocades, Soclin, France), five endopolygalacturonases are converted to those in Example 1.1

cleaned way described. The properties of these purified enzymes are summarized in Table II.

Table II. Physicochemical properties and pH optima of five A. niger polygalacturonases

enzyme Mr * I.E.P. " pH optimum (Activity) PGI 55K 3.2-3.5 4.9 PGII 38K 4.6 to 5.9 4.8 PGIIIA 57 K 3.3 4.3 PGIIIB 57 K 3.3 4.5 PGIV 59 K 3.7 4.8

a Extrapolated value determined by SDS gel electrophoresis.

b Isoelectric point, determined by isoelectric power focussing.

All purified enzymes have an apparent molecular weight in the range of 55-59 kDa on a 15% SDS-polyacrylamide gel, except for PGII, which appears to be a much smaller protein (38 kDa). The peculiar character of PGII is underlined by the relatively high isoelectric point compared to the low isoelectric point values determined for the other polygalacturonases. The pH optimum of all polygalacturonast η is in the same range (4.3-4.9).

Specific antibodies to purified PGI and PG II are raised in male New Zealand white rabbits following the immunization schedule described by Uitzetter (ref. 33).

As noted below, cross-reactivity is observed between the two antisera and the five purified polygalacturonases. Loaded onto a 10% SDS-polyacrylamide gel to 0.4 to '\ fi \ given ig purified protein and transfer method described by electrophoresis from the gel to a nitrocellulose membrane using inter alia by Bowen (Ref. 37). Incubation of the nitrocellulose blot with the specific antisera followed by staining with peroxidase-labeled goat anti-rabbit IgG is performed according to Uitzetter (Ref 36). After incubation with PG! -Specific antiserum, a strong signal for PGI and PG III A, III B and IV is detected. PG II gives a slightly weaker signal to this antibody. Incubation of the blot with PG II specific antiserum gives one high intensity band for PGII, but only weak bands for the other four polygalacturonases.

Example 1.3: Determination of the Amino Acid Sequence of Cyanogen Fragments of Polygalacturonase II About 100 μg of PG II are dissolved in 150 μM of 70% formic acid and a solid cyanogen bromide is added in a one hundred fold molar excess of methionine (of which 4 residues per enzyme molecule occur). The reaction mixture is stirred constantly at room temperature in a sealed reaction vial for 24 hours. After 24 hours is water

added and the preparation is dried by rinsing with N ₂ . This step is repeated to remove the formic acid.

After electrophoresis on 15% SDS polacrylamide, about 10 single bands can be stained by Coomassie Brilliant Blue. They represent incomplete and completely cleaved fragments. In addition to the intact protein, ι. As has a molecular mass of 38 kDa, the following bands are observed: 33,30,27,19,17,12,10,7,5,6 and 6kDa. Sampling at regular intervals during the 24-hour reaction period and analysis by SDS-polyacrylamide gel electrophoresis determined the order in which the partial and final reaction products occur and their position relative to each other. The 17 kDa fragment is an internal fragment while the 5 kDa fragment is located either at the C- or N-terminus. The fragments of the 24 hour treatment are then blotted onto Immobilon-P, a polyvinylidene difluoride membrane (Millipore), prepared according to the procedure described by Matsudaira et al. (Ref. 4). Three fragments are used for gas-phase sequencing, one 17 kDa fragment and two smaller fragments (5 and 6 kDa). Amino acid sequences are determined with an Applied Biosystems Protein Sequenator, Model 470A, which was directly connected to an Applied Biosystems Model 120A PTH analyzer. Membrane fragments containing 0.5-1 nmoles of a particular peptide are washed, placed on the gas phase sequenator, and subjected to sequence analysis according to the program described by Amons (ref. 5).

 The following sequence is determined for the 5kDa fragment:

Position: 1 5

Amino acid: Asp-ser-X-thr-phe-thr-thr-ala-position: 10 12 13

Amino acid: ala-ala-ala-lys (ala) - (ala)

In position 3 (X) no amino acid is detected. Since the applied sequencing program only discovers cysteine residues when the protein is previously S-pyridylethylated, position 3 is likely to be a cysteine (Amons, ref. 5). In positions 12 and 13, traces of ala are found, as indicated by the parentheses. While the trace at position 12 clearly results from an incomplete reaction in the previous step, the low signal of ala at position 13 represents the amino acid ala at position 13 of the peptide.

The sequence for the 17kDa fragment is:

Position: 1 5

Amino acid: ala-phe-ser-val-gln-ala-asn-position: 10

Amino acid: asp-ile-thr (ile) -pheithr)

The traces of isoleucine and threonine observed in the last two steps and indicated by parentheses, c. clearly indicate that the reactions have reacted in previous steps.

EXAMPLE 1.4 Determination of the Amino Acid Sequence of the N-Terminal Part of Polygalacturonase I 100 μl of PGI, which had been purified according to Example 1.1.1, were dialysed three times on 11 millipore-filtered water and lyophilized. The amino acid sequence is determined as in Example 1.3. For the enzyme, the following N-terminal amino acid sequence was determined:

Position: 1 5

Amino acid: ala-ser-thr-X-thr-phe-thr-position: S

Amino acid: ser-ala

The cysteine residues in the protein have not been modified and thus are not detected. It is likely that cysteine is present in position 4 (X) of the sequence. The N-terminal amino acid sequence of PGI has homology with the amino acid sequence of the 5 kDa cyanogen bromide fragment of PG II isolated from rapidase (Example 1.3) and with the N-terminal amino acid sequence of PGII derived from the A. niger transformant N 593 / pGW 1800-27 (Example 6.3) was isolated. This homology is underlined in the following scheme where it is assumed that cysteine occurs at positions 4 and 3 of PGI and PG II sequences, respectively:

PGI ala-ser-thr-cys-thr-phe-thr-ser-ala PGII asp-sercys-thr-phe-thr-thr-ala The open space between the serine residue at position 2 and the presumed cysteine residue at position 3 in the sequence

of polygalacturonase II is introduced to align the two sequences.

The serine residue at position 8 of the PG I sequence is not in the corresponding position of the PG II sequence (position 7)

present, but in the latter case, a similar amino acid, d. h., A small hydroxyl amino acid f ι hreonine), present.

Thus, the N-terminal amino acid sequences of PGI and PG II have homology but are not identical. The Differences are such that they are not the result of a partial modification of a single gene product, such as

for example, a partial proteolytic cleavage. It is concluded that PGI and PG II are encoded by different genes of the same family.

Example 1.5: Determination of Amino Acid Sequence of Cyanogen Bromide Fragments of Polygalacturonase I Approximately 100 μg of PGI are dissolved in 150 μl of 70% formic acid and solid cyanogen bromide is added to produce fragments of the protein as described in Example 1.3. There are 4 methionine residues per enzyme molecule, κ 'cn electrophoresed on 15% SDS-polyacrylamide gels and stained with Coomassie brilliant blue

Larger bands are observed with a molecular mass of 39.5 35.21, 19.5 and 5.5 kDa.

The 21 and 5.5 kDa fragments are sequenced using the same equipment and procedures as in Example 1.3.

The sequence for the 21 kDa fragment is:

Position 1

Amino acid: ala-ser-thr-X-thr-phe-thr-. Position: 10

Amino acid: ser-ala-sur-glu

It is likely that cysteine occurs at position 4 (X) of the sequence, similar to that described in Examples 1.3 and 1.4. The sequence of the 21 kDa fibragion is identical to the N-terminal amino acid sequence of the intact PG I protein described in Example 1.4.

The 5.5kDa fragment has the following sequence:

Position: 1 5

Amino acid: ala-asp-gly-ala-val-ile-asp-position: 10

 · <Amino acid: gly-asp-gly-ser

It is concluded that the 5.5 kDa fragment does not match the N-terminus of the protein. The basis for this is the sequence data.

EXAMPLE 1.6 Determination of the Amino Acid Sequence of a Tryptical Peptide PG II is partially denatured by dialysis using 0.5% formic acid and then freeze-dried. The enzyme (1 mg) is suspended in 1 ml of a 0.2 M N-ethylmorpholine acetate buffer solution, pH 8.0, and then incubated at 37 ° C. with trypsin (Sigma), which is in a molar ratio of 1:50 After 24 hours, digestion is stopped by the addition of acetic acid (final concentration 30%), the digested is freeze-dried, and samples of the digested are dissolved in 0.1% trifluoroacetic acid containing 2.5 mM dithiothreitol. and maintained at 37 ⁰ C for at least one hour. using a device Spectra Physics SP 8000 HPLC equipped with a Nuclcosil C-18 column (4.6 mm x 150 mm) (Supelco) and a Vydac guard column (Chrompack) are trypische Peptides (100μΙ samples containing 100-200 μρ protein) are separated at a column temperature of 25 ° C, a flow rate of 2 ml / min, indicating a linear gradient of the jet, which in 50 min of 100% solvent A (0 , 1% TFA in water) to 50% sol A + 50% solvent B (0.1 TFA in acetonitrile) changes. Peptides are detected by UV absorption at 214 nm. One of the peptides released late during digestion appears well off the other peaks in the chromatogram at about 21% acetonitrile. This peptide is dried by rinsing with dry air at 25 ⁰ C and sequenced. The amino acid sequence is determined by the method described in Example 1 4. The Sequen ί refreshes:

Position: 1 5

Amino acid: Thr-ile-ser-gly-ala-thr-gly-position: 10 14

Amino acid: ser-val-ser-glu-ile-thr-tyr

Example 2 Construction of genomic library of Aspergillus niger

Example 2.1: Isolation of high molecular weight DNA from A. niger N 400 conidiospores from the Asperglllus niger strain N 400 are inoculated with a final spore density of 10 ^e spores / ml in 200 ml minimal medium and in II conical flasks for 24 hours at 28 ° C Shaken at 300 rpm using a rotary shaker from New Brunswick. The mycelium is harvested by filtration with a Buchner funnel with Myracloth, washed with cold sterile saline, frozen in liquid nitrogen and either stored at -60 ⁰ C or used directly. The method used to isolate DNA for genomic library production is based on the method described by Yelton et al. (Ref. 18).

For the construction of the bank, 10 g mycelium in liquid nitrogen are ground in 1 g portions in a brown microdismembrator. The ground mycelium is transferred to a sterile II-Erlenmeyer flask containing 200 ml extraction buffer (50 mM EDTA, pH 8.5, 2% SDS) and 200 μM diethylpyrocarbonate. The mixture is slowly warmed to room temperature and then heated at 68 ^° C. for 20 minutes with occasional shaking. The suspension is cooled to room temperature and centrifuged for 15 min at 12000 g. To the supernatant is added a volume of Vie of an 8M potassium acetate solution, pH 4.2, and the mixture is left on ice for one hour. The precipitate is removed by centrifugation (20 min, 16,000 g, 4 ^° C.). The nucleic acids are precipitated from the supernatant by incubation with a 0.6 volume of isopropanol on ice for 15 min. The precipitated nucleic acid is collected by centrifugation (10 min; 6,000 xg; 4 ⁰ C) collected, washed with 70% ethanol and dried briefly. The pellet is suspended in 10 ml TE containing 20μς / ιηΙ RNase A (Boehringer, Mannheim) and incubated for a period of 15 min at 37 ⁰ C. The DNA is with nucleasefreier Pronase (concentration final 1 mg / ml) (High Light, Coinbrock), for a period of one hour at 37 ⁰ C. The pronase stock solution in TE buffer contains 20 mg / ml E-NZYM, the is pre-incubated at 37 ⁰ C for one hour to digest nucleases.

8.5 ml of CsCl are dissolved in 9 ml of the DNA solution thus obtained, 0.2 ml of 10 mg / ml ethidium bromide are added, and this solution is applied either for a period of 60 hours at 33,000 rpm in a Beckman SW41. Rotor or for the duration

centrifuged for 40 hours at 45,000 rpm in a Beckman 50 Ti rotor. The DNA band is collected and the ethidium bromide is removed by multiple extraction with isopropanol equilibrated with a saturated solution of NaCl in water. 5 volumes of TE are added and the DNA solution is treated sequentially with TE-saturated phenol, phenol / chloroform / isoamyl alcohol 25: 24: 1 and chloroform / isoamyl alcohol 24: 1. The DNA is precipitated by the addition of 0.1 volume 3 M sodium acetate solution, pH 5.2.2.5 volume ethanol and incubation at -20 ° C overnight. The precipitate is collected by centrifugation (1 hour, 30,000 g, 4 ° C), washed with 70% ethanol, dried and dissolved in 400 μΙ TE.

Example 2.2 Partial Digestion of A. nlger N400 DNA with Mbol and Isolation of the Fragments To determine the Mbol concentration which gives the largest amount of DNA fragments between 13.6 and 23kbp, portions become 1 \ ig with decreasing amounts of MboI (0.5 to 0.001 unit) digested by A. Nigor N-400 DNA in the appropriate buffer recommended by the supplier, for a period of one hour at 37 ° C in a volume of 10μΙ , The reaction is stopped by the addition of 1 μM 0.25 M EDTA and the samples are transferred to a 0.6% agarose gel in TBE buffer containing 1 μg / ml ethidium bromide. Appropriate size markers are a mixture of lambda DNA and lambda DNA digested with Bgl I, giving bands of 49,22,8,13,6,9,8,2,3kbp and a non-visible fragment of 0,45kbp. The required Mbol concentration to achieve a high yield of the desired fragments of 13.6-23 kbp is about 0.02 units of DNA. Thus, 200 μg of the DNA is digested in a total volume of 2 ml and divided into 20 equal aliquots immediately after addition of the enzyme. After one hour at 37 ⁰ C, the digested is each placed on ice. After a Ι-μΙ sample had been tested by the passage on a gel for proper digestion, EDTA is added to a final concentration of 25 mM was added, the enzyme is heat-inactivated by treatment at 65 ⁰ C for a period of 10 min, the samples are pooled and the DNA is precipitated, washed, dried and dissolved in 400μΙ TE.

The fragmented DNA is separated on a 0.4% preparation agarose gel (center well 120 mm χ 1.5 mm). Lambda DNA digested with BglII is used as a marker to determine the size of the partially digested DNA fragments after electrophoresis at 4 ° C and 40V (3 V / cm). The gel region containing fragments of the correct size is excised from the gel and the DNA is electroeluted from the gel in a sterile dialysis tube in 2ml TBE at 100V for 2 to 3 hours. The current is reversed for a period of 30s and the buffer containing the DNA is collected. Subsequently, the fragments are concentrated by ethanol precipitation and dissolved in 100μΙ TE.

Example 2.3 Preparation of Vector DNA and Cloning of High Molecular Weight DNA Fragments from A. niger N 400

In EMBL4

The genomic library of the A. niger strain N400 is constructed in the lambda vector EMBL4. The vector, the one Cloning capacity of 9-23 kbp is used by Frischauf u. a. (Rof.9) and by Kam et al. (Ref. 19) and was described by the Promega Biotechn. Inc. related. To avoid double insertions from different parts of the genome, is for the Cloning uses a minimum fragment length of 13.6kbp. It will be 10μς lambda EMBL4 DNA with 50 units of BamHI in the supplier's recommended buffer in one volume

of 100μΙ for 2 hours at 37 ⁰ C completely digested. The enzyme is inactivated by 10 min at 65 ⁰ C. The

NaCl concentration is increased to 15 mM, and 50 units of Sail are added, followed by another 2 hours of incubation

at 37 ^° C. After addition of EDTA to 25 mM and inactivation of the enzyme dOminute heating boi 65 ° C), the solution is mixed with equal volumes of phenol (TE-saturated), phenol / chloroform / isoamylalcohol 25: 24: 1 and chloroform /

Isoamyl alcohol (24: 1) extracted. To turn off the small BamHI / Sall polylinker fragments, the DNA becomes 0.6 volume Isopropanol after the addition of 0.1 volume 3 M sodium acetate, pH 5.2, precipitated. After 15 minutes on ice and

Centrifuge at 12000 x g for 15 minutes at 4 ° C, wash the precipitate thoroughly with 70% ethanol, dry and dissolve in 40μΙ TE.

Example 2.4: Ligatlon and in vitro packaging of genomic A. niger N400 DNA fragments

It is essential that the cos sites are hybridized to the vector prepared according to Example 2.3 prior to the ligation reaction. The vector in 10 mM Tris-HCl, pH 7.5, and 10 mM MgCl ₂ is heated for 10 min at 65 ⁰ C and then hybridized at 42 ⁰ C for one hour. From experimental ligations, it is determined that a ratio of vector to fragment of approximately 1: 1 (weight basis) yields most recombinants. Ligation was carried out in 50 mM Tris-HCl, pH 7.5.1 mM MgCl ₂ , 10 mM DTT and 1 mM ATP using 9.5 μg vector and 10 μg DNA fragments in a total volume of 100 μM. DNA ligase (BRL) was incubated at a concentration of 0.5 units ^ g DNAzugesetzt, and the ligation mixture overnight at 14 ⁰ C. To test for ligation, a sample of the ligated DNA is placed on an agarose gel. In addition, as a control, a vector amount of 0.5 μg is ligated without the addition of the fragments in an δ-pl volume. The large volume ligation mixture is concentrated by ethanol precipitation and dissolved in 20 μΙ TE prior to in vitro packaging. In vitro packaging is carried out with Promega Packagene extracts according to the manufacturer's instructions using ΙΟ-μΙ portions to package 1 μg of DNA. As a control, separately 1 μΙ of the high molecular weight control phage Lambda el 857 Sam 7, which is supplied with the extracts, packed separately. After packaging, 500 μΙ of the phage solution buffer (PSB) and 5 μΙ of chloroform are added. The recombinant phage stocks can be stored at 4 ⁰ C. The recovered library is constructed from two separate ligation experiments.

Example 2.5: Titration and amplification of A. nlger strain N400 genomic library

Cells of E. coll NM 539 are grown on an LB medium containing 0.2% maltose, 10 mM MgSO ₄ and 1 mM CaCl ₂ to an optical density (600 nm) of 1.0. To 0.1 ml of appropriate phage dilution in PSB, aliquots of this culture are added to 0.2 ml. After adsorption of the phages for 20 minutes at 37 ⁰ C 3 mL 0.6% sodium LB top agar are added at a temperature of 45 ° C, the mixture is plated on LB agar plates, and these incubated overnight at 37 ° C. The number of plaque-forming units (pfu) per ml of phase suspension is 12 χ 10 ⁵ and 4.2 x 10 ⁶ pfu / ml in the two prepared according to Example 1.4 phage stocks. After subtracting the background calculated from controls without fragments (17% and 40%, respectively), the absolute number of recombinants is 6 χ 10 ⁶ . The DNA contained in the recombinants is equivalent to more than 200 genomes of Aspergillus niger.

To amplify a library, βΟμΙ aliquots of the two phage stocks are used to infect E. coli NM 539 cells which are plated in LB agarose on LB agar plates and then incubated overnight at 37 ° C. The phages are eluted from the agarose by gently shaking the plates with 5ml PSB per plate for one hour at room temperature. The PSB is collected, centrifuged (10 min at 6000 g) to remove the bacteria and chloroform (0.5% final concentration) added. Both phage stocks, which are amplified approximately to the same extent, are then mixed (40 ml stock), titrated (8 χ 10 ⁹ pfu / ml) and stored at 4 ^0C.

Example 3 Examination of genomic library of A. nlger on nucleic acids related to polygalacturonases

Example 3.1: Synthesis of ollgonuclotide mixtures with the coding for the 17 kDa cyanogen bromide d fragment of polygalacturonase II

The oligonucleotides for testing Aspergillus niger genomic library prepared according to Example 2 are synthesized using the phosphoramidite method (M.H. Caruthers, ref. 8) with an Applied Biosystems oligonucleotide synthesizer (model 280B). The * 7 kDa cyanogen bromide fragment described in Example 1.2 is an internal peptide. Therefore, the amino acid sequence determined in Example 1.4 can be extended at the N-end with a methionine residue. The synthesized oligonucleotides are complex mixtures because of the degeneracy of the genetic code. For technical reasons, it is necessary to reduce the number of nucleotides in the mixture. To exclude the oligonucleotides with the wrong combination TG and AC at positions 10 and 11 and to limit the size of the mixture, two separate mixtures of oligonucleotides corresponding to the sequence in the coding strand are synthesized, taking into account the degeneracy of the genetic code. The number of oligonucleotides required is also reduced by introducing inosine as the taumet base at four different positions on the synthesized 29-mer, and so each mixture consists of 16 different oligonucleotides (Ohtsuka et al., Ref. 16). The two mixtures, designated HR6195 and HR 6196, represent DNA which encodes the following amino acid sequence and has the following composition:

Amino acid sequence: met ala phe ser val gin ala

HR6195: 5 '(d) ATG GCI TTR, TCI GTI CAR ₂ GCI

HR6190: 5 '(d) ATG GCI TTR ₁ AGI GTI CAR ₂ GCI

Amino acid sequence: asn asp tie HR6195: AAR ₁ GAR ₁ AT 3 ' HR6196: AAR ₁ GAR ₁ AT 3 '

wherein I is inosine, R _{1 is} T or C and R _{2 is} A or G.

Example 3.2: Synthesis of an oligonucleotide mixture encoding the S ^ kDA cyanogen bromide fragment of Polygalacturonase I

The δ kDa cyanogen bromide fragment described in Example 1.5 is an internal peptide produced by CNBr cleavage. Its amino acid sequence can therefore be extended at the N-end with a methionine residue.

The number of oligonucleotides required is reduced by introducing inosine as the tumbling base at five different sites on the 32-mer that are synthesized.

This limits the mixture to 24 oligonucleotides. The mixture designated HR6298 represents DNA which encodes the following amino acid sequence and has the following composition:

Amino acid sequence: mead ala asp giy ala val tie asp HR 6298: 5 '(d) ATG GCI AT ALL, GGL GCI GTI ATR ₂ GAR ₁ Amino acid sequence: giy asp giy HR 6298: GGI GAR ₁ GG 3 ',

wherein I is inosine, R, T or C and R _{2 is} T, C or A.

Example 3.3: "P-labeling of oligonucleotides

The lyophilized oligonucleotide mixtures HR6195, MR6196 and HR6298 are dissolved in concentrations of 29μΜ in water. Samples of these solutions are diluted tenfold to produce the reaction mixture. The reaction mixture is composed of either 20 pmoles of oligonucleotide mixture HR6195 together with 20 pmoles HR6196 or of only 4G pmol HR6298, L4 pmol [V- ³² P] ATP (NEN, 6000Ci / mmol) and 30 units T4 polynucleotide kinase (BRL) in 50μΙ Kinase buffer consisting of 50 mM Trie HCl (pH 7.6), 10 mM MgCl ₂ , 5 mM DTT, 0.1 mM EDTA and 0.1 mM permidine (Maniatis et al., Ref. 6, p. 122). The Inkubalion is performed at 37 ⁰ C for a period of 30min. The reaction is terminated by the addition of 4 μM 0.5 M EDTA (pH 8.0). The reaction mixtures are wound without purification to test the genomic library (Example 3.4) or probing Southern blots (Example 3.6).

Example 3.4: Checking the A. nlger N400 bank

A portion of the genomic library of Aspergillus niger strain N 400 described above (Example 2) is diluted in SM and 0.1 ml portions, each containing about 2000 pfu, are plated. Host cells are seeded by inoculating 50 ml LB medium supplemented with 0.2% maltose with 0.5 ml of an overnight culture of E. coll-NM 539 in LB medium, shaking at 250 rpm for 4 hours on a Gallenkamp orbital shaker 37 ⁰ C, followed by the addition of 0.5 ml 1M MgSO ₄ and 0.5 ml 0.5MCaCI ₂ , prepared. 0.2 ml aliquots of these cells are each mixed with a 0.1 ml portion of the phage suspension, and these mixtures are incubated at room temperature for half an hour. Then 3ml of 0.7% agarose

in LM medium at 47 ^° C., swirled briefly and immediately plated on LM agar plates. The plates are incubated overnight at 37 ⁰ C for 2 hours and quenched at 4 ° C.

From each plate, two replicates are made according to the plaque hybridization method of Benton and Davis (ref.7). The first filter (Schleicher and Schuell BA85) is placed on top of the plate for 1 min, the second replica for 2mh>, and the position of the replicas is marked using pink ink. After removing the filters, Me will be put into a dam! '; containing 100 ml of a denaturing solution (1 M NaCl, 0.5 M NaOH), duration 0.5 min, then 1 min in 100 ml neutralizing solution (0.5M Tris-HCl, pH 7.5.1, 5M NaCl). The filters are placed in a dish containing 3 χ SSC and gently rubbed with a gloved hand to remove bacterial debris and are rinsed with 3 x SSC. The filters are blotted, dried for 10 min at room temperature and baked on Whatman 3 MM paper for 2 hours in an oven at 8O ⁰ C.

The baked filters are wetted in 3 χ SSC, washed in this solution for one hour at room temperature and then transferred to a tray in which 250 ml of prewarmed (65 ⁰ C) Prähybridisationsgemisch are composed of 2 x SSC, if the oligonucleotide mixture HR6195 and HR6196, and from 1 χ SSC when the oligonucleotide gum HR6298 is used, also from 10 x Denhardts (0.2% BSA, Boehringer V fraction, 0.2% Ficoll 400, Pharmacia, 0.2% polyvinylpyrrolidone). 10, Sigma), 0.1% SDS and 0.1 mg / ml of sheared and freshly denatured herring sperm DNA. The prehybridization is carried out in a Rüttelwasserbad at 65 ⁰ C for 5 hours. Then the filters are washed once for half an hour in 250ml preheated (65 ° C) hybridization mixture, identical to the pre- or pre-hybridization until the elimination of herring sperm DNA is. Then the filters are placed in a different dish containing 150 ml of prewarmed (65 ⁰ C) Hybridisationsgemische to which the previously labeled combined oligonucleotide mixtures HR6195 and HR6196 (Example 3.1) or the labeled mixture HR6298 had been freshly added. In the case in which HR6195 and HR6196 are used, the shell is placed in the Rüttelwasserbad at 65 ⁰ C, the thermostat is set to 47 ⁰ C, and the hybridization is allowed to proceed for 14 hours. The filters are washed once for a period of half an hour in 250 ml prewarmed (47 ⁰ C) Hybridisationsgemisch at 47 ⁰ C, followed by washing at room temperature with two changes in 250ml 2 x SSC, each for a period of 45 min. A rigorous wash is performed by transferring the filters to a dish in which 250ml prewarmed (63. ⁰ C) 6 χ SSC, 0.05% sodium pyrophosphate are, and then incubating in a shaking water bath at 63 ⁰ C for a period of 30 min , Then the filters are washed at room temperature with two changes in 2 χ SSC for 30 min each. The filters were air dried, fixed on a support of Whatman 3MM paper, covered with a plastic envelope and exposed three days at -60 ⁰ C using an intensifying screen on Kodak XAR5 film.

In this way 6 positive signals are obtained from the six tested plates. Positive plaques are punched out with a sterile Pasteur pipette by carefully positioning the plates on the autoradiograph using the ink marks. The pieces of agar containing the positive plaques are added to 1 ml of SM and 2.5 μL of chloroform are added. Allowing the phage at room temperature for a period diffuse from one hour with occasional swirling, and then inkubiurt overnight at 4 ⁰ C. The agar and bacterial cell debris are removed by centrifugation for five minutes, 2.5μl of chloroform are added, and the phage stocks are stored at 4 ° C.

The positive clones are referred to as XC to KG and M. Since the phages are plated at high density, the positive plaques are purified twice by plating to low density and repeating the entire procedure of replica doubling, hybridizing and taking out the positive plaques.

In the case in which the oligonucleotide mixture 6298 HR is used, the tray in the shaking water is added at 65 ⁰ C, the thermostat is adjusted to 52 ⁰ C, and allowing the hybridization to proceed for 14 hours. The filters are then washed once in 250 ml prewarmed (52 ⁰ C) Hybridisationsgemisch for a period of half hour at 52 ⁰ C, followed by washing at room temperature with two changes of 250 ml 2 χ SSC, each over 45 minutes. Subsequently the stringent wash is performed by transferring the filter to a shell (64 ⁰ C) containing 250 ml prewarmed 4 x SSC, 0.05% sodium pyrophosphate, and then incubating for half an hour in a shaking water bath at 64 ⁰ C. Then The filters are washed at room temperature with two changes of 2 χ SSC for 30 min each. The filters are air dried, fixed on a support of Whatman 3MM paper, covered with a plastic envelope and exposed for three days C using an intensifying screen at -6O ⁰ to Kodak XAR film. 5

In this way one receives nine positive signals from the six tested plates. Positive plaques are punched out with a sterile pasteur pipette with careful positioning of the plates on the autoradiogram using the ink marks. The pieces of agar containing positive plaques are added to 1 ml of SM and 2.5 μL of chloroform are added. Allowing the phage at room temperature with occasional swirling of the diffuse agar for one hour, and then was incubated overnight at 4 ⁰ C. The agar and bacterial cell debris are removed by centrifugation for five minutes, 2.5μl of chloroform are added, and the phage stocks are stored at 4 ° C. The positive clones are designated PG Ι-λ 1-9. The positive plaques are further purified by plating at low density, gent using the 1,2kbp BamHI / EcoRI Frag.T \ PGW 1803 (see Example 3.8) as a heterologous probe for hybridization which at 6O ⁰ C is carried out while the washing is also carried out at 6O ⁰ C in 2 χ SSC.

Example 3.5: Isolation of lambda DNA

To isolate DNA from the recombinant clones, the phage are first amplified. For this purpose, E. coli LE 392 host cells were grown to an optical density (600 nm) of 1.0 in LB medium supplemented with 10 mM MgSO ₄ and 0.2% maltose. Then, separately, 50 μl of the stocks of purified phage are plated, as described in Example 2.5. After overnight incubation be! 37 ^° C., the phage were eluted from the non-confluent plates by stroking 5 ml of SM over the plates and incubating with gentle shaking for two hours. The alu phage are harvested and 0.1 ml of chloroform is added. The mixture is allowed to vortex briefly and cell debris is removed by centrifugation. The supernatant is recovered, it is added chloroform to 0.3%, and the resulting Plattenlysat is stored at 4 ⁰ C.

In order to obtain approximately confluent plates for the isolation of the phage DNA, portions of 10 μl of the plate lysates are plated with E. coli LE392 host cells. After incubation overnight at 37 ⁰ C the Agaroseoberschicht is scraped off from three nearly confluent plates. These layers are combined, it will 20ml SM and 0.4 ml of chloroform was added, and the resulting mixture is shaken at 37 ⁰ C for 30 min. Cell debris and agarose are removed by centrifugation

removed, the supernatant is recovered and its volume matched with SM to 18ml. An equal volume of 2M NaCl, 20% PEG 6000 (BDH, Poole, UK) in SM is added and the solutions are mixed and placed on ice. After 75 minutes, the phages are pelleted by centrifuging at 12,000 × g at 4 ° C. for 20 minutes. The supernatant is decanted and the remaining liquid is removed with Kleenex tissue. The pellet is resuspended in 3 ml SM and then extracted with 3 ml chloroform. The aqueous phase is treated 20min at 37 ⁰ C with RNase A (67 pg / ml) and DNase I (33μς / ηΊΐ). Then, this mixture is extracted by the addition of 2 ml of phenol, vortexing, the addition of 1 ml of chloroform, re-vortexing and separation of the two phases by centrifugation. The aqueous phase is extracted twice additionally with 3 ml of phenol / chloroform (1: 2) or 3 ml of chloroform. Then the DNA is precipitated from the aqueous phase by the sequential addition of 0.3 ml of 3M sodium acetate buffer (pH 5.2) and 6 ml of ethanol. This mixture is allowed to stand at 4 ⁰ C for 16 hours, then the DNA by centrifugation (10 min, 12000 g, 4 ⁰ C) was recovered. The pellet is dissolved in 0.4 ml of TE buffer, RNase A is added to it biszu 200μ9 / ΓηΙ and at 37 ⁰ C in one hour incubated. The DNA is precipitated, to 38 .mu.M 3 M sodium acetate buffer (pH 5.2) and 0.8 ml of ethanol are added at 4 ° C, acid one hour. The DNA is recovered by centrifugation and then dissolved in 100μΙ ΊΈ-Puffei.

Example 3.6: Restriction analysis of the PQII and PGI lambda clones of A. niger N 400

From the positive phage containing the PG II gene sequences, AD and λΕ are selected for further analysis. First, it is determined by restriction analysis that both phages contain inserts derived from the same region of the A. niger genome, and then a partial restriction map of XE is constructed.

There are 2 μρ of the phage DNA with 20 units of EcoRI or BamHI f ^ he combination of these enzymes in a volume of 100μΙ for 3 hours at 37 ⁰ C in the manufacturer recommended by (BRL) buffer and in the presence of 0.8mg / with RNase A digested. Then, 10μl of a 3M nitrate acetate buffer (pH 5.2) is added and the mixture is extracted with 80μl of chloroform. The DNA is precipitated from the aqueous phase by the addition of 250 μM ethanol, and the mixture is placed on ice for 1 hour. The DNA is collected by centrifugation, dissolved in 25μΙ of 1 x sample buffer and heated at 65 ⁰ C for 10min. The samples are treated on a 0.7% agarose gel using 1 μg lambda DNA (BRL) digested with HindIII as size markers. The gel is photographed on a UV transilluminator using a Polaroid film 667. The DNA is transferred to a nitrocellulose membrane from Schleicher and Schuell BA85 according to the method of Southern (1975), as described by Maniatis et al., Pp. 382-386 (reference 6). The membrane is then baked and hybridized with the combined, labeled oligonucleotide mixtures HR6195 and HR6196, as described in Example 3.3.

Fragment lengths are calculated from the photograph and the autoradiograms by comparison with the known marker bands. The size of fragments smaller than 5 kbp and determined after digestion of the DNA isolated from the phages AD and AE with EcoRI, BamHI or the combination of these enzymes is given in Table III. In the resolution of the electrophoresis system used, it is not useful to compare fragments of greater length. As evidenced by the presence of some reduced intensity bands in the EcoRI digests shown in Table III, EcoRI has not completely digested the DNA. The fragments which are present in the EcoRI / BamHI double digestion, but not in one of the individual digestions, have comparable intensities to those of the BamHI fragments in the same size range. You must therefore represent completely digested products. The fragments which hybridize to the combined oligonucleotide mixtures HR6195 and HR6196 are, in the case of AE, a fragment larger than 10kbp in BamHI digestion, a 7.4kbp EcoRI fragment and a fragment larger than 10kbp is in the EcoRI digest and a 2.8kbp fragment as well as a fragment larger than 10kbp in the BamHI / EcoRI double digest.

In the case of AD, the fragments which hybridize to the combined oligonucleotide mixtures HR6195 and HR6196 are as follows: a fragment larger than 10kbp in the BamHI digest, a 5.8kbp fragment, and a fragment larger than 10kbp is in the EcoRI digest and a 1.2kbp fragment as well as a fragment larger than 10kbp in the BamHI / EcoRI double digest. If more fragments are observed, e.g. In EcoRI digestions, the larger fragment is considered a product resulting from partial cleavage. Hybridization of equal sized fragments derived from AD and AE with the oligonucleotide mixtures is not observed. From the differences in the phages AD and AE listed above, it is concluded that the phage AD and AE are not identical. However, Table III lists two EcoRI fragments, three BamHI fragments and at least four BamHI-EcoRI fragments that are the same size in AD and AE. These phages must have their origin in the inserts of these phages, since the vector contains no EcoRI or BamHI sites, except for the BamHI sites used to insert the fragments of Aspergillus DNA into the vector, and the EcoRI sites flanking these BamHI sites and thus also flanking the inset (Frischauf et al. Ref. 9). It is therefore concluded that the inserts of the phages AD and AE were derived from the same region of the A. nlger genome. In conjunction with the fact that the relevant hybridizing BamHI-EcoRI fragment of AD is smaller than the corresponding fragment of AE, e.g. 1.2 kbp compared to 2.8 kbp, and assuming that the observed sub-chords in the restriction pattern are not the result of a cloning artifact, it follows that the EcoRI site of the hybridizing 1.2 kbp BamHI-EcoRI Fragment of AD is not derived from A. niger DNA and is one of the EcoRI sites flanking the inset of this phage. In addition, it follows that the insertion of AD in one direction extends at most 1.2 kbp beyond the sequence which hybridizes with the oligonucleotide mixture. In addition, it is concluded that the sequence of AE that hybridizes to the oligonucleotide mixture is within 1.2 kbp from the BamHI site to the boundary of the hybridizing 2.8 kbp BamHI-EcoRI fragment (Figure 1).

XD λΕ 4.4 4.4 2.8 2.4 2.2 2.2 1.6 1.6 1.5 1.5 1.2 0.84 0.84 0.72 0.72 0.68

Table III

Approximate size of fragments (in kbp) smaller than 5kbp recovered after digestion of DNA isolated from phage AD and XE with the restriction enzymes EcoRI, BamHI, or the combination of these enzymes. (P) denotes fragments likely to result from partial cleavage.

EcoRI BamHI EcoRI + BamHI

XD λΕ AD XE

3.8. 3.8

3.5 (Pi 3.2 (P) 2.4 2.4 2.4

2,2 2,2

1.6 1.6

0.98

0.62 0.62 0.62 0.62

To construct a partial restriction map of XE, phage DNA is digested with EcoRI, XbaI, HindIII and all possible combinations of these enzymes. This happens in two steps. First, 6μg of DNA are incubated for 105min at 37 ⁰ C either in the presence or absence of 200 units of EcoRI in a volume voin 200μΙ containing the manufacturer (BRL) recommended buffer and RNase A (2 mg per ml). Then the reaction mixtures are extracted with 100 .mu.l phenol / chloroform (1: 1) and then with 100 .mu.l chloroform. DNA is precipitated from the aqueous phase by the addition of 0.1 volume of 3M sodium acetate buffer and 2 volumes of ethanol. After the whole thing has been on ice for 10min, the precipitates are collected by centrifuging. The pellets are dried in air and dissolved in ΙΟΟμΙ TE buffer. Then the solutions are used for subsequent incubations, either in the absence of the restriction enzyme (EcoRI digested material only) or in the presence of HindIII, XbaI or the combination of these enzymes. Incubations are carried out for 2 hours at 37 ⁰ C in a volume of 20 μΙ containing 10 μΙ of the respective DNA solution, RNase A (2 mg / ml), 10 units of the respective restriction enzyme and recommended by the manufacturer (BRL) buffer , The incubation is stopped by the addition of 5 μΙ of the five-fold concentrated sample buffer, and then the samples are analyzed as described above.

On the autoradiogram, only one single hybridizing band greater than 10 kbp is detected in the digestions with HindIII, XbaI and the combinations of these two enzymes. A band of about the same size is present in all other digests, albeit at a lower intensity, indicating that the enzymes have not completely restricted the DNA. The second and most strongly hybridizing band in the EcoRI digestion represents a 7.4kbp fragment. This band, again indicating incomplete dispersion, is present in the digests with EcoRI and a second enzyme, albeit at a lower intensity. In addition, the EcoRI / HindIII double digest and the EcoRI / HindIII / XbaI triple digest give a hybridizing fragment of 3.6 kbp. A 4.1 kbp fragment hybridizing to isi is detected in the double digestion with the enzymes EcoRI and XbaI. This fragment is also present in the triple bond with the enzymes EcoRI, HindIII and Xbal, but in very low intensity. In the latter case, the 4.1 kbp fragment is considered to be a partial cleavage product.

It is concluded that the 7.4 kbp EcoRI fragment which hybridizes with the combined oligonucleotide mixtures HR6195 and HR6196 can be cleaved with each of the enzymes XbaI, HindIII or BamHI and that the location of the cleavage site of these enzymes is as shown in Fig 1 must be shown. This figure gives only a partial restriction map, e.g. For example, the 7.4 kbp EcoRI fragment could still contain more than one cleavage site for one of the enzymes HindIII, Xbal and BamHI, in which case only the location closest to the particular sequence closest to the one would be shown hybridized hybrid oligonucleotide mixtures HR6195 and HR6196.

No XbaI or HindIII digest is made with the phage XD, but it is believed that the XbaI and HindIII restriction sites are located as in phage XE.

From the nine positive clones carrying PGI gene sequences, the four phages PGI-X4, -X5, -X6 and -X7 are selected for further analysis. First, it is determined that the phage contain inserts derived from the same region of the A. nlger genome, and then a partial restriction map of X5 is prepared, as described above for the PGII gene sequence containing phages D and E contains. The DNA is digested with restriction enzymes (enzymes see Table IV) according to the recommendations of the enzyme manufacturer. The fragments are separated on an agarose gel and blotted to nitrocellulose as described above. Then the membrane is baked and hybridized with a previously nick-translated 1.2kb BamHI / EcoRI fragment of the structural gene coding for PGII. This fragment is derived from plasmid pGW 1803, which is described in Example 3.8. The fragment is isolated from slices of agarose gel, and 50 ng of the fragment is nick-translated as described by Maniatis et al. (Pp. 109-112, ref. Before the nick-translated DNA is added to the hybridization mixture, it is denatured for 10 minutes in a boiling water bath. The nitrocellulose filters are hybridized with the radioactive probe, as described in Example 3.8, but the prehybridization and the hybridization temperature are each 6O ⁰ C. The membranes are then washed at 60 ^° C. using a series of preheated buffers. First, the membranes are rinsed in 6 χ SSC and washed twice in hybridization buffer for half an hour. Then the filters are washed successively in 4 x SSG and 2 x SSC for 30 min per buffer. These buffers contain both 0.1% SDS and 0.1% Na ₄ P ₂ O? χ 10HjO. After the last wash, the membranes are rinsed briefly in 0.1 χ SSC and then allowed to dry, then exposed to X-ray film.

The probe used represents a small portion of the PG II promoter region (200 bp) and much of the coding sequence. Under the described hybridization conditions, this probe gives strong signals to all phage isolated above (see Example 3.4) containing PGI sequences.

Fragment lengths are determined from the photograph and the autoradiograms by comparison with the known marker bands. Table IV lists the hybridizing fragments and their approximate size.

Table IV

The approximate size of hybridizing fragments (kbp) recovered after digestion of the DNA isolated from PGI λ4-7 with the restriction enzymes EcoRI, BamHI, Xhol and the combinations of these enzymes and with the BamHI / BglII

restriction enzyme phage λ5 A6 λ7 A4 8.6 23 8.6 Bam 8.6 6.4 6.4 6.4 EcoR! 6.4 6.4 6.4 6.4 EcoRI / BamHI 6.4 > 23 £ 23 a 23 XhoI 2:23 2.0 2.0 2.0 XhoI / EcoRI 2.0 7.5 > 23 7.5 BamHI / BglII 7.5

Table IV shows that all phages contain an EcoRI fragment of 6.4 kbp and a Xhol / EcoRI fragment of 2.0 kbp, while an EcoRI / BamHI double digestion also leads to a 6.4 kbp. The pages λ4, λ5 and λ7 also have identical fragments when digested with BamHI (8.6kbp) and BamHI / Bglll (7.5kbp). The vector contains no BamHI sites except for the BamHI sites, which are used to insert fragments of Aspergillus DNA (Frischauf et al Ref. 9). The insets of these three phages are therefore considered to be derived from the same region of the A. nlger genome. To create a partial restriction map, A5 phage DNA is also digested with KpnI, SmaI, SstI and Sail and BamHI in conjunction with these enzymes. In addition, a Bglll / Xhol digest is analyzed. All of these incubations are carried out for 3 hours at 37 ⁰ C, except Saml (30 ⁰ C), in a volume of 20μΙ containing 1 pg of phage DNA. The fragments that hybridize at 6O ⁰ C with the PGII probe are listed in Table V.

Table V

The approximate size of hybridizing fragments (kbp) recovered after digestion of DNA isolated from PG Ι-λ5 with the restriction enzymes Bglll, Kpnl, SmaI, Sstl, Sail and with combinations of BamHI with these enzymes or with XhoI were. A double digestion by Bglll / Xhol is also performed.

fragment length (Kbp) fragment length (Kbp) restriction enzyme 8.6 restriction enzyme Bam 9.7 7.5 BglII 5.1; 2.7 BamHI / BglI 4.2 KpnI 6.4 BamHI / XhoI 3.0 EcoRI 4.7 BglII / XhoI 4.8; 2.8 Smal 9.9 BamHI / KpnI 8.3 SSTI 8.9 BamHI / SstI 8.5 Sail BamHI / Sall

A restriction map of PGI-A5 can be constructed from the hybridizing fragments, from which it can be concluded that the gene encoding polygalacturonase I is located at the 8.6 kbp BamHI fragment.

Example 3.7: Construction of pGW1800 and pGRW1803

The relevant EcoRI-Xba! Fragments of phages AD and AE are inserted into pEMBL vectors (Dente and Cortese, Ref. 10), resulting in plasmids pGW1803 and pGW1800, respectively.

From Fig. 1 and Example 3.5 it is deduced that the phage AD must have a 2.5 kbp EcoRI-XbaI fragment which is identical to a part of the 4.1 kbp EcoRI-XbaI fragment of phage AE , There are digested 6 \ ig of AD DNA with 60 units of Xbal for 2 hours at 37 ° C in a volume of 200μΙ in the recommended BRL buffer plus RNase A (1.5 mg / ml). Then, the NaCl concentration is adjusted to 14 oMM, concentrated reaction buffer is added to compensate for the increase in volume, 60 units of EcoRI are added, and the incubation is continued for 2.5 hours in a volume of 230 μΙ. Subsequently, the reaction mixture is extracted with 100 μΙ chloroform, and the DNA is precipitated from the aqueous phase by the addition of 0.1 volume of 3 M sodium acetate buffer (pH 5.2) and 2 volumes of ethanol. After incubation at 4 ^° C. for 16 hours, the DNA is recovered by centrifugation, the pellet is air-dried and then dissolved in the same buffer. Restriction fragments are separated on a 0.6% low melting agarose (BRL) gene in 0.5 χ TBE buffer containing ethidium bromide. The DNA fragments are visualized under UV light and a gel disc containing the 2.5 kbp EcoRI-XbaI fragment is isolated. Phage AE DNA is incubated with the restriction enzymes XbaI and EcoRI essentially as described above. After extraction with chloroform, the DNA is precipitated, pelleted by centrifugation, dissolved in the same buffer, and electrophoresed on a 0.6% agarose gel in 1X TBE buffer. A gel disc containing the 4.1 kbp Xba I-Eco RI fragment is recovered and stored at -2O ⁰ C. To the bottom of a 0.5 ml microcentrifuge tube containing 60 μΙ of the high TE buffer (10 mM Tris-HCl, pH 8.0, 10 mM EDTA) is added a plug of silanized glass wool. The gel disc is thawed, placed in the test tube and the tube frozen in liquid nitrogen. In the bottom of the small tube a small hole is pushed, and it gets into a

Add 1 .mu.L microcentrifuge tube, and the buffer and DNA from the gel disc are collected by centrifugation. The remainder of the gel disc is resuspended in 50 μL of the high TE buffer, this suspension is frozen again in liquid nitrogen, and the buffer is collected by centrifugation. The eluates are then combined and extracted with 100μΙ chloroform. The DNA is precipitated from the aqueous phase, collected by centrifugation and dissolved in 40 μM TE buffer. The DNA concentration is determined by agarose gel electrophoresis, followed by visualization of the band under UV light, using 1 μρ of the HindIII-digested lambda DNA (BRL) as a reference. The vectors pEMBL18 and pEMBL19 are prepared by sequential digestion with XbaI and EcoRI under conditions recommended by the manufacturer (BRL). The extraction of the DNA mi onol, phenol / chloroform (1: 1) and chloroform and the precipitation of the DNA with ethanol are carried out as described by Maniatis et al. (Ref 6) except omitting the isoamyl alcohol from the chloroform solution and the temperature used for the precipitation of the DNA is 4 ^° C.

DNA fragments are ligated to the respective vector in a reaction volume of 25μΙ containing the BRL-recommended buffer plus ATP (1mM), 1.5 units T4 DNA ligase (BRL), 10ng of the vector DNA raised on as described above, and the relevant restriction fragment. XbaI and EcoRI digested with pEMBL18 are used for the construction of pGW 1800 plus an equimolar amount of the purified 4.1 kbp XbaI fragment from AE. The reaction mixture is incubated for 16 hours at 16 ⁰ C, then the reaction is stopped by the addition of 125 μΙ distilled water and freezing. XbaI and EcoRI-digested pEMBL19 is used for the construction of pGW 1803. In this case, the agarose disc containing the 2.5 kbp XbaI-EcoRI fragment of D is melted at 60 ° C and a volume of 4 μM containing about 15 ng of the DNA becomes 11 μM distilled water is added, whereupon the other components of the reaction mixture are added. The ligation reaction is allowed to proceed for 14 hours at 20 ^° C, then an additional unit of T4 DNA ligase is added. The reaction is continued for another 7 hours, and then the reaction is terminated as described above.

15μΙ of the resulting reaction mixture is used to transform E. coli, as described in the BRL M13 Cloning / Dideoxy Sequencing Handbook (p.30-33; ref 11), but E. coil DH 5aF 'and E. coll JM109 to an OD ₆ M value of 0.7 or 0.9 g>. before the pistons are put on ice. The former strain is transformed with the fragment of AD using the ligation reaction mixture, the latter strain is transformed with the fragment AE using the ligation reaction mixture. After thermal shock, the cells are incubated on ice for two minutes, then 1 ml of LB medium is added and the cells are incubated at 37 ^° C. for one hour. The cells are pelleted by low speed centrifugation, 1 ml of the supernatant is removed, and the cells are gently resuspended. The plates are then plated on LB agar plates containing ΙΟΟμρ / ml ampicillillin and blotted with an IPTG / X gall solution (= 200μΙ H ₂ 0.30 μΙ dimethylformamide containing 2% X-GaI and 20μΙ of a 24 mg solution / ml IPTG in water). The plates are incubated overnight at 37 ^° C. Several single white colonies are used to prepare overnight cultures in LB medium supplemented with 0.1% glucose and 75μρ / (μ) Ι ampicillin. These cultures are used for plasmid isolation using the mini-preparation method of Holmes and Quigley (ref 12). The plasmids are digested with several restriction enzymes according to the manufacturer's recommendations (BRL) and in the presence of RNAse A (0.5 mg / ml), and the products are analyzed on agarose gel. Plasmids leading to the formation of XbaI-EcoRI, BamHI-EcoRI and HindIII fragments of the expected size are selected and the E. coli cells they carry are kept at -20 ° C on glycerol ,

Two new plasmids are constructed. pGW1800 is the 4.1 kbp XbaI-EcoRI fragment of phage AE inserted into the vector pEMBL18. pGW1803 is the 2.5 kbp XbaI-EcoRI fragment of phage AD inserted into the vector pEMBL19.

Example 3.8: Restriction analysis of pGW1600 and pGW1803.

The relationship between pGW 1800 and pGW 1803 is confirmed by extended restriction analysis. The particular sequence which hybridizes to the combined oligonucleotides HR6195 and HR6196 is referred to as a specific region of pGW1803. The lack of cloning artifacts, such as deletions or ligations of A. niger-derived DNA fragments, is determined by comparison of the restriction fragments derived from plasmid pGW1800 and A. niger-N 400 DNA, respectively.

pGW1800 and pGW 1803 are propagated in E. coli strain JM109 and DH5aF ', respectively, and plasmid DNA is recovered from 250 ml overnight cultures in LB-modium supplemented with 0.1% glucose and 100 μg / ml ampicillin by Maniatis et al. (p.90-91; ref.6), and finally resuspended in TE buffer. Since pGW 1800 is also used to transform A. niger, it is purified by banding in a cesium chloride gradient. To 2.5 ml of DNA solution in TE are added 3.3 g of CsCl and 1 ml of ethidium bromide (10 mg per ml in water). The centrifugation is carried out in a Beckman ^e- rotor VTi 65.2 at 20 ⁰ C for 16 hours at 45000U / min. Of the two visible under UV light, fluorescent bands, the lower, which contains covalently closed circular plasmid DNA, obtained by lateral puncturing of the tube. The DNA solution (about 1 ml) is washed five times with water-saturated butanol to remove the ethidium bromide. Then the volume is brought to 15 ml with water and the DNA is precipitated by the addition of 30 ml of ethanol. The DNA is collected by centrifugation, and then the pellet is washed once with 75% ethanol and then dissolved in TE buffer and stored at -2O ⁰ C. pGW1803 is not isolated from a CsCl gradient, but undergoes a faster procedure. RNase A is 4 ml DNA solution to a concentration of 10Opg / ml was added, and this mixture is incubated C for one hour at 37 ⁰ and then with an equal volume of phenol, phenol / chloroform (1: 1) and chloroform. Then the DNA is precipitated from the aqueous phase by the addition of 0.4 ml of 3M sodium acetate buffer, pH 5.2 and 8 ml of ethanol. The DNA is collected by centrifugation, the resulting pellet is washed with 75% ethanol and air dried and then dissolved in TE buffer.

A. niger DNA is prepared by a method slightly modified from that used for isolation of plant RNA (Slater, Ref. 21). Mycelium is washed with saline, frozen in liquid nitrogen, and 2.5 g are split using a Mikrodismembrationsgerätes (brown). The mycelium powder is extracted with freshly prepared extraction puffiir. The extraction buffer is prepared as follows: 5m Triiosopropylnaphthalenesulfonic acid (TNS, 20mg / ml) are mixed with 5ml p-aminosalicylic acid (PAS, 120mg / ml) and 2.5ml 5x RNB buffer (5x RNB contains

121.1 g Tris, 73.04 g NaCl and 95.1 g EGTA in 11, pH 8.5). After the addition of 7.5 ml phenol, the extraction buffer is equilibrated 10 minutes at 55 ⁰ C. The warm buffer is then added to the mycelial powder and the suspension is mixed for 2 minutes. Then 5 ml of chloroform are added and mixed for 2 minutes. The phases are separated by centrifugation (10 minutes, 10,000 xg), and the aqueous phase is extracted once more with 10 ml of phenol / chloroform (1: 1) and then twice with chloroform.

The aqueous phase contains both RNA and DNA. The DNA is precipitated with 2 volumes of ethanol at room temperature and collected by centrifugation (10 min, 10000 g), washed twice by repeated dissolution in distilled, sterile water and reprecipitation with ethanol. RNA is removed by the addition of RNase A (20 μg / ml) to the final solution.

To construct physical maps of pGW1800 and pGW1803, various reaction mixtures are prepared containing about 1 μg of plasmid DNA, RNase A at 1 mg / ml (pGW 1803 only), BRL recommended relevant buffer, and 10 units of plasmid DNA Contain restriction enzymes, wherein different enzymes are selected for the individual reaction mixtures. In several cases, a combination of two different enzymes is chosen, or plasmid DNA is restricted by a particular enzyme or combination of enzymes, followed by precipitation of the DNA in the presence of sodium acetate and ethanol and subsequent resumption of the DNA by centrifugation Material is then used as a substrate for a second or third restriction enzyme. The reaction mixtures are incubated at 37 ^° C. for one hour, then the reaction is stopped by the addition of five times concentrated sample buffer, and then the reaction products are analyzed on a 1% agarose gel in TBE buffer. From the calculated size of the specific fragments, the position of each restriction enzyme locus is derived relative to a reference point arbitrarily chosen at the unique XbaI site. The restriction map of pGW1800 is given in Fig.2. The restriction map from the A. niger-derived DNA of pGW 1803 (not shown) is identical to the map of pGW 1800 from the XbaI site in position 1 to the HincII site in position 2000. However, pGW 1803 does not contain a Bglll location that exists in position 2400 in pGW1800. The 0.4 kbp Hincll-BglII fragment of pGW1800 had the same electrophoretic mobility as the Hincll-EcoRI fragment of pGW1803 located at the end of the A. nlger-derived insert DNA. It is concluded that the A. nlger-derived DNA of pGW1803 interacts with A. nlger-derived pGW 1800 DNA between the Xbal site at position 1 and a site very close to the BglII site at 2400. but this does not include, is identical. Consequently, the deduced size of the EcoRI-XbaI fragment of the phage XD of 2.5 kbp (Example 3.6) represents a small overestimation.

To locate the particular sequence which hybridizes to the combined oligonucleotide mixtures HR6195 and HR6196, pGW1803 DNA is restricted and the resulting fragments are separated in the manner described above. The DNA is then transferred to a nitrocellulose membrane and allowed to hybridize with the combined and labeled oligonucleotide mixtures HR6195 and HR6196, as described above. The fragments that hybridize with the combined oligonucleotide mixtures HR6195 and HR6196 are a 0.64 kbp Hincll fragment in Hincll digestion and a 0.62 kbp Ncol-EcoRI fragment in the Ncol / EcoRI double digest. It is concluded that the particular sequence which hybridizes to the combined oligonucleotide mixtures HR6195 and HR6196 is located between the NcoI site at position 1750 and the HincII site at position 2000 of the pGW 1803 restriction map, these coordinates coinciding with the same sequence on the restriction map of pGW1800 match. The lack of cloning artifacts is determined by comparing the restriction fragments of pGW 1800 with the restriction fragments derived from A. niger N400 DNA. Digestions of pGW 1800 are made in the manner described above. Digestions of the chromosomal DNA of strain N 400 are carried out at 37 ⁰ C in a reaction volume of 200μΙ, which consists of 2μΙ DNA, 0.5 mg / ml RNase A, a BRL supplied reaction buffer (REACT buffer 2 for Xhol, Xbal, EcoRV and BgIII, REact buffer 4 for Kpnl and REact buffer 3 for EcoRI and Sail) and 90 units of the respective enzyme. The reaction mixture is incubated for 2 hours and then extracted with 100μΙ chloroform. Then the ÜNA from the aqueous phase by the addition of 20μ | of a 3M sodium acetate buffer, pH 5.2, and 0.5 ml of ethanol, followed by standing on ice for 45 minutes. Thereafter, the DNA is resumed by centrifugation and dried in air. The DNA is resolved in the sample buffer and these samples and the digests of pGW1800 and lambda DNA size marker are placed on a 0.7% agarose gel in TBE buffer. After electrophoresis, the resulting pattern is documented and the DNA in the lanes containing the digests of the A. niger chromosomal DNA is transferred to a nitrocellulose membrane, both in the manner described above. The membrane is baked and cut into two parts which are hybridized with different probes.

The probes used for hybridization are the nick-translated EcoRV-BglII fragments of 1.45 kbp and 2.05 kbp of pGW 1800. The fragments are previously isolated from the slices of an agarose gel as described above and 100 ng the fragments are nick-translated in separate reactions, such as that of Maniatis et al (Pp. 109-112; ref.6). Before addition to the hybridization mixture, the nick-translated DNA is denatured for 10 min in a boiling water bath.

That is baked nitrocellulose filters are wetted in 3xSSC and then transferred to separate dishes, in which 100 ml of prewarmed (68 ⁰ C) hybridization buffer is composed of 6 χ SSC, 1OmM EDTA, 0.1 mg per ml freshly added, sheared and denatured Herring sperm DNA, 0.1% Na ₄ P ₂ O ₇ x 10H ₂ .0.5% SDS and 5x Denhardts (0.1% BSA, Boehringer, fraction V, 0.1% Ficoll 400, Pharmacia, 0, 1% polyvinylpyrrolidone-10, Sigma). The Vorhybridisation carried out for two hours at 68 ⁰ C in a shaking water bath and then the hybridization buffer with fresh buffer (75 ml) is replaced, then is added to the one of the nick translation subjected probe. The hybridization is allowed to continue at 68 ^° C. for at least 16 hours. The membranes are then washed at 68 ° C using a series of preheated buffers containing all 0.1% SDS and 0.1% Na ₄ P ₂ O ₇ χ 10H ₂ O but a decreasing amount of SSC. First, the membranes are rinsed in 4 x SSC and then washed twice in the length of 10 min in 4 x SSC.

The filters are then washed successively for 30 min in 4 χ SSC, 2 χ SSC, 0.5 χ SSC, 0.2 χ SSC and 0.1 χ SSC. After the last wash, the membranes are rinsed briefly in 0.1 x SSC and then allowed to dry, after which they are exposed to X-ray film.

The membrane probed with the 1.45 kbp EcoRV-BglII fragment contains the following hybridizing fragments: a 2.4 kbp fragment in the Xhol digest, a 2.8 kbp and a 1.2 kbp Fragment in the Kpnl resolution and a 1.3

kbp fragment in the Bglll / EcoRV double digest. The membrane probed with the 2.05 kbp EcoRV BglII fragment contains the following fragments: a large fragment of approximately 11 kbp in the EcoRI / Sall double digestion, 2.3 kbp and 2.1 kbp Fragments in the Xhol digest, 2.3kbp and 1.4kbp fragments in the Xho / XbaI double digest, 1.2kbp fragments in the KpnI digest, and a 2.0kbp fragment in the EcoRV / BglII double digest. For four of the hybridizing fragments, only the presence and a minimum size can be deduced from the restriction map of pGW1800, i. H. Fragments having homology with an inserted probe one end of which is outside the sequence present in pGW1800. These fragments are in the case of the 2.05 kbp EcoRV Bglil probe the fragments in the EcoRI / Sall digestion, the 2.1 kbp fragment in the Xhol digest and the 3.2 kbp fragment in the KpnI digestion and in the case of the 1.45 kbp EcoRI-BglII probe, the 2.8 kbp fragment in the KpnI digestion. These fragments are all smaller than the minimum size deduced from the pGW1800 restriction map. The different hybridizing fragments of genomic A. nlger DNA can be correlated to fragments present in the digests of pGW1800 and all have a calculated size very close to the size derived from the pGW1800 restriction map. It is concluded that the A. niger-derived pGW 1800 DNA is a plausible representation of a portion of the A. niger N 400 genome.

Example 3.9: The construction of pGW1900 and pGW1902 and their restriction analysis.

The 8.6 kbp BamHI restriction fragment of phage PGI-X7, which hybridizes with PGII coding sequences (see Table IV, Example 3.6), is inserted into the pUC9 vector (Vieira, J. and Messing, J. 1982, Gene 19, 259-268), resulting in plasmids pGW 1900 (see Fig. 3) and pGW1901, which have insertion in opposite directions. ^ _L to 5 .mu.g PGI-A7 OMA 5μΙ in TE buffer 1 μΙ spermidine are added to a final volume of 30μΙ a 10 mM stock solution, 20 units of BamHI, the recommended by BRL ^ reaction buffer and sterile distilled water. A quarter of loading buffer is added to the digested samples (loading buffer = 0.25% bromophenol blue, 0.25% xylene cyanol and 15% Ficoll 400 in H ₂ O). The reaction fragments are separated on a 0.6% agarose gel in 1 × TAE buffer containing ethidium bromide (50 × TAE buffer = 252 g Tris, 57.1 ml acetic acid and 100 ml 0.5M EDTA, pH 8, 0, per liter).

The DNA fragments are visualized under UV light and a gel slice containing the 8.6 kbp BamHI fragment is isolated. DNA fragments are electrophoretically isolated by conventional methods. Elution is at 100V for one hour. The DNA is collected and precipitated with 2 volumes of ethanol. After centrifugation in an Eppendorf centrifugation for 30 minutes, the precipitate is collected, dried in a Speedvac instrument and dissolved in 10μΙ TE buffer. Vector pUC9 (1 μς) is linearized using 10 units of BamHI at 37 ⁰ C for 1.5 hours under Dauervon using the recommended BRL buffer in a total reaction volume of 20 μΙ. Subsequently, 1 μΙ CIP solution (about 2 units) is added and the mixture is incubated for 30 min at 37 ° C. The linearized vector is also prepared by electrophoresis and is dissolved in 20 μΙ TE, which corresponds to a DNA concentration of approximately Bong / μΙ.

In the ligation reaction, 1 μΙ of the linearized and ClP-treated pUC9 vector (50ng) and 4 μΙ of the BamHI fragment (approximately 100 ng) are ligated with 1.2 units of T4 DNA ligase in an angiogenic ligase buffer. The final reaction volume is 10ml. The reaction is allowed to run for 14 hours at 14 ⁰ C, then the mixture is diluted with TE to 50 μΙ.

For transforming E. coil in the manner described in the M 13 Cloning / Dideoxy Sequencing Handbook of BRL (pages 30 to 33; ref 11), we used the 50 μM of the resulting ligation reaction mixtures, but E. coli was used. DH 5aF 'is taken to an OD ₆₆ o value of 0.5 to 0.7 before the flasks are placed on ice After heat shock, the cells are incubated on ice for two minutes then 1 ml of LB medium is added and the cells are incubated for one hour at 37 ° C. The cells are pelleted by low speed centrifugation, 1 ml of the supernatant is removed, and the cells are gently resuspended, then the cells are plated on LB agar plates, which 1 (^ g / ml ampicillin and an IPTG / X-gall solution (= 200 μΙ H ₂ 0.30 μΙ dimethylformamide containing 2% X-GaI and 20 μΙ of a solution of 24 mg / ml IPTG in water) The plates were dried overnight at 37 ^° C Several single white colonies are used to prepare overnight cultures in LB medium supplemented with 0.1% glucose and 75 μ / I ampicillin. These cultures are used to isolate plasmid using the mini-preparation method of Holmes and Quigley (ref 12). The plasmids are digested with various restriction enzymes, following the manufacturer's recommendations (BRL) and in the presence of RNase A (0.5 mg / ml), and the products are analyzed on an agarose gel. Plasmids which give BamHI fragments of the expected size are selected and the E. coli cells carrying them are maintained at glycerol at -20 ° C. The new plasmids pGW 1900 (shown in Figure 3) and pGW 1901, which carry the insert in the opposite direction, are used for further experiments.

pGW1900 is propagated in E. coli strain DH 5aF 'and the plasmid DNA is recovered from 250 ml overnight cultures in LB medium supplemented with 0.1% glucose and 100 pg / ml ampicillin, such as that of Maniatis et al. Pp. 90-91; Ref. 6), and finally resuspended in TE buffer. Since pGW1900 is also used to transform A. nlger, it is purified by banding in a cesium chloride gradient. To 2.5 ml of DNA solution in TE are added 3.3 g of CsCl and 1 ml of ethidium bromide (10 mg / ml of water). The centrifugation is performed in a Beckmanr.® rotor VTi 65.2 at 20 ⁰ C for 16 hours Dauervon 45000U / min. Of the two visible under UV light, fluorescent bands, the lower, which contains covalently closed circular plasmid DNA, obtained by lateral puncturing of the tube. The DNA solution (about 1 ml) is extracted five times with water-saturated butanol to remove the ethidium bromide. Then the volume is brought to 15 ml with water and the DNA is precipitated by the addition of 30 ml of ethanol. The DNA is collected by centrifugation and the pellet is washed once with 75% ethanol and then dissolved in TE-Puffor and stored at -20 ° C.

In addition, from a pGW1900-KpnI digestion, a 2.7 kbp KpnI DNA fragment was electrophoretically isolated from an agarose gel slice and inserted into pEMBL18 (Dente and Cortese, ref. 10), yielding plasmids pGW1902 (see Fig. 4). or PGW1903 results.

About 1902 to construct a physical map of PGW 1900, PGW, werdon different reaction mixtures prepared, the plasmid DNA about 1 ig \, the relevant buffer as recommended by BRL and 10 units of a restriction enzyme, or

Combination of two different restriction enzymes included. The reaction products are analyzed on 1% agarose gel in TAE buffer. From the calculated size of specific fragments, the position of each restriction enzyme locus in Figures 3 and 4, respectively, is determined.

Example 3.10: Molecular cloning of the polygalacturonase II gene (pgall) from A. niger NW756

The genomic DNA of A. niger NW756 is analyzed by Southern blot analysis using the pgall gene of A. niger N400 (i.e., the 1.2 kbp BamHI-BglII fragment of pGW 1800) as a probe. Compared to the description in Example 7.1, two modifications have been made. In this case, restriction enzymes are chosen which cleave within the structural component of the A. niger N400 pgall gene, and the hybridization conditions are more stringent, ie, the "homologous" conditions described in Example 7.2 apply. In the BamHI digestion Under these conditions of hybridization, a single sequence is detected, and this is therefore defined as the pgail gene of A. niger NW756 A single Hincll hybridizing fragment of 3.3 kbp is observed. The hybridizing Xhol-BglII fragment is 5.5kbp, and these results are not consistent with the date η given in Example 3.7 and the DNA sequence of pgall from A. niger N400, the in the sequence listing under SEQ ID No. 2. It is therefore concluded that the pgall gene of A. niger NW756 does not interfere with the pgall gene n is identical to A. niger N400.

With minor modifications, a genomic library of A. nlger NW756 is created as described for strain N 400 in Example 2. Sau3Al is used instead of the isoschizomer Mbol for the restriction of Asperglllus DNA. The library of strain NW756 is constructed in the lambda vector EMBL3, which is a close relative of EMBL4 (Ref 9). EMBL3 DNA already digested with BamHI and EcoRI and treated with phosphatase was purchased from Promega. Part of the resulting library is plated and plaque hybrids are prepared as described in Example 3.3. The filters are then hybridized with the 1.2 kbp BamHI-EcoRI fragment of pGW 1803 using the homologous conditions described in Example 7.2. Positive phage are purified in a repeated screening step and then the DNA of these phages is purified as described in Example 3.4. The DNA is subjected to restriction analysis using the enzymes Bglll and Xhol. Then, the 5.5 kbp Xhol-Bgl II fragment of one of the positive phage containing this fragment is isolated in the manner described in Example 3.6. This f / agment is then ligated into BamHI and SalI digested pEMBL18, and the resulting ligation mixture is used to transform E. coli JM109 (Example 3.6). The transformations are then analyzed by colony hybridization under "heterologous" conditions, as described in Example 7.3 The plasmid DNA of a positive clone is purified and subsequently used to construct a physical map (Example 3.7) The restriction map of pGW1756 is described in U.S. Pat Figure 6. pG \ V1756 is the 5.5 kbp Xho I Bgl II fragment containing the A. niger NW756 pgall gene inserted into the pEMBL 18 vector.

Example 4 Determination of the nucleotide sequence of the polygalacturonase genes Example 4.1: The polygalacturonase II gene (pgall) of A. niger N400 Suitable restriction fragments of pGW1800 and pGW1803 are isolated after agarose gel electrophoresis and inserted into the Vectors M13 mp 18 RF and M13mp 19RF using a 2- to 10-fold excess of fragment relative to Vector ligated. The transformation of E. coll JM109 is performed as above, but with the cells after the heat shock

plated immediately, as described in the M 13 cloning / dideoxy sequencing manual Ji> .34; Ref. 11) of BRL. The isolation of the single-stranded DNA templates from the recombinant phages is carried out as described by

Exercise u. a. (Section 7.3.9, Ref. 40), where the cells are harvested in addition to the supernatants, and these cells become

then stored as a glycerol culture at -20 ° C.

One of the clones thus obtained containing the 2.4 kbp XbaI-EcoRI fragment of pGW 1803 inserted into the polylinker of M13 mp 18, is then manipulated to obtain sequencing data from the HindIII, PstI, BamHI and Ncol sites, respectively

to be able to determine. Separate overnight cultures in YT medium are prepared from E. coli JM109 and from the relevant clone, in the latter case, part of the glycerol culture is used as the inoculum.

Then 200 ml of 2x YT medium is inoculated with 0.4 ml of the JM 109 culture, and this culture is then 2.5 hours

long incubated at 37 ⁰ C in an orbital shaking apparatus. Then 20 ml of the overnight culture of the relevant clone are added and incubation in the orbital shaker is continued for 5 hours. The replicative form of DNA is then isolated from these cells as described above for pGW1803. This DNA is then digested with HindIII, PstI, BamHI or Nc. The BamHI and Ncol digested DNA is then digested with Sail followed by phenol / chloroform (1: 1) and

Chloroform extracted and then precipitated with ethanol. The incompatible, sticky ends are then used

of 5 units of T4 DNA polymerase (BRL) in the buffer described by Maniatis et al. (p. 117; ref.6) and in the presence of 0.1 mM dCTP, d / ΓΡ, dGTP and dTTP, respectively. The reaction mixtures with a volume of 25μΙ are incubated for 5 minutes at 37 ⁰ C, then 5 μΙ 0.5 M EDTA, pH 8.0, was added and the mixtures are subsequently phenol extracted with. The small DNA fragments present in the four DNA preparations thus obtained are removed by electrophoresis in a 0.7% low melting agarose gel (BRL) and gel slices containing large fragments are isolated. These DNA fragments are then circularized using T4 DNA ligase. The resulting

Ligation reaction mixtures are then used to transform E. coli JM109 in the manner described above

used.

Since Bell is sensitive to the methylation of the substrate, it may be the plasmid DNA derived from E. coli JM109 or E. coli DH 50CF'isolated, did not cut. Therefore, the previously isolated pGW1800 and pGW1803 are used to transform E. coli JM110 (Yanisch-Perron

u. t., Ref. 29), and the plasmid DNA is then isolated in the manner described in Example 3.8, but with all

Media 0.1% casamino acids can be added to pull E. coli JM110. The plasmid DNA isolated from E. coli JM110

then used to recover subclones allowing sequence analysis from the Bcll site.

The resulting clones are probed with the T7 Sequencing ™ kit from Pharmacia using the manufacturer's instructions

sequenced recommended conditions. In some cases, the sequencing data thus obtained will be for the

Programming the synthesis of specific oligonucleotides by the method of Caruthers (Ref. 8). These oligonucleotides are HR 6425, which is 5'Id) CAAGAACGTCACCATCGAACa ', HR 6439, which is 5'Id) GAATTGCTCACGGTGGAGTGa', and HR6 / 40, the

5'Id) is ACTTGGGClTCTTCTTTCCG3 '. These oligonucleotides are then used as the specific sequencing sites for the relevant templates. Primer HR6439 gives two overlapping sequencing ladders when used with M IS templates and therefore this primer is used for double-stranded sequencing of alkali-denatured pGW 1800 according to the instructions of Pharmacia.

The sequence of the gene encoding PGII (pgall) located on pGW1800 is recovered from both strands of the DNA. Sequencing in the downstream direction (from the XbaI site at position 1 in the direction of the Pvull site at about position 3028) is from the sites of Xbald), Eco RV (about 334), Hind III) (about 557), PstI (about 827), Bell (about 1056Γ, BamHI (about 1158), Hincll (about 1344 and about 1974), Kpnl (about 1565 and about 2706), Ncol (about 1749) and BgIII (about 2379, respectively), while the primer Sequencing in the opposite direction occurs from the locations of Pvull (about 3028 and about 1442), Kpnl (about 2706 and about 1565), BgIII (about 2379), Hincll (see US Pat. 1974), BamHI (about 1158), Bell (about 1056), PstI (about 827), Hindill (about 557), and EcoRV (about 334), respectively, while primers HR6439 and HR644C were used for sequencing across Hincll sites (Fig. about 1974) or Kpnl (about 1565) are used.

The sequence of pgall is shown in the sequence listing under SEQ ID NO. 2 given. The 3031 bp sequence begins with the first nucleotide of the XbaI site at position 1 in pGW1800 and terminates at the last nucleotide of the Pvull site, indicated in approximate map position 3050 in the pGW 1800 restriction map. The pgall gene comprises 1356 nucleotides of the promoter region, 1138 nucleotides of the structural portion (including a putative intron of 52 nucleotides) and 537 nucleotides of the transcriptional terminator region.

The sequence just below the signal sequence and the XhoI-Spc Hortes encodes an amino acid sequence that is completely consistent with the sequence determined for the 5 kDa fragment of polygalacturonase II, provided that cysteine is present at position 3 (Example 1.3 ).

The DNA sequence encodes a leader peptide of 27 amino acids, with arginine the last amino acid before the sequence of the mature protein. This leader peptide must be removed by proteolytic cleavage. Since signal peptidase cleavage sites are not found immediately immediately behind arginine residues and not immediately behind charged amino acids (von Heijne, Ref. 39), the leader peptide is removed in at least two proteolytic steps; h "the leader peptide represents a prepro sequence. In this case, signal peptidase cleaves the pre-sequence or the signal peptide while the remaining prosequence is cleaved by another protease.

The structurally active polygalacturonase II gene contains an intron most likely comprising the nucleotide sequence from position 1987 to 2038. This sequence contains termination codons in all three possible reading frames. The presence of this intron alters the reading frame in a manner consistent with the protein sequencing data that was determined (see Example 1). The reading frame in front of the intron is confirmed by the amino acid sequences of the cyanogen bromide fragments (Example 1.3), while the reading frame after the intron is confirmed by the amino acid sequence of the tryptic peptide TP4 (Example 1.5), this sequence also from the nucleotide sequence from position? 183 to 2225 can be derived. The 5 'site of the intron, GTAAGC, is similar to the fungal 5' splicing consensus sequence GTPuNGT, while the 3 'splice site TAG is fully aligned with the fungal consensus 3' splice site PyAG (Ref. 41).

Example 4.2: The polygalacturonase I gene (pgal) of A. niger N400

Suitable restriction fragments are isolated from pGW1900 and pGW1902 after agarose gel electrophoresis, as described in Example 3.9. These are ligated into the M 13mp 18RF and M 13mp19RF vectors according to the BRL M13 Cloning / Dideoxy Sequencing Handbook (ref 11). Competent cells are prepared as described in the Pharmacia manual for the M13 cloning / sequencing system. The transformation of E. coil JM101 is carried out as described by Messing et al., Ref. 30. Isolation of single-stranded DNA templates from recombinant phages is accomplished by conventional methods (e.g., Ref. 11, pp. 29-34). The resulting clones are sequenced using the T7 Sequencing ™ kit from Pharmacia (Uppsala, Sweden) using the manufacturer's recommended conditions.

pGW 1900 is sequenced from the EcoRI site in approximate map position 5750 to the call location in approximate map position 3900, which is close to the HindIII site in approximate map position 3790. Using the method of Caruthers (reference 8), several oligonucleotides (304-307) are synthesized. These oligonucleotides have the following sequences:

Number304 5 '(d) TTCAGCCCAA G CGTCAATCC 3'

Number 305 5 '(d) ACCTGAACGACTTCACCATC3'

Number306 5 '(d) TCTGTAGGACGTCT 6 GTTG 3 ¹

Number307 5 '(d) TGGCAGTAAAACCACCTAAC3'

They are used as special sequencing primers for the relevant templates.

Oligonucleotide # 307 is used for double-stranded sequencing of alkali-denatured pGW 1900 following the instructions for the T7 Sequencing ™ kit. The complete sequence for the pgal gene is set forth in the Sequence Listing of SEQ ID NO. 1 given. The sequence is based on the sequencing data obtained with both strands.

The 2495bp pgl sequence begins with the first nucleotide of the EcoRI site at approximate map position 6280 in pGW1900 and ends 12 nucleotides beyond the last nucleotide of the Clal site, close to the HindIII site indicated at 3880.

The pgal sequence comprises 909 nucleotides of promoter region, 1218 nucleotides of structural portion, including two putative introns to 52bp (intron A) and 62 bp (intron B), and 366 nucleotides of the transcriptional terminator region.

The amino acid sequences jrmittelt for mature polygalacturonase I (see Example 1.4) and for the Cyanogenbromidfragment to 21 kDa (see Example 1, i, agree perfectly with the amino acid sequence identical, which can be derived from the nucleotide sequence and the position in 1003 begins, so the DNA sequence encodes a Leadsr peptide from

31 amino acids, where lysine is the last amino acid before the beginning of the mature protein. For reasons similar to those given for PGII, where the leader peptide ends with an arginine residue, this PGI leader peptide should be a prepro sequence which is also deleted in at least two proteolytic steps

The sequence that hybridizes to the oligonucleotide mixture is used as a probe and begins at position 1277 of the nucleotide sequence. There is complete agreement between the N-terminal amino acid sequence determined for the 5.5 kDa cyanogen bromide peptide fragment in Example 1 and the putative amino acid sequence based on the nucleotide sequence.

The polygalacturonase I structural gene contains two introns. Intron A comprises the nucleotide sequence from position 1138 to 1189. The 5 'splice site GTATGT is in agreement with the fungal δ'-splice site consensus sequence GT Pu NGT (Ref. 41), while the lariat sequence is GC TAAC and the 3' TAG cleavage site also match the known consensus sequences Pu CT Pu AC and Py AG. The presence of this intron alters the reading frame in a manner consistent with the protein sequence data obtained with the already-linked 5.5 kDa cyanogen bromide fragment (see Example 1). The second intron (B) comprises nucleotide sequence 1610 to 1671. Both the lariat sequence and the 3 'splice site are consistent with known consensus sequences. The 5 'splice site GCACGA does not match the GT Pu GNT consensus sequence, but GC at the 5' splice site and an A at +6 relative to the 5 'splice site were found in several other genes (Ref 43).

The presence of intron B is based on the following arguments:

a) It changes the reading frame, while an early stop occurs in the two other reading frames.

b) The intron in pgall occurs in the same position, and the amino acid sequence preceding this intron, Asn-Ser-Gly-Giu, is identical in both proteins. A region of strong homology is also detected between the amino acid sequences derived from the nucleotide sequences immediately following the putative intron:

amino acid residue

PG Il Asn-Ile-Trp-Phe-Thr Gly-Gly-Thr-Cys PG I Ser-Ile-Ser-Phe-Thr Gly-Gly-Thr-Cys

PG II Ile-Gly-Gly-His-Gly-Leu-Ser-Ile-Gly PG I Ser-Gly-Gly-His-Gly-Leu-Ser-Ile-Gly.

Example 4.3: Homology between A. niger N400 polygalacturonases The polygalacturonases PGI and PGII that were isolated from A. niger catalyze the same? Reaction and are immunological

related to each other, as described in Example 1.2.

The gene coding for these enzymes are also closely related, as with the pgall gene also others Polygalacturonase genes from an A. niger N400 Genombank be isolated as described in Example 7.2. On Sequence comparison of the putative PGI and PGII amino acid sequences of the mature enzymes, which are 2 residues in length

show that there is a high degree of homology. These data clearly indicate that the gene coding for the PGs are closely related and are members of a polygalacturonase gene family.

Example 5 Cotransformatlon of A. niger using the A. nlger-pyr Α gene e! S selection marker and a plasmid containing the Polygalacturonase carries I or III gene as a transforming plasmid

Example 5.1: Propagation and purification of the plasmids used for transformation of A. niger Plasmid ρGW635, which is a truncated version of pGW613 (Goosen et al, Ref. 13) and which also contains the pyrA gene, and plasmid pGW 1800, which is the polygalacturonase Il gene is propagated in E. coil MH1 and JM109, respectively. Plasmid pGW1900 is propagated in E. coil DH5aF '. Plasmid DNA is recovered from 250ml overnight cultures, such as Maniatis et al. (P.90-91, reference 6) and described in example 3.7.

Example 5.2: Preparation of protoplasts and transformation of the primitive auxotrophic mutant A. niger strain N 593 The A. nlger strain N 593 (cspA, pyrA), which is a derivative of the parental strain N400, was identified by positive selection on the toxic 5-fluoro-amino acid-like Analogously obtained in yeast (Boeke et al., Ref. 14) in the presence of uridine, as that of Goosen, et al (Ref. 13).

Liquid minimal medium supplemented with 0.5% yeast extract, 0.2% casamino acids, 1OmM uridine (Janssen Chemie) and 5OmM glucose supplemented with 10 ⁶ conidiospores of A. niger N 593 per ml inoculated and 20 hours at 3O ⁰ C incubated in a New Brunswick orbital shaker. The mycelium is recovered by filtration through Miracloth, washed with isoosmotic minimal medium (STC) followed by the composition: 1.33 M sorbitol, 10 mM Tris-HCl, pH 7.5, 5 mM CaCl ₂ . An amount of 1 g of the mycelium is resuspended in 20 ml of STC. Within two hours protoplasts are released from the mycelium by the addition of 150 mg of filter-sterilized Novozym 234 (Novo Industries, Denmark) and incubating the mixture at 30 ° C in a shaker operating at 95 rpm. The protoplasts are separated from the residual mycelium by filtration using a funnel with a glass wool plug. Then cold STC is added to a volume of 40 ml and the mixture is placed on ice for 10 min. The protoplasts are recovered by centrifugation (10 min, 2500 rpm) and the pellet is resuspended in 5 ml STC. The protoplasts are pelleted once more and finally resuspended in 1 ml of cold STC.

For transformation, 5 χ 10 ⁸ protoplasts are taken up in 200μΙ, which are then incubated together with 1 μg pGW 635 and 20 μg pGW1800 or pGW1900. Following the addition of plasfnid DNA to the protoplasts, 50 μM PCT (10 mM Tris-HCl, pH 7.5, 50 mM CaCl ₂ , 25% PEG 6000) is added and this incubation mixture is kept on ice for 20 min. Then another 2 ml of PCT are added and the mixture is incubated at room temperature for a further 5 min. Finally, 4 ml of STC are added and mixed. Aliquots of this final 1 ml transformation solution are mixed with 4 ml of liquified isoosmotic MM top agar stabilized by 0.95M sucrose. The protoplast mixture is immediately plated on agar plates containing the same iso-osmotic minimal medium and these are incubated at 3O ⁰ C. To

the appropriate control experiments include similarly treated protoplasts without plasmid DNA and those on non-stabilized minimal medium with 2.5 mM uridine.

After three days of growth at 3O ⁰ C well growing transformants appear that form spores (150 transformants / pg pGW635). In addition, a large number of presumably abortive transformants appear. About 300 transformants are obtained with pGW1800 and about 100 with pGW1900. From each of the transformants with pGW1800 and pGW1900, twenty colonies are arbitrarily taken out, spores are taken from individual transformants and plated separately on 5OmM glucose minimal medium to obtain single colonies, which are purified once more and then multiplied for spore growth further transformant analysis can be used.

Example 5.3: Selection of polygalacturonase overproducer cotransformants of the A. niger strain N593 by halogenation on non-porous, solid media

About 200 colonies that had been transformed with pGW 1800 and about 100 colonies that had been transformed with pG 1900 and that were recovered in the manner described in Example 5.2 were tested for an increase in polygalacturonase activity following a colonization procedure without prior purification , The medium used for screening is composed of 2% glucose, 0.5% apple pectin (34.8% degree of esterification, obipectin, Bischoffszell) minimal medium salts and spore elements; 6 g / l NaNO ₃ ; 0.2% yeast extract; 0.2% peptone, 0.004% Triton X-100 and 1.2% agar. The Petri dish is seeded in the middle and incubated for 2 days at 30 ° C. The colonies are kept cold overnight. Then, the surface of the plate is stained by adding an overcoat of 5 ml of a 0.05% ruthenium red solution, and it is incubated with shaking for 5 minutes. The unbound dye is then removed by washing with distilled water for an additional 5 minutes. The production of polygalacturonase under these conditions is indicated by the size of the court formed. Approximately 50% of the transformants analyzed in this way have a polygalacturonase activity higher than that of the wild-type.

Twenty colonies of the pGW1800 transformants and seven of the pGW1900 transformants are taken out on the basis of the size of the courtyard formed on pectin-containing solid media, and after a second sighting with these positive colonies after 45 hours of growth, six of the transformants, respectively finally removed and cleaned in the manner described in Example 5.2.

Example 5.4 Genome Analysis of A. niger Strains Transformed with Polygalacturonase II Transformants obtained according to Examples 5.2 or 5.3 and the parent wild strain N402 are grown on a liquid minima / medium supplemented with 0.5% yeast extract, 0.2% Casamino acids, 5OmM glucose and NaNO ₃ (6g / l). After 18 hours of growth at 30 ° C, the DNA is extracted and analyzed for the presence of transforming plasmid. A. niger DNA is isolated as described above.

Digests of the chromosomal DNA (2pg) are carried out at 37 ⁰ C in a reaction volume of 200μΙ, which consists of 5OmM Tris-HCl, pH 8.0, 1 mM MgCl ₂ , 10OmM NaCl and 4mM spermidine, which to a pH of 7.5, to which Tris base was used, before adding it to the reaction mixture. 20 units of both EcoRI and Sail are added and the reaction mixture is incubated for 2 hours at 37 ^° C., then an additional 20 units of the two enzymes are added and incubation is continued for a further 2 hours. Then the reaction mixture (200μΙ) is extracted with 100μΙ chloroform. The DNA is then precipitated from the aqueous phase by the addition of ¹ Ao of a 3M sodium acetate buffer, pH 5.2, and 2.5 volumes of ethanol. After a one-hour incubation at 4 ⁰ C and after centrifugation, the DNA pellet is air-dried and released in 20 μΙ sample buffer. DNA from the transformants and A. niger N402 digested with EcoRI / SalI is prepared by hybridization of the Southern blots in the manner described above with the 1.2 kbp BamHi / BglII fragment of pGW 1800 as a PGII probe analyzed. A cotransformation abundance of more than 75% is determined. Southern blotting was used to analyze a number of 9 transformants. The probe hybridizes to a large genomic fragment in N402. In the genomic blots of the transformants containing pGW1800 sequences, a 4.1 kbp EcoRI-Sal insert is detected. The intensity of this band varies depending on the copy number. In the cases analyzed, the genomic fragment representing the wild-type gene is always found, indicating heterologous integration. Analysis of the production of polygalacturonase II in an A. niger transformant, hereinafter referred to as N593 / pGW 1800-27, is given as a detailed example (Example 6). From a series of DNA dilutions, the copy number is estimated to be at least on the order of 20. In addition to the wildtyphybric fragment and the 4.1 kbp Fragmont, several other smaller hybridizing fragments are found in this strain, which are Gronz fragments of type II integration events or rearrangements.

Example 5.5: Production of Polygalacturonase II by Transformed A. nlger Strains and by A. nlger N402 Twenty dar pGW1800 transformants described in Example 5.2 and six of the pGW1800 transformants described in Example 5.3 are grown on a medium containing from a minimum salt medium to which urea (4.2 g / l), 1% (w / v) apple pectin (degree of esterification 61.2%) and 1% (w / v) wheat bran are added. The cultures are grown for 43 hours at 30 ° C at 250 rpm in a Gallenkamp orbital shaker, and culture filtrates are recovered. The mycelium is removed by filtration through Miracloth using a Buchner funnel. The content of these samples on PGII is determined by Western blotting performed using the alkaline phosphatase detection method according to the instructions of the Biorad Instruction Manual. Based on the signals on the Western blots, 70% of the 20 transformants randomly picked from those obtained in Example 5.2 produced significantly more polygalacturonase II than A. nlger N 402. Transformants based on farm size of the plate-screening method were determined (see Example 5.3), all produce significantly more enzyme than A. nlger N402.

A. nlger strain N 402 and three of the transformants designated N 593 / pGW 1800-27, N 593 / pGW 1800-30, and N 593 / pGW 1800-37 are selected for measurement of polygalacturonase activity. The latter three strains are from the set of pGW1800 transformants obtained in Example 5.2.

N 593 / pGW 1800-30 and N 593 / pGW 1800-37 both contain multiple copies of pGW 1800, but fewer copies than N 593 / pGW 1800 ^: 27. These strains are grown on a 1% pectin medium (degree of esterification 61.2%). ) to which 1% (w / v) dried and ground sugar beet pulp has been added, operating under the conditions described above.

To remove reducing sugars and inhibitors of PG activity, PGII is partially purified after fermentation using cross-linked alginate. One milliliter of the culture filtrate is diluted with 1 ml of 20 mM sodium acetate buffer, pH 4.2, and then added to a small column with a packing volume of 2 ml cross-linked alginate (5.2 ml / g) equilibrated in this buffer. Subsequently, the column is washed with 4 ml of sodium acetate buffer and then the PGII activity is determined pulsating out of the column using 4 ml of 20 mM sodium acetate buffer, pH 4.2, to which 1M NaCl has been added. The PG activity in the eluate is then determined in the manner described (Ref. 2), and from the value determined, the PG activity in the culture filtrate is calculated.

The following PG activities were calculated for culture filtrates obtained twenty hours after inoculation: 2,2,5,6,5,8 and 10,8 units / ml for strains N402, N 593 / pGW 1800-30, N 593 / pGW 1800-37 or N 593 / pGW 1800-27. For the culture filtrates recovered after forty hours, these values are, in the same order, 2,8,13,7,16,4 and 30,9 units / ml.

Thus, it appears that pGW1800 can be successfully used to transform A. nlger to produce much higher PG activity.

Example 5.6: Production of polygalacturonase I by transformed A. nlger strains and by A. nlger N402 and N 593 Seventeen of the pGW1900 transformants described in Example 5.2 and six of the pGW transformants described in Example 5.3. and A. nlger N 402 and a pyr transformant of N ⁺ 593 are drawn on a medium, the ⁿ from a Minimalsalzrrediurr ^<? TEHT, the urea (4.2 g / l), 1% (wt./vol.) apple pectin (Degree of esterification 61.2%), 1% beet pulp are added, u. Cultures are grown for 64 hours at 30 ° C using a Gallenkamp orbital shaker operating at 250 rpm and samples of the culture filtrate are taken in between 20 hours and 39 hours. The content of PGI in these samples, like the PGII content in Example 5.5, was examined by Western blotting.

Based on the signals on Western blots, it can be seen that of the 23 transformants tested, 65% produce significantly more PGI than A. niger N402. The transformants selected on the basis of yardage all produce more PGI than A. nlger N 402, and four out of six transformants are strong producers. Activity measurements indicate that in this medium the activity is higher after 20 hours than after 39 hours. Taking 12 different PGI-transformed A. niger strains, the activity varies between 2.8 and 7 units / ml, while the non-transformed control strain N402 and an A. nlger-N 593 / pGW635 transformant 0.5 and 0, respectively, 8 units / ml produce. This activity is at least in part the result of the Wj jdtyp levels for PGI and PGII, while the increase in transformants is the result of increased PGI expression.

Examples Isolation, Purification and Characterization of Polygalacturonase II from the PGII Overproducing A. nlger Transformants N593 / pGW1800-27 Example 6.1: Culture conditions for the preparation of polygalacturonase II

The A. nlger transformant N 593 / pGW 1800-27 described in Example 5.4 is grown on complete medium in petri dishes for 3 to 4 days at 30 ^° C. to produce conidia. The conidia are harvested in 5 ml of sterile saline containing 0.005% Tween 80 per plate. The spore suspension is stirred on a Griffin shaker for 20 minutes, and after counting the spores, 10 * spores / ml are placed in 11-liter siliconized Erlenmeyer flasks containing 300 ml of sterile growth medium. This medium is a minimal medium containing 70 mM ammonium chloride. As a nitrogen source and 1% (w / v) apple pectin (degree of esterification 61,%) and 1% (w / v) of sugar beet pulp as carbon sources. The mycelium is ⁰ C using a Gallenkamp Orbitalschüttelapparates, who worked with 200U / min drawn 43 hours at 3O. After growth, the mycelium is removed by filtration through Miracloth using a Buchner funnel. The culture filtrate is adjusted to a pH of 4.2 using 1N NaOH. In all further steps, 0.02% sodium azide is added to prevent microbial growth.

Example 6.2: Purification of polygalacturonase II, which was obtained from the A. nlger transformant N593 / pGW 1800-27 The culture filtrate (about 2.5I) is a cross-linked alginate column (2.5 cm X 25 cm) supplied with 2OmM sodium acetate buffer , pH 4.2, had been equilibrated. After loading, the column is washed sequentially with a bed volume of the equilibration buffer, a bed volume of 20 mM sodium acetate buffer, pH 5.6, a linear salt gradient to 1200 ml (0-0.5M NaCl) in the previous buffer and finally with 275 ml of a 1M NaCl. Solution eluted in the same buffer. Fractions of 6 ml each are collected and tested for their enzymatic activity, as described in B ', game 1.1. The middle part of the active fractions is summarized and three times using a? 20 mM bis-Tris-HCl buffer, pH 6.0, dialyzed. The final enzyme solution (475 ml) is then fed to a DEAE-Sepharose fast flow column (Pharmacia) which had been equilibrated with the same buffer. After washing, a NaCl gradient is applied in the same buffer and polygalacturonase activity is eluted at about 10 mM sodium chloride. The active fractions are analyzed by SDS-polyacrylamide gel electrophoresis. These fractions, which have a high content of PGII, are pooled (54 ml), dialyzed using 20 mM bis-Tris-HCl buffer, pH 6.0, and further purified on a Mono Q (Pharmacia) column had been equilibrated with the same buffer. After loading, the enzyme is eluted using a salt gradient (0-1M NaCl).

The enzyme is randomly collected in two different pools A and B corresponding to the 0.2 to 0.26M part of the sodium chloride gradient and the 0.26 to 0. 34M part of the gradient. Both fractions contain a single protein band in the same position as PGII when subjected to SDS-polyacrylamide gel electrophoresis.

Example 6.3: Determination of the amino acid sequence of the N-terminal part of polygalacturonase II

200pg of PGII from combined pools A and B, which were purified according to Example 6.2, were dialysed three times from 11 millipore-filtered distilled water and lyophilized. The amino acid sequence is determined as described in Example 1.3 using an Applied Biosystems Model 470A gas phase protein sequencer. For the enzyme, the following N-terminal amino acid sequence is determined:

Position: 1 5 10

Amino acid: aps-ser-X-thr-thr-phe-thr ala-ala-ala position: 15 20

Amino acid: ala-lys-ala-gly-lys-ala-lys-X-ser-thrile

The cysteine residues in the protein have not been modified and therefore are not detected. They are likely to occur at position 3 (X) and at position 18 (X) of the sequences (see Example 1.3). The last three amino acid residues are detected only at low level. The sequence determined for this pure enzyme corresponds exactly to the amino acid sequence of the N-Tecminus of PGII derived from the nucleotide sequence of the PGII gene (see Example 4 and Fig. 4, Formula II). The corresponding nucleotide sequence also shows cysteine residues in the expected positions, i. at residues 3 and 18. This sequence also corresponds to the sequence determined for the cyanogen bromide fragment at 5kDa (see Example 1.3) and thus corresponds to the N-terminus of protein.

Example 6.4 Properties of Polygalacturonase II Purified from Transformant N593 / pGW 1800-27 The enzyme purified according to Example 6.2 was compared with the enzyme purified from Rapidase as described in Example 1.1 , Both enzymes have an apparent molecular mass of 38kDa on SDS-polyatrylamide gels, and they react identically with polyclonal antibodies raised by PGII. A monoclonal antibody which reacts only with a continuous epitope of PGII, but not with PGI, IHA, HIB or IV, also reacts with the enzyme purified according to Example 5.2. In isoelectric focusing, the PGII produced and purified according to Examples 6.1 and 6.2 has a sharp band at a pI value identical to PGII (pI = 5.2). Due to the microheterogeneity of PGII, a number of other bands with lower pI values were observed when operating with a pH gradient of pH 3 to 7 or of pH 3-10. Similar patterns are obtained using PGII prepared according to Example 6.1.

Example 7 Detection and isolation of sequences related to the polygalacturonase II gene Example 7.1: Detection of the sequences related to the polygalacturonase II gene

DNA is isolated from A. niger NW756 using the method described above. The DNA is restricted with the enzymes BamHI, EcoRI and the combination of these enzymes, as described in Example 5.4. The DNA fragments are then separated on a 0.6% agarose gel and then transferred to a nitrocellulose membrane as described in Example 3.7. The baked membrane is prehybridized for 2 hours at 60 ° C in a preheated hybridization buffer consisting of 1% BSA (Boehringer), 1 mM EDTA, 0.5 M sodium phosphate, pH 7.2 (added from a stock of 1M, composed of 89.0g Na ₂ HPO ₄ 2H ₂ O and 4ml of 85% H ₃ PO ₄ per liter) and 7% SDS as described by Church and Gilbert (ref 38) and sheared and denatured herring sperm DNA was added to a concentration of 0.1 mg / ml. The nick translated subjected 1,2kbp-BamHI-BglII fragment of pGW1800, which was prepared as in Example 3.7 is then added and allowed to hybridization untersanftem shaking for 44 hours at 60 ⁰ C to continue. Then the membrane is washed twice with prewarmed (60 ° C) hybridization buffer (without herring sperm DNA) for 10 min. The membrane is then washed twice 20 min at 6O ⁰ C in a preheated buffer consisting of 5X SSC, 0.1% SDS and 0.1% Na ₄ P ₂ O ₇ 10H ₂ O. The membrane is then dried and exposed for 3 days at -60 ⁰ C to Kodak XAR5 film. Nonspecific hybridization is not observed under these conditions, which results from the lack of a significant smear specimen on hybridizing DNA fragments, and also from the lack of hybridization of the probe with lambda size markers. In each lane, several hybridizing bands are observed, with one band more intense in each lane than the other bands. These intense bands are consistent with the 3.3kbp fragment in the BamHI digest, a larger fragment than 20kbp in the EcoRI digest and a 3.3kbp fragment in the BamHI / EcoRI double digest. The lower intensity bands matched the 17,9,5,6,4 and 2,0 kbp fragments in the BamHI digest, the fragments of 15,12,65 and 4,8 kbp in EcoRI digestion and the fragments of 7,6,6,4,4,0,3,7 and 2,0kbp in the BamHI / EcoRI double digestion.

From the fact that specific hybridization signals are observed, it follows that the PGII gene of A. niger N400 can be used to detect specific sequences in the DNA recovered from A. niger NW756. It is believed that the fragments which give strong hybridization signals carry the PGII gene. In principle, a weakly hybridizing fragment may form when a restriction enzyme cuts the DNA within and near the end of the region homologous with the probe used. However, this can not fully explain the number of hybridizing large fragments observed in the present example. As a result, specific DNA sequences have been detected that are homologous with, but not identical to, the PGII gene. It is believed that these DNA sequences are distinct PG genes, consistent with the fact that polygalacturonases have protein level homology (see Example 1.4).

Example 7.2: Isolation of the genes related to the polygalacturonase II gene

Using E. coli LE 92, approximately 1 × 10 phage from the A. nigar N400 library are plated on 5 plates, and from each plate are made three nitrocellulose replicates as described in Example 3.4 the third filter is incubated on top of a plate for 5min. The first and second filters of each plate are treated under conditions called "hetarolog".

The third filter is subjected to severe conditions, are referred to as "homologous". Prehybridization, hybridization and washing of the filters are performed at 6O ⁰ C under heterologous conditions and at 68 ⁰ C under homologous conditions After baking, the filters in 3X SSC be. and then prehybridized for two hours in preheated hybridization buffer consisting of 10x Denhardt's (see Example 3.4), 50 mM Tris-HCl, pH 7.5.2 mM EDTA, pH 8.0, 1M NaCl, 0.5% SDS and 0.1% sodium pyrophosphate, to which 0.1 mg / ml sheared and denatured herring sperm DNA are added fresh, and the filters are then individually transferred to a flask containing 50 ml

Hybridization buffer, including herring sperm DNA, to which was previously added the nick-translated BamHI-BglII fragment to 1.2 kbp of pGW 1800. The hybridization is allowed to proceed for an additional 40 hours and then the filters are washed under homologous or heterologous conditions. The following are the homologous wash conditions: The filters are washed twice in 2x SSC, 0.1% SDS, and 0.1% sodium pyrophosphate for two and a half hours, and then in 0.2x SSC, 0.1% SDS, and 0.1% twice for half an hour. Sodium pyrophosphate washed. The following are the heterologous conditions: The filters are incubated twice for half an hour in hybridization buffer, then for half an hour in 4x SSC, 0.1% SDS and 0.1% sodium pyrophosphate and finally in 2x SSC, 0.1% SDS and 0.1 % Sodium pyrophosphate washed. The filters are air dried and exposed to Kodak film XAR 5 for 3 days at -60 ° C using intensifying screens. The phages which give positive signals are obtained as in example 3.4.

On the filters exposed to the homologous conditions, 7 positive signals were detected, which are also present at the corresponding positions on filters exposed to heterologous conditions. These signals are considered to be the result of recombinant lambda phage carrying the PGII gene. Apart from these signals, 30 positive signals were obtained on the filters exposed to heterologous conditions, and these signals are present in the corresponding position on both filters. The signal strength is different for these 30 signals. The majority of these signals are considered to be the result of phage containing a PG gene other than PGIi gene.

The A. nlger N 400 genomic library is spotted a second time. Plaque lifts are performed in the manner described above. Apart from the temperature, the hybridization is carried out in the manner described above. Hybridization and washing carried out at a dor both obtained from a disk filters at 62 ⁰ C, while the other filters at 68 "C hybridized and washed. After hybridization, the filters under strong SSC conditions (HSSC) conditions are at 62 ⁰ C or washed at 68 ° C. The following are the HSSC conditions: The filters are washed twice in 5X SSC for 5 minutes, then the filters are washed twice in 2x SSC for half an hour and then in 2x SSC for two and a half hours The SSC solutions used also contain 0.1% SDS and 0.1% sodium pyrophosphate.

On the filters incubated at 68 ^° C. ("homologous" hybridization conditions), five strong, positive signals were detected, which are also present in the corresponding position on the filters incubated at 62 ^° C. The restriction analysis of one of these phages according to example 3.5 shows that this phage contains an insert on which the gene is located with the encoding PGII (pga II). It is therefore assumed that these five phage all contain pga II. in addition, in the incubated at 62 ⁰ C filters ( "heterologous" hybridization ) 17 positive signals that do not or nu on the corresponding, at 68 ⁰ C incubated filters. to hybridize weakly. The signal strength of these 17 signals is different. Sixteen phages before the first sighting and 10 phages from the second sighting, which do not contain pgall, are selected for further characterization. These phages are purified under the conditions used for the original detection. The characterized phages are the phages listed in Table VII and eight additional phages (Nos. 2,3,7,31,33,40,41,42). The phages numbered 1 to 30 were determined on the first sighting of the library, while the phages of higher number on the second sighting were detected.

To discriminate between the phage containing the polygalacturonase I gene and those containing other polygalacturonase II related sequences, plaque lifts of the selected phage become the previously nick-translated 1.8 kbp HindIII fragment of pGW1900 (Example 3.9). Hybridization occurs at 62 ^° C. while also washing at 62 ^° C. using a series of SSC buffers containing all 0.1% SDS and 0.1% sodium pyrophosphate (4 χ SSC, 2 χ SSC, Ix SSC, 0.5x SSC, 0.2 χ SSC and 0.1 χ SSC, incubation time per buffer for half an hour). Using these conditions, phages 2,3,7,40,41 and 42 give strong hybridization signals comparable to the signal detected on phage PGI-X7 carrying the pgal gene (Example 3.6). Restriction analysis of the DNA detected from one of these phages also indicates that this phage contains an insert on which the pgal gene is located. It is therefore assumed that these six phages all contain the pga gene. The other phages analyzed (1,8,31,33,35,36,37,38,43) give, if any, only a weak hybridization signal, and thus these phages do not contain the pgal gene.

To find out which phages contain identical fragments, DNA is isolated from the phage indicated in Table VII in the manner described in Example 3.5 and digested as described in Example 3.6, and the resulting fragments are Blot analysis characterized. For the analysis of Hlnf I and Hlncll digestions, the agarose content of the gels is increased to 1% (w / v). Southern blots feed at 60 ° C with a previously dom Nink translation unterzogonen 1,2kbp BamHI / EroRI fragment of pGW1803 hybridize, the washing is also at 60 ⁰ C, the above-described HSSC conditions are applied. The restriction enzymes which are found to be useful for an initial classification of these phages are a combination of BamHI and BglII and of Hlnfl and Hincll, the latter enzymes being used separately. Hlncll and Hlnfll generate small restriction fragments on the shelf, which in the present case minimizes the possibility that the resulting hybridizing fragments contain, in addition to the pgall-related sequence, DNA derived from the EMBL4 vector.

Table VI ^?

Classification of PGII-related λ phages based on the size of hybridizing λ DNA fragments (kbp) recovered after digestion of DNA isolated from these phages with Hincll, Hlnfl and Bglll / BamHI and sometimes with Sail using the 1.2 kbp BamHI / EcoRI fragment of pGW 1803 as a probe

Class of λ phage " Restriction- A BC DEFG ^b

tion enzyme

λ phages belonging to the corresponding classes: 9, 10, 4, 1, 16, 8, 6, 5 17,

43 35, 36 20, 11, 36 27

37 12

Fragment length (kbp) 2.4 1.75 1.3; 1.3; 2.3 3.0 (λ-17) HincII 1.25 0.4 0.78 4.9 (λ-27) 1.1 1.28 1.8 0.65 0.6 Hlnfl 0.7; 0.3 3.1 8.7 1.7 4.1 2 23 BglII / BamHI 7.2; (Λ-4) (Λ-20) (Λ-6) 0.56 (Λ-10) n.d. 6.8 1.3; n.d. Sail 6.9 (Λ-16; 0.5 λ-20)

phages numbered 16 and 20 also have a 1.64kbp KPnl fragment and a 1.38kbp HlncII / Xpnl fragment. b Class G phages do not hybridize with PGII under non-severe conditions. n. d. = no decomposition carried out.

From the data presented in Table VII, it can be seen that in most classes of phage, several representative phage were independently isolated. Based on the fact that only a selection of all hybridizing signals was included in the initial sighting, the number of λ phage determined for each class (class A: 3; B: 3; C: 4; D: 3, E: 2) that different genes are found at a similar frequency. In the case of PGI, this number is larger (6 out of 26 phages analyzed), while PGII-containing phages are found at the same frequency (12 of analyzed phage). The class G hybridizes weaker with both probes derived from either the PGI gene or the PGIII gene. In addition to a hybridizing fragment of 3.0 and 4.9kb in the phage number 17 and 27, respectively, several non-hybridizing fragments are found in the Bgll / BamHI double digestion which are identical in both phages and are derived from the inserts, viz a 5.6 kbp, a 5.1 kbp, a 1.45 kbp, and an O, 57kbp fragment. The Hindi and Hlnfi digestions of the two phages are also approximately the same. The phages isolated in this example are renamed as follows:

Class number name

A 9 λΡΰ-Α9 10 λΡβ-ΑΙΟ 43 λΡΰ-Α43 B 4 λΡΟ-Β4 35 λΡΰ-Β35 36 λΡΟ-Β36 C 1 KPG-C 1 16 λΡΰ-ΟΙβ 20 λΡα-Ο20 37 λΡΟ-Ο37 D 8th KPG Di 11 λΡθ-Dn 12 KPG OM e 6 λΡΰ-Ε6 38 λΡΰ · Ε38 F 5 K ¹ PG-? S G 17 KPG GVL 27 KPG-G 27 not determined 31 λΡΩ-Χ31 not determined 33 λΡΰ-Υ33

Example 7.3: Subcloning of the PGC gene (pgaC). The construction of pGW1910

Phage APG-C20 (Example 7.2, phage 20, class C) is digested with BglII and the resulting fragments are separated on agarose gel. The gel slices containing the hybridizing 7.9kbp BglII are recovered and the fragment is then isolated in the manner described (Example 3.6). The BglII fragment is ligated into the BamHI-digested and ClP-treated (calf intestinal phosphatase) pUC9. The ligation reaction mixture is used to transform E. coli JM109 (Example 3.6). Several of the resulting white colonies are streaked onto YT agar supplemented with ampicillin. After the colonies have grown overnight, they are adsorbed onto a nitrocellulose filter. The colonies on the filter are then dissolved and the released DNA is fixed by baking, like that of

Maniatis et al. (Ref 6, p. The baked filters are wetted in 2½ SSC and gently rubbed with a gloved hand to remove the bacterial cell debris. The filters are then hybridized with the 1.2 kbp fragment of PGW 1803 using the heterologous conditions described in Example 7.2 (6O ⁰ C, washes with 2x SSC). A positive clone is selected and the plasmid DNA is purified as above. The plasmid DN A is then used for restriction analysis to prepare a physical map.

In this way a new plasmid was constructed. pGW1910 (Figure 7) is the 7.8kbp BglI fragment of phage APG-C20 inserted into the BamHI site of vector pUC9. This subclone comprises hybridizing fragments of phage APG-C20, e.g. For example, the SmaI fragment is 1.1 kbp and the KpnI fragment is 1.6 kbp. From the location of these fragments on the physical map of pGW 1910, it is deduced that this plasmid contains the complete PGC gene (pgaC).

Examples Expression of human hybrid interferon BDB under the control of the PGII promoter Example 8.1 Construction of the Plasmid pGII-IFN AM 119 Precursor (Figure 4)

Plasmid pGW1800 digested with EcoRI and treated as below with T4 polymerase. The religation of this DNA and the transformation of E. coli DH SaF 'allow the isolation of a plasmid pGW 1800-E, which is the same as pGW 1800, except for the fact that the EcoRI cleavage site is deleted.

Plasmid pGW1800-E is digested with BglII and treated with alkaline bacterial phosphatase (BRL) in the presence of 50 mM Tris-HCl, pH 8.0, and 50 mM NaCl for one hour at 65 ° C. The alkaline phosphatase is inactivated by digestion with proteinase K (Boehringer, Mannheim) and phenol extraction. Subsequently, the DNA is precipitated with ethanol, dried and redissolved in water. Then the sticky ends are filled as below with T4 DNA polymerase.

Plasmid pJDB207-IFN AM 119 (EP205404) is digested with HindIII and CIal. The sticky ends of these linear fragments are digested with T4 DNA polymerase (Boehringer, Mannhein) in the presence of 0.1 mM dCTP, dGTP, dATP and dTTP plus 67 mM Tris-HCl, pH 7.5, 6.7 mM MgCl _2, 16.7 mm (NH ₄ J ₂ SO _4, and 5 mM DTT 30min long filled at 37 ⁰ C. the reaction is stopped by heating to 65 ⁰ C for a period of 5 min. the fragments are separated in a 0.8% Agarose gel with low gelation temperature (BioRad) is separated, and the 1.0kbp fragment comprising the IFN AM 119 coding region is excised, the DNA purified on an Elutip D column (Schleicher & Schull) and ethanol precipitated (Schmitt and Lohen, Ref. 34).

100 ng of the IFN AM 119 fragment and the prepared pGW1800 E vector are combined together in 5 μM 20 mM Tris-HCl, pH 7.5.1 μmMgCIj, 10 mM DTT, 1 mM ATP and one unit of T4 DNA ligase (Boehringer, Mannheim) for a period of 2 hours at room temperature. This mixture is transferred to competent E. coli DH5aF 'cells. Ampicillin-resistant transformants are screened by restriction digestion of the plasmid DNA to identify those carrying the plasmid pGII-IFN AM 119 precursor.

Example 8.2: Generation of Precise pGI-IFN AM 119 and pGllss-IFN AM 119 Fuslons using PCR

(Figures 4 and 5)

It is the of R. M. Horton u. a. (Ref.35) described PCR method shown in Fig. 5.

pGW1800 is linearized by XbaI digestion and precipitated with ethanol. After re-suspension in water, 100 ng of DNA of a multiplication by polymerase chain reaction (PCR reaction) using the oligonucleotides A and B (Fig. 5) (in an automated thermal cycler for 25 cycles each consisting of 1 min at 94 ⁰ C, are 2 min at 4O ⁰ C and 3 min at 72 ⁰ C) unterzöget), followed by 10 minutes at 72 ⁰ C. For each reaction 10OpM each nucleotides and 0,5μΙ Taq polymerase (Perkin Elmer Cetus) in a volume of 100 μΙ using the reaction buffer recommended by the manufacturer. This results in DNA1 (Figure 5).

Similarly treated pGW1800 with oligonucleotides A and C yields DNA2.

Similarly, pJDB207-IFN yields AM 119 linearized with BamHI and PCR with oligonucleotides D and F or oligonucleotides E and F, DNA3 and PNA4, respectively.

These reaction mixtures are ethanol precipitated, redissolved in water, and an aliquot is gel-tested to determine the concentration of DNA fragments in the mixtures.

Under the same conditions as above, DNA1 and DNA4 are subjected to PCR with oligonucleotides A and F to give DNA5, and DNA2 and DNA3 with the same oligonucleotides to give DNA6 (Figure 5).

The DNA5 starts with a BamHI site and ends with an EcoRI site and includes a perfect in-frame fusion of the original methionine type codon coupled to a PGII promoter fragment with the coding domain for the mature hybrid interferon BDBS.

The BamHI-EcoRI-Fragn-.ent of DNA5 is ligated into the BamHI-EcoRI cut plasmid pGII-IFN AM 119 precursor constructed in Example 8.1 to create the plasmid pGI-IFN AM 119.

Similarly, the BamHI-EcoRI fragment of DNA6, which contains a perfect in-frame fusion of the PGII signal sequence, coupled to a PGII promoter fragment with the coding region for the mature hybrid interferon BDBB, into the pGII-IFN AM 119- Precursor inserted,> -m to create the plasmid pGllss-IFN AM 119.

Example 8.3: Cotransformation of the Aspegillus nfger mutant at 8 with pCG59 D7 and pGllss-IFN or pGII-IFN

The uridine auxotrophic mutant An8 (= DMS 3917, disclosed in EP278355) is co-transformed with plasmid pCG 59D7 and pGllss-FN or pGII-IFN AM119 to give uridine prototrophic.

Konidialsporen of nfger A. An 8 are drawn for 4 days at 28 ⁰ C in a complete medium until they have fully sporulated. Two 10 ⁸ conidiospores are used to inoculate 200 ml of minimal medium supplemented with 1 g / l arginine and uridine.

After 20 hours of growth at 28 ⁰ C and 180 "U / min, the mycelium is harvested by filtration through Miracloth, washed twice with 10 ml 0.8M KCl, 5OmM _CaCl2 washed and resuspended in 20 ml 0.8 M KCl, 5OmM _CaCl2, 0, 5mg / ml Novozym 234 (Novo Industries) was suspended. The mixture (30 ⁰ / C 50U min) incubated in a shaking water, have been until sufficient protoplasts released (after 90 to 120 min microscopically detected). The protoplast suspension is filtered through a plug of Glass wool is filtered in a funnel to remove mycotic debris and the protoplasts are gently centrifuged

(10min, 2000U / min) pelleted at room temperature and washed twice with 10ml 0.8M KCl, 50mM CaCl ₂ . Finally, the protoplasts are resuspended in 200 to 500 μM 0.8M KCl, 50 mM CaCl ₂ to give a concentration of 1 × 10 ⁸ ZmI.

For transformation, an aliquot of the protoplast suspension is added to 200 μρ of pCG 59D7 and 50 pg of pGllss-IFN AM 119- or

pGII-IFN AM 119 or pGII-IFN AM 119 DNA, 50 μM PCT (10 mM Tris-HCl, pH 7.5, 5 mM CaCl 2, 25% PEG 6000). The

Incubation mixture is kept on ice for 20 min, a further 2 ml PCT are added, and the mixture becomes more

Incubated for 5 minutes at room temperature. 4 ml of 0.8 M KCl, 50 mM CaCl _{2 are} added and aliquots of 1 ml of the prepared transformation solution are mixed with liquefied minimal agar medium (minimal medium + 1 g / l arginine + 10 g / l

Bacto agar (Difcoj) stabilized with 0.8M KCl. The mixtures are immediately on agar plates of the same Poured medium and incubated at 3O ⁰ C. After 2 to 3 days growth at 28 ^° C., stable transformants appear as vigorously growing and speculative colonies

a background growth of many hundreds of small, probably abortive transformants.

Example 8.4: Expression of the hybrid interferon BDBB gene under the control of the PGII promoter

Transformants of the cotransformation experiment (Example 8.3) are taken out and analyzed for interferon expression. Interferon activity is determined by the method of Armstrong (JA Armsang, Appl. Microbiol, 21, 732 (1971)) using human CCL-23 cells and vesicular stomatitis virus (VSV) as the aptitude virus. Konidialsporen of transformants are individually in 50ml of a preculture medium (Pectin Slow Set L (Unipectin, SA, Redon, France !, 3g / l, NH ₄ Cl ₂ 2g / l, KH ₂ PO ₄ 0.5g / l, NaCl 0.5g / Mg ₂ SO ₄ .7H ₂ O0.5 g / l, Ca ₂ SO ₄ .2H ₂ O0.5 g / l, pH 7.0.1% arginine) is pre-cultured for 72 hours at 250 rpm and incubated for 28 ° C. 10% of the preculture are used to inoculate M ₁ ^'1 ^ main culture medium (soybean flour 20 g / l, pectin Slow set 5 g / l, 1% arginine) were used. the culture is ι 72 to 96 Stunüuii, i 250rpm and 28 ⁰ C pulled.

Samples are taken at various times (every 20 hours), the cells are pelleted by centrifugation and disrupted by freeze drying and dry milling. Both supernatant and cell extracts are assayed for interferon activity as described above. The mass of interferon activity, secreted into the medium, is found in transformants carrying pGllss-IFN AM 119, whereas transformants carrying pGII-IFN AM 119 are predominantly in the cell extract.

Examples Production of polygalacturonase I and polygalacturonase II by transformed strains of A. nldulans Example 9.1: Propagation and purification of plasmids used to transform A. nldulans G191 E. coll MH1

become

pGW635 is propagated in E. coli MH1, pGW1800 in JM109 and PGW1900 in DH5aF '.

Example 9.2: Preparation of protoplasts and transformation of primitive auxotrophic A. nlduians mutants The A. nldulans mutant strain G191 (pyrG, pabaA1, fwA1, and others Y9) was described by Ballance and Turner, 1985 (ref 27). Mycelium is grown at 37 ° C and further in the manner described for A. nlger (see Example 5.2) but with 2 mg of p-aminobenzoate added per liter of medium. Protoplasts are produced according to the procedure described for A. nlger. For the transformation, 5 × 10 ° protoplasts are taken up in 200 μl STC, which are then incubated together with 1 μg pGW635 and 20 μg pGW1800 or 25 μg pGW1900. The plates are incubated at 37 ° C for three days. In the cotransformation experiment, about 50 transformants / μg of pGW635 are obtained, and in each experiment, 20 transformants are further purified on 50 mM minimal glucose medium. These strains are then used to propagate spores for further analysis.

Example 9.3: Western blot analysis of the production of polygalacturonase I and II by transformed strains of

A. nidulans

Those recovered using pGW1800 as the transforming plasmid by the method of Example 5.2 Cotransformants are grown immersed in 75 ml of minimal medium using 2 mg / l p-aminobenzoate, 7.5 g / l NH ₄ NO ₃ as Nitrogen source and 1% (w / v) apple pectin (degree of esterification 61.2%) plus 1% (w / v) sugar beet pulp as Carbon source is used, starting with 10 ° conidiospores per milliliter. It is with the Gbllenkamp- Orbital shaker at 250U / min work, and the growth temperature is kept at 3O ⁰ C. Samples are taken after a growth time of 43 and 68 hours, centrifuged and the supernatant from

5 mM sodium phosphate buffer, pH 6.5, containing 0.02% (w / v) sodium azide, dialyzed overnight at 4 ° C. The

Analysis of the content of these samples on PGII is made by Western blotting (see (Orig. S. 69) using polyclonal

or monoclonal antibodies. A.nidulans samples used as control do not contain PGII cross-reactive material as tested with monoclonal antibodies.

The analyzed twenty transformants produce all polygalacturonase II, although the amount among the various Transformants is different. In addition to a larger band with the expected molecular mass (38kDa) are several

smaller band of lower molecular weight, most likely representing degradation products. The

Transformant that produces the most enzyme is A.nidulans G191 / PGW1800-13. The polygalacturonase activity of this Transformants were amplified using the different growth media with the activity of the recipient strain

compared, as shown in Table VIII.

Table VIII

Polygalacturonase activity of culture filtrates of A. nldulane transformant G191 / pGW1800-13 and A. nldulans G191. The strains are prepared by seeding 10 ^e spores / ml at 30 ⁰ C in minimal medium using the defined N and C sources and before. high phosphatase (15g KH ₂ PO ₄ /!) plus 0.1% yeast extract.

tribe C source N-source fermented Polygalac TIE turonase rungs- activity Time (Einh./ml) G191 3% glucose 1% NH ₄ Cl 40 n.d. G191 / pGW635-1 3% glucose 1% NH ₄ Cl 40 n.d. G191 / pGW1800-13 3% D-glucose 1% NH ₄ Cl 40 n.d. G19I 1% pectin + 1% NH ₄ Cl 40 n.d. 1% sugar beet pulp G191 / pGW1800-13 1% pectin + 1% NH ₄ Cl 40 130 1% sugar beet pulp

n.d. = undetectable

Since the transformant G191 / pGW1800-13 synthesizes high levels of PGII in the absence of pectic substances, the PGII production of the other A. nldulans G191 / pGW1800 transformants is further analyzed. For this purpose, 19 transformants and G 191 / pGW635-1 are grown in a medium consisting of minimal medium salts, using 0.4% NH ₄ Cl as nitrogen source and 5% glucose as carbon source and high concentration of phosphate (15g / l KH ₂ PO ₄ ) are added. Culture filtrates are taken at 46 and 69 hours, and are then analyzed by Western blotting and probing with the monoclonal antibody without prior concentration of ¹ μl dialysis of the culture filtrates. At least 17 of the 19 A.nldulans G191 / pGW1800 transformant syntheses PGII on the glucose medium, while no signal is detected with A. nldulans G191 / pGW635-1. The fact that clear signals are detected implies a high level of expression compared to A.nlger N402 when this strain is grown under polygalacturonase-inducing conditions, as described in Example 5.5, as only weak PGII signals on Western blots of culture filtrates of the untransformed strain when working with non-concentrated filtrates and the monoclonal antibody. Also analyzed is PGII production of A.niger G191 / pG W1800-13 and six other G191 / pGW1800 transformants using the medium described above, but 1% sugar beet pulp and 1% pectin as the carbon source instead of 5% glucose be used. In contrast to A. nldulans G191 / pGW 1800-13, these six transformants produce far more PGII on the medium with pectin and beet pulp, while again no signal is detected with A. nidulans G191 / pGW635-1.

The cotransformants obtained according to Example 9.2 using pGW 1900 as the cotransforming plasmid are grown on two different media. The first medium consists of a minimal phosphate medium with high phosphate content, the NH ₄ Cl (4.0 g / L), 1% (w / v) apple pectin (degree of esterification 61.2%) and 1% (w / v) Sugar beet pulp was added, while some transformants are also drawn in this medium with urea (4.2 g / l) instead of NH ₄ Cl from nitrogen source. The difference with the former low-phosphate minimal medium (orig. P. 28) is that 15 g KH ₂ PO ₄ per liter is used instead of i, og. The second medium also consists of a high phosphate minimum salt medium to which 0.1% yeast extract, NH ₄ Cl (10 g / l) and 3% glucose as nitrogen and carbon source are added. For both media, 2 mg / l p-aminobenzoate is added. The cultures are grown for 42 hours at 30 ° C using a Gallenkamp orbital shaker at 250 rpm, and samples of the culture filtrate are taken at 20 hours and at 42 hours. Western blots of A. nidulans G191 grown under conditions similar to the transformants show little or no protein cross-reacting with polyclonal antibodies raised from purified polygalacturonase I. In the culture filtrate of 75% of the transformants PGI is detected in significant values.

If NH ₄ Cl is used in place of urea and a high phosphate content, even in complex media, the proteolytic degradation of polygalacturonase I, which is preconditioned, is considerably reduced. Based on the results of western blotting and activity measurements, it is believed that the transformant G191 / pGW 1900-6 produced more than 1 gram of enzyme per liter, as shown in Table VI, as the specific activity of PGI550 units per mg ("Ester and Visser, 1990).

Table VI

Polygalacturonase activities of culture filtrates from A. nldulans transformant G191 / pGW 1900-6 and control strain G191 / PGW635-1. The logs are taken by inoculating 10 * spores / ml at 3O ⁰ C in minimal medium using the indicated N- and C-sources and a high phosphate content (15g KHjPO ₄ /!)

tribe C source N-source fermented Polygalac TIE turonase · rungs- activity Time (Einh./ml) G191 / pGW635-1 3% glucose 0.4% NH ₄ Cl 64 n.d. G191 / pGW635-1 3% pectin + 0.4% NH ₄ Cl 49 n.d. 1% sugar beet pulp G191 / pGW635-1 1% pectin + 0.4% urea 26 n.d. 1% sugar beet pulp G 691 / pGW 1900-6 3% glucose 0.4% NH ₄ Cl 64 5 G191 / pGW1900-6 1% pectin + 0.4% NH ₄ Cl 22 17 1% sugar beet pulp 1% pectin + 0.4% NH ₄ Cl 26 125 1% sugar beet pulp 1% pectin + 0.4% NH ₄ Cl 49 570 1% sugar beet pulp G191 / pGW1900-6 1% pectin + 0.4% urea 22 125 1 "/ o sugar beet pulp 1% pectin + 0.4% urea 26 225 1% sugar beet pulp 1% pectin + 0.4% urea 49 140 1% sugar beet pulp

n. d. = undetectable

The pgal and the pgall gene coding for polygalacturonase I or IL are not expressed in A. niger on glucose-containing media, not even in multicopy transformants with a high gene dose. The expression of these A. nlger genes in A.nldulans transformants, such as in strains G191 / pGW 1900-6 and G191 / pGW 1900-10 or in strains G191 / pGW1800-13 and G191 / pGW 1800-20 however, points out that in A.nldulans the catabolite repression of these genes is circumvented. This implies different specificities in the catabolite repression system in these different Aspergillus species. This can be used to express a particular A. nlger polygalacturonase gene in a different host, such as A. nldulans, under conditions which avoid the expression of the host's polygalactonases themselves. The polygalacturonase enzymes thus obtained are practically pure.

Example 10 Isolation, purification and characterization of polygalacturonase II from A. nldulans transformant G 191 / pGW1800-13 Example 10.1: Production of PGII using the Transformantan G 191 / pGW1800-13

An A. nIdulans transformant G191 / pGW1800-13 is grown in 100 ml cultures on a 1% beet pulp and 1% pectin medium having the composition described in Example 5.3, but with 15g / l KH ₂ instead of 1.5g / l PO ₄ are used. Likewise, this transformant is also grown on minimal medium at both low and high phosphate levels using 5% or 1% glucose as the carbon source. These media do not yield any detectable polygalacturonase II in A. niger N402, while strain A. nldulans G191 itself is unable to produce PG II as described in Example 9.3.

In the culture filtration samples of the A.nidulans transformant G191 / pGW1800-13 taken after 72 hours and using 5% glucose and a high phosphate content, a PG activity of about 860 units / ml is determined while at low phosphate content this amount is equal to 550 units / ml. The lower levels observed when working with 1% glucose and a high phosphate content are mainly due to an increase in protein turnover when the carbon source is depleted after 48 hours. At 1% glucose and low phosphate content, the production level remains low throughout the culture period. The amount of protein determined per liter of culture filtrate using 5% glucose and a high phosphate content is about 1 g / l. SDS-polyacrylamide gel electrophoresis shows that the culture filtrate of the transformant contains a protein band having a molecular mass corresponding to that of A. niger PGII.

Example 10.2: Isolation and purification of PGII from the culture filtrate of A. nldulans transformant G191 / pGW1800-13 The culture filtrate (about 21), which has a pH of about 4.9, is diluted five times with distilled water and then submerged Use of 2N NaOH brought to a pH of 6.0. To concentrate the enzyme, the solution is fed to a Sephadex DEAE-A50 column of 600 ml pre-equilibrated in 20 mM potassium phosphate buffer, pH 6.0, maintained in a Büchner funnel to allow high flow rates. All enzyme activity is adsorbed onto the ion exchange material and collected by elution with 1M NaCl in the same buffer in 300 ml (recovery: 65%). The enzyme solution is then dialysed from 10 mM Bis-Tris-Pufv </ r, pH 6.0 and fed to a Sepharose fast-flow column DEAE (60 ml bed volume) equilibrated in the same buffer. The enzyme activity is eluted by applying a NaCl gradient of 0-0.5M in a buffer at about 0.15M NaCl (total gain 57%).

Example 10.3: Properties of PQII purified from the culture filtrate of the A. nldulans transformant A. nldulans Q191 / pGW1800-13

PGII purified according to Example 10.2 has been compared with the enzyme purified from Rapidase as described in Example 1.1 (Case PGiI). Both enzymes have an apparent molecular weight of 38 kDa on SDS-polyacrylamide gels, and they react identically with polyclonal antibodies and with the monoclonal antibody (see Example 6.4). After isoelectric focusing, PGII produced by the A. nldulans transformant and purified according to Example 10.2 has a much lower microheterogeneity than the enzyme produced by A. nlger, in addition to the major band (pI value 5.2 ) only a smaller band is detected.

The kinetic properties of both enzymes were compared by measuring polygalacturonase activity at 25 ^° C. in 0.075 M sodium acetate buffer, pH 4.2, varying the polygalacturonate concentration between 0.2 and 1 mg / ml using a modified ferricyanide assay. For the A. nlger PGII of Rapidase is V _m , _x 2760 units / mg protein at a K _n value of 0.8 mg / ml polygalacturonate (USB). For the PGII derived from the transformant, the Vmix value is slightly higher, being 3480 units / mg protein, while the K _n , value is identical. Finally, PGII purified from the A. nldulans transformant was treated with cyanogen bromide according to Example 1.3 (case PGII). This results in an identical pattern of fragments as PGII purified from Rapidase.

Example 11

Expression of the pgall gene from A. niger NW756 in transformed A. nlger N 593 strain pGW1756 (Example 3.10) is used to transform A. nlger N 593 using pGW635 as the selective vector (see Example 5.2). Eight arbitrarily picked transformants are cleaned and used for further analysis. They are grown on a liquid minimum salt medium to which ammonium chloride (4.0 g / l), 1% pectin (degree of esterification 61.2%) and 1% dried and ground sugar beet pulp are added, operating according to the conditions described in Example 5.5. The PGII overproduction into the culture filtrates of the transformants is demonstrated by Western blotting using PGII-specific antibodies. Two of the PGII overproducing transformants (N593 / pGW1756-6 and N593 / pGW 1756-7) are selected and these strains and the control strain N 402 (see Example 5.5) are again grown under the conditions described above. Culture filtrates are obtained after 44 hours after inoculation and the polygalacturonase activity in the crude filtrates is determined in the manner described (Ref. 2) while the enzyme reaction mixture is buffered at pH 4.8 using 5 mM sodium acetate.

The results also show that the pgall gene is functional on pGW1756 and that this plasmid is useful for transforming

A. can be used for over-expression or overexpression of polygalacturonase activity.

Example 12

Production of Polygalacturonase C by Transformed A. nidulans Strains Plasmid pgW1919 carrying the A. niger N400 pgaC gene (Example 7.3) is used as the transforming plasmid in an experiment used for the transformation of A. nldulans G191 to Uridinprototrophie is constructed, as described in Example 9.2. Ten of the resulting transformants are purified and then used to propagate spores for further analysis. These strains and G191 / pGW635-1 are grown in a liquid minimal salt medium supplemented with 2 mg / ml p-aminobenzoate, 4.0 g / l NH ₄ Cl as nitrogen source, 1% sugar beet pulp and 1% pectin as carbon sources, using phosphate in a high concentration (15 g / l KH ₂ PO ₄ ) was added. The vaccination is carried out with 10 ° spores / ml and incubation) ei 3O ⁰ C in a Gallenkamp orbital shaker, operating at 250 U / min. Culture filtrates are collected 65 hours after seeding and the filtrates are then analyzed without prior purification or concentration. Western blots are incubated with a mixture of PGI and PGII raised antibodies (Example 1.2). Activity measurements (Ref. 2) are made in a 50 mM sodium acetate buffer, pH 4.8 containing 0.25% polygalacturonic acid (USB).

Based on the word blotting, most of the transformants obtained produce large amounts of polygalacturonase C (PGC). This result is confirmed by measuring the PG activity in the supernatant of the transformants and a control strain (A.nldulans G191, transformed with pGW635).

Example 13

The Expressfon of A. nlger pgaA and pgaD Genes In Transformed A. nidulans Strains In addition to the pgal, pgall, and pgaC genes, other members of the A. niger polygalacturonase gene family (Example 7.2) are used Transfermation used by A. nldulans. In the present example, phage λ clones are used instead of its subclones in a plasmid vector.

Phage A DNA is prepared from plate lysates as described in Example 3.5 and is then extracted once more with phenol and chloroform. For a cotransformation experiment, approximately 20 μg of λ DNA is used and the DNA is recovered in approximately equal amounts of 2 phages of the same class (e.g., APG-A10 in combination with APG-A43 or APG-D8 in combination with APG-D11). The cotransformation of A. nldulans G191 is carried out as in Example 9.2, while the controls in this case include cotransformation with pGW1900 and APGI-7 separately. When using A-phage DNA prepared in the manner described above, the transformation frequencies are lower than that of plasmid DNA purified by banding in cesium chloride gradients.

The relevant transformants are purified and analyzed as described for the pGW1910 transformants in Example 12. In this case, the transformants are also grown on a medium containing 3% glucose as carbon source (high phosphate content, 0.1% yeast extract, 1% ammonium chloride).

Using the phages of class PG-A and PG-D, respectively, mentioned above, transformants A. nldulans-G 191 / lambda A-1 and -G 191 / lambda D-1 were obtained. The polygalacturonase activities in the culture filtrates of the Zuckerrubenpulpe / pectin medium were significantly greater at 65 hours after seeding than at control G191 / pGW635-1. The pgall-related sequences present in the class A and D phages thus encode proteins with polygalacturonase activity. From Western blots, it is concluded that these gene products, polygalacturonases A and D, respectively, migrate with a similar electrophonic mobility to PGI.

A. nldulans G 191 / lambda A-1 also produces polygalacturonase A on the medium with glucose as the carbon source.

Example 14 The expression of Hybrld interferon in transformed A.nldulans strains

For a cotransformation experiment, about 20 μg of plasmid DNA pGII-IFN AM 119 or pGllss-IFN AM 119 are inserted. The cotransformation of A. nldulans G191 is carried out in the manner described in Example 9.2.

The relevant transformants are purified and analyzed as described for the transformation in Example 8.4. In this case, the transformants are also grown on a medium containing 3% glucose as carbon source (high phosphate content, 0.1% yeast extract, 1% ammonium chloride).

At several times (every 20 hours) samples are taken, the cells are pelleted by centrifugation and

disrupted by freeze drying and dry milling. The supernatant and cell extracts are assayed for interferon activity (see above). The mass of interferon activity is found secreting into the medium in transformants carrying pGII: s-IFN AM 119, whereas in transformants carrying pGII-IFNAM 119 it is predominantly detected in the cell extract, indicating that A. nldulans IFN from pGII-IFN AM 119 or pGllss-IFN AM 119 produces when glucose is used as the sole carbon source.

Example 15 Maceratlon properties of polygalacturonase II and polygalacturonase I

Cell separation of cucumber tissue is used to test the macerating activity of A.ni.qer polygalacturonases. A cucumber fruit is purchased at the local grocery store and the surface is then decontaminated by wiping with a cloth soaked in ethanol or by rinsing in Javel lye of commercial grade for one hour, diluted to 0.5% sodium hypochlorite). The cucumber is then sliced and the soft interior of the cucumber slice is removed. Two of the resulting slices (about 12 g) are added to a 100 ml conical flask containing 25 ml of a maceration buffer to which polygalacturonase has been previously added or not added. The subsequent incubation is for 24 hours with gentle, undirected shaking in a water bath, which was held at 30 ⁰ C via a thermostat. Then the flasks are checked visually. Complete maceration meets the following criteria: (i) the cucumber fruit shell is substantially free of adherent tissue, as revealed by macroscopic examination; (ii) the maceration buffer has become very cloudy; (Hi) There is a positive correlation between cell separation and high turbidity of the macerating buffer, as indicated by a high proportion of loose cells that appear to be intact, as judged by microscopic visualization.

Polygalacturonase II and polygalacturonase I, prepared in the manner described in Example 1, are tested in various buffers. Maceration Buffer A (MBA) is 5 mM sodium acetate, pH 4.8. Maceration Buffer B (MBB) is a phosphate nitrate buffer (Ishii [1976], Phytopathology 66, £ .281-289). MBB is prepared by mixing 0.1 M citric acid and 0.1 M Na ₂ HPGy solution until the desired pH of 4.5 is reached, then adding an equal volume of distilled water and then bovine serum albumin to a final concentration of 10 mg / 25 ml using a concentrated solution of 10 mg / ml.

Cucumber tissue is completely macerated within 24 hours when 1 μg polygalacturonase M is used in MBA. In this buffer, the cucumber tissue is not macerated in the absence of polygalacturonase or in the presence of 1 % polygalacturonase I. The maceration of cucumber tissue in MBB is tested in the absence of polygalacturonase or in the presence of 10 μg polygalacturonase I or polygalacturonase II. Also in this case, no maceration is observed in the absence of the enzyme or in the presence of polygalacturonase I, while polygalacturonase II completely macerates the cucumber tissue. PGII prepared according to Example 10 also has macerating properties.

references

1. Rombouts, F.M., Geraeds, CCJ. M., Visser, J. and Pilnik, W., Purification of various pectic enzymes nn crosslinked polyuronides (purification of various pectic enzymes on cross-linked polyuronides) in T.C. J. Gribnau, J.Viiser and R.F. J. Nivard (Eds.) Affinity chromatography and Related Techniques (Affinity Chromatography and Related Techniques), £ .255-260,1982, Elsevier, Amsterdam.

2. Rozie, H "Somere, W., Bonte, A., Visser, J., van't Riet, K. and Rombouts, F.M. (1988) Biotechn. Appi.Biochem. 10.346-358.

3. Robyt, J.F., Ackerman, R.J., and Keng, J.G. (1973), Anal. Biochem.45,517-524.

4. Matsudarai, P. (1987), J. Biol. Chem.262, 10035-10038.

5. Amons, R. (1987), Vnpor-phase modification of sulfhydryl groups in proteins (vapor phase modification of sulfhydryl groups in proteins), FEBS Letters 212, 68-72.

6. Maniatis, T., Fritsch, E.F., and Sambrook, J., Molecular Cloning, a laboratory manual (Molecular cloning, a laboratory manual), Cold Spring Harbor Laboratory (1982).

7. Benton, W.D., and Davis, R.W. (1977), Science 196, 180-182.

8. Caruthers, M.H., "Chemical and Enzymatic Synthesis of Gene Fragments": 1 laboratory manual (Chemical and Enzymatic Synthesis of Gene Fragments: A Laboratory Manual), Verlag Chemie (1982).

Frischauf, A. M. Lehrach, H., Poustra, A., and Murray, N. (1983) J. Mol. BIoI. 170.827 to 842.

10. Denis, L, and Cortese, R. (1987), Methods In Enzymology, Vol. 155, pp. 111-119.

11. BRL, M13 cloning / dideoxy sequencing instruction manual (M13 Cloning / Dideoxy Sequencing Instrumen- tion Manual from BRL).

12. Holms, D. S. and Quigley, M. (1981), Anal. Biochem. 114.193.

13. Goosen, T., Bloemheuvel, G., Gysier, Ch., De Bie, D.A., van den Broek, H.W. J. and Swart, K. (1987), Current Genetics 11,499-503.

14. Boeke, J.D., Lacroute, F., and Fink.G.R. (1984), Mol.Gen.Genet.197,345-346.

15. Rombouts, F.M., and Pilnik, W. (1980, Pectic Enzymes). In A. H. Rose (Eds.) Mlcrobial Enzymes and Byconversion. Economic Microbiology (Microbial Enzymes and Bfo Conversion, Economic Microbiology), Vol.5, Academic Press, p.227-282.

16. Ohtsuka, E., Matsukl, S., Ikehara, M., Takahashi, Y., And Matsubara, K. (1985), J. Biol. Chem. 260, 605-2608.

17. Pharmacia T7 sequencing TM Kit Instruction Manual, pp 1-35.

18. Yelton M.M., Hammer, J.E., and Timberlake, W.E. (1984) Proc. Natl. Acad. Sci. USA 81, 1470-1474.

19. Kam, J., Brenner, S., Barneff, L., and Cesareni, G. (1980) Proc.Natl.Acad.Sci.USA77,5172-5176.

20. Slater, R.J. (1980) in: Method in Molecular Biology Vol.2, Eds .: J.M. Walker, The Humana Press Inc.

21. Zissler, J., et al. (1971) in: The Bacteriophage Lambda Cold Spring Harbor Labs, New York, A.D. Hersley, Hsg.

22. Dente, L., Cesarini, G., and Cortese R. (1983), Nucl. Acids Res. 11, 1645-1655.

23. Dente, L., Sollazzo, M., Baldari, C, G. Cesarene and R. Cortese In: DNA Cloning vol. 1. A practical approach (DNA cloning, Vol. 1. A Practical Approach), eds .: D.M. Glover, IRL Press, Oxford 1985.

24. Norrander, J., Kempe, T., and Messing, J. (1983) Gene 26, 101-106.

25. Boel, E, Hansen, M.T., Hjort, I., Hoegh, I., FiH, N.P. (1984), EMBOJ.3,1581-1585.

26. Mount, S.M. (1982), Nucleic Aside Res. 10, 459-472.

27. Ballance, D.J., and Turner, G. (1985), Gene 36, 321-331.

28. Bimbolm, H.C. & DoIy, J. (1979), Nucleic Acids Res. 7, 1513-1523.

29. Yanisch-Perron, C, Vieira, J. and Messing, J. (1985 !, Gene 33, pp. 103-119.

30. Messing, J., Crea, R. and Seeburg, P.H., Nucleic Acids Res. 9, 309-321 (1981).

31. Renard, C.M.G.C, Voragen, A.G.J., Schols, H.A., Searle-van Leeuwen, MJ.F., Thibault.J.F., PiInIk, W. (1989). Apple Protopectin; preliminary study of enzymatic extraction. (Apple Protopectin Preliminary Examination of Enzymatic Extraction): J.P.Roozen, F.M.Romboute, A.G. J. Voragen (ed.), Food science: Basic Research for Technological Progress (food science, basic research for technical progress). PUOOC, Wageningen. Netherlands.

32. Voragen, A.G. J. (1989): Food enzymes: prospects and limitations. (Food enzymes, prospects and limits). In: J.P. Roozen, F.M. Rambouts, A.G. J. Voragen (Ed.): Food Science: Basic Research for Technological Progress. PUDOC, Wageningen, Netherlands.

33. Beldman, G., Rombouts, F.M., Voragen, A.G.J. PiInIk, W. (1984) Enzyme Mlcrob. Technol. 6,503 to 507.

34. Schmitt, J.J., and Cohen, B.N. (1983), quantitative isolation of restriction fragments from low-agarose agarose by Elutip-a affinity chromatography (Quantitative isolation of restriction fragments from low-melting agarose by Elutip - an affinity chromatography). Analytical Biochemistry 133,462-464.

35. Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K., and Pease, L.R. (1989). Enzymes: Gene splicing by overlap extension (construction of hybrid genes without the use of restriction enzymes, gene splicing by extension of the overlap). Gene 77, 61-68.

36. J.H. A.A. Uitzetter (1982). Studies on carbon metabolism in wild type end mutants of Aiperglllus nidulans (studies on the carbon metabolism in wild type and mutants of Aiperglllu »nldulan ·). PhD Thesis (Doctor dissertation), Agricultural University Wageningen, The Netherlands.

37. Bowen, B., Steinberg, J., Laemmli, U.K., and Wt intraub, H. (1980). N-JCI. Acids Res. 8: 1-20.

38. Church, G. M. and Gilbert, W. (1984), Proc. Natl. Acad. Be. USA81,1991-1995.

39th, by Holjne, G. (1986), Nucleic Acids Research 14, 4883-4690.

40. Ausübet, F.M., Brent, R., Kingston, R.E., Moore, D.D., Smith, J.A., Seidman, J.G., and Struhl, K. (Eds.) (1987). Current Protocols in Molecular Biology, John Wiley and Sons, New York, Chichester, Brisbane, Toronto, Singapore.

41. Rambosek, J., and Leach, J. (1987). Recombinant DNA in filamentous fungi: progress and prospects, CRC Critical Reviews in Biotechnology 6,357-393.

42. Gooaen, T., van Engelenburg, F., Debets, F., Swart, K., Bo8, K., and van den Broek, HWJ (1989), Mol. Genet. 219282-288.

43. Shapiro, M.B., and P. Senapathy (1987), Nucleic Acids Res. 15,7155-7174.

44. K.S. Poutanen (1990). Announcement at the 199th ACS Meeting, Boston, Mass., May 22-27. April 1990. Abstract of the Department of Cellulose, Paper and Textiles.

Deposited microorganisms

At the German Collection of Microorganisms and Cell Cultures (DSM), Mascheroder Weg 16, D-330Q Braunschweig, the following microorganisms and phages were deposited:

Microorganism: DSM no. Disposal date Escherichia coli JM109 / pGW 1800 5505 August 30, 1989 Escherichia coli DH5aF7pGW 1900 5866 21.März1990 Escherichia coli DH5aF7pGW1756 5942 18.Mai1990 Escherichia coli DH5aF7pGW1910 5943 18.Mai1990 Escherichia coli DH5aF7pGW 1911 5944 18 May 1990 Escherichia coli LE 392 5941 18 May 1990 phages all 18 May 1990 APG-A9 5945 APG-A10 5951 APG-A43 5964 APG-B4 5949 APG-B35 5960 APG-B 36 5961 APG-CI 5948 APG-C16 5954 APG-C 20 5956 APG-C 37 5962 APG-D8 5947 APG-D11 5952 APG-D12 5953 APG-E6 5946 APG-E 38 5963 APG-F5 5950 APG-G17 595S APG-G 27 5957 APG-X31 5958 APG-Y33 5959

sequence Listing

SEQ ID NO. 1

Sequence type: nucleotide with corresponding polypeptide

Sequence length: 2495 base pairs

Strand type: double strand

Topology: linear

Molecule type: genomic Original organism source: Aspergillus niger N400 Immediate expert?. :: -. Source: Plasmid pGWigoo (DSM 5866)

Characteristics: Genpg from 1 to 909: from 901 to 963: from 901 to 1 002: from 1003 to 2 127: from 1138 to 1189: from 1610 to 1671: from 2138 to 2 130: from 2131 to 2 495:

gaattcggaa

tcctaaaatt

gaacccctga

tgattcgcgg

cactcgatag

tcagtgcggc

tgagtcccag

ccaaggaccg

attgccgaga

aagcatgttg

atggggcaga

agtggagatg

gaccttcagc

GGGTTGGCCG CCGGATGACA CATGCAGTGC CCGTTAGAGA TGGTCTTTCC TCAGGAACAG AAAACTCTCC ACAACACCTC TGACCAGACC GTTGACCAGA

''. '..: Coding for A.nlger N400 prepro-polygalacturonase I

promoter region

coding region for PGI signal peptide

coding region for PGI preprosequence

coding area for mature PGI

Inset, Intror, Inset, intron stop codon

3 'non-coding region, part of the transcriptional terminator region

GAATGTCTGC TATCCGATGA AAGGAATCTC ACCCTGTAAa TGGGATCGGC CATTTCCGAC ACCAGTCTAT TGoGATGACG TCATGCCCCC CGACAGAGTG TGGGGGAAGA CCGAGAAGTG CCAAGCGTCA GACTGTAAGC CGAACCTTGG CGGCGGTATC TTGATACCCG ACCAATAATG AAGCTTAGCA AGGACTTCCG ACTCTTCCAC CCATCCATTC ACCTATACCA

TAC CAG Tyr GIn 5

GTC VaI

TTC Phe

TCT Ser

GCT Als

CTT Leu

GCC AIa

AAG

Lys

CTT Leu

GCC AIa

AAG Lys

GGC GIy

CCC

Per

20

GCC AIa

GTTCGTGCGC TCAACCGAGG GCCGAAAGGA GTGCCCTAAA ACTGGCAGTT CGATCCGTAG ATCGATATCA AGTATGCATT GTCCTGGAGG AAACAGCGTG GAGCGAGACA CCGAGAGCCG

ATCCATGCCT CCGTTAGCGT TGCTTACCAA CCTGGCTÜAA GGTGGATCGG

gaggtatctc

tggaccagtc

tcgttgagat

tccttghct

ttttggccga

acaatcacc

CTG Leu

GCT AIa

TCT Ser

GCC AIa 10

CCT Pro

GCT AIa

TCT Ser

acaacgacgt

aaccagggtc

tcaatcatat

gggtctttgc

tctagtctcg

tgctggtggg

TCACCAAATT GGCACTGAGA TGCATCCATC GATAAGCCGG CGGCATCÄGC CCGATGCTTC

TCTTGGGTCA CTGAGATACG TGCTGTGATG GCGCCCATCG AGGGTCCCCT ACTGCTTTGT TTTCACGTAT GCTCTATCCA TTCTTTCTGT AACCTGTTCT ATG CAC Met His 1

GTC VaI

CGC 'Arg

ACC TGC ACC

Thr Cys thr

35

GGC GIy

GTC VaI 25

TTC PheTCT Ser

TCC Ser

TCC Ser

ACC Thr

CTC

Lou 15

GAG GIu

TCT Ser

40 80 120 160 200 240 280 320 360 400 440 480

520 560 600 640 680 720 760 800 840 880 918

954

990

1026

GAT Asp

TCT Ser

GTT VaI

GAG ACC GIu Thr 65

GAG GIu

GTC VaI

CTC Leu

GCC AIa

CTG

Leu

55

GAC Asp

AGC GAG Ser GIu 45

AGC Ser

CTG Leu

AGC Ser

TCC Ser

AGC ATC Ser He

AC Me

GAT GCT Asp AIa 70

TCC Ser

GAG GTC GIu VaI 60

GCT AIa

AGC Ser

CCC Pro

GAT AspTGC

Cys

50

GCT AIa

TCC Ser

GGC GIy

GGC TCC

GIy Ser

75

1022

1098

1134

ACC Thr

GTATGTGCTC AACACCATCT AG TCAGCCGTCT

ATC Hey

ACC Thr

TTC Phe

TCCATCCTGG

GAG

Glu

80

GGC GIy

ACC Thr

CTATCACGCT

ACT ThrTCC Ser

TTC

Phe

85

1177

1216

TAC Tyr GGT GIy AAG Lys GAA GIu TGG Trp 90 TCC Ser MG Lys GGC GIy AGC Ser CCC Pro CTG Leu ATC lie 95 TTC Phe 220 CGC Arg TTC Phe -49- 297 448 GGA GIy GGT GIy TCT Ser 235 AAG Lys 100 GAT Asp CTG Leu GGC GIy ACT thr GTC VaI GGC GIy ACC Thr 105 ATG Met GCC Ala CTC Leu GAC Asp GGC GIy 1252 'GGT GIy GTC VaI GTG VaI ATC lie GAC Asp GGT GIy TCC Ser 250 GAC Asp 115 GGT GIy GAT Ape 240 TOC Ser CGC Arg TGG Trp ACC Thr TGG Trp 120 GAC Asp 1288 GCT Ala 110 AAG Lys AAC Asn GGT GIy ACC Thr 125 AAC Asn CGC Arg GGT GIy GGC GIy TCC Ser AAG Lys ACC Thr 130 AAG Lys _t 'AGC Ser 255 CCC Pro AAG Lys 1324 AGC Ser ATG Met GGT GIy TAC Tyr 135 ATC Hey CAC His AGC Ser GAT Asp GTT VaI 140 AAG Lys GAG GIu GAC Asp TCG Ser TAC Tyr ACC Thr TTC Phe 145 1360 TTC Phe GGC GIy ATC lie AAC Asn ATC II »150 AAG Lys AAC Asn ATC Me ACT thr CCC Pro GTC VaI 155 ICT Ser CAG Gin GCC Ala 1396 AAG Lys AGT Ser GTC VaI 160 CAG Gin GCT Ala ACC Thr AAC Asn GTC VaI 165 CAC His CTG Leu AAC Asn GAC Asp 1432 ATC lie ACC Thr ATC lie GAC Asp AAC Asn TCC Ser 175 GAC Asp GGT GIy GAT Asp GAC Asp AAC Asn 180 GGT GIy 1468 TTC Phe 170 CAC His AAC Asn ACC Thr 185 GAC Asp GGT GIy TTC Phe GAC Asp ATC lie 190 AGC Ser GAG GIu TCT Ser 1504 GGC GIy GGT GIy 195 GTC VaI TAC Tyr ATC lie AGC Ser GGT GIy 200 GCT Ala ACC Thr GTC VaI AAG Lys AAC Asn 205 1540 ACC Thr GAC Asp GAC Asp TCiC Cys ATF lie 210 GCC Ala ATC Hey AAC Asn TCT Ser GGC GIy 215 GAG GIu 1576 CAG Gin GCACGATATC CCTATTCCAC TATCATTCCT TCCATTCATA 1609 TCGCTAACAA TCAAACCCAC AG ATC Hey TCT Ser ACC Thr 1649 GGC GIy ACC Thr TGC Cys 225 GGT GIy CAC His GGT GIy 230 TCC Sor ATC Hey 1686 GGC GIy GTC VaI GGT GIy CGT Arg GAC Asp AAC Asn GTC VaI AAG Lys 245 1722 AAC As η ACC Thr ATC lie GAC Asp ACT thr GTC VaI " AAC Asn TCC Ser 1758 GCC Ala GGT GIy 260 GTC VaI ATC! Ie ACC Thr 265 ATC Hey AAG Lys GAG GIu 1794 ACC Thr 270 GAT Asp GTC Va! GAG GIu 275 ACC Thr TAC Tyr AAC Asn 280 ATC Hey 1830 1866

TCC GGA ATC ACC GAC TAC GGT ATC GTC ATC ATCGATCCAC ACTTGACATG -50- 297 448 1902 CAG CTC Ser Gly lie Thr Asp Tyr Hey Hey Val He TGCCATAGTG TTAGTGAATA Gin Leu 285 290 GTGAATTTGT AGCAGAAGTA GAC TAC GAG AAC GGC TCT CCC ACC GGC ACC TAATGATGAA AGATAGAATT 1938 GAG CAG Asp Tyr Glu Asn GIy Ser Per thr Gly Thr AATAACGGGG TGAATTAGGG Giu Gin 300 305 AGTTGTCATC CCTCACACTC 295 ACC GGT ATC CCC ATC ACT GAT GTC ACC GTT ATATCTTCCA ACCTCTGAAC 1974 CCC .TCC Thr Gly lie Pro He Thr Asp VaI Thr Val TAACAAGATT CTTCTATATC Pro Ser 310 315 GTC ACC GGT ACT CTC GAG GAT GAC GCC ACC 2010 GAC GGT Val Thr Gly Thr Leu Giu Asp Asp Ala Thr Asp Gly 320 325 TAC ATT CTC TGC GGT GAC GGC TCT TGC TCT 2046 CAG GTC Tyr lie Leu Cys GIy Asp GIy Ser Cys "he Gin VaI 335 340 330 ACC TGG TCC GGT GTT GAC CTC TCT GGT GGC 2082 GAC TGG Thr Trp Ser GIy VaI Asp Leu Scr Gly Gly Asp Trp 345 350 AGC GAT AAA TGC GAG AAC GTT CCT TCC GGT 2118 AAG ACC Ser Asp Lys Cys Uiu Asn VaI Pro Ser Gly Lys thr 360 3155 355 TGC TAA ATCGTTCCTC CGGATGCGAG GCAACGTCTG 2160 GCT TCT Cys Ala Ser 368 GGTTGTATAT 2 200 TAGGACGTCT GTGGTTI 2 240 TACTAGTTAG ITAC 2 280 ATAGGAGCTT TGCTCAATAT 2320 AATGAGTAGA CTGATAGAGG 2360 TAATACCAGG tgatgaagtt 2400 CGCGTAGGCT taggtatata 2440 GAAATCTCTT CCTCTTTCTT 2480 CACCAGTTGC CTCCACAGAC 2495 GATGCTTGAT CTCAA

SEQIDNO.2

Sequence type: nucleotide with corresponding polypeptide d Sequence length: 3031 base pairs Strand type: double strand Topology: linear Molecule type: genomic Original organism source: Aspergiiius niger N400 Immediate Experimental Source: Plasmid pGW1800 (DSM 5505) Features: Gene pgall encoding A.niger N400 prepro! Galacturonase II

from 1 to 1 356: promoter region from 1 357 to 1 419: coding region for PGII signal peptide from 1 357 to 1 437: coding region for PGII preprosequence from 1 438 to 2 494: coding region for mature PGII from 1 987 to 2 038: intron from 2 495 to 2 497: stop codon

from 2 498 to 3 031: 3 'non-coding region. Part of the transcription terminator area

TCTAGAAGCA TTAATCTGCT TGACTCCCTC ATAGGGGTAA AACGGGACAA GCGCACTGGT CCGTTTTGCG AATGAATCCA AGCATCACTC GCAGGTGGAA CTTCCCGTGG TGACGAACGC TCAATATAGC TGGAGCGAAT TATGGTTCAC GGCTTCCGAT CCAGCACTAC ATAGGAGGAA GGATATCGAG AGATTTGCTC TGGAGAACAT UTTGTCTCCA TGGCTTCTAC CCGGCTAGAA CTGCCATGAT GCACCAGACT TTTGTCCTCC TGTCGATATT AATACCGGGC AATCTGTATC

AACACGCTGG GGTCAGAGCA AACCTTGAAA GAGGGTAATG GGAATAGTGT CAGACATAAA TGCCCCGAGG CGCGCTCGAT TGAGGTTGTT GAAAAAACGT

40 80 120 160 200 240 280 320 360 400

GCT ATGACCTTTC AACAACTAAC CGCCCCTATC GTC CAC -51- 440 297,448 AACTTGATGA Ala 5 ACCAGTATAG TCCACCGGAT TCGCTCACCG Val His 480 CACTGCTGTG ACC GCTTCCTCCT TTTTCGTCAT CTTTTCCTCT GAA GCC 520 TTAGCCAGTG Thr CCCCACTCCA GGTTGCTTGT TGCCGGCAAG Glu Ala 560 TCTTGACTGG TGATTAGCGA GCTTTGCGCA CTATTCCTGA 25 GCT 600 CTTTCGACCC AGC GAAGGAACGG ATGGACGCTG CGCTAGTTTC GCT Ala 640 TTTAGCTGTC Ser TCTGATAT7A ACATTGGCTA CAGACTAGCC Ala 680 ATCTCGAATC CGGAATCTGG CACACAGGGA GTTTATGGAC GCT 720 GATTACGCTC GGC TGGAACTAGC AAAGCACCAT AATTGCCGCG ACC Ala 760 CGTTCATTGG Gly TTCAGGCTGC AGCCTTACTA ggattagtat Thr 800 GACCCTGCAT TCGTACTCGT ACACTGCAGT ACCGGCCTGG CTT 840 AGCTGTCTTC ATC TCAACGATGG CATCCGCTTC CTCCAGGACT CTC Leu 880 AATCTCGGGA lie TGTGAAGGCC AATTATAGTG TTGCTTGTTT Leu 50 920 TACGGCTGCT TCAGCGGTAC ATACAAACGC TTCTCTATCT GAC 960 ACGTGCCAAT GGT GACAATAGGT TTACCCTCGG GAGCGGAGCT ATC Asp 1000 TGCCCTTTTT Gly TCCACCGACA TGCGCATCCG TTCCATCACC He 1040 ttgccttctf 65 GTCGGCTGAT CAGCCACGCA CGGCTGGTAT TTC 1080 CGCGGAACCC ACC GCCACTCATG TCGAACTGAG GTTCACGGGA TGG Phe 1120 AAATTAATCG Thr TTTGAGACAA CACCTCAATA TGAAACGAGG Trp 1160 AAACGCAATA CTACATTTCC TCCAGGGGCT GTCGGCAGTT 85 GCA 1200 ATCCAGGGTC TTG CGACCGGAAA AGATTCGCAA TAGTCGTGAG ATC Ala 1240 ATGAACTTTT Leu TJGTACCTGC ICA CACTGAT GTCTACTTGC He 1280 TATAAGAACC ACACTCATTC AAAATCTTAC CAACAACACT ACC 1320 TCATCATTCC GGT TTCTTTTCTA TTGTTAACAA TTAATC ATG TGC Thr 1362 CCTTCTGTCA Gly Met 1 Cys TCT CTT CTC GCC TAC GGC CTG GAT 1398 TCG TTT CGC Ser Leu Leu AIa Tyr 0 Gius Leu AGC Asp Ser Phe bad TTC GCT TCT GCC TCT CCT ATC Ser 110 1434 GGC GCC The AIa Ser AIa Ser Pro He GGA GIy Ala AAG 20 GGC Gly 15 Lys TGC ACG TTC ACC ACC GCT GCC Gly 1470 CGA GAC 125 Cys thr Phe Thr Thr Ala Ala CTT Arg Asp 30 35 Leu AAG GCG AAA TGC TCT ACT ATC 1506 AAA GCG Lys aaa Lys Cys Ser Thr Hey Lys Ala 45 40 GAA GTT CCA GCT GGA ACC ACC 1542 AAC AAC GIu VaI Pro Ala GIy Thr Thr Asn Asn 55 60 CTC ACC AGC GGT ACC AAG GTC 1578 CTG ACC Leu Thr Ser GIy Thr Lys VaI Lou Thr 70 ACG ACC TTC CAG TAC GAA GAA 1614 GAG GGC Thr Thr Phe GIn Tyr GIu GIu GIu GIy 80 75 ATC TCC ATG AGT GGC GAA CAT 1650 GGC CCC He Ser Met Ser GIy Giu His GIy Pro 90 95 GCC TCC GGC CAC CTC ATC AAT 1686 GTC ACT AIa Ser GIy His Leu Let Asn VaI thr 105 100 TGG TGG GAT GGC AAG GGA ACC 1722 GGT GCG Trp Trp Asp Gly Lys GIy Thr GIy Ala 115 120 CCC AAG TTC ΤΓΤ TAC GCC CAT 1758 AAG AAG Pro Lys Phe Phe Tyr Ala his Lys Lys 130th

TCC Ser ACC Thr TCG Ser TCT Ser ATT lie ACT Thr 140 GGC GIy 5 GGC GIy GGA GIy TTA Leu AAC Asn TGG Trp ATC lie AAA Lys 145 AAC Asn ACC Thr 215 GGC GIy -52- 297 448 1794 GAC Asp 135 CCC Pro GTC VaI 230 CTT Leu , PG Met 150 GCG Ala TTT Phe CGC Arg TCC Ser AGT Ser GTC VaI GAG Gin 155 CTC Leu 225 GCG Ala AAT Asn GAC Asp ATC lie GGC GIy 1830 ACC Thr ACG Thr 160 - ACC Thr TlT Phe ACC Thr GAT Asp GTT VaI CAC His 245 TCC Ser ACC Thr 165 ATC lie AAT Asn GTC VaI AAT Asn GCG Ala GAT Asp 170 AAG Lys AAC Asn 240 1866 ATT lie GAC Asp GCC Ala ACC Thr CAG Gin GGT GIy 175 GGA GIy ATT Hey AAG Lys CAC His AAC Asn ACT thr AGC Ser GAT Asp 180 GCG Ala TTC Phe TCC Ser GAA GIu 1902 GGC GIy GTT VaI TCC Ser GGC GIy 185 AAC Asn TCG Ser GTC VaI GAG GIu ATT lie 270 GGG GIy GTG VaI 190 AAT Asn TCT Ser ATC Hey ATT Hey AAG Lys GCC Ala ACT thr 1938 GAT Asp TGG Trp TCT Ser GTC VaI CAT His AAC Asn CAG Gin 200 TCC Ser GAT Asp GAT Asp GAC Asp TGT Cys TCC Ser CTT Leu GCG Ala 205 GTT VaI ATC Ib 275 GTC VaI 1 & 74 CCT Pro 195 TCT Ser GAT Asp 290 GGC GIy GAG GIu 210 GTAAGCAGCT GAC Asp GGC GIy CTGCATATAT GTG VaI 285 GCTTGATTCG ATT Hey CAG Gin 2016 AAC Asn TAATTATATT AAC Asn GATATTCTAT AC ACT Thr 305 ATT lie AAC Asn ATC lie ACG thr TTC Phe AAG Lys CCG Pro 300 2056 GGC GIy GTG Va! TGC Cys ATT He 220 AGC Ser GTG VaI CAC His GGT GIy GTT VaI TCC Ser CTG Leu GAG GIu 2092 TCT Ser GGC GIy GAC Asp AAC Asn 235 AAC Asn GGG GIy GTC VaI ACT thr GAG GIu 2128 GTC VaI ATC lie GAA GIu ACC Thr GTG VaI AAT Asn 250 2164 AAC Asn GTC VaI 255 CGA Arg ACC Thr ATC He 260 GGC GIy 2 200 GGC GIy 265 GTG VaI TCC Ser ACG thr TAC Tyr AAC Asn 2236 ATG Met GGC GIy ATC He 280 TAC Tyr GGC GIy GTC VaI 2272 CAG Gin TAC Tyr GAA GIu AAG Lys 295 CCT Pro GGT GIy 2308 ACG thr GGT GIy GTC VaI CAG Gin GAT Asp AAG Lys 310 2344 AGC Ser ACT Thr 315 GGT GIy GAT Asp AGT Ser 320 GCT Ala 2380

CTT CTT TGC GGG TCT GGT AGC TGC TCG GAC -53- 297 448 2418 ATC ACT Leu Leu Cys GIy Ser GIy Ser Cys Ser Asp let Tyr 330 335 325 TGG GAC GAT GTG AAA GTT ACC GGG GGG AAG 2452 TGG ACC Trp Asp Asp VaI Lys VaI Thr GIy Gly Lys Trp thr 340 345 ACC GCT TGC AAG AAC TTC CCT TCG GTG GCC 2488 AAG .TCC Thr Ala Cys Lys Asn Phe Pro Ser Val Ala Lys Ser 355 360 350th DAY GCTGCTAGGT TGGTGAGTTG TAGCCCTAGC 2 527 TCT TGT Ser Cys 362 CTGCTTCGTC TGCTTCGTCT GCTTCGTCTG 2 567 TGAAATTCGT TTCTTCTGCT TCGTCTGCTT TGTCTGCTTT 260 / CTTCGTCTGC TCCACTTCGT CCACTTCGAC TGGTTAGATG 2647 GTCTGCTTCG TAGTTTTTAG AGAGAACAGA ATATGTACAG 2 687 GGCCTTGTAA AGGTGGTACC GAGTTGTATA TTTATTTAAA 2727 TAAGCCTTAG TCGCGTGTCT TTATATTTAT AGCCTTTTAC 2 767 ATGTTACCTA AGCTACAGTG GATTATCTTA CAGCCCACAC 2807 ATATATACGG GGGAACTACG TGAATGAATG CTCGGTTAGA 2847 TCATCGTGCT CACTGCCACA ACCAACCAGG AACCTTGGCA 2887 AGGCCTTGCT TGGGCATTTT TGTCTGGCCC TATCTCTTTC 2927 GGTACATGCT TCTGGATGAG TCACGGCACG AGTAGATTGA 2967 CAGATGGTGG AACCCGCGCA TAAAGCATAC GCCAGAAGTG 3007 CCGCTACTCC AAGACAGCCA GCTG 3031 CAAGGGATAC

SEQIDNO.3

Sequence type: nucleotide with corresponding polypeptide Sequence length: 3047 basone pairs Strand type: double strand Topology: linear Molecule type: genomic Original organism floater: Aspergillus niger NW756 Immediate Experimental Source: pGW1756 (DSM 5942) Characteristics: Gene pgall encoding the A.niger NW756 prepropyl galacturonase II From 1 to 889: promoter area

from 890 to 952: coding region for PGII signal peptide

from 890 to 970: putative coding region for PGII preprosequence from 971 to 2 027: putative coding region for mature PGII

from 1 520 to 1 571: intron from 2 028 to 2 030: stop codon

from 2,031 to 3,047: 3'-nk coding region, part of the transcriptional terminator region

CCGGATTTGC TGTCTTCTCC TGCTTATTGC TTGCACACTA GACGCTGCAC CTAACTACAG CACAGAGTGA AAGGCACCAT AGCCTTACTG

ACACTGCAGA ACCCGTTTCC ATTATAGTAC TATGAATCTG

acgctcaaga gaacctgttc

ccaccacggc

cttaagttca

cttaatgtga

aggctgtcgg

gctgaaattg

tgaggtgagt

agaccgatta

TCACCGnGG

TTCCTCTCCT CGGCAAGCTT TTCCCGATGT TAGTTTCATT

AGTGACTAG ^

TTTTTTGAAT AAATGCCGCA GGATTAGTAT ACCGGCTTGG TCCAGGACTG TGCTTGTCAA TCTTTGTCTT GGGCATTTTG GGTCACCCGC TCATATATAT TTAAAAAAAA AACGTGAACC CAGTTATGAC TGACTATAAG TTGCTCATCA

CACTCT (TTT

CCAATGGCTT TGACTGGCCC TCAACCCTGA AGCTGTCGAA TCGAATCTCT CGATCACGCT CATTCATTGG GACCCTGCAT AGCTGCCATC

ATCCCAAGGC ATGGCTGTTT TGTCTTGAGT TCCACCTTGA

CGTrcTTTTC GGACCCCGTC TAGTTGCCCA GGTAACATTT CTGGACTAGC TTTCCGATCA AACCTCAAGC TCCTACACTC

GTCC111111

CCTCCTTTCC CACTCCAGGT TTAGCGAGCT GGAACGGATG GATATTAATA CCGGATCTGG TGGAATTTGC ATCGAGCTAC TCGTACTCGT CTACGATGAC GTGAAGGCGA CAGCGGTATA CAATAATGTT ATCGACATGC GGCTGATCAG CCATGTCGAA GAGACAATAT ATCTCTCCAG GAAGAGATGC CTGCCGATGC ATTTGGCATC TCTATCGCTA

40 80 120 160 200 240 280 320 360

400 440 480 520 560 600

640 680 720 760 8CO 840 880

TCATTGACC GGC GIy CTA Leu ATG Met CAC His TCC Ser TTT Phe GCT Ala C TCT Ser CTT Leu CTG Leu GCC AIa TAC Tyr 10 CCC Pro ATC Me 1 GCC Ala GCC Ala AGC Ser 15 GCC Ala O ACC Thr CTC Leu GCT AIa TCT Ser 20 GCC AIa TCC Ser GCT Ala 35 GCT Ala GAA GIu 25 GCC Ala CGG Arg GGA GIy AGC Ser TGC Cys 30 ACC Thr TTC Phe AAA Lys ACG thr ACC Thr ATC Me GCT Ala GCC Ala AAA Lys GCG Ala 40 GGC GIy AAG Lys GCA AIa GGG GIy TGC Cys 45 TCT Ser ACC Thr ACC Thr 60 ACC Thr CTT Leu 50 GAC Asp AAC Asn ATC lie GAA GIu GTC VaI 55 CCC Pro GCT AIa GGA GIy AAG Lys GTC VaI CTC Leu GAC Asp CTG Leu ACC Thr GGT GIy 65 CTC Leu ACC Thr AGC Ser GGT GIy ACG Thr 70 GAA GIu GAA GIu ATC lie TTC Phe GAG GIu 75 GGC GIy ACC Thr ACG thr ACC Thr TTC Phe 80 GAT Asp TAT Tyr AAA Lys 95 GAT Asp TGG Trp 85 GCA Ala GGC GIy CCC Pro TTG Leu ATC Me 90 TCC Ser ATG Met AGT Ser GGC GIy ATC lie AAC Asn ATC Hey ACC Thr GTC VaI ACT Thr 100 GGT GIy GCC AIa TCA Ser GGC GIy CAT His 105 CTC Leu GGG GIy ACC Thr ι: ί » TGC Cys GAC Asp 110 GGT GIy GCG Ala CGG Arg TGG Trp TGG Trp 115 GAC Asp GGC GIy AAG Lys GCT Ala CAT His AGC Ser GGA GIy AAG l.ys AAG Lys AAG Lys 125th CCC Pro AAG Lys TTC Phe TTC Phe TAC Tyr 130 AAT Asn ATC lie GGC GIy CTT Leu GAC Asp 135 TCC Be TCG Ser TCC Ser ATT Hey ACT Thr 140 GGA GIy TFG Leu CAG Gin 155 GCG Ala AAG Lys 145 AAC Asn ACT thr CCC Pro CTT Leu ATG Met 150 GCG AIa TTT Phe AGT Ser GTT VaI AAC Asn AAC Asn GAT Asp GAC Asp <VTC let ACT Thr 160 GCT Leu ACT thr GAC Asp ATT Me ACC Thr 165 ATC lie ACT thr G / .r Asp 180 GCG Ala GAC Asp 170 GGT GIy GAT Asp ACC Thr CTG Leu GGT GIy 175 GGA GIy CAC His AAC Asn AAT Asn ATC lie GCG. Ma TTT Phe GAT Asp GTT VaI GGT GIy 185 AAC Asn TCT Ser GTC VaI GGT GIy GiG VaI 190 TGT Cys CTT Leu ATC lie AAA Lys CCG Pro 195 TGG Trp GTC VaI CAT His AAC Asn CAG GIn 200 GAT Asp GmC Asp GCG Ala 2C5 ATC lie AAC Asu TCT Ser GÜC GIy GAG Giu 210 GTAAGCAGCT

916 952

988 1024 1060 1096 1132 1168 1204 1240 1276 1312 1348 1384 1420 1456 1492 1529

TGG ATTTGATTTG CATGTATGTT GATATTCTAT j \G GGC -55- 297 448 1571 TTGAACATAG Trp TTT ACC AGC GGC ACC TGC ATT GGC Gly 1607 AAC ATC Phe thr Ser GIy Thr Cys Hey Gly Asn lie CTC 215 220 TTC Leu TCC ATC GGT TCT GTC GGC GGC CGC Ser 1643 CAC GGT 225 Ser Me GIy Ser VaI GIy GIy bad His GIy GTT 230 TCC Val GTC AAG AAC GTC ACT ATC GAA CAC Ser 1679 AAC AAC. VaI Lys Asn VaI thr lie GIu His Asn Asn AGC 240 245 AAG 235 Ser AAT TCC GAG AAC GCC GTC CGG ATT Lys 1715 ACC GTG Asn Ser Gius Asn Ala VaI Arg lie Thr VaI TCT 250 255 ATC Ser GGT GCC ACT GGT TCC GTG TCT GAG lie 1751 ACC GTC GIy Ala Thr GIy Ser VaI Ser Glu 270 Thr VaI TCC 265 GAT 260 Ser AAC ATT GTC ATG TCC GGC ATC TCC Asp 1787 ACA TAC Asn lie VaI Met Ser GIy lie Ser Thr Tvr GTC 275 280 GGC Val GTT ATC CAG CAG GAT TAC GAG GAT G "y 1823 TAC GGC 285 VaI lie Gin Gin Asp Tyr Glu Asp Tyr GIy ACG 290 ATT Thr GGT AAG CCC ACG AAC GGT GTC ACT lie 1859 AAG CCT Gily Lys Pro Thr Asn GIy VaI Thr Lys Pro GTC 300 305 GTG 295 Val AAG CTG GAG AGC GTG ACT GGT ACT Val 1895 ACG GAT Lys Leu GIu Ser VaI Thr GIy Thr Thr Asp AAG 310 315 GGA Lys GCT ACT GAT ATC ACT CTC CTT TGC Gly 1931 GAT AGT Ala Thr Asp lie Ty Leu Leu Cys 330 Asp Ser AGC 325 GTG 320 Ser TGC TCG GAC TGG ACT TGG GAC GAT Val 1967 TCT GGT Cys Ser Asp Trp Thr Trp Asp Asp Ser Gly ACT 335 340 AAA Thr GGA GGA AAG AAG TCT ACT GCT TGC Lys 2003 AAG GTC 345 GIy GIy Lys Lys Ser Thr Ala Cys Lys VaI CCT 350 Per TCG GTG GCT TCT TGC DAY GTTAGTAGGT 2040 AAC TAC Ser VaI Ala Ser Cys Asn Tyr 360 362 355 TAGCACTTGC TAACATGCAT , TCTTGAG 2080 TGTTCGGTTG GATTTGTGAA ATTATCGGTG TG, .. .. ~ * AGA 2120 GGGTCAAATG AGTAAGATTC AGTGGTGGCA GCGTGTATAG 2160 GATGGTGTCC TGTTATTTAT CGCATAACTC TATATATCAA 2 200 CTCTATACAA AAGAGAACCT GCCTTCAGCC ACAAATAACC 2 240 ATACTCGATT G ^ AGGTATCA GATTCCGGGA ACCCCTACCT 2280 AAGTTCCTCG CGTTGCAGAT AGTTCTGCTG GTAAATCAGG 2320 AGCCTTACTC GAATTACGAT GCCAGCAAAT TCACCGCTAC 2360 ATGGTATGCT GCATAAAACA TACGCCAGAA GTGCAAGGGA 2400 TCCAACCCGC CAGCTGTGTC TTCGCGCAAG TAACTCTGCA 2440 TAAAGACAGC TCTGACATAG TATAG CATC TCTTCTACAC 2480 TAATCCAGTT TCCCTCTCCA TAAACTCCCT CACAGTAATA 2520 CTTGGCAAAC TCCCCTTCCC GCCCTTGGCC TTAAACGCCG 2560 AGCGTCTCCC CGCCGCAGCC GTTTGAATCT CCGTAGGCCC 2600 CCTTCTTCAA TACTCCCCAT CCCTAAACTG CGAATAAATA 2640 ATTACCAAAG GCTCCTGCTC ACGCCAATAC TCCCCTTTCG 2680 AAAACATCCC GTTCGGGTCC GCTAGAACCT GATACCGGGC 2720 TATTCATGTC

GTCACTATAC CCATCACCGT CAGCATCTAC -56- 297 448 2760 TTTCTTGCCA TCACGTAAAA GATAATGATA AGTAAAACCT 2800 TCATCACTCA AAACGTATTC ACCACCTCCG CCGATGAAAC 2840 TACCAGAAAC GACCCCTGAA TCAGCCGTCT ATTCCACCGC 2880 AATATCACTC CAAAAACCCC ATGAACCAGA TCCCCAAAGT 2920 AACGGGTTAA ACTGATCCAG GGGAAATCTT CTTTCCCGCC 2960 CATCCTTCAT GTCTTGTATG TTAGATAACC CTCAGAGTCA 3000 CCAAAATGGC GCCATCCGCC GAATAAGTCG GCGTAGTCCG 3040 GGGAATGTGG 3047 GCTCGAG

SEQIDNO.4

Sequence type: nucleotide with corresponding polypeptide Sequence length: 2304 Strand type: double strand Topology: linear Molecule type: genomic Original source: Aspergillus niger N400 Direct experimental source: pGW1910 (DSM 5943)

Features: Gene pgaC encoding A. niger N400 prepro-polygalacturonase C From 1 to 662: 663 to 710 promoter region: coding region for PGC signal peptide from 663 to 782: presumptive coding region from 783 to 1 995: putative coding region for mature PGC from 927 to 1 001: intron from 1 428 to 1 438: intron from 1 614 to 1 666: intron from 1 996 to 1 998: stop codon from 1 999 to 2 304: S 'non-coding region, Part of the transcription terminator area

CCATGGCTGA ATC AACTTTGCCC CTGACCTAGT CCATTTCATT CTT GTG 40 TTATATAATG He CTGATGAGAT ATGGTTCTTG CACAACTATG Leu 5 Val 80 CTTTTCCTCG GTCGGTGCGT AATGTATAGT TCGTGGGTGG GCT 120 TAAGGAAATT CCT CACCGACAGC AACTCCCAGC ATAACATGGA Aia ACG 160 GAAGAACCGA Per TGAATGAGCA GCGACAAACA TGGTACCACA Thr 200 ATTCTTGAAT 20 AAGCATTTAG ACTCCGGCTT GG 11111 CC GTT 240 GTTGCATTGG CCT CGCTGGTGTT GTTCCTGCGC ACGGTGCAAC Val GCG 280 CGTTATCTCC Per ACCAATGATT ACCTGCAGAA AGCCCATGGC Ala 320 TGCAACCACC CAGCCGACTT GAGTCCACCT AACAGCATAC AGG 360 TCAGCATACT TGC CGATGCTGGG AATTACTTCA GGTATGGTCG bad TCC 400 GCTGAATATG Cys CAGTCGATTT CCGGCGCCAG GAACAGTCCG 40 Ser 440 GCCCCCTCAC CACGGACATA GACCCGCCAC CAAAACGTCG GCA 480 ATAGCGGCCT AGC CGCTTCGTCA ACGACCATTT TGCCCACCCC Ala ATC 520 TGACACCCAG Ser GAAAGACGTC TTCCAATAAC AATATAAAAG ne E60 GGCGAGTCTT GTCCTCTCAC TTTCCGTCTT TCGAGTATGC ACA 65 600 CTTGCCAGTT CCCAACTTGA CTTGAGACCT CCCATTTCGG Thr 640 TCATTTGTCA CCCGCTATAA GA ATG GTC CGT CAG 677 Met VaI 1 Arg GIn ATC CTG AGC AGT CTG CTG GCA GCT GTT 713 Hey Leu Ser Ser Leu Leu AIa Ala VaI 10 15 CGC GCG GCC GAT CCG GCT CAT CCC ATG 749 Arg AIa Ala Asp Pro Ala His Pro Met 25 GAA GCG GAC GTC AAT TTG GTT GAA AAG 735 GIu AIa Asp VaI Asn Leu VaI Giu Lys 30 35 ACT ACT ACC TTC TCG GGC TCC GAA GGT 821 Thr Thr Thr Phe Ser GIy Ser GIu GIy 45 50 AAG GCC AAG TCG AAA ACC TCT TGC TCC 857 Lys AIc Lys Ser Lys Thr Ser Cys Ser 55 60

TAC Tyr CTG Leu GGA GIy TAT Tyr TCC Ser GAC Asp GTG VaI 70 ACT thr GCC Ala GCC Ala GTC VaI CCA Pro ATGTCTTATT TCT Ser GGC GIy 75 GGA GIy TAC Tyr GAG GIU 100 GCTGACGAT GTG VaI TGT Cys GTG VaI ACA thr ACC Thr CTGGTAG GGT GIy AAC Asn CAC His 893 CTT Leu GAT Asp CCT Pro 105 CTC Leu 80 TCT Ser GAC Asp CGT Arg CTG Leu AAT Asn GAT Asp 85 GGA GIy ACC Thr TCT Ser 110 GGA GIy ACT thr AGT Ser GAA GIu CAC His TC Γ Ser 240 GGT GIy 926 GTACGTTCCC GAG GIu CGGGTGATTC AGC Ser 120 CTCACACCCA GCG Ala GTG VaI CTC Leu GAT Asp 966 ATCGCGTCAA AGC Ser TAGTACTGGC TGG Trp TGACAGATGT ACTAG GGA GIy GAG GIu 135 GGT GIy AAT Asn 125 ATC lie 90 TTC Phe 1010 CAG Gin AAA Lys GAA GIu ACC Thr 95 CCC Pro TTT Phe TTC Phe TTC Phe TAT Tyr GGC GIy TGG Trp GAA GIu 1046 GGG GIy ACC Thr CTT Leu GTG VaI ACC Thr GTT VaI AAG Lys AGC Ser ATC lie 160 GCC Ala ATC lie ACG Thr 115 1082 GTC VaI TCT Ser 165 GGG GIy GAG GIu CAG Gin GAC Asp TTC Phe 170 AGC Ser ATC lie TAC Tyr GGC GIy GAT Asp 1116 GGC GIy GAT Asp CGC Arg 130 TGG Trp ATG Met 180 GAT Asp GAT Asp ATC lie ACG thr GAT Asp AAT Asn GGT GIy 1154 GGT GIy 140 GAT Asp ACA thr AAG Lys ACG thr AAG Lys 145 GAC Asp CTC Leu 195 GCC Ala GTG VaI 185 CAT His 150 GAC Asp 1190 TTG Leu GGC GIy TCT Ser TCC Ser 155 ATC lie ATC Hey (3AA GIu AGC Ser ACC Thr GCC Aia ATC lie GAG GIu 1226 AAC As η ACA thr CCT Pro GTG VaI GAA GIu GTG VaI TAC Tyr AAC Asn CAA Gin 220 TAT Tyr GGC GIy TCC Ser 175 1262 Thr GCC Ala 225 CTT Leu ACC Thr TCT Ser ACT thr GAG GIu 230 GTATGCGTCC GAT Asp GAT Asp AAC Asn 1298 ACG thr ATTGAGAGGA GGT GIy 190 GAC Asp GAGGCGCCTT GAC Asp AAT Asn ACG thr 1334 GAT Asp 200 ATT lie TTC Phe GAC Asp AGT Ser 235 GGG GIy 205 ATC Me 210 ACG thr 1370 ATC lie GGT GIy GCC Ala 215 ATC lie GAC Asp TGC Cys 1406 GTT VaI ATC Hey AAT As η GGA GIy CCTGGCACTG 1447 1486 TTC Phe Κ'522

CTG AAG TCT ATT GGC TAC TCT GTT GGT GAC ACT GGT CGG GAT TTA GCA ATC GAT -58- 297 448 GGC Leu Lys Ser lie Gly Tyr Ser Val Gly Asp Thr Gly bad Asp Ala He Asp 1558 Gly 250 255 275 245 ACT GTC GTC AAG AAC CAT GTG ACG TTT ATT GCC DID GAT GTC GGC TCC GTC AAT AAC Thr Val Val Lys As η His Val Thr Phe lie Ala Tyr Asp Val Gly Ser Val Asn 1594 As η 290 260 295 265 285 CTC GAT AAG TCC CAG ATT CAA GGTAAGGGAA ATT GAG AGCATTTGAA TTT TCG GAC GTT - Leu Asp Lys Ser gin He Gin He Glu Phe Ser Asp 1632 Val 270 305 CCATCCGTTT ACC GCCGTCCTCT ACC ACT ACC CAG AAC DID CGT Thr Thr Thr Thr Gin As η Tyr bad 1674 AACGTATGCT 320 310 ATC GAT ACC ATC CTC AAC ATC GGG GTA CCG AGC He Asp Thr He Leu Asn He Gly Val Per Ser 1710 280 GGC GAA GAT ACT TAC TGT Gly GAA GTA GTT GGA ACG GCT Glu Asp Thr Tyr Cys Glu Val Val Gly Thr Ala 174S GAG 335 300 ACT GAT TAC GGC TGC Glu GAT TGG TAC ATT GCC GAT Thr Asp Tyr Gly Cys Asp Trp Ty. lie Ala Asp 1782 350 GTC 355 345 GAC AGC TCC AAG GGC Val AGT GTC ACT TGG ACT ATC Asp Ser Ser Lys Gly Ser Val Thr Trp Thr He 1818 315 365 CCT ACG AAT TTT GTG TCC Per Old AGC AGT GAC GAC TGT Thr As η Phe Val Ser lie Ser Ser Asp Asp Cys 1854 325 GAG 380 370 GAA GCCGTTGTGA GAT GAT TTGGGGGAGA Glu TGTTCCCGGG TGC GAT TTG TGC Glu UTTCGTTTAG Asp Asp CCAGCCCTTT 330 CTGTTGAGTG Cys Asp Leu Cys 1890 CTATACTGTC 340 GATTGTGTGT ACC GAGATTACTA 383 GGT GGAAAGAGCA GGC AGC GTGCATCCTA Thr TCTTTTATTC TACTCTGGTC GGC Gly GGGGTTGGCC Gly Ser TACTAGTACA TTGTACCCGA GCCTGTTCTT Gly 1926 GTGAAAGTAA AGGGCTTACA TCG GAATTAGTCC CCTTGCCCGA 360 GTG ACAACTTTTA GTG ACT TCAGAGCGCA Ser TCGGTCACGT TTTGCCGGTC TGC Val GTATTGATCA Val Thr ATGAAGATAA CTTGG AGAGTCAACG Cys 196? GGC AGGAGCAAAG CTT GTT CCC Gly CATGTTGAAA DAY Leu Val Per 1998 375 GGG Gly 2 038 2078 2118 2158 2198 2 238 2278 2304

Claims (48)

1. A process for the preparation of a recombinant DNA molecule which comprises a DNA sequence selected from a) the Aspergillus niger DNA insert of pGW1800 or pGW1900, b) a DNA sequence which hybridizes to the coding region for the mature PGII or PGI which is included in a DNA insert according to a) and which comprises a structural gene for a polypeptide having galacturonase or polygalacturonase activity and optionally a promoter, a coding gene Range for a signal or leader peptide and / or a transcription terminator, c) a derivative of a DNA sequence as defined in a) or b) or d) a DNA sequence which codes for a mature PG or its signal peptide or its leader peptide and which is degenerate within the meaning of the genetic code with respect to a DNA sequence according to a), b) or c), characterized in that it comprises the steps a) Isolation of genomic DNA from suitable fungal cells and selection of the desired DNA, e.g. Using a DNA probe or using a suitable expression system and screening for the desired polypeptide, or b) isolation of mRNA from suitable fungal cells, selection of the desired mRNA, e.g. By hybridization with a DNA probe or by expression in a suitable expression system and post-expression expression of the desired polypeptide, coinage of single-stranded cDNA complementary to this mRNA, then from double-stranded cDNA, or c) isolation of cDNA from a cDNA library and selection of the desired cDNA, e.g. Using a DNA probe or a suitable expression system and views after expression of the desired polypeptide, or / and d) incorporation of the double-stranded DNA from step a), b) or c) into an appropriate vector, e) transformation of appropriate host cells with the obtained hybrid vector, f) selecting transformed host cells containing the desired DNA from untransformed host cells or multiplying the transformed host cell and, if necessary, g) Isolation of the desired DNA and / or conversion of the DNA into a mutant or its fragment. 2. The method of claim 1 for the preparation of a recombinant DNA molecule comprising the Aspergillus niger DNA insert of pGW1800 or pGWi900. A method according to claim 1 for the preparation of a recombinant DNA molecule comprising a DNA sequence which hybridizes to the coding region for the mature PGII or PGI comprised by a DNA insert of pGW 1800 or pGW 1900, which encodes a polypeptide having galacturonase or polygalacturonase activity and / or a signal or leader peptide and / or has promoter and / or transcriptional terminator activity. The method of claim 1 for the preparation of a recombinant DNA molecule comprising a derivative of the Aspergillus niger DNA insert of pGW 1800 or pGW 1900 or a DNA sequence which hybridizes to the coding region for the mature PGII or PGI, comprising a DNA insert of pGW1800 or pGW1900 encoding a polypeptide having galacturonase or polygalacturonase activity and / or a signal or leader peptide and / or having promoter and / or transcriptional terminator activity. A method according to claim 4 for the preparation of a recombinant DNA molecule comprising an insert or its fragment from a vector selected from the group of vectors selected from XPG-A9, -A10, -A 43, -B 4, -B-35, -B36, -CVC16, -C20, -C37, -D8, -D11, -D12, -E6, -E38, -F5, -G17, -G27, -X31 and Y33, pGW1756, pGW1910, pGW1800, pGWi900 and pGW 1756. A method according to claim 4 for the preparation of a recombinant DNA molecule comprising a DNA fragment derived from the A. nlger insert of pGW 1800 or pGW1900 or a DNA sequence directed to the coding region for the mature PGII or PGI hybridized by one of the DNA inserts, and a structural gene and / or a leader or hybrid Signal peptide encoded and / or comprises a sequence with promoter and / or transcription terminator activity. A method according to claim 4 for the preparation of a recombinant DNA molecule comprising a DNA fragment having promoter activity derived from an insert of a vector selected from the group of vectors selected from XPG-A9, -A10 , -A43, -B4, -B35, -836, -01, -016, -C20, -037, -08, -011, -012, -E6, -E38, -F5, -G17, -G27 X31 and Y33, pGW1910, pGW 1800, pGW 1900 and pGW1756. 8. The method of claim 4 for the preparation of a recombinant DNA molecule comprising a DNA fragment coding for a leader peptide derived from an insert of a vector selected from the group of vectors consisting of XPG-A9, -A10, -A43, -B4, -635, -636, -01, -016, -C20, -C37, -D8, -D11, -O12, -E ^ -ESe ₁ -FB, -G17, -G27, -X31 and -Y33, pGW1910, pGW1800, pGW1900 and pGW1756. 9. A method according to claim 4 for the preparation of a recombinant DNA molecule comprising a DNA fragment encoding a signal peptide derived from an insert of a vector selected from the group of vectors derived from XPG. A9, -A10, -A43, -84, -835, -B36, -Cl ₁ -016, -C20, -C37, -D8, -011, -012, -E6, -E38, -F5, -G17, -G 27, -X31 and -Y33, pGW1910, pGW1800, pGW1900 and pGW1756. A method according to claim 4 for the preparation of a recombinant DNA molecule comprising a DNA fragment having transcriptional terminator activity derived from an insert of a vector selected from the group of vectors selected from XPG-A9, -A10 , -A43, -64, -B35, -B36, -01, -016, -020, -037, -08, -011, -012, -E6, -E38, -F5, -G17, -G 27, -X31 and -Y33, pGW1910, pGW1800, pGW1900 and pGW 1756. A method according to claim 4 for the preparation of a recombinant DNA molecule comprising a DNA fragment encoding a structural gene for a galacturonase or polygalacturonase, or its fragment having galacturonase or polygalacturonase activity derived from an inset of a vector, selected from the group of vectors consisting of XPG-A9, ^ 10, ^ 43, -84, -835, -836, -01, -016, -C 20, -037, -08, -011, - 012, -EO, ^ 38, -Fo, -G17, -G27, -X31 and -Y33, pGW1910, pGW1800, pGW1900 and pGW1756. 12. The method according to claim 1 for the preparation of a recombinant DNA molecule according to claim 1, which is an expression cassette. 13. ancestor according to claim 1 for the preparation of a recombinant DNA molecule which is a hybrid vector. 14. The method of claim 1 for the preparation of a recombinant DNA molecule selected from the group of vectors selected from pGW1800, pGW1900, pGW1756, pGW1910, XPG-A9, XPG-A10, XPG-A43, XPG-B4, XPG-B35, XPG-B 36, XPG-C1, XPG-C16, XPG-C20, XPG-C37, XPG-D8, XPG-D11, XPG-D12, XPG-E6, XPG-E38, XPG-F 5, XPG-G17, XPG-G 27, XPG-X31 and XPG-Y33. A process for the preparation of a DNA molecule comprising a gene for a PG or its functional fragment isolated from a PG-producing filamentous fungus strain, characterized in that it comprises the steps a) Isolation of genomic DNA from suitable fungal cells and selection of the desired DNA, e.g. Using a DNA probe or using a suitable expression system and views after expression of the desired polypeptide, or b) isolation of mRNA from suitable fungal cells, selection of the desired mRNA, e.g. By hybridizing with a DNA probe or by expression in a suitable expression system and looking for the expression of the desired polypeptide, preparing single cDNA that is complementary to this mRNA, and double-stranded cDNA of this or that c) isolation of cDNA from a cDNA library and selection of the desired cDNA, e.g. Using a DNA probe or using a suitable expression system and views after expression of the desired polypeptide, or / and d) incorporation of the double-stranded DNA from step a), b) or c) into an appropriate vector, e) transformation of suitable host cells with the obtained hybrid vector, f) selecting transformed host cells containing the desired DNA from non-transformed host cells or multiplying the transformed host cell and, if necessary, g) Isolation of the desired DNA and / or conversion of the DNA into a mutant or its fragment. 16. The method of claim 15 for the preparation of a DNA molecule isolated from Aspergilius spec. The method of claim 15 for the production of a DNA molecule which is a insert of a hybrid vector selected from the group of hybrid vectors selected from pGW1800, pGW 1900, pGW 1756, pGW 1910, XPG-A9, XPG-A10, XPG -A43, XPG-B4, XPG-B35, APG-B36, XPG-C16, XPG-C20, XPG-C37, XPG-D8, XPG-D11, XPG-D12, XPG-E6, XPG-E38, XPG- F5, XPG-G17, XPG-27, XPG-X31 and XPG-Y33, or its fragment containing the promoter region of a PG gene or a coding region for a signal peptide, leader peptide, prepro-PG, PG or a fragment of a PG having galacturonase or polygalacturonase activity or a transcriptional terminator region of a PG gene. 18. A process for the preparation of a host transformed with a recombinant DNA molecule comprising a DNA sequence selected from a) the Aspergilius niger DNA insert of pGW 1800 or pGW 1900, b) a DNA sequence which hybridizes to the coding region for the mature PGII or PGI formed by a DNA insert of a) and which comprises a structural gene for a polypeptide having galacturonase or polygalacturonase activity and optionally a promoter, a coding region for a signal or leader peptide and / or a transcription terminator, c) a derivative of a DNA sequence as defined in a) or b) or d) a DNA sequence which encodes a mature PG or its signal peptide or its leader peptide and which is degenerate within the meaning of the genetic code with respect to a DNA sequence according to a), b) or c), characterized in that a suitable host cell is treated under transforming conditions with a recombinant DNA molecule according to the present invention, in particular a hybrid vector according to the present invention, optionally together with a selection marker gene, and optionally the transformants is selected. 19. A process for the preparation of a polypeptide, characterized in that a structural gene inserted into an expression cassette comprising a DNA sequence selected from a) the Aspergilius niger DNA insert of pGW 1800 or pGW 1900, b) a DNA sequence which hybridizes to the coding region for the mature PGII or PGI comprised by a DNA insert of a) and which comprises a structural gene for a polypeptide having galacturonase or polygalacturonase activity and optionally a promoter, a coding region for a signal or leader peptide and / or a transcription terminator, c) a derivative of a DNA sequence as defined in a) or b) or d) a DNA sequence which codes for a mature PG or for its signal peptide or for its leader peptide and which is degenerate within the meaning of the genetic code with respect to a DNA sequence according to a), b) or c), according to conventional methods in a suitable host and the polypeptide is optionally isolated in a conventional manner. 20. The method according to claim 19, characterized in that an Aspergilius nlger strain is used. 21. The method according to claim 19, characterized in that an Aspergilius nidulans strain is used. 22. The method according to claim 19, characterized in that the structural gene encodes the hybrid interferon BDBB. 23. The method according to claim 19, characterized in that the structural gene encodes a polypeptide with galacturonase or polygalacturonase activity and is derived from a DNA sequence which is selected from a) the Aspergillus niger DNA insert of pGW 1800 or pGW 1900, b) a DNA sequence which hybridizes to the coding region for the mature PGII or PGI comprised by a DNA insert of a) and which comprises a structural gene for a polypeptide having galacturonase or polygalacturonase activity and optionally a promoter, a coding region for a signal or leader peptide and / or a transcription terminator, c) a derivative of a DNA sequence as defined in a) or b) or d) a DNA sequence which codes for a mature PG or for its signal peptide or for its leader peptide and which is degenerate within the meaning of the genetic code with respect to a DNA sequence according to a), b) or c). 24. A process for the preparation of a single PG _1, characterized in that this PG is purified by conventional methods from a crude source. 25. The method according to claim 24, characterized in that a PG is purified in purified form from a raw enzyme mixture, which was obtained from Aspergillus niger. 26. A process for the preparation of a single galacturonase or polygalacturonase which is encoded by a DNA sequence according to claim 1 or its derivative having galacturonase or polygalacturonase activity, and their biologically acceptable salts. A process for the preparation of an enzymatic composition comprising a polypeptide according to claim 26 or a mixture thereof, optionally in a predetermined combination with one or more enzymes having other than PG activity. Process for the processing of plant material, wherein a polypeptide according to claim 26 or an enzymatic composition according to claim 27 is used. 29. A recombinant DNA molecule comprising a DNA sequence selected from a) the Aspergillus niger DNA insert of pGW1800 or pGW1900, b) a DNA sequence which hybridizes to the coding region for the mature PGII or PGI which is included in a DNA insert according to a) and which comprises a structural gene for the polypeptide having galacturonase or polygalacturonase activity and optionally a promoter, a coding gene Range for a signal or leader peptide and / or a transcription terminator, c) a derivative of a DNA sequence as defined in a) or b) or d) a sequence which codes for a mature PG or its signal peptide or its leader peptide and which is degenerate within the meaning of the genetic code with respect to a DNA sequence according to a), b) or c). The recombinant DNA molecule of claim 29 comprising the Aspergillus niger DNA insert of pGW1800 or pGW1900. 31. Recombinant DNA molecule according to claim 29, which comprises a DNA sequence which hybridizes to the coding region for the mature PGII or PGI which is encompassed by a DNA insert of pGW1800 or pGW1900 which is suitable for a polypeptide with galacturonase or polygalacturonase activity and / or a signal or leader peptide and / or has promoter and / or transcription terminator activity. 32. The recombinant DNA molecule of claim 29, which comprises a derivative of the Aspergillus niger DNA insert of pGW 1800 or pGW 1900 or a DNA sequence which hybridizes to the coding region for the mature PGII or PGI which is derived from a DNA Which comprises a polypeptide having galacturonase or polygalacturonase activity and / or a signal or leader peptide and / or having promoter and / or transcription terminator activity. 33. The recombinant DNA molecule of claim 32, which comprises an insert or its fragment from a vector selected from the group of vectors selected from XPG-A9, -A10, -A43, -B4, -635, -836 , -01, -016, -C 20, -C 37, -08, -011, -012, -Ee, ^ 38, -Fo, -G 17, -G 27, -X31 and -Y33, pGW1756, pGW1910, pGW1800, pGWi900 and pGW1756 is formed. A recombinant DNA molecule according to claim 32 which comprises a DNA fragment derived from the A. niger insert of pGW1800 or pGW1900 or a DNA sequence which hybridizes to the coding region for the mature PGII or PGI, the by one of the DNA inserts and encodes a structural gene and / or a leader or signal peptide and / or comprises a sequence with promoter and / or transcription terminal activity. A recombinant DNA molecule according to claim 34, which comprises a DNA fragment having promoter activity derived from an insert of a vector selected from the group of vectors selected from APG-A9, -A10, ^ 43, - 64, -835, -836, -01, -016, -020, -C 37, -08, -DH, -D12, -E6, -E38, -F5, -G17, -G27, -X31 and -Y33 , pGW1910, pGW1800, pGW1900 and pGW1756. A recombinant DNA molecule according to claim 34 comprising a DNA fragment coding for a leader peptide derived from an insert of a vector selected from the group of vectors selected from XPG-A9, -A10 , -A 43, -B 4, -B 35, -B 36, -01, -O 16, -C 20, -C 37, -D 8, -D 11, -D 12, -E 6, -E 38, -F 5, -G 17, -G27, -X31 and -Y33, pGW1910, pGW1800, pGWi900 and pGW 1756. A recombinant DNA molecule according to claim 34 comprising a DNA fragment coding for a signal peptide derived from an insert of a vector selected from the group of vectors consisting of XPG-AO, ^ 10, ^ 43, -84, -835, -836, -01, -016, -020, -037, -D8, -P11, -D12, -E6, -E38, -F5, -G17, -G27, -X31 and Y33, pGW1910, pGW1800, pGWi900 and pGW 1756. A recombinant DNA molecule according to claim 34 comprising a DNA fragment having transcriptional terminator activity derived from an insert of a vector selected from the group of vectors selected from XPG-A9, -A10, -A43, B4, -B35, -B36, -C1, -016, -C20, -O37, -D8, -D11, -D12, -E6, -E38, -F5, -G17, -G27, -X31 and -Y33 , pGWi910, pGW1800, pGWi900 and pGW1756. A recombinant DNA molecule according to claim 34 comprising a DNA fragment encoding a structural gene for a galacturonase or polygalacturonase or its fragment having galacturonase or polygalacturonase activity derived from an insert of a vector selected from the group of vectors selected from XPG-A9, -A10, -A43, -B4, -B35, -B36, -01, -016, -C20, -037, -08, -011, -012, -E6 , -E38, -F5, -G17, -G27, -X31 and -Y33, pGW1910, pGW1800, pGWi900 and pGW1756. 40. The recombinant DNA molecule of claim 29, which is an expression cassette. 41. The recombinant DNA molecule of claim 29, which is a hybrid vector. 42. The recombinant DNA molecule of claim 41 selected from the group of vectors selected from pGW1800, pGW1900, pGW1756, pGWi910, XPG-A9, XPG-AIO, XPG-A43, XPG-B4, XPG-B 35, XPG-B 36, XPG-C1, XPG-C16, XPG-C 20, XPG-C 37, XPG-D 8, XPG-D11, XPG-D12, XPG-E 6, XPG-E38, XPG-F5, XPG -G17, XPG-G 27, XPG-X31 and XPG-Y33. 43. A DNA molecule comprising a gene for a PG or its functional fragment isolated from a PG-producing filamentous fungus strain. 44. The DNA molecule according to claim 43, which is isolated from Aspergillus spec. 45. The DNA molecule of claim 43, which is an insert of a hybrid vector selected from the group of hybrid vectors selected from pGW1800, pGW1900, pGW1756, pGW1910, XPG-A9, XPG-A10, XPG-A 43, XPG- B 4, XPG-B 35, XPG-B 36, XPG-C1, XPG-C16, XPG-C 20, XPG-C 37, XPG-D 8, XPG-D11, XPG-D12, XPG-E6, XPG E38, XPG-F5, XPG-G17, XPG-G27, XPG-X31 and XPG-Y33, or its fragment containing the promoter region of a PG gene or a coding region for a signal peptide, leader peptide, a prepro PG, PG or a fragment of a PG having galacturonase or polygalacturonase activity or a transcriptional terminator region of a PG gene. 46. A host transformed with a recombinant DNA molecule according to claim 29. 47. A single galacturonase or polygalacturonase encoded by a DNA sequence according to claim 29 or its derivative having galacturonase or polygalacturonase activity and their biologically acceptable salts. An enzymatic composition comprising a polypeptide of claim 47 or its mixture, optionally in a predetermined combination with one or more enzymes having other than PG activity.