DD287104A5 - IMMUNOASSEY FOR DETECTION OF AN HCU ANTIGEN AND ANTICO PERPERS PROVIDED AGAINST A HCU ANTIGEN - Google Patents
IMMUNOASSEY FOR DETECTION OF AN HCU ANTIGEN AND ANTICO PERPERS PROVIDED AGAINST A HCU ANTIGEN Download PDFInfo
- Publication number
- DD287104A5 DD287104A5 DD88321971A DD32197188A DD287104A5 DD 287104 A5 DD287104 A5 DD 287104A5 DD 88321971 A DD88321971 A DD 88321971A DD 32197188 A DD32197188 A DD 32197188A DD 287104 A5 DD287104 A5 DD 287104A5
- Authority
- DD
- German Democratic Republic
- Prior art keywords
- hcv
- clone
- cdna
- sequence
- polypeptide
- Prior art date
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
Die Erfindung betrifft Immunoassay zum Nachweis eines HCU-Antigens und von Antikoerpern, die gegen ein HCU-Antigen gerichtet sind. Erfindungsgemaesz wird beispielsweise ein Immunoassay zum Nachweis eines HCU-Antigens zur Verfuegung gestellt, dadurch gezeichnet, dasz (a) eine Probe, die vermutlich ein HCU-Antigen enthaelt, mit einem Sondenantikoerper, der gegen, das nachzuweisende HCU-Antigen gerichtet ist, unter Bedingungen inkubiert wird, die die Bildung eines Antigen-Antikoerper-Komplexes gestalten; und (b) ein Antigen-Antikoerper-Komplex, der den Sondenantikoerper enthaelt, nachgewiesen wird.{Immunoassay; HCU-Antigen; Antikoerper Sondenantikoerper; Antigen-Antikoerper-Komplex}The invention relates to immunoassay for the detection of an HCU antigen and of antibodies directed against an HCU antigen. According to the invention, for example, an immunoassay for detecting an HCU antigen is provided, characterized in that (a) a sample suspected of containing an HCU antigen is probed with a probe antibody directed against the HCU antigen to be detected under conditions is incubated, which shape the formation of an antigen-antibody complex; and (b) detecting an antigen-antibody complex containing the probe antibody. {Immunoassay; HCU antigen; Antibody Probe Antibodies; Antigen-antibody complex}
Description
Hierzu 63 Seiten ZeichnungenFor this 63 pages drawings
Die Erfindung betrifft Immunoassay zum Nachweis eines HCU-Antigens und von Antikörpern, die gegen ein HCU-Antigen gerichtet sind, zur Beherrschung der Verbreitung der Infektion durch das Nicht-A-Nicht-B-Hepatitisviruo (NANBU),The invention relates to an immunoassay for detecting an HCU antigen and antibodies directed against an HCU antigen for controlling the spread of infection by the non-A non-B hepatitis viruo (NANBU),
In der Anmeldung zitierte Literatur Barr und Mitarbeiter (1986), Biotechniquos 4:428In the application cited literature Barr and coworkers (1986), Biotechniquos 4: 428
Botstein (1979), Gene 8:17. Botstein (1979), Gene 8:17.
Brinton, M. A. (1986) in: The Viruses: The Togaviradae and Flaviviridae, (Serien herausgegeben von Fraenkel-Conra! und Wagner, Band herausgegeben von Schlesinger und Schlesinger, Plenum Press), S.327-374.Brinton, M.A. (1986) in: The Viruses: The Togaviradae and Flaviviridae, (Series edited by Fraenkel-Conra! And Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press), p.327-374.
Broach (1981) in: Molecular Biology of the Yeast Saccharomyces (Molekularbiologie der Saccharomyces), Band 1, S.445, Cold Spring Harbor Press.Broach (1981) in: Molecular Biology of the Yeast Saccharomyces, Vol. 1, p.445, Cold Spring Harbor Press.
Broach und Autorenkollektiv (1983), Meth. Enz. 101: 307Broach and Autorenkollektiv (1983), Meth. Enz. 101: 307
Chang und Autorenkollektiv (1977), Nature 198:1056 Chang and author collective (1977), Nature 198: 1056
Chirgwin und Autorenkollektiv (1979), Biochemistry 18,5294 Chirgwin and author collective (1979), Biochemistry 18, 5294
Chomczynski und Sacchi (1987), Analytical Biochemistry 162:156 Chomczynski and Sacchi (1987), Analytical Biochemistry 162: 156
Clewell und Autorenkollektiv (1969), Proc. Natl. Acad. Sei. USA 62:1159 Clewell and Author Collective (1969), Proc. Natl. Acad. Be. USA 62: 1159
• Clewell (1972), J.Bacteriol. 110:667 Clewell (1972) J. Bacteriol. 110: 667
Cohen (1972), Proc. Natl. Acad. Sei. USA 69: 2110 Cohen (1972), Proc. Natl. Acad. Be. USA 69: 2110
Cousens und Autorenkollektiv (1987), Gene 61: 265 Cousens and author collective (1987), Gene 61: 265
De Boer und Autorenkollektiv (1983), Proc. Natl. Acad. Sei. USA 292:128 De Boer and Author Collective (1983), Proc. Natl. Acad. Be. USA 292: 128
Dreesman und Autorenkollektiv (1985), J. Infect. Disease 151:761 Dreesman and Autorenkollektiv (1985), J. Infect. Disease 151: 761
Feinstone, S. M. und Hoofnagle, J. H. (1984), New England, J. Med. 311:185. Feinstone, S.M. and Hoofnagle, J.H. (1984), New England, J. Med. 311: 185.
Fields und Knipe (1986), Fundamental Virology (Grundlagen der Virologie), (Raven Press, New York)Fields and Knipe (1986), Fundamental Virology (Foundations of Virology), (Raven Press, New York)
Fiers und Autorenkollektiv (1978), Nature 273:113. Fiers and Author Collective (1978), Nature 273: 113.
Gferety, R. J. und Autorenkollektiv, in Viral Hepatitis and Liver Disease (Virus > epatitis und Leberkrankheit) (Vyas, B. N., Dienstag, J.L. und Hoofnagle, J.H., herausgegeben von Grüne und Stratton, Inc., 198·!, S.23-47Gferety, R.J., and author collective, Viral Hepatitis and Liver Disease (Vyas, B.N., Tuesday, J.L., and Hoofnagle, J.H., edited by Grüne and Stratton, Inc., 198, p.23-47
Goeddel u. Autorenkollaktiv (1980), Nucleic Acids Res. 8: 4057 Goeddel u. Autorenkollaktiv (1980), Nucleic Acids Res. 8: 4057
Graham and Van der Eb (1978), Virology 52: 546 Graham and Van der Eb (1978), Virology 52: 546
Grunstein und Hogness (1975), Proc. Natl. Acad. Sei USA 73:3961 Grunstein and Hogness (1975), Proc. Natl. Acad. Be USA 73: 3961
Grych u. Autorenkollektiv (1985), Nature 316:74 Grych u. Author Collective (1985), Nature 316: 74
Gubler und Hoffman (1983) Gene, 25,263. Gubler and Hoffman (1983) Gene, 25, 263.
Hammerling und Autorenkollektiv (1981), Monoclonal Antibodies and T-CeII Hybridomas (Monodonale Antikörper und T-Zellen-Hybridome) Hess u. Autorenkollektiv (1968), J. Adv. Enzyme Reg. 7:149.Hammerling and author collective (1981), Monoclonal Antibodies and T-CeII Hybridomas (monodonal antibodies and T cell hybridomas) Hess et al. Author collective (1968), J. Adv. Enzyme Reg. 7: 149.
Hinnen u. Autorenkollektiv (1978), Proc. Natl. Acad. Sei. 75:1929. Hitzeman u. Autorenkollektiv (1980), J. Biol. Chem. 255: 2073. Holland u. Autorenkollektiv (1978), Biochemistry 17:4900. Holland (1981), J. Biol. Chem. 256:1385. Houghton u. Autorenkollektiv (1981), Nucleic Acids Res. 9:247.Hin u. Author Collective (1978), Proc. Natl. Acad. Be. 75: 1929th Hitzeman u. Author collective (1980), J. Biol. Chem. 255: 2073. Holland u. Author collective (1978), Biochemistry 17: 4900. Holland (1981) J. Biol. Chem. 256: 1385. Houghton u. Authors collective (1981), Nucleic Acids Res. 9: 247.
Hunyh, T.V. u. Autorenkollektiv (1985) in: DNA Cloning Techniques; A Practical Approach (Verfahren zur DNA-Clonierung; Praktisches Herangehen), (herausgegeben von D. Glover, IRL Press, Oxford, Großbritannien), S. 49-78. Immun. Rev. (1982) 62:185. Iwarson (1987), British Medical J. 295,94P.Hunyh, T.V. u. Author collective (1985) in: DNA Cloning Techniques; A Practical Approach (Edited by D. Glover, IRL Press, Oxford, UK), pp. 49-78. Immune. Rev. (1982) 62: 185. Iwarson (1987), British Medical J. 295, 94P.
Kennett u. Autorenkollektiv (1980), Mono -lonal Antibodies. (Monoclonale Antikörper) Laemmli (1970), Nature 227,680. Lee u. Autorenkollektiv (1988), Science 239:1288.Kennett u. Author collective (1980), Mono-Lonal Antibodies. (Monoclonal Antibodies) Laemmli (1970), Nature 227, 680. Lee u. Author collective (1988), Science 239: 1288.
Maniatis, T. u. Autorenkollektiv (1982), Molecular Cloning; A Laboratory Manual (Molekularclonierung, ein Laborhandbuch) (Cold Spring Harbor Press, Cold Spring Harbor, New York). Maye und Walker, Herausgeber (1987), lmmunochemical Methods in Cell and Molecular Biology (lmmunocheciische Methoden in der Zeil- und Molekularbiologie), (Academic Press, London). Mdxam u. Autorenkollektiv (1980), Methods in Enzymology 65:499. MacNamara U.Autorenkollektiv(1984),Science226:1325. Messing u. Autorenkollektiv (1981), Nucleic Acids Res. 9: 309. Messing (1983), Methods in Enzymology 101: 20-37. Methods in Enzymology (Academic Press).Maniatis, T. u. Author Collective (1982), Molecular Cloning; A Laboratory Manual (Molecular Cloning, Laboratory Manual) (Cold Spring Harbor Press, Cold Spring Harbor, New York). Maye and Walker, Eds. (1987), Immunochemical Methods in Cell and Molecular Biology (Academic Press, London). Mdxam u. Authors collective (1980), Methods in Enzymology 65: 499. MacNamara U.Autor collective (1984), Science 226: 1325. Brass u. Authors collective (1981), Nucleic Acids Res. 9: 309. Messing (1983), Methods in Enzymology 101: 20-37. Methods in Enzymology (Academic Press).
Monath (1926) in: The Viruses: The Togaviradae and Flaviviridae (Serie herausgegeben von Fraenkel-Conrat und Wagner, Band herausgegeben von Schlesinger u. Schlesinger, Plenum Press), S. 375-440. Nagahuma u. Autorenkollektiv (1984), Anal. Biochem. 141:74. Neurath u. Autorenkollektiv (1984), Science 224:392.Monath (1926) in: The Viruses: The Togaviradae and Flaviviridae (Series edited by Fraenkel-Conrat and Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press), pp. 375-440. Nagahuma u. Author collective (1984), Anal. Biochem. 141: 74th Neurath u. Author Collective (1984), Science 224: 392.
Nisonoff u. Autorenkollektiv (1981), Clin. Immunol., Immunopathol. 21:397-406. Overby, L.R. (1985), Curr. Hepatol. 5:49. Overby, L.R. (1986), Curr. Hepatol. 6: Overby, L.R. (1987), Curr. Hepatol. 7: Peleg (1969), Nature 221,193.Nisonoff u. Author collective (1981), Clin. Immunol., Immunopathol. 21: 397-406. Overby, L.R. (1985), Curr. Hepatol. 5:49. Overby, L.R. (1986), Curr. Hepatol. 6: Overby, L.R. (1987), Curr. Hepatol. 7: Peleg (1969), Nature 221, 193.
Pfefferkorn und Shepirs (1974), in: Comprehensive Virology (Allgemeine Virologie), Bd. 2 (herausgegeben von Fraenkel-Conrat u. Wagner, Plenum Press, New York) S. 171-230. Piince, A.M. (1983), Annu. Rev. Microbiol. 37: 217.Pfefferkorn and Shepirs (1974), in: Comprehensive Virology, Vol. 2 (edited by Fraenkel-Conrat & Wagner, Plenum Press, New York) p. 171-230. Piince, A.M. (1983) Annu. Rev. Microbiol. 37: 217.
Rice u. Autorenkollektiv (1986) in: The Viruses: Togaviradae and Flaviviridae (Serie herausgegeben von Fraenkel-Conrat und Wagner, Band herausgegeben von Schlesinger u. Schlesinger, Plenum Press), S. 213-328.Rice u. Author collective (1986) in: The Viruses: Togaviradae and Flaviviridae (series edited by Fraenkel-Conrat and Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press), pp. 213-328.
Roehrig (1986) in: The Viruses: The Togaviridae and Flaviviridae (Serie herausgegeben von Fraenkel-Conrat and Wagner, Band herausgegeben von Schlesinger u. Schlesinger, Plenum Press). Sadler u. Autorenkollektiv (1980), Gene 8,279. Saiki u. Autorenkollektiv (1986), Nature 324:163. Sanger u. Autoronkollektiv (1977), Proc. Natl. Acad. Sei. USA 74: 5463. Schlesinger u. Autorenkollektiv (1986), J.Virol. 60:1153.Roehrig (1986) in: The Viruses: The Togaviridae and Flaviviridae (series edited by Fraenkel-Conrat and Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press). Sadler u. Author collective (1980), Gene 8,279. Saiki u. Author collective (1986), Nature 324: 163. Sanger u. Autoron Collective (1977), Proc. Natl. Acad. Be. USA 74: 5463. Schlesinger u. Author collective (1986), J. Virol. 60: 1,153th
Scopes (1984), Protein Purification, Principles and Practice, Second Edition (Protein, Reinigung, Prinzipien und Praxis, 2. Ausgabe) (Springer-Verlag, New York). Shimatake u. Autorenkollektiv (1981), Nature 292:128. Steimer u. Autorenkollektiv (1986), J. Virol. 58:Scopes (1984), Protein Purification, Principles and Practice, Second Edition (Protein, Purification, Principles and Practice, 2nd Edition) (Springer-Verlag, New York). Shimatake u. Author Collective (1981), Nature 292: 128. Steimer u. Author collective (1986), J. Virol. 58:
Stoller (1980) in: Die Togaviren (Herausgeber: R.W. Schlesinger, Academic Press, New York) S. 584-622. Taylor u. Autorenkollektiv (1976), Biochem. Biophys. Acta 442:324. Towbin u. Autorenkollektiv (1979), Proc. Natl. Acad. Sei. USA 76:4350.Stoller (1980) in: The Togaviruses (Editor: R.W. Schlesinger, Academic Press, New York) pp. 584-622. Taylor u. Author collective (1976), Biochem. Biophys. Acta 442: 324. Towbin u. Author collective (1979), Proc. Natl. Acad. Be. USA 76: 4350.
' Tsu und Herzenberg (1980), in: Selected Methods in Cellular Immunology (Ausgewählte Methoden in der Zellimmunologie) (W. H. Freeman u. Co.) S. 373-391.Tsu and Herzenberg (1980), in: Selected Methods in Cellular Immunology (W.H. Freeman & Co.) pp. 373-391.
Vytdehaag u. Autorenkollektiv (1985), J. Immunol. 134:1225. Valenzuela, P. u. Autorenkollektiv (1982), Nature 298: 344.Vytdehaag u. Authors collective (1985), J. Immunol. 134: 1225th Valenzuela, P. u. Author collective (1982), Nature 298: 344.
Valenzuela, P. u. Autorenkollektiv (1984), in: Hepatitis B (Millman, I. u. Autorenkollektiv, Herausgeber: Plenum Press) S.225-236. Warner (1984), DNA 3:401.Valenzuela, P. u. Author collective (1984), in: Hepatitis B (Millman, I. and author collective, publisher: Plenum Press) p.225-236. Warner (1984), DNA 3: 401.
Wu und Grossman (1987), Methods in Enzymology, Bd. 154, Recombinant DNA, Teil E. Wu (1987), Methods in Enzymology, Bd. 155, Recombinant DNA, Teil F. Zoller (1982), Nucleic Acids Res. 10: 6487.Wu and Grossman (1987), Methods in Enzymology, Vol. 154, Recombinant DNA, Part E. Wu (1987), Methods in Enzymology, Vol. 155, Recombinant DNA, Part F. Zoller (1982), Nucleic Acids Res. 10 : 6487.
Nicht-A-Nicht-B-Hepatitis (NANBH) ist eine übertragbare Krankheit oder Familie von Krankheiten, von der angenommen wird,daß sie durch ein Virus induziert wird, und die sich von anderenFormen Virus-begleiteter Leberkrankheiten, einschließlich derjenigen, die durch die bekannten Hepatitisviren, d.h. Hepatitis-A-Virus (HAV), Hepatitis-B-Virus (HBV) und Delta-Hepatitis-Virus (HDV) verursacht werden, wie auch von der durch das Zytomegalie-Virus (CMV) oder das Epstein-Barr-Virus (EBV) induzierten Hepatitis unterscheidet. NANBH wurde erstmals bei Menschen mit Bluttransfusionen identifiziert. Die Übertragung vom Menschen auf Schimpansen und Serienpassagen in Schimpansen lieferten den Nachweis, daß NANBH auf (einen) übertragbare(n) Infektionserreger zurückzuführen ist. Das für NANBH verantwortliche Übertragungsmittel ist jedoch immer noch nicht identifiziert, und die Zahl der diese Krankheit verursachenden Erreger ist unbekannt. Die epidemiologischen Beweise lassen darauf schließen, daß es drei Typen NANBH geben kann; den durch Wasser übertragenen epidemischen Typ, den Blutoder Nadeltyp und den sporadisch auftretenden (in der Gemeinschaft erworbenen) Typ. Die Anzahl der die NANBH verursachenden Erreger ict jedoch unbekannt.Non-A-non-B hepatitis (NANBH) is a transmissible disease or family of diseases believed to be induced by a virus other than those of other forms of virus-associated liver disease, including those caused by the virus known hepatitis viruses, ie Hepatitis A virus (HAV), hepatitis B virus (HBV) and delta hepatitis virus (HDV), as well as those caused by cytomegalovirus (CMV) or Epstein-Barr virus (EBV ) differentiates hepatitis. NANBH was first identified in people with blood transfusions. Transmission from humans to chimpanzees and serial passages in chimpanzees has provided evidence that NANBH is due to transmissible infectious agent (s). However, the NANBH transmission agent is still unidentified and the number of pathogens causing this disease is unknown. The epidemiological evidence suggests that there may be three types of NANBH; the epidemic type transmitted by water, the type of blood or needle, and the sporadically occurring type (acquired in the community). However, the number of NANBH-causing pathogens is unknown.
Die klinische Diagnose und der Nachweis von NANBH erfolgte bis jetzt hauptsächlich durch Ausschluß anderer Virusmarker. Zu den Verfahren, die zum Nachweis mutmaßlicher NANBV-Antigene oder -Antikörper angewandt werden, gehören Agar-Gel-Diifusion, Überwanderungselektrophorese, Immunfluoreszenzmikroskopie, Immunelektronenmikroskopie, Radioimmunoassay und Enzymimmunoassay. Keiner dieser Assays hat sich jedoch als ausreichend empfindlich, spezifisch und reproduzierbar erwiesen, um als Diagnosetest für NANBH anwendbar sein zu können.The clinical diagnosis and detection of NANBH has so far mainly been done by excluding other viral markers. Methods used to detect putative NANBV antigens or antibodies include agar gel diifusion, over-migration electrophoresis, immunofluorescence microscopy, immunoelectron microscopy, radioimmunoassay and enzyme immunoassay. However, none of these assays has been found to be sufficiently sensitive, specific and reproducible to be useful as a diagnostic test for NANBH.
Bis jetzt gibt es weder Klarheit noch Übereinstimmung in bezug auf die Identität oder die Spezifität der Antigen-Antikörper-Systeme, die mit den Erregern von NANBH in Beziehung stehen. Das ist zumindestens teilweise auf eine vorherige oder gleichzeitige HBV-Infektion bei Individuen mit NANBV und auf die bekannte Komplexität der mit HBV assoziierten löslichen und feinverteilten Antigene sowie auch auf die Integration der HBV-DNA in das Genom der Leberzellen zurückzuführen. Weiterhin besteht die Möglichkeit, daß NANBH durch mehr als einen Infektionserreger verursacht wird und es könnte außerdem eine Fehldiagnose von NANBH vorliegen. Es ist außerdem gar nicht klar, was die serologischen Assays im Serum von Patienten mit NANBH entdecken. Es wurde postuliert, daß die Agar-Gel-Diffusion und das Überwanderungselektrophoreseassay Autoimmunreaktionen oder unspezifische Proteinwechselwirkungen, die manchmal zwischen Serumproben vorkommen, nachweisen, und daß sie keine spezifischen NANBV-Antigen-Antikörper-Reaktionen darstellen. Immunfluoreszenz, Enzymimmunoassay und Radioimmunassay scheinen geringe Anteile eines rheumafaktorartigen Materials, das häufig im Serum von Patienten mit NANBH und auch von Patienten mit anderen Hepatitis- und Nicht-Hepatitiserkrankungen vorkommt, nachzuweisen. Ein Teil der festgestellten Reaktivität kann ein Antikörper zu wirtsdeterminierten Zytoplasmaantigenen sein. Es gibt eine Reihe von NANBV-Anwärtern. Siehe zum Beispiel die Zusammenfassungen von Prince (1983), Feinstone und Hoofnagle (1984), Overby (1985,1986,1987) und die Artikel von Iwarson (1987). Es gibt jedoch keinen Beweis, daß einer dieser Kandidaten der ätiologische Erreger von NANBH ist.So far, there is no clarity or consistency in the identity or specificity of the antigen-antibody systems related to the NANBH pathogens. This is due, at least in part, to previous or concurrent HBV infection in individuals with NANBV and to the known complexity of soluble and finely divided antigens associated with HBV, as well as to integration of HBV DNA into the genome of liver cells. Furthermore, there is the possibility that NANBH is caused by more than one infectious agent and there could also be a misdiagnosis of NANBH. It is also unclear what serological assays in the serum of patients with NANBH detect. It has been postulated that agar gel diffusion and the migration electrophoresis assay detect autoimmune reactions or nonspecific protein interactions that sometimes occur between serum samples, and that they do not represent specific NANBV antigen-antibody reactions. Immunofluorescence, enzyme immunoassay and radioimmunoassay appear to detect low levels of rheumatoid factor-like material commonly found in serum from patients with NANBH and also from patients with other hepatitis and non-hepatitis. Part of the observed reactivity may be an antibody to host-determined cytoplasmic antigens. There are a number of NANBV candidates. See, for example, the summaries of Prince (1983), Feinstone and Hoofnagle (1984), Overby (1985, 1986, 1987), and the articles by Iwarson (1987). However, there is no evidence that any of these candidates is the etiological agent of NANBH.
Die Forderung nach sensitiven, spezifischen Screening- und Nachweisverfahren für NANBV-Träger und für mit NANBV kontaminiertes Blut oder Blutprodukte ist von großer Bedeutung. Posttransfusionshepatitis (PTH) tritt bei fast 10% der Transfusionspatienten auf, wobei NANBH für bis zu 90% dieser Fälle verantwortlich ist. Das Hauptproblem bei dieser Krankheit ist die häufige Verschlimmerung bis zu chronischer Leberschädigung (25-55%).The demand for sensitive, specific screening and detection methods for NANBV carriers and for NANBV-contaminated blood or blood products is of great importance. Posttransfusion hepatitis (PTH) occurs in almost 10% of transfusion patients, with NANBH responsible for up to 90% of these cases. The main problem with this disease is the frequent aggravation to chronic liver damage (25-55%).
Die Patientenbehandlung wie auch die Vermeidung der Übertragung von NANBH durch Blut und Blutprodukte oder r urch enge persönliche Kontakte erfordern zuverlässige diagnostische und prognostische Mittel zum Nachweis von Nucleinsäuren, Antigenen und Antikörpern, die mit dem NANBV in Verbindung stehen. Außerdem besteht ein dringender Bedarf an wirksamen Vakzinen und immunotherapeutischen Mitteln zur Vorbeugung und/oder Behandlung der Krankheit.Patient treatment, as well as the prevention of NANBH transmission through blood and blood products or close personal contacts, require reliable diagnostic and prognostic means to detect nucleic acids, antigens, and antibodies associated with NANBV. In addition, there is an urgent need for effective vaccines and immunotherapeutic agents for the prevention and / or treatment of the disease.
Ziel der Erfindung ist die Verbesserung zur Beherrschung der Verbreitung der Infektion durch das Nicht-A-Nicht-B-Hepatitisvirus (NANBV).The aim of the invention is the improvement for controlling the spread of infection by the non-A-non-B hepatitis virus (NANBV).
' Darlegung des Wesens der ErfindungExplanation of the essence of the invention
Der Erfindung liegt die Aufgabe zugrunde, neuartige diagnostische DNA-Fragmente, diagnostische Proteine, diagnostische Antikörper und Schutzantigene sowie Antikörper für den Krankheitserreger des Hepatitis-C-Virus zur Verfugung zu stellen. Die Erfindung betrifft die Isolierung und Charakterisierung eines neu entdeckten ätiologischen Erregers von NANBH, das Hepatitis-C-Virus (HCV). Genauer gesagt, stellt die Erfindung eine Familie von cDNA-Kopien von Teilen des HCV-Genoms zur Verfugung. Diese cDNA-Kopien wurden durch eine Technik isoliert, die folgendes umfaßt: eine neuartige Stufe des Screenings von Expressior.sproduktion aus cDNA-Bibliotheken, die aus einem feinverteilten Erreger in infiziertem Gewebe mit Seren von Patienten mit NANBH geschaffen wurden, um neu synthetisierte Antigene, die aus dem Genom des bisher nicht isolierten und nicht charakterisierten Viruserregers abgeleitet wurden, nachzuweisen, und die Selektion von Clonen, die Produkte herstellten, die immunologisch nur mit Seren von infizierten Individuen im Ve gleich zu nichtinfizierten Individuen reagierten. Untersuchungen der Natur des HCV-Genoms unter Verwendung von aus der HCV-cDNA entwickelten Sonden wie auch der Sequenzinformation, die in der HCV-cDNA enthalten ist, weisen darauf hin, daß das HCV ein Flavirus oder ein flaviartiges Virus ist.The invention has for its object to provide novel diagnostic DNA fragments, diagnostic proteins, diagnostic antibodies and protective antigens and antibodies to the pathogen of hepatitis C virus available. The invention relates to the isolation and characterization of a newly discovered etiological agent of NANBH, the hepatitis C virus (HCV). More specifically, the invention provides a family of cDNA copies of portions of the HCV genome. These cDNA copies were isolated by a technique comprising: a novel step of screening expressior production from cDNA libraries created from a finely distributed pathogen in infected tissue with sera from patients with NANBH to obtain newly synthesized antigens; which were derived from the genome of the hitherto unisolated and uncharacterized virus pathogen, and the selection of clones producing products which reacted immunologically only with sera from infected individuals as compared to uninfected individuals. Studies of the nature of the HCV genome using probes developed from the HCV cDNA as well as the sequence information contained in the HCV cDNA indicate that the HCV is a flavirus or a flaviartic virus.
Teile der cDNA-Sequenzen, die aus dem HCV abgeleitet wurden, sind als Sonden nützlich, um die Anwesenheit des Vir'js in Proben nachzuweisen, und um natürlich vorkommende Varianten des Virus zu isolieren. Diese cDNAs machen auch Polypeptidsequenzen von HCV-Antigenen verfügbar, die in dem (den) HCV-Genom(en) codiert sind, und gestatten die Produktion von Polypeptiden, die als Standards oder als Reagenzien in diagnostischen Tests und/oder als Komponenten von Vakzinen nützlich sind. Antikörper, und zwar sowohl polyclonale als auch monoclonale, die gegen die HCV-Epitope gerichtet sind, die in diesen Polypeptidsequenzen enthalten sind, sind ebenfalls für diagnostische Tests und für therapeutische Mittel fürPortions of the cDNA sequences derived from the HCV are useful as probes to detect the presence of the virus in samples and to isolate naturally occurring variants of the virus. These cDNAs also provide polypeptide sequences of HCV antigens encoded in the HCV genome (s) and permit the production of polypeptides useful as standards or as reagents in diagnostic assays and / or as components of vaccines are. Antibodies, both polyclonal and monoclonal, directed against the HCV epitopes contained in these polypeptide sequences are also useful for diagnostic assays and therapeutic agents for
u3s Sr-. «ring von antiviralen MiHeIn und für die Isolierung des NANBV-Erregers, aus dem diese cDNAs abgeleitet werden, nützlich. Außerdem wird es durch Anwendung der aus diesen cDNAs abgeleiteten Sonden möglich, andere Teile des HCV-Genoms zu isolieren und zu sequenzieren, so daß weitere Sonden und Polypeptide entstehen, die für die Diagnose und/ oder prophylaktische als such therapeutische Behandlung von NANBH nützlich sind.u3s Sr-. "Ring of antiviral MiHeIn and for the isolation of the NANBV pathogen from which these cDNAs are derived useful. In addition, by using probes derived from these cDNAs, it becomes possible to isolate and sequence other portions of the HCV genome to yield additional probes and polypeptides useful for the diagnosis and / or prophylactic therapeutic search for NANBH.
In bezug auf die Polynucleotide betreffen dementsprechend einige Aspekte der Erfindun j: ein gereinigtes HCV-Polynuclaotid; ein rekombinantes HCV-Polynucieotid; ein rekombinantes Polynr-Ieotid, das eine aus einem HCV-Genom oder aus HCV-cDNA abgeleitete Sequenz enthält; ein rekombinani es Polynucleotid, das für ein Epitcp von HCV codiert; einen rekombinanten Vektor, der beliebige der oben genannten rekombine nten Polynucleotide enthält, und eine Wirtszelle, die mit beliebigen dieser Vektoren transformiert wird. Andere erfindungsgemäße Aspekte sind: ein rekombinar.:es Expressionssystem, das einen offenen Leserrahmen (ORF) der aus einem HCV-Genom oder aus HCV-cDNA abgeleiteten DNA umfaßt, wobei der ORF an eine Kontrollsequenz operabel gebunden ist (engl. Text schwer lesbar- operably linked? d. Ü.), die mit einem erwünschten Wirt kompatibel ist; eine Zelle, die mit dem rekombinanten Expressionssystem transformiert wird; und ein Polypeptid, das von der transformierten Zelle produziert wird.Accordingly, with respect to the polynucleotides, some aspects of the invention relate to: a purified HCV polynucleotide; a recombinant HCV polynucleotide; a recombinant polynucleotide containing a sequence derived from an HCV genome or HCV cDNA; a recombinant polynucleotide encoding an epitope of HCV; a recombinant vector containing any of the above recombinant polynucleotides, and a host cell transformed with any of these vectors. Other aspects of the invention are: a rekombinar.:es Exp r essionssystem comprising an open reading frame (ORF) derived from an HCV genome or from HCV cDNA DNA, wherein the ORF is operably linked to a control sequence (English text difficult. readably operably linked? d., Ü) compatible with a desired host; a cell transformed with the recombinant expression system; and a polypeptide produced by the transformed cell.
Weitere erfindungsgemäße Aspekte sind: gereinigtes HCV, ein Präparat von Polypeptiden aus dem gereinigten HCV; ein gereinigtes HCV-Polypeptid; ein gereinigtes Polypeptid, das ein Epitop enthält, das immunologisch mit einem in HCV enthaltenem Epitop identifizierbar ist.Further aspects of the invention are: purified HCV, a preparation of polypeptides from the purified HCV; a purified HCV polypeptide; a purified polypeptide containing an epitope that is immunologically identifiable with an epitope contained in HCV.
In die erfindungsgemäßen Aspekte sind eingeschlossen: oin rekombinantes HCV-Polypeptid; ein rekombinantes Polypeptid, das aus einer Sequenz besteht, die aus einem HCV-Genom oder aus HCV-cDNA gewonnen wurde; ein rekombinantes Polypeptid, das aus einem HCV-Epitop besteht; und ein Fusionspolypeptid, das aus einem HCV-Polypeptid besteht. In die Erfindung sind weiterhin eingeschlossen: ein monoclonaler Antikörper, der gegen ein HCV-Epitop gerichtet ist; und ein gereinigtes Präparat von polyclonalen Antikörpern, die gegen ein HCV-Epitop gerichtet sind. Ein weiterer erfindungsgemäßer Aspekt ist ein Partikel, das gegen HCV-lnfektion immunogen wirkt und ein Nicht-HCV-Polypeptid enthält, das eine Aminosäuresequenz besitzt, die ein Partikel bilden kann, wenn diese Sequenz in einem eukaryontischen Wirt erzeugt wird, und ein HCV-Epitop.The aspects of the invention include: recombinant HCV polypeptide; a recombinant polypeptide consisting of a sequence derived from an HCV genome or HCV cDNA; a recombinant polypeptide consisting of an HCV epitope; and a fusion polypeptide consisting of an HCV polypeptide. The invention also includes: a monoclonal antibody directed against an HCV epitope; and a purified preparation of polyclonal antibodies directed against an HCV epitope. Another aspect of the invention is a particle that is immunogenic against HCV infection and contains a non-HCV polypeptide that has an amino acid sequence that can form a particle when that sequence is generated in a eukaryotic host and an HCV epitope ,
Ein weiterer erfindungsgemäßer Aspekt ist eine Polynucleotidsonde für das HCV. Erfindungsgemäße Aspekte, die zu Analysekits gehören, sind diejenigen für: Analyse von Proben auf die Anwesenheit von Polynucleotide^ die aus dem HCV abgeleitet wurden mittels einer Pol/nucleotidsonde, welche eine Nucleotidsequenz aus dem HCV von etwa 8 oder mehr Nucleotiden enthält, in einem geeigneten Behälter (engl. container); Analyse von Proben auf die Anwesenheit eines HCV-Antigens mittels eines gegen das nachzuweisende HCV-Antigen gerichteten Antikörpers in einem geeigneten Behälter; Analyse von Proben auf die Anwesenheit eines gegen ein HCV-Antigen gerichteten Antikörpers mittels eines Folypeptids, das ein in dem HCV-Antigen vorhandenes HCV-Epitop enthält, in einem geeigneten Behälter.Another aspect of the invention is a polynucleotide probe for HCV. Aspects of the invention pertaining to analysis kits are those for: analyzing samples for the presence of polynucleotides derived from the HCV by means of a polynucleotide probe containing a nucleotide sequence from the HCV of about 8 or more nucleotides in a suitable one Container (English container); Analysis of samples for the presence of an HCV antigen by means of an antibody directed against the HCV antigen to be detected in a suitable container; Analysis of samples for the presence of an antibody directed against an HCV antigen by means of a polypeptide containing an HCV epitope present in the HCV antigen in a suitable container.
Andere erfindungsgemäße Aspekte sind: ein Polypeptid, das aus einem HCV-Epitop besteht, das an ein festes Substrat geknüpft ist; und ein Antikörper gegen ein HCV-Epitop, der an ein festes Substrat geknüpft ist.Other aspects of the invention are: a polypeptide consisting of an HCV epitope linked to a solid substrate; and an antibody to an HCV epitope linked to a solid substrate.
Weitere erfindungsgemäße Aspekte sind: ein Verfahren zur Erzeugung eines Polypeptide, das ein HCV-Epitop enthält, indem mit einem Expressionsvektor transformierte Wirtszellon, wobei der Vektor eine Sequenz enthält, die für ein ein HCV-Epitop enthaltendes Polypeptid codiert, unter Bedingungen inkubiert werden, die die Expression des Polypeptids erlauben; und ein Polypeptid, das ein HCV-Epitop enthält, das durch dieses Verfahren erzeugt wurde.Further aspects of the invention are: a method of producing a polypeptide containing an HCV epitope by incubating host cell ion transformed with an expression vector, the vector containing a sequence encoding a HCV epitope-containing polypeptide, under conditions which: allow expression of the polypeptide; and a polypeptide containing an HCV epitope generated by this method.
Die Erfindung umfaßt auch ein Verfahren zum Nachweis von HCV-Nucleinsäuren in einer Probe, wobei die Nucleinsäuren der Probe mit einer Sonde für ein HCV-Polynucleotid unter Bedingungen miteinander reagieren, die die Bildung eines Polynucleotidduplexes zwischen der Sonde und der HCV-Nucleinsäure aus der Probe erlauben; und zum Nachweis eines Polynucleotidduplexes, der die Sonde enthält.The invention also encompasses a method of detecting HCV nucleic acids in a sample, wherein the nucleic acids of the sample react with a probe for an HCV polynucleotide under conditions which permit the formation of a polynucleotide duplex between the probe and the HCV nucleic acid from the sample allow; and for detecting a polynucleotide duplex containing the probe.
Immunoassays sind ebenfalls in die Erfindung eingeschlossen. Dazu gehören ein Immunoassay zum Nachweis eines HCV-Antigens, wobei eine Probe, die vermutlich ein HCV-Antigen enthält, mit einem Sondenantikörper, der gegen das nachzuweisende HCV-Antigen gerichtet ist, unter Bedingungen inkubiert wird, die die Bildung eines Antigen-Antikörper-Komplexes gestatten; und zum Nachweis eines Antigen-Antikörper-Komplexes, der den Sondenantikörper enthält. Ein Immunoassay zum Nachweis von Antikörpern, die g«gen ein HCV-Antigen gerichtet sind, wobei eine Probe, die vermutlich Anti-HCV-Antikörper enthält, mit einem Sondenpolypeptid, das ein Epitop des HCV enthält, unter Bedingungen inkubiert wird, die die Bildung eines Antikörper-Antigen-Komplexes gestatten; und zum Nachweis des Antikörper-Antigen-Komplexes, der das Sondenantigen enthält.Immunoassays are also included in the invention. These include an immunoassay to detect an HCV antigen wherein a sample suspected of containing an HCV antigen is incubated with a probe antibody directed against the HCV antigen to be detected under conditions that prevent the formation of an antigen-antibody. Allow complex; and for detecting an antigen-antibody complex containing the probe antibody. An immunoassay for detecting antibodies directed to an HCV antigen, wherein a sample suspected of containing anti-HCV antibodies is incubated with a probe polypeptide containing an epitope of the HCV under conditions which prevent its formation allow an antibody-antigen complex; and for detection of the antibody-antigen complex containing the probe antigen.
' In die Erfindung sind auch Vakzine zur Behandlung der HCV-lnfektion eingeschlossen, die ein immunogenes Pept'd, das ein HCV-Epitop enthält, oder ein inaktiviertes HCV-Präparat oder ein abgeschwächtes HCV-Präparat umfassen. Ein weiterer erfindungsgemäßer Aspekt ist eine mit HCV infizierte Gewebekultur.Also included in the invention are vaccines for the treatment of HCV infection which comprise an immunogenic peptide containing an HCV epitope or an inactivated HCV preparation or an attenuated HCV preparation. Another aspect of the invention is a tissue culture infected with HCV.
Ein noch weiterer erfindungsgemäßer Aspekt ist ein Verfahren zur Erzeugung von Antikörpern gegen das HCV, indem einem Individuum ein isoliertes immunogenes Polypeptid, das ein HCV-Epitop enthält, in einer Menge verabreicht wird, die ausreicht, eine Immunreaktion hervorzurufen.A still further aspect of the invention is a method of generating antibodies to HCV by administering to an individual an isolated immunogenic polypeptide containing an HCV epitope in an amount sufficient to elicit an immune response.
Ein noch weiterer erfindungsgemäßer Aspekt ist ein Verfahren zur Isolierung von cDNA, die aus dem Genom eines nicht identifizierten Infektionserregers abgeleitet wurde, indem (a) Wirtszellen bereitsgestellt werden, die mit Expressionsvektoren transformiert wurden, die eine cDNA-Bibliothek enthalten, welche aus Nucleinsäuren hergestellt wurde, die aus dom mit dem Erreger infizierten Gewebe isoliert wurden und man diese Wirtszellen unter Bedingungen wachsen läßt, die die Expression von in der cDNA codiertem(n) Polypeptid(en) gestatten; (b) eine Wechselwirkung der Expressionsprodukte der cDNA mit einer Antikörper enthaltenden Körperkomponente eines mit dem Infektionserreger infizierten Individuums unter Bedingungen besteht, die eine Immunreaktion erlauben, und die im Ergebnis der Wechselwirkung gebildeten Antikörper-Antigen-Komplexe nachgewiesen werden; (c) Wirtszellen gezüchtet werden, die Polypeptide exprimieren, die Antikörper-Antigen-Komplexe gemäß Stufe (b) unter Bedingungen bilden, die ihr Wachstum als individuelle Chlone erlauben und diese Clone isoliert werden; (d) Zellen aus den Clonen gemäß (c) unter Bedingungen gezüchtet werden, die die Expression von Polypeptid(en), die in der cDNAcodiert sind, gestatten, und die Expressionsprodukte mit Antikörper enthaltenden Körperkomponenten von anderen als in Stufe (a) genannten Individuen, die mit dem Infektionserreger infiziert sind, und mit Kontrollindividuen, die nicht mit dem Erreger infiziert sind, in Wechselwirkung stehen, und die im Ergebnis dieser Wechselwirkung gebildeten Antikörper-Antigen-Komplexe nachgewiesen werden; (e) Wirtszellen gezüchtet werden, die Polypeptide exprimieren, die Antikörper-Antiken-A still further aspect of the invention is a method of isolating cDNA derived from the genome of an unidentified infectious agent by providing (a) host cells transformed with expression vectors containing a cDNA library prepared from nucleic acids isolated from dom-infected tissues and allowing these host cells to grow under conditions permitting the expression of polypeptide (s) encoded in the cDNA; (b) there is an interaction of the expression products of the cDNA with an antibody-containing body component of an individual infected with the infectious agent under conditions which permit an immune reaction and the antibody-antigen complexes formed as a result of the interaction are detected; (c) culturing host cells that express polypeptides that form antibody-antigen complexes according to step (b) under conditions that allow their growth as individual chlones and that these clones are isolated; (d) growing cells from the clones according to (c) under conditions which allow the expression of polypeptide (s) encoded in the cDNA, and the expression products with antibody-containing body components from individuals other than those mentioned in step (a) infected with the infectious agent and interacting with control individuals not infected with the agent and detecting the antibody-antigen complexes formed as a result of said interaction; (e) culturing host cells expressing polypeptides having antibody-antagonists
Komplexe mit Antikörper enthaltenden Körperkomponenten von infizierten Individuen und von Individuen, die vermutlich infiziert sind, und nicht mit den Komponenten von Kontrollindividuen, unter Bedingungen bilden, die ihr Wachstum als individuelle Clone erlauben, und diese Clone isoliert werden; und (f) die cDNA aus den Wirtszellclonen aus Stufe (e) isoliert wird.Complex antibody-containing body components of infected individuals and of individuals suspected of being infected, rather than the components of control individuals, under conditions that allow their growth as individual clones, and these clones are isolated; and (f) isolating the cDNA from the host cell clones of step (e).
Kurze Beschreibung der ZeichnunyenShort description of the drawings
Fig. 1 zeigt die doppelsträngige Nucleotidsequenz des HCV-cDNA-lnserto in Clon 5-1-1 und die vermutliche Aminosäuresequenz des darin codierten Polypeptids.Figure 1 shows the double-stranded nucleotide sequence of the HCV cDNA insert in clone 5-1-1 and the putative amino acid sequence of the polypeptide encoded therein.
Fig. 2 zeigt die Homologien der überlappenden HCV-cDNA-Sequanzen in den Clonen 5-1-1,81,1-2 und 91.Figure 2 shows the homologies of the overlapping HCV cDNA sequences in clones 5-1-1,81,1-2 and 91.
Fig. 3 zeigt eine zusammengesetzte Sequenz von HCV-cDNA, die aus den überlappenden Clonen 81,1 -2 und 91 abgeleitet wurde, und die darin codierte Aminosäuresequenz.Figure 3 shows a composite sequence of HCV cDNA derived from overlapping clones 81, 1-2 and 91 and the amino acid sequence encoded therein.
Fig. 4 zeigt die doppelsträngige Nucleotidsequenz des HCV-cDNA-lnserts in Clon 81 und die vermutliche Aminosäuresequenz des darin codierten Polypeptids.Figure 4 shows the double-stranded nucleotide sequence of the HCV cDNA insert in clone 81 and the putative amino acid sequence of the polypeptide encoded therein.
Fig. 5 zeigt die HCV-cDNA-Sequenz in Clon 36, das Segment, das die NANBV-cDNA vor ι Clon 81 überlappt und die in Clon 36 codierte Polypeptidsequenz.Fig. 5 shows the HCV cDNA sequence in clone 36, the segment which overlaps the NANBV cDNA clone 81 before ι and encoded in clone 36 polypeptide sequence.
Fig. 6 zeigt die kombinierten offenen Leserahmen (ORF) von HCV-cDNAs in den Clonen 36 und 81 und das darin codierte Polypeptid.Figure 6 shows the combined open reading frames (ORF) of HCV cDNAs in clones 36 and 81 and the polypeptide encoded therein.
Fig. 7 zeigt die HCV-cDNA-Sequenz in Clon 32, das Segment, das Clon 81 überlappt und das darin codierte Polypeptid.Figure 7 shows the HCV cDNA sequence in clone 32, the segment that overlaps clone 81, and the polypeptide encoded therein.
Fig. 8 zeigt die HCV-cDNA-Sequenz in Clon 35, das Segment, das C!on 36 überlappt und das darin codierte Polypepvic.Figure 8 shows the HCV cDNA sequence in clone 35, the segment that overlaps C! On 36, and the polypeptide encoded therein.
Fig. 9 zeigt die kombinierten offenen Leserahmen (ORF) von HCV-cDNAs in den Clonen 35,36,81 und 32 und das darin codierte Polypeptid.Figure 9 shows the combined open reading frames (ORF) of HCV cDNAs in clones 35, 36, 81 and 32 and the polypeptide encoded therein.
Fig. 10 zeigt die HCV-cDNA-Sequenz in Clon 37b, das Segment, das Clon 35 überlappt und das darin codierte Polypeptid.Figure 10 shows the HCV cDNA sequence in clone 37b, the segment that overlaps clone 35, and the polypeptide encoded therein.
Fig. 11 zeigt die HCV-cDNA-Sequenz in Clon 33b, das Segmant, das Clon 32 überlappt und das darin codierte Polypeptid.Figure 11 shows the HCV cDNA sequence in clone 33b, the segmant overlapping clone 32, and the polypeptide encoded therein.
Fig. 12 zeigt die HCV-cDNA-Sequenz in Clon 40b, das Segment, das Clon 37 b überlappt und das darin codierte Polypeptid.Figure 12 shows the HCV cDNA sequence in clone 40b, the segment that overlaps clone 37b, and the polypeptide encoded therein.
Fig. 13 zeigt die HCV-cDNA-Sequenz in Clon 25c, das Segment, das Clon 33b überlappt und das darin codierte Polypeptid.Figure 13 shows the HCV cDNA sequence in clone 25c, the segment that overlaps clone 33b, and the polypeptide encoded therein.
Fig. 14 zeigt die Nucleotidsequenz und das darin codierte Polypeptid des offenen Leserahmens (ORF), der durch die HCV-cDNAs in den Clonen 40b, 37 b, 35,36,81,32,33b und 25c erweitert ist.Figure 14 shows the nucleotide sequence and the open reading frame (ORF) polypeptide encoded therein extended by the HCV cDNAs in clones 40b, 37b, 35, 36, 81, 32, 33b and 25c.
Fig. 15 zeigt die HCV-cDNA-Sequenz in Clon 33c, das Segment, das die Clone 40b und 33c überlappt und die darin codierten Aminosäuren.Figure 15 shows the HCV cDNA sequence in clone 33c, the segment that overlaps clones 40b and 33c, and the amino acids encoded therein.
Fig. 16 zeigt die HCV-cDNA-Sequenz in Clon 8h, das Segment, das Clon 33c überlappt und die darin codierten Aminosäuren.Figure 16 shows the HCV cDNA sequence in clone 8h, the segment that overlaps clone 33c and the amino acids encoded therein.
Fig. 17 zeigt die HCV-cDNA-Sequenz in Clon 7e, dar ment, das Clon 8h überlappt und die darin codierten Aminosäuren.Fig. 17 shows the HCV cDNA sequence in clone 7e, since r ment, overlaps clone 8h, and the amino acids encoded therein.
Fig. 18 zeigt die HCV-cDNA-Sequenz in Clon 14c, d nent, das Clon 25c überlappt und die darin codierten Aminosäuren.Figure 18 shows the HCV cDNA sequence in clone 14c, not overlapping clone 25c and the amino acids encoded therein.
Fig. 19 zeigt die HCV-cDNA-Sequenz in Clon 8f, das .. .yment, das Clon Vt ü überlappt und die darin codierten Aminosäuren.Figure 19 shows the HCV cDNA sequence in clone 8f, the ..yment overlapping the clone Vt and the amino acids encoded therein.
Fig. 20 zeigt die HCV-cDNA-Sequenz in Clon 33f, das Segment, das Clon 8f überlappt und die darin codierten Aminosäuren.Figure 20 shows the HCV cDNA sequence in clone 33f, the segment that overlaps clone 8f and the amino acids encoded therein.
Fig. 21 zeigt die HCV-cDNA-Sequenz in Clon 33g, das Segment, das Clon 33f überlappt, und die darin codierten Aminosäuren.Figure 21 shows the HCV cDNA sequence in clone 33g, the segment that overlaps clone 33f, and the amino acids encoded therein.
Fig. 22 zeigt die HCV-cDNA-Sequenz in Clon 7f, das Segment, das die Sequenz in Clon 7 e überlappt und die darin codierten Aminosäuren.Figure 22 shows the HCV cDNA sequence in clone 7f, the segment that overlaps the sequence in clone 7e, and the amino acids encoded therein.
Fig.23 zeigt die HCV-cDNA-Sequenz in Clon 11b, das Segment, das die Sequenz in Clon 7f überlappt und die darin codierten Aminosäuren.Figure 23 shows the HCV cDNA sequence in clone 11b, the segment that overlaps the sequence in clone 7f and the amino acids encoded therein.
Fig. 24 zeigt die HCV-cDNA-Sequenz in Clon 14i, das Segment, das die Sequenz in Clon 11b überlappt und die darin codierten Aminosäuren.Figure 24 shows the HCV cDNA sequence in clone 14i, the segment that overlaps the sequence in clone 11b, and the amino acids encoded therein.
Fig.25 zeigt die HCV-cDNA-Sequenz in Clon 39c, das Segment, das die Sequenz in Clon 33g überlappt und die darin codierten Aminosäuren.Figure 25 shows the HCV cDNA sequence in clone 39c, the segment that overlaps the sequence in clone 33g and the amino acids encoded therein.
Fig. 26 zeigt die zusammengesetzte HCV-cDNA-Sequenz, die aus ausgerichteten (engl. aligned) cDNAs in den Clonen 14 i, 11 b, 7 f, 7e, 8 h, 33c, 40b, 37 b, 35,36,81,32,33b, 25c, 14c, 8 f, 33 fund 33g abgeleitet wurden; weiter wird die im erweiterten ORF in der abgeleiteten Sequenz codierte Aminosäuresequenz des Polypeptids gezeigt.Figure 26 shows the composite HCV cDNA sequence obtained from aligned cDNAs in clones 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35,36,81 , 32,33b, 25c, 14c, 8 f, 33 fund 33g were derived; Further, the amino acid sequence of the polypeptide encoded in the extended ORF in the deduced sequence is shown.
Fig. 27 zeigt die Sequenz der HCV-cDNA in Clon 1(?)f, das Segment, das Clon 14i (?) überlappt und die darin codierten Aminosäuren. (Engl. Text schlecht lesbar, d.U.)Figure 27 shows the sequence of the HCV cDNA in clone 1 (?) F, the segment that overlaps clone 14i (?), And the amino acids encoded therein. (English text illegible, d.U.)
Fig. 28 zeigt die Sequenz der HCV-cDNA in Clon 35 f, das Segment, das Clon 39c überlappt und die darin codierten Aminosäuren.Figure 28 shows the sequence of the HCV cDNA in clone 35f, the segment that overlaps clone 39c and the amino acids encoded therein.
Fig. 29 zeigt die Sequenz der HCV-cDNA in Clon 19g, das Segment, das Clon 35f überlappt und die darin codierten Aminosäuren.Figure 29 shows the sequence of the HCV cDNA in clone 19g, the segment that overlaps clone 35f and the amino acids encoded therein.
Fig.31A ist ein Foto eines Coomassieblau-gefärbten Polyacrylamidgels, das in Hefe exprimierten C100-3 identifiziert.Fig. 31A is a photograph of a Coomassie blue-stained polyacrylamide gel that identifies C100-3 expressed in yeast.
Fig. 31B zeigt ein Western blot von C10Ü-3 mit Serum aus einem mit NANBV infizierten Menschen.Fig. 31B shows a western blot of C10Ü-3 with serum from a human infected with NANBV.
Fig. 32 zeigt ein Autoradiogramm eines Northern blot von RNA, die aus der Leber eines mit RB-NANBV infizierten Schimpansen isoliert und mit BB-NANBV-cDNA von Clon 81 sondiert worden war.Fig. 32 shows an autoradiogram of a Northern blot of RNA isolated from the liver of a RB-NANBV infected chimpanzee and probed with clone 81 BB-NANBV cDNA.
Fig.33 zeigt ein Autoradiogramm von NANBV-Nucleinsäure, die mit RNase A oder DNase I behandelt und mit BB-NANBV-cDNA von Clon 81 sondiert worden var.Figure 33 shows an autoradiogram of NANBV nucleic acid treated with RNase A or DNase I and probed with BB-NANBV cDNA from clone 81 var.
Fig. 34 zeigt ein Autoradiogramm von Nucleinsäuren, die aus NANBV-Partikeln extrahiert wurden, die mit AnIi-NANB6.,., aus infiziertem Plasma eingefangen (engl. captured) und mit 32P-markierter NANBV-cDNA aus Clon 81 sondiert worden waren.Fig. 34 shows an autoradiogram of nucleic acids extracted from NANBV particles captured from infected plasma with AnIi-NANB 6 .,., And probed with 32 P-labeled NANBV cDNA from clone 81 were.
Fig. 30 zeigt die Sequenz von Clon 26g, das Segment, das Clon 19g überlappt und die darin codierten Aminosäuren.Figure 30 shows the sequence of clone 26g, the segment that overlaps clone 19g, and the amino acids encoded therein.
Fig.31 zeigt die Sequenz von Clon 15 (?), das Segment, das Clon 26g überlappt und die darin codierten Aminosäuren.Figure 31 shows the sequence of clone 15 (?), The segment that overlaps clone 26g, and the amino acids encoded therein.
Fig. 32 zeigt die Sequenz in einer zusammengesetzten cDNA, die durch Ausrichten (engl. aligning) der Clone 12 f bis 15 (?) in der 5'-3'-Richtung abgeleitet wurden, sowie die im kontinuierlichen (engl. continuous) ORF codierten Aminosäuren.Fig. 32 shows the sequence in a composite cDNA derived by aligning clones 12 f to 15 (?) In the 5'-3 'direction and those in continuous ORF coded amino acids.
Fig. 33 zeigt ein Foto von Western blots eines Fusionsproteins, SOD-NAND5.,.,, mit Schimpansenserum aus mit BQ-NANB, HAV und HBV infizierten Schimpansen.Figure 33 shows a photograph of Western blots of a fusion protein, SOD-NAND 5 , with chimpanzee serum from BQ-NANB, HAV and HBV infected chimpanzees.
Fig. 34 zeigt ein Foto von Western blots eines Fusionsproteins, SOD-NANB6.].ι, mit Serum aus mit NANBV, HAV und HBV infizierten Menschen und aus Kontrolloersonen.Fig. 34 shows a photograph of Western blots of a fusion protein, SOD-NANB 6. ]. Ι, with serum from humans infected with NANBV, HAV and HBV and from control individuals.
Fig. 35 zeigt in einer Karte die signifikanten Merkmale des Vektors pAB 24.Fig. 35 shows in a map the significant features of the vector pAB 24.
Fig. 36 zeigt die vermutliche Aminosäuresequenz des Carboxy-Terminus des Fusionspolypeptids C100-3 und die dafür codierende Nucleotidsequenz.Fig. 36 shows the putative amino acid sequence of the carboxy terminus of the fusion polypeptide C100-3 and the nucleotide sequence coding therefor.
isoliert und mit BB-NANBV-cDNA von Clon (11 sondiert worden war.and probed with BB-NANBV cDNA from clone (11).
von Clon 81 sondiert worden war.had been probed by clone 81.
infiziertem Plasma eingefangen und mit 32P-markierter NANBV-cDNA aus Clon 81 sondiert worden waren.were probed and probed with 32 P-labeled NANBV cDNA from clone 81.
minussträngigen DNA-Sonden, die aus NANBV-cDNA in Clon 81 abgeleitet worden waren, sondiert wurden.minus-stranded DNA probes derived from NANBV cDNA in clone 81 were probed.
Screening.Screening.
worden waren.had been.
Der Begriff Hepatitis-C-Virus wurde von den auf diesem Gebiet arbeitenden Wissenschaftlern für einen bisher unbekannten Erreger von NANBH reserviert. Dementsprechend bezieht sich der Begriff „Hepatitis-C-Virus" (HCV) in der hier gebrauchten Bedeutung auf einen Erreger, der NANBH verursacht, der früher als NANBV und/oder BB-NANBV bezeichnet wurde. Die Begriffe HCV, NANBV und BB-NANBV werden hier austauschbar gebraucht. Als Erweiterung dieser Terminologie wird die durch das HCV verursachte Krankheit, früher als NANB-Hepatitis (NANBH) bezeichnet, jetzt Hepatitis C genannt. Die Begriffe NANBH und Hepatitis C können hier austauschbar gebraucht werden.The term hepatitis C virus was reserved by scientists working in this field for a previously unknown pathogen of NANBH. Accordingly, the term "hepatitis C virus" (HCV), as used herein, refers to a pathogen causing NANBH, formerly known as NANBV and / or BB-NANBV, the terms HCV, NANBV and BB-NANBV As an extension of this terminology, the disease caused by HCV, formerly known as NANB hepatitis (NANBH), is now called hepatitis C. The terms NANBH and hepatitis C can be used interchangeably herein.
Dor Begriff „HCV" bezeichnet in der hier gebrauchten Bedeutung eine Virusspezies, die NANBH verursacht, sowie geschwächte Stämme oder davon gewonnene unvollständige, interferierende (defective interfering) Partikel. Wie im folgenden gezeigt wird, besteht aus HCV-Genom aus HNA. Es ist bekannt, daß RNA-haltige Viren relativ hohe, spontane Mutationsraten, die im Bereich von 10~3 bis 10~4 pro Nucleotid liegen sollen (Fields & Knipe [1986]), aufweisen. Es gibt daher vielfältige Stämme innerhalb der im folgenden beschriebenen HCV-Spezies. Die hier beschriebenen Zusammensetzungen und Verfahren ermöglichen Vermehrung, Identifizierung, Nachweis und Isolierung der verschiedenen verwandten Stämme. Darüber hinaus erlauben sie auch die Durchführung von Diagnosen und Herstellung von Vakzinen für die verschiedenen Stämme und sind für Screening-Untersuchungen nach antiviralen Mitteln für pharmakologische Zwecke nützlich, indem sie die Replikation des HCV hemmen. Die hier zur Verfugung gestellte Information, obwohl sie von einem HCV-Stamm gewonnen wurde, im folgenden als CDC/HCVI bezeichnet, reicht für einen Virustaxonomisten aus, andere, zu diesen Spezies gehörende Stämme zu !(-identifizieren. Wie hier beschrieben wird, haben wir entdeckt, daß das HCV ein Flävivirus oder flaviartiges Virus ist. Morphologie und Zusammensetzung von Flaviviruspartikeln sind bekannt und wurden in Brinton (1936) besprochen. Im Hinblick auf die Morphologie enthalten die Flaviviren allgemein gesagt in der Mitte ein Nqcleokapsid, das von einer lipoidhaltigen Doppelschicht umgeben ist. Die Virionen sind kugelförmig und haben einen Durchmesser von etwa 40nm-50nm. Ihre Kernj haben einen Durchmesser von etwa 25nm-30 nm. Auf der Außenfläche der Virionhülle befinden sich Projektionen mit einer Länge von etwa 5 nm-10 nm mit terminalen Knöpfen (knobs) von etwa 2nm Durchmesser.As used herein, the term "HCV" refers to a virus species that causes NANBH, as well as debilitated strains or defective interfering particles derived therefrom. "As will be shown below, the HCV genome is HNA that RNA-containing viruses relatively high spontaneous mutation rates, which are intended to be in the range of 10 -3 to 10 -4 per nucleotide (Fields & Knipe [1986]), have. There is therefore a variety of strains within the ranges described in the following HCV The compositions and methods described herein allow propagation, identification, detection, and isolation of the various related strains, as well as allowing for the diagnosis and production of vaccines for the various strains, and for screening for antiviral agents for pharmacological purposes useful in inhibiting the replication of HCV. Available here Although information obtained from an HCV strain, hereinafter referred to as CDC / HCVI, is sufficient for a virus taxonomist to identify other strains belonging to these species. As described herein, we have discovered that the HCV is an avivirus or flavivirus. Morphology and composition of flaviviral particles are known and discussed in Brinton (1936). In terms of morphology, the flaviviruses generally contain a nucleocapsid in the middle, which is surrounded by a lipid-containing bilayer. The virions are spherical and have a diameter of about 40nm-50nm. Their nuclei have a diameter of about 25 nm-30 nm. On the outer surface of the virion shell are projections with a length of about 5 nm-10 nm with knobs of about 2 nm in diameter.
Das HCV codiert für ein Epitop, das immunologisch mit einem Epitop im HCV-Genom identifizierbar ist, aus dem die hier beschriebenen cDNAs abgeleitet wurden, das Epitop ist vorzugsweise in einer hier beschriebenen cDNA codiert. Im Vergleich zu anderen bekannten Flaviviren ist das Epitop einzigartig zum HCV. Diese Einzigartigkeit des Epitops kann durch seine immunologische Reaktivität mit dem HCV und der fehlenden immunologischen Reaktivität mit anderen Flavivl· usspezies bestimmt werden. Verfahren zur Bestimmung der immunologischen Reaktivität si >d im Fachgebiet bekannt, beispielsweise durch Radioirnmunassay, durch ELISA, durch Hämagglutination, wobei mehrere Beispiele geeigneter Techniken für Assays hier vorgestellt werden.The HCV encodes an epitope that is immunologically identifiable with an epitope in the HCV genome from which the cDNAs described herein were derived, the epitope is preferably encoded in a cDNA described herein. Compared to other known flaviviruses, the epitope is unique to HCV. This uniqueness of the epitope can be determined by its immunological reactivity with the HCV and its lack of immunological reactivity with other species of flavivirus. Method for determining immunological reactivity si> d known in the art, for example by radioimmunoassay, by ELISA, by hemagglutination, several examples of suitable techniques for assays being presented here.
Zusätzlich zu dem oben Gesagten sind die folgenden Parameter entweder allein oder in Kombination miteinander bei der Identifizierung eines Stammes als HCV anwendbar. Da HCV-Stämme evolutionsmäßig verwandt sind, wird erwartet, daß die Gesamthomologie der Genome auf Nucleotidebene mindestens etwa 40%, vorzugsweise etwa 60% oder mehr, und noch besser etwa 80% oder mehr beträgt. Außerdem werden die entsprechenden angrenzenden Sequenzen von mindestens etwa 13 Nucleotiden erwartet. Die Übereinstimmung zwischen der vermutlichen Genomsequenz des HCV-Stammes und der CDC/CH1-HCV-cDNA-Sequenz läßt sich durch im Fachgebiet bekannte Techniken feststellen. Beispielsweise können sie durch einen direkten Vergleich der Sequenzinformation des Polynucleotide aus dem vermutlichen HCV und der (den) hier beschriebenen HCV-cDNA-Sequenz(en) bestimmt werden. Zum Beispiel können sie auch durch Hybridisierung der Polynucleotide unter Bedingungen, unter denen sich stabile Duplexe zwischen homologen Regionen (zum Beispiel solchen, die vor der SpDigestion angewandt werden wurden) herausbilden, bestimmt werden, dann schließt sich eine Digestion mit einzelsträngiger(n) spezifischer(en) Nuclease(n) und danach eine Größenbestimmung der digerierten Fragmente an.In addition to the above, the following parameters, either alone or in combination, are applicable to the identification of a strain as HCV. Since HCV strains are evolutionarily related, it is expected that the total homology of genomes at nucleotide level will be at least about 40%, preferably about 60% or more, and more preferably about 80% or more. In addition, the corresponding contiguous sequences are expected to be at least about 13 nucleotides in length. The correspondence between the putative genomic sequence of the HCV strain and the CDC / CH1 HCV cDNA sequence can be determined by techniques known in the art. For example, they can be determined by a direct comparison of the sequence information of the polynucleotide from the putative HCV and the HCV cDNA sequence (s) described herein. For example, they may also be determined by hybridization of the polynucleotides under conditions in which stable duplexes are formed between homologous regions (for example, those that would be used prior to SpDigestion), then digestion with single-stranded (specific) ( en) Nuclease (s) and then sizing the digested fragments.
Wegen der evolutionären Verwandtschaft der HCV-Stämme sind die vermutlichen HCV-Stämme durch ihre Homologie auf der Polypeptidebene identifizierbar. Allgemein gesagt, sind über 40%, vorzugsweise über etwa 60% und noch besser über etwa 80% dor HCV-Stämme auf der Polypeptidebene homolog. Die Techniken zur Bestimmung der Aminosäurensequenzhomologie sind im Fachgebiet bekannt. Die Aminosäuresequenz kann beispielsweise direkt bestimmt und mit den hier vorgestellten Sequenzen verglichen werden. Beispielsweise kann auch die Nucleotidsequenz des Genommaterials des vermutlichen HCV bestimmtBecause of the evolutionary relatedness of the HCV strains, the putative HCV strains are identifiable by their homology at the polypeptide level. Generally speaking, over 40%, preferably over about 60%, and more preferably over about 80% of the HCV strains are homologous at the polypeptide level. The techniques for determining amino acid sequence homology are known in the art. The amino acid sequence can for example be determined directly and compared with the sequences presented here. For example, the nucleotide sequence of the genome of the putative HCV may also be determined
werden (gewöhnlich durch eine cDNA-Zwischenverbindung); die darin codierte Aminosäuresequenz kann bestimmt und dieentsprechenden Regionen können verglichen werden.(usually through a cDNA intermediate); the amino acid sequence encoded therein can be determined and the corresponding regions can be compared.
8 Nucleotiden und besser mindestens etwa 10-12 Nucleotiden und am besten mindestens etwa 15-20 Nucleotidenzusammensetzt, die einer Region der bezeichneten Nucleotidsequenz entsprechen, d.h. homolog oder komplementär zu ihr.sind.8 nucleotides, and more preferably at least about 10-12 nucleotides, and most preferably at least about 15-20 nucleotides, corresponding to a region of the designated nucleotide sequence, i. homologous or complementary to her.
einzigartig ist, homolog oder komplementär. Ob eine Sequenz zu dem HCV-Genom einzigartig ist oder nicht, läßt sich durch denunique, homologous or complementary. Whether a sequence to the HCV genome is unique or not, can be determined by the
z. B. Genebank, verglichen werden, um festzustellen, ob sie im nicht infizierten Wirt oder in anderen Organismen vorhanden ist.z. Genebank, to see if it is present in the uninfected host or in other organisms.
beispielsweise auch Maniatis und Mitarbeiter (1982). Weiterhin können durch Hybridisierung entstandene Fehlbildungen vonfor example, Maniatis and co-workers (1982). Furthermore, malformations of
einsträngige Gebiete in Duplexpolynucleotiden digeriert, festgestellt werden. Regionen, aus denen typische DNA-Sequenzen.abgeleitet" werden können, umfassen, sind jedoch nicht auf diese beschränkt, beispielsweise Rügionen, die für spezifischesingle-stranded regions digested in duplex polynucleotides. Regions from which typical DNA sequences can be derived include, but are not limited to, for example, rations specific for
auf verschiedene Weise, einschließlich z. B. chemischer Synthese oder DNA-Replikation oder Reverser Transkription oderin different ways, including z. As chemical synthesis or DNA replication or reverse transcription or
gegebenen Informationen beruhen, erzeugt werden.given information can be generated.
davon, wobei der Teil aus mindestens 3-5 Aminosäuren, vorzugsweise aus mindestens 8-10 Aminosäuren und noch besser ausmindestens 11-15 Aminosäuren besteht, oder der immunologisch mit einem in der Sequenz codierten Pulypeptid identifizierbarof which the part consists of at least 3 to 5 amino acids, preferably of at least 8 to 10 amino acids and more preferably at least 11 to 15 amino acids, or which is immunologically identifiable with a peptide encoded in the sequence
den in Fig. 1-32 gezeigten Sequenzen, oder aus einem HCV-Genom translatiert, es kann auf verschiedene Weisen erzeugtwerden, einschließich z.B. chemischer Synthese oder Expression eines Rekombinant-Expressionssystems, oder Isolierung ausmutiertom ICV.The sequence shown in Figures 1-32, or translated from an HCV genome, can be generated in a variety of ways, including e.g. chemical synthesis or expression of a recombinant expression system, or isolation mutant ICV.
cDNA-, semisynthetischem oder synthetischem Ursprung, welches dank seines Ursprungs oder seiner Manipulation (1) nichtmit dem gesamten oder einem Teil des Polynucleotide verknüpft ist, mit dem es in Natur oder in Form einer Bibliothek verknüpftist; und/oder (2) mit einem anderen Polynucleotid verbunden ist als es in Natur verbunden wäre.cDNA, semisynthetic or synthetic origin which, by virtue of its origin or manipulation (1), is not linked to all or part of the polynucleotide to which it is linked in nature or in the form of a library; and / or (2) is associated with a different polynucleotide than would be naturally associated.
umfaßt auch beispielsweise durch Methylierung und/oder „capping" modifizierte und nichtmodifizierte Formen desalso includes, for example, by methylation and / or "capping" modified and unmodified forms of
.Homologie oder Komplementarität zur cDNA wird etwa 50% oder mehr, vorzugsweise etwa mindestens 70% und noch besseretwa mindestens 90% betragen. Die entsprechenden Sequenzen werden in der Länge etwa mindestens 70 Nucleotide,vorzugsweise etwa mindestens 80 Nucleotide und noch besser etwa mindestens 90 Nucleotide betragen. Die Übereinstimmungzwischen der HCV-Sequenz und der cDNA kann durch im Fachgebiet bekannte Techniken bestimmt werden, wie beispielsweisedurch einen direkten Vergleich des sequenzierten Materials mit den beschriebenen cDNAs oder durch Hybridisierung undHomology or complementarity to the cDNA will be about 50% or more, preferably about at least 70%, and more preferably about at least 90%. The corresponding sequences will be at least about 70 nucleotides in length, preferably at least about 80 nucleotides in length, and more preferably at least about 90 nucleotides in length. The correspondence between the HCV sequence and the cDNA can be determined by techniques known in the art, such as by direct comparison of the sequenced material with the described cDNAs or by hybridization and
d. h. es enthält weniger als etwa 50%, vorzugsweise weniger als etwa 70% und noch besser weniger als etwa 90% and. H. it contains less than about 50%, preferably less than about 70%, and more preferably less than about 90%
(engl. disruption) der Partikel mit einem chaotropen Mittel und Trennung des (der) Polynucleotids(e) und Polypeptids(e) durchlonenaustauschchromatographie, Affinitätschromatographie und Sedimentation nach der Dichte ein.(disruption) of the particles with a chaotropic agent and separation of the polynucleotide (s) and polypeptide (s) by ion exchange chromatography, affinity chromatography and sedimentation by density.
von, d. h. es enthält weniger als 50%, vorzugsweise weniger als etwa 70% und noch besser weniger als etwa 90% an zellularenfrom D. H. it contains less than 50%, preferably less than about 70%, and more preferably less than about 90% of cellular
„Rekombinanto Wirtszellen", »Wirtszellen", ,Zellen", „Zellinien", „Zellkulturen" ind andere derartige Begriffe, die Mikroorganismen oder höhere eukaryontische Zellinien, die als unizellulare Einheiten in Kultur genommen wurden, bezeichnen, beziehen sich auf Zellen, die als Rezipienten für einen rekombinanten Vektor out eine andere Transfer-DNA verwendet werden können oder verwendet wurden und schließen auch die Nachkommenschaft der Criginalzelui, die transfiziert wurde, ein. Es versteht sich, daß die Nachkommenschaft einer einzelnen Elternzelle nicht notwendigerweise in Morphologie oder als Genomoder Gesaint-DNA-Kornplement infolge einer zufälligen oder beabsichtigten Mutation mit der Originalelternzelle identisch sein muß. Die Nachkommenschaft der Elternzelle, die zur Elternzelle au !»reichende Ähnlichkeiten aufweist und durch relevante Eigenschaften, wie die Anwesenheit einer Nucleotidsequenz, die fü: ein gewünschtes Peptid codiert, charakterisiert ist, ist in dor durch diese Definition erläuterten Nachkommenschaft inbegriffen und durch die oben genannten Begriffe erfaßt. Ein „Replicon" ist jedes genetische Element, d. h. ein Plasmid, ein Chromosom, ein Virus, das sich als eine autonome Einheit der Polynucleotidrepükation innerhalb einer Zelle verhält, d.h. daß es unter eigener Steuerung zur Replikation fähig ist. Ein „Vektor" ist ein Replikon, an den ein anderes Polynucleotidsegment geknüpft ist, um so die Replikation und/oder Expression des angeknüpften Segments zu bewirken."Recombinantoic host cells", "host cells", "cells", "cell lines", "cell cultures" and other such terms that refer to microorganisms or higher eukaryotic cell lines that have been cultured as unicellular units refer to cells identified as "cells." Recipients of a recombinant vector may be or have been used for a different transfer DNA, and also include the progeny of the Criginalzelui that has been transfected. It is understood that the progeny of a single parent cell are not necessarily of morphology or genome or totality. The parent cell progeny, which has similarities to the parent cell and is characterized by relevant characteristics, such as the presence of a nucleotide sequence encoding a desired peptide, may be identical to the DNA complement due to a random or intended mutation is in dor d Progeny explained by this definition are included and covered by the above terms. A "replicon" is any genetic element, ie, a plasmid, a chromosome, a virus that behaves as an autonomous unit of polynucleotide repellency within a cell, ie that it is capable of replication under its own control. A "vector" is a replicon to which another polynucleotide segment is linked so as to effect the replication and / or expression of the attached segment.
„Kontrollsequenz' büzieht sich auf Polynucleotidsequenzen, die notwendig sind, um die Expression der Codiersequenzen, an die sie ligiert sind, zu bewirken. Die Art dieser Kontrollsequenzen unterscheidet sich je nach Wirtsorganismus; in Prokaryonten sind diese Kontrollsequenzen im allgemeinen Promoter. Ribosombindestellen und Terminatoren; in Eukarvonten sind diese Kontrollsequenzen Promoter, Terminatoren und in einigen Fällen Verstärker. Der Begriff „Konlrollsequenzen" soll mindestens alle Komponenten umfassen, deren Anwesenheit für die Expression notwendig ist und kann auch zusätzliche Komponenten umfassen, deren Anwesenheit vorteilhaft ist, wie zum Beispiel Leadersequenzen. „Operably linked" (operabel geknüpft) bezieht sich auf eine Juxtaposition, in der die so beschriebenen Komponenten in einer Beziehung miteinander stehen, die ihre Funktion in der beabsichtigten Weise erlaubt. Eine Kontrollsequenz, die an eine Codiersequenz „operabel geknüpft" ist, ist auf eine solche Weise ligiert, daß die Expression der Codiersequenz unter Bedingungen erreicht wird, die für die Kontrollsequenzen verträglich sind."Control sequence" refers to polynucleotide sequences necessary to effect expression of the coding sequences to which they are ligated. The nature of these control sequences differs depending on the host organism; in prokaryotes, these control sequences are generally promoters. Ribosome sites and terminators; in eukaryotes, these control sequences are promoters, terminators, and in some cases enhancers. The term "regulatory sequences" is intended to include at least all components whose presence is necessary for expression, and may also include additional components whose presence is advantageous, such as leader sequences. "Operably linked" refers to a juxtaposition, in the components thus described are in a relationship with one another which allows their function in the intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions that are compatible with the control sequences.
Ein „offener Leserahmen" (ORF) ist eine Region ainer Polynucleotidsequenz, die für ein Polypeptid codiert; diese Region kann einen Teil einer Codiersequenz oder eine vollständige Codiersequenz darstellen.An "open reading frame" (ORF) is a region of a polynucleotide sequence that encodes a polypeptide, which region may be part of a coding sequence or a complete coding sequence.
Ε·ηβ „Codiersequenz" ist eine Polynucleotidsequenz, die in mRNA transkribiert und/oder in ein Polypeptid translatiert wird, wenn sie sich unter der Kontrolle von geeigneten Regulationssequenzen befindet. Die Grenzen der Codiersequenz werden durch ein Translationsstartcodon am 5'-Terminus und durch ein Translationsstopcodon am 3'-Terminus bestimmt. Eine Codiersequenz kann mRNA, cDNA und rekombinante Polynucleotidsequenzen umfassen, ist abor nicht auf diese beschränkt."Ier · ηβ" coding sequence "is a polynucleotide sequence that is transcribed into mRNA and / or translated into a polypeptide when under the control of appropriate regulatory sequences The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and by a A coding sequence may include, but is not limited to, mRNA, cDNA, and recombinant polynucleotide sequences.
»Immunologisch identifizierbar mit/als" bezieht sich auf das Vorhandensein eines (von) Epitops (Etpitopen) und Polypeptids (Polypeptiden), die in dem (den) bezeichneten Polypeptid(en), gewöhnlich HCV-Proteinen, vorhanden und zu diesen einzigartig sind. Immunologische Identität kann durch Antikörperbindung und/oder Bindungskonkurrenz b( stimmt werden; diese Techniken sind den Fachleuten auf diesem Gebiet bekannt und werden auch weiter unten illustriert. Die Einzigartigkeit eines Epitops kann auch durch Computerforschungen in bekannten Datenbanken, z.B. Gen°bank, nach den Polynucleotidsequenzen, die für das Epitop codieren, sowie durch Aminosäuresequenzvergleiche mit ander' «kannten Proteinen bestimmt werden. Im hier gebrauchten Sinn bezieht sich „Epitop" auf eine Antigendeterminante eine. lypeptids; ein Epitop könnte 3 Aminosäuren in einer räumlichen Anordnung umfassen, die für das Epitop einzigartig ist, im allgemeinen besteht ein Epitop aus mindestens 5 solcher Aminosäuren und noch allgemeiner besteht es aus mindestens 8-10 solcher Aminosäuren. Die Verfahren zur Bestimmung der räumlichen Anordnung der Aminosäuren sind im Fachgebiet bekannt und umfassen beispielsweise Röntgenkristallographie und zweidimensionale magnet.'.-..ie Kernresonanz."Immunologically identifiable with / as" refers to the presence of an epitope (epitope) and polypeptide (polypeptide) present in and unique to the designated polypeptide (s), usually HCV proteins. Immunological identity can be determined by antibody binding and / or binding competition, and these techniques are well known to those skilled in the art, and are also illustrated below The uniqueness of an epitope may also be determined by computer research in known databases, eg Gen ° bank, for the polynucleotide sequences As used herein, "epitope" refers to an antigenic determinant of an epitope, an epitope could comprise 3 amino acids in a spatial arrangement common to the epitope is unique, generally an epitope consists of at least 5 such amino acids and more generally it consists of at least 8-10 such amino acids. The methods for determining the spatial arrangement of the amino acids are known in the art and include, for example, X-ray crystallography and two-dimensional magnetization.
Ein Polypeptid ist mit einem Antikörper „immunologisch reaktiv", wenn es an einen Antikörper bindet aufgrund der Tatsache, daß der Antikörper ein spezifisches Epitop, das im Polypeptid enthalten ist, erkennt. Die immunologische Reaktivität kann bestimmt werden durch die Antikörperbindung, insbesondere durch die Kinetik der Antikörperbindung, und/oder durch Bindungskonkurrenz, indem ein bekanntes Polypeptid odor bekannte Polypeptide, das/die ein Epitop enthält/enthalten, gegen das/die der Antikörper gerichtet ist, als Konkurrent(en) verwendet wird/werden. Die Techniken zur Bestimmung, ob ein Polypeptid mit einem Antikörper immunologisch reaktiv ist, sind im Fachgebiet bekannt.A polypeptide is "immunologically reactive" with an antibody when it binds to an antibody due to the fact that the antibody recognizes a specific epitope contained in the polypeptide.The immunological reactivity can be determined by antibody binding, especially by kinetics antibody binding, and / or by binding competition, by using a known polypeptide or known polypeptide (s) containing an epitope against which the antibody is directed, as a competitor (s); whether a polypeptide is immunologically reactive with an antibody is known in the art.
In der hier gebrauchten Bedeutung beinhaltet der Begriff „ein HCV enthaltendes immunogenes Polypeptid" natürlich vorkommende HCV-Polypeptide oder Fragmente davon ebenso wie Polypeptide, die durch andere Maßnahmen hergestellt wurden, wie beispielsweise chemische Synthese, oder die Expression des Polypeptids in einem rekombinanten Organismus. Der Begriff „Polypeptid" bezieht sich auf eine Molekülkette von Aminosäuren und nicht auf eine spezifische Länge des Produktes, so daß Peptide, Oligopeptide und Proteine in die Definition des Polypeptids eingeschlossen sind. Der Begriff bezieht sich auch nicht auf die Modifikationen des Polypeptids nach der Expression wie beispielsweise Glycosylierungen, Acetyllerungen, Phosphorylierungen und dergleichen.As used herein, the term "an HCV-containing immunogenic polypeptide" includes naturally occurring HCV polypeptides or fragments thereof as well as polypeptides produced by other means, such as chemical synthesis, or expression of the polypeptide in a recombinant organism The term "polypeptide" refers to a molecular chain of amino acids rather than a specific length of the product such that peptides, oligopeptides and proteins are included in the definition of the polypeptide. The term also does not refer to the modifications of the polypeptide upon expression such as glycosylations, acetylations, phosphorylations and the like.
„Transformation" in der hier gebrauchten Bedeutung bezieht sich auf die Insertion eines exogenen Polynucleotids in eine Wirtszelle ungeachtet des für die Insertion angewandten Verfahrens, wie beispielsweise direkte Aufnahme, Transduktion oder „f-mating". Das exogene Polynucleotid kann als nicht integrierter Vektor erhalten bleiben, wie z.B. ein Plasmid, oder kann auf eine andere Weise in das Wirtsgenom integriert werden."Transformation" as used herein refers to the insertion of an exogenous polynucleotide into a host cell regardless of the method used for the insertion, such as direct uptake, transduction or f-mating. The exogenous polynucleotide may be retained as a nonintegrated vector, e.g. a plasmid, or may be integrated into the host genome in some other way.
„Behandlung" in de η hier gebrauchten Sinn bezieht sich auf Prophylaxe und/oder Therapie."Treatment" in the sense used here refers to prophylaxis and / or therapy.
Ein „Individuum" im hier gebrauchten Sinn bezieht sich auf Vertebraten, insbesondere Mitglieder der Säugetierspezies und schließt Haustiere, Sporttiere, Primaten und Menschen ein, ist jedoch nicht darauf beschränkt. In der hier gebrauchten Bedeutung enthält der „Plus-Strang" einer Nucleinsäure die Sequenz, die für das Polypeptid codiert. Der „Minus-Strang" enthält eine Sequenz, die zu der des „Plus-Strangs" komplementär ist.An "individual" as used herein refers to vertebrates, particularly members of mammalian species, and includes, but is not limited to, pets, sports animals, primates, and humans As used herein, the "plus strand" of a nucleic acid includes the sequence that encodes the polypeptide. The "minus strand" contains a sequence that is complementary to that of the "plus strand".
In der hier gebrauchten Bedeutung ist ein „positiv-strängiges Genom" eines Virus eines, in dem das Genom, ob RNAoder DNA, einsträngig ist und für ein Viruspolypeptid/Viruspolypeptide codiert. Beispiele positiv-strängiger RNA-Viren sind Togaviridae, Coronaviridae, Retroviridae, Picornaviridae und Caliciviridae. Ebenfalls eingeschlossen sind die Flaviviridae, die früher als Togaviridae klassifiziert waren. Siehe Fields & Knipe (1986).As used herein, a "positive-stranded genome" is a virus in which the genome, whether RNA or DNA, is single-stranded and encodes a viral polypeptide / virus polypeptide.Examples of positive-stranded RNA viruses are Togaviridae, Coronaviridae, Retroviridae, Also included are the Flaviviridae, formerly classified as Togaviridae, see Fields & Knipe (1986).
In der hier gebrauchten Bedeutung bezieht sich „Antikörper enthaltende Körperkomponente" auf eine Komponente des Körpers eines Individuums, der eine Quelle für die in Frage kommenden Antikörper ist. Antikörper enthaltende Körperkomponenten sind im Fachgebiet bekannt und umfassen zum Beispiel Plasma, Serum, Liquor, Lymphe, die äußer an Abschnitte des Respirations-, Verdauungs- und Urogenitaltraktes, Tränen, Speichel, Milche, weiße Blutzellen und Myelomz jllen. In der hier gebrauchten Bedeutung bezieht s'ch »gereinigtes HCV-Präparat" auf ein HCV-Pröparat, das aus den zellularen Bestandteilen, mit denen das Virus normalerweise assoziiert ist und aus anderen Virusspezies, die im infizierten Gewebe vorkommen können, isoliert wurde. Die Techniken zur Isolierung der Viren sind den Fachleuten auf diesem Gebiet bekannt und schließen zum Beispiel Zentrifugierung und Affinitätschromatographie ein; ein Verfahren zur Herstellung von gereinigtem HVC wird im folgenden erläutert.As used herein, "antibody-containing body component" refers to a component of the body of an individual that is a source of the antibodies of interest. Antibody-containing body components are known in the art and include, for example, plasma, serum, cerebrospinal fluid, lymph, external to sections of the respiratory, digestive and urogenital tracts, tears, saliva, milk, white blood cells and myeloma. As used herein, "purified HCV preparation" refers to an HCV preparation derived from the cellular Ingredients with which the virus is normally associated and isolated from other virus species that may be present in the infected tissue. The techniques for isolating the viruses are known to those skilled in the art and include, for example, centrifugation and affinity chromatography; A process for producing purified HVC will be explained below.
Für die Durchführung der vorliegenden Erfindung werden, wenn nicht anders angegeben, herkömmliche Techniken der Molekularbiologie, Mikrobiologie, Rekombinant-DNA-Technik und Immunologie angegeben, die im Fachbereich üblich sind. Diese Techniken werden in der Literatur ausführlich erklärt. Siehe z.B. Maniatis, Fitsch & Sambrook, MOLECULAR CLONING; /. LABORATORY MANUAL (Molekulare Clonierung, Ein Laborhandbuch) (1982); DNA CLONING, VOLUMES I AND Il (DNA-Clonierung, Band I und II) (Herausgeber D. N. Glover, 1985); OLIGONUCLEOTIDE SYNTHES- (Oligonucleotidsyntheso) (Herausgeber M.J.fiait, 1984»; NUCLEIC ACID HYBRIDIZATION (Nucleinsäurehybridisierung; (Herausgeber B. D. Harnes & S. J. Higgins, 1984); TRANSCRIPTION AND TRANSLATION (Transkription und Translation) (Herausgeber B.D.Hames&S.J.Higgins, 1984); ANIMAL CELL CULTURE (Tierzellenkultur) (Herausgeber R. I.Frishney, 1986); IMMOBILIZED CELLS AND ENZYMES (Immobilisierte Zellen und Enzyme) (IRL Press, 1986); B. Perbai, A PRACTICAL GUIDE TO MOLECULAR CLONING (Ein praktische Führung für die molekulare Clonierung) (1984); die Serien: METHODS IN ENZYMOLOGY (Methoden der Enzymologie) (Academic Press, Inc.); GENE TRANSFER VECTORS FOR MAMALIAN CELLS (Gentransfervektoren für Säugetierzellen) (Herausgeber J. H. Miller und M. P. Calos, 1987, Cold Spring Harbor Laboratory), Methods in Enzymology Vol. 154 and Vol. 155 (Methoden der Enzymologie, Band 154 und Band 155) (Herausgeber Wu und Grossmsn bzw. Wu), HerausgeberMayerundWalker(1987),IMMUNOCHEMICALMETHODSIN CELLAND MOLECULAR BIOLOGY (Immunologische Verfahren in der Zeil- und Molekularbiologie) (Academic Press, London), Scopes (1987) PROTEIN PURIFICATION: PRINCIPLES AND PRACTICE (Proteinreinigung: Prinzipien und Praxis), zweite Auflage, (Springer-Verlag, N.Y.) und HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, VOLUMES NV (Handbuch der experimentellen Immunologie, Band HV), (Herausgeber D. M.Weir und CC. Blackwell, 1986).Unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology and immunology, which are conventional in the art, are given for carrying out the present invention. These techniques are explained in detail in the literature. See, e.g. Maniatis, Fitsch & Sambrook, MOLECULAR CLONING; /. LABORATORY MANUAL (Molecular Cloning, A Laboratory Manual) (1982); DNA CLONING, VOLUMES I AND II (DNA Cloning, Volumes I and II) (Editor D.N. Glover, 1985); OLIGONUCLEOTIDE SYNTHESIS (Oligonucleotide Synthesis) (Editor MJfiait, 1984) NUCLEIC ACID HYBRIDIZATION (Published by BD Harnes & SJ Higgins, 1984) TRANSCRIPTION AND TRANSLATION (Editor BD Hames & S.J.Higgins, 1984) ANIMAL CELL CULTURE (published by RIFrishney, 1986), IMMOBILIZED CELLS AND ENZYMES (Immobilized Cells and Enzymes) (IRL Press, 1986), B. Perbai, A PRACTICAL GUIDE TO MOLECULAR CLONING (A Practical Guide to Molecular Cloning (1984); Series: METHODS IN ENZYMOLOGY (Methods of Enzymology) (Academic Press, Inc.); GENE TRANSFER VECTORS FOR MAMALIAN CELLS (Gene Transfer Vectors for Mammalian Cells) (Editor JH Miller and MP Calos, 1987, Cold Spring Harbor Laboratory) , Methods in Enzymology Vol. 154 and Vol. 155 (Methods of Enzymology, Volume 154 and Volume 155) (Editors Wu and Grossmsn and Wu, eds. Mayer and Walker (1987), IMMUNOCHEMICALMET HODSIN CELLAND MOLECULAR BIOLOGY (Academic Press, London), Scopes (1987) PROTEIN PURIFICATION: PRINCIPLES AND PRACTICE (Protein Purification: Principles and Practice), second edition, (Springer-Verlag, NY) and HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, VOLUMES NV (Handbook of Experimental Immunology, Volume HV), (publisher DMWeir and CC. Blackwell, 1986).
Alle hier im vorangegangenen und im folgenden erwähnten Patente, Patentanmeldungen und Publikationen werden durch Bezugnahme darauf hierin eingeschlossen.All patents, patent applications and publications mentioned hereinbefore and hereinafter are incorporated herein by reference.
Die nützlichen Materialien und Prozesse der vorliegenden Erfindung werden ermöglicht durch die Bereitstellung einer Familie von eng homologen Nucleotidsequeruen, die aus einer cDNA-Bibliothek isoliert wurden, welche aus Nucleinsäuresequenzen abgeleitet wurden, die im Plasma eines HCV-infizierten Schimpansen vorhanden waren. Diese Familie von Nucleotidsequenzen hat ihren Ursprung weder beim Menschen noch beim Schimpansen, da sie weder an Human- noch an Schimpansen-Genom-DNA von nicht infizierten Individuen hybridisiert und da Nucleotide dieser Sequonzfamilie nur in der Leber und im Plasma von Schimpansen mit HCV-lnfektion vorkommen und da die Sequenz auf der Genebank nicht vorhanden ist. Außerdem zeigt diese Sequenzfamilie keine signifikante Homologie zu Sequenzen, die im HBV-Genom enthalten sind.The useful materials and processes of the present invention are made possible by the provision of a family of closely homologous nucleotide sequences isolated from a cDNA library derived from nucleic acid sequences present in the plasma of an HCV-infected chimpanzee. This family of nucleotide sequences does not originate in either humans or chimpanzees because it does not hybridize to human or chimpanzee genomic DNA from uninfected individuals and nucleotides of this family of sequences exist only in the liver and plasma of chimpanzees with HCV infection occur and because the sequence is not present on the Genebank. In addition, this family of sequences shows no significant homology to sequences contained in the HBV genome.
Die Sequenz eines Mitgliedes der Familie, die im Clon 5-1-1 enthalten ist, hat einen kontinuierlichen offenen Leserahmen (ORF), der für ein Poiypeptid von etwa 50 Aminosäuren codiert. Die Seren von HCV-infizierten Menschen enthalten Antikörper, die an dieses Poiypeptid binden, während die Seren von nicht infizierten Menschen keine Antikörper enthalten, die an dieses Poiypeptid binden. Während schließlich die Seren von nicht infizierten Schimpansen keine Antikörper enthalten, die an dieses Poiypeptid binden, werden die Antikörper in Schimpansen nach einer akuten NANBH-Infektion induziert. Darüber hinaus werden Antikörper, die an dieses Poiypeptid binden in Schimpansen und Menschen, die mit HAV und HBV infiziert sind, nicht nachgewiesen. Nach diesen Kriterien ist die Sequenz eine cDNA gegen eine Virussequenz, wobei das Virus die NANBH verursacht oder damit verbunden ist; diese cDNA-Sequenz wird in Fig. 1 gezoigt. Wie weiter unten diskutiert wird, unterscheidet sich die cDNA-Sequenz in Clon 5-1-1 von der der anderen isolierten cDNAs darin, daß sie 28 extra Basenpaare enthält. Eine Zusammensetzung anderer identifizierter Mitglieder der cDNA-Familie, die isoliert wurden, indem eine synthetische .Sequenz, die einem Fragment dercDNA in Clon 5-1-1 entspricht, als Sonde verwendet wurde, wird in Fig.3 gezeigt. Ein Mitglied der cDNA-Familie, die isoliert wurde, indem eine aus der cDNA in Clon 81 abgeleitete synthetische Sequenz verwendet wurde, wird in Fig. 5 gezeigt, und eine Zusammensetzung dieser Sequenz mit der von Clon 81 wird in Fig. 6 gezeigt. Andere Mitglieder der cDNA-Familie, einschließlich derjenigen, die in den Clonen17f, 14i, 11^7ί,7β,8^33ο,40^37^35,36,81,32,33^25ο, 14c, 8f33f,35f, 19g, 26g, 15c, 33g und 39c vorhanden sind, werden im Abschnitt IV. A. beschrieben. Eine Zusammensetzung der cDNAs in diesen Clonen wird in Abschnitt IV. A. 9. beschrieben und in Fig. 39 geneigt. Die zusammengesetzte cDNA zeigt, daß sie einen kontinuierlichen offenen Leserahmen enthält und damit für ein Polyprotein codiert. Diese Daten stimmen mit der im folgenden erörterten Vermutung überein, daß HCV ein Flavivirus oder flaviartiges Virus ist.The sequence of a member of the family contained in clone 5-1-1 has a continuous open reading frame (ORF) coding for a polypeptide of about 50 amino acids. The sera from HCV-infected humans contain antibodies that bind to this polypeptide, while the sera from uninfected humans do not contain antibodies that bind to this polypeptide. Finally, while the sera from uninfected chimpanzees do not contain antibodies that bind to this polypeptide, the antibodies in chimpanzees are induced after acute NANBH infection. In addition, antibodies that bind to this polypeptide are not detected in chimpanzees and humans infected with HAV and HBV. According to these criteria, the sequence is a cDNA against a viral sequence, which virus causes or is linked to NANBH; This cDNA sequence is gezöigt in Fig. 1. As will be discussed below, the cDNA sequence in clone 5-1-1 differs from that of the other isolated cDNAs in that it contains 28 extra base pairs. A composition of other identified members of the cDNA family isolated by using a synthetic sequence corresponding to a fragment of the cDNA in clone 5-1-1 is shown in FIG. A member of the cDNA family which was isolated by using a synthetic sequence derived from the cDNA in clone 81 is shown in Fig. 5, and a composition of this sequence with that of clone 81 is shown in Fig. 6. Other members of the cDNA family, including those in the clones 17f, 14i, 11 ^ 7ί, 7β, 8 ^ 33o, 40 ^ 37 ^ 35,36,81,32,33 ^ 25ο, 14c, 8f33f, 35f, 19g , 26g, 15c, 33g and 39c are described in Section IV. A. A composition of the cDNAs in these clones is described in Section IV. A. 9. and tilted in Figure 39. The composite cDNA shows that it contains a continuous open reading frame and thus encodes a polyprotein. These data are consistent with the presumption discussed below that HCV is a flavivirus or flavivirus.
Die Verfügbarkeit dieser in Fig. 1-32 gezeigten Familie von cDNAs gestattet die Konstruktion von DNA-Sonden und Polypeptiden, die für die Diagnostizierung von NANBH infoige einer HCV-lnfektion und für Screening-Untersuchungon bei Blutspendern sowie auch bei Spenderblut und Blutprodukten auf eine Infektion nützlich sind. Zum Beispiel ist es möglich, aus den Sequenzen DNA-Oligomero von etwa 8-10 Nucleotiden oder mehr zu synthetisieren, die als Hybridisiersonden nützlich sind, um das Vorhandensein des Virusgenoms in beispielsweise Seren von Individuen, die möglicherweise das Virus beherbergen, nachzuweisen, oder die zum Screening von Spenderblut auf das Vorhandensein des Virus nützlich sind. Die Familie von cDNA-Sequenzen erlaubt auch den Entwurf und die Erzeugung von HCV-spezifischen Polypeptiden, die als Diagnosemittel für Anwesenheit von Antikörpern, die während der NANBH entstanden, nützlich sind. Antikörper gegen gereinigte Polypeptide, die aus den cDNAs abgeleitet wurden, können ebenfalls zum Nachweis viraler Antigene in infizierten Individuen und in Blut verwendet werden.The availability of this family of cDNAs shown in Figures 1-32 permits the construction of DNA probes and polypeptides useful for the diagnosis of NANBH infection of HCV infection and for screening examination in blood donors as well as donated blood and blood products for infection are useful. For example, it is possible to synthesize from the sequences DNA oligomer of about 8-10 nucleotides or more which are useful as hybridizing probes to detect the presence of the viral genome in, for example, sera of individuals who may harbor the virus, or the like useful for screening donated blood for the presence of the virus. The family of cDNA sequences also allow the design and generation of HCV-specific polypeptides useful as diagnostic agents for the presence of antibodies raised during NANBH. Antibodies to purified polypeptides derived from the cDNAs can also be used to detect viral antigens in infected individuals and in blood.
Die Kenntnis dieser cDNA-Sequenzen erlaubt auch den Entwurf und die Produktion von Polypeptiden, die als Vakzine gegen das HCV und auch für die Produktion von Antikörpern, die wiederum als Schutz vor dieser Krankheit verwendet werden können, und/oder für die Therapie von mit HCV infizierten Individuen eingesetzt werden können.Knowledge of these cDNA sequences also permits the design and production of polypeptides useful as vaccines against HCV and also for the production of antibodies which, in turn, can be used to protect against this disease and / or for therapy with HCV infected individuals can be used.
Darüber hinaus erlaubt die Familie von cDNA-Sequenzen die weitere Charakterisierung des HCV-Genoms. Die von diesen Sequenzen abgeleiteten Polynucleotidsonden können zum Screening von cDNA-Bibliotheken nach zusätzlichen überlappenden cDNA-Sequenzen genutzt werden, welche wiederum dazu verwendet werden können, noch mehr überlappende Sequenzen zu erhalten. Falls nicht das Genom segmentiert wird und den Segmenten gemeinsame Sequenzen fehlen, kann diese Technik verwendet werden, um die Sequenz des gesamten Genoms zu erhalten. Wenn das Genom jedoch segmentiert wird, können andere Segmente des Genoms durch Wiederholung Hes Lambda-gt11-serologischen Screening-Verfahrens zur Isolierung der hier beschriebenen cDNA-Clone oder auf eine alternative Weise durch Isolierung des Genoms aus gereinigten HCV-Partikeln gewonnen werden.In addition, the family of cDNA sequences allows further characterization of the HCV genome. The polynucleotide probes derived from these sequences can be used to screen cDNA libraries for additional overlapping cDNA sequences, which in turn can be used to obtain even more overlapping sequences. Unless the genome is segmented and the segments lack common sequences, this technique can be used to obtain the sequence of the entire genome. However, when the genome is segmented, other segments of the genome can be obtained by repeating the Hes-Lambda-gt11 serological screening procedure to isolate the cDNA clones described herein or, alternatively, isolating the genome from purified HCV particles.
Die Familie von cDNA-Sequenzen und die aus dieser Sequenzen abgeleiteten Polypeptide wie auch die gegen diese Polypeptide gerichteten Antikörper sind bei der Isolierung und Identifizierung der (des) BB-NANBV-Erreger(s) nützlich. Beispielsweise können Antikörper, die gegen HCV-Epitope gericht)>t sind, die in aus den cDNAs gewonnenen Polypeptiden enthalten sind, in Prozessen eingesetzt werden, die auf der Affinitätschi cmatographie zur Isolierung des Virus beruhen. Alternativ können die Antikörper verwendet werden, um die durch andere Techniken isolierten Viruspartikel zu identifizieren. Die viralen Antigene und das genomische Material innerhalb der isolierten Viruspartikel können dann weiter charakterisiert werden. Did aus der weiteren Sequenzieruny des (der) HCV-Genoms (Genome) sowie aus der weiteren Charakterisierung der HCV-Antigene und der Charakterisierung des Genoms gewonnenen Informationen erlauben den Entwurf und die Synthese von zusätzlichen Sonden und Polypeptiden und Antikörpern, die für Diagnose, Vorbeugung und Therapie von HCV-induzierter NANBH sowie zum Screening von infiziertem Blut und blutähnlichen Produkten eingesetzt werden können. Die Verfügbarkeit von Sonden für HCV, einschließlich Antigenen und Antkörpern, sowie Polynucleotide^ die aus dem Genom abgeleitet wurden, aus dem die Familie von cDNAs abgeleitet wurde, erlaubt auch die Entwicklung von Gewebekultursystemen, die für die Aufhellung der Biologie des HCV von größtem Nutzen sein werden. Dies wiederum kann zur Entwicklung neuer Behandlungsmethoden auf der Grundlage antiviral Komponenten, die vorzugsweise die Replikation des oder die Infektion durch das HCV hemmen, führen.The family of cDNA sequences and the polypeptides derived from these sequences as well as the antibodies directed against these polypeptides are useful in the isolation and identification of the BB-NANBV pathogen (s). For example, antibodies directed against HCV epitopes) contained in polypeptides derived from the cDNAs can be used in processes that rely on affinity chromatography to isolate the virus. Alternatively, the antibodies can be used to identify virus particles isolated by other techniques. The viral antigens and the genomic material within the isolated virus particles can then be further characterized. Information derived from the further sequencing of the HCV genome (s), as well as from further characterization of the HCV antigens and genome characterization, allows the design and synthesis of additional probes and polypeptides and antibodies useful for diagnosis, prevention and therapy of HCV-induced NANBH and for the screening of infected blood and blood-like products. The availability of probes for HCV, including antigens and antibodies, as well as polynucleotides derived from the genome from which the family of cDNAs was derived, also allow the development of tissue culture systems which are of great benefit for brightening the biology of HCV become. This, in turn, may lead to the development of new treatments based on antiviral components that preferentially inhibit the replication of or infection by the HCV.
Die zur Identifizierung und Isolierung des Erregers von NANBH angewandte Methode ist neuartig und kann angewandt werden bei der Identifizierung und/oder Isolierung von zuvor nicht charakterisierten Erregern, die ein Genom enthalten, und die mit einer Vielzahl von Krankheiten, einschließlich solcher, die durch Viren, Viroide, Bakterien, Pilze und Parasiten induziert werden, verbunden sind. Bei dieser Methode wurde eine cDNA-Bibliothek aus den im infizierten Gewebe aus einem infizierten Individuum vorhandenen Nucleinsäuren geschaffen. Die Bibliothek wurde in einem Vektor geschaffen, der die Expression der in der cDNA codierten Polypeptide erlaubte. Clone von Wirtszellen, die den Vektor enthielten, der ein immunologisch reaktives Fragment eines Polypeptids des Krankheitserregers exprimierte, wurden durch immunologisches Screening der Expressionsprodukte der Bibliothek mit einer Antikörper enthaltenden Körperkomponente aus einem anderen, zuvor mit dem vermutlichen Erreger infizierten Individuum selektioniert. Die Stufen des immunologischen Screening-Verfahrens schlossen die Wechselwirkung der Expressionsprodukte der cDNA enthaltenden Vektoren mit der Antikörper enthaltenden Körperkomponente eines zweiten infizierten Individuums und den Nachweis der Bildung von Antikörper-Antigen-Komplexen zwischen dem (den) Expressicnsprodukt(en) und Antikörpern des zweiten infizierten Individuums ein. Die isolierten Clone werden weiterhin immunologischen Screening-Verfahren unterzogen, indem ihre Expressionsprodukte mit den Antikörper enthaltenden Körperkomponenten der anderen mit dem vermutlichen Erreger infizierten Individuen und mit Kontrollindividuen, die mit dem vermutlichen Erreger nicht infiziert wurden, in Wechselwirkung traten und die Bildung von Antigen-Antikörper-Komplexen mit Antikörpern aus den infizierten ndividuen nachgewiesen wurde; und die cDNA enthaltenden Vektoren, die für Polypeptide codieren, die immunologisch η-,it Antikörpern aus infizierten Individuen und aus Individuen, die vermutlich mit dem Erreger infiziert sind, jedoch nicht mit Kontrollindividuen, reagieren, isoliert werden. Die für die Konstruktion der cDNA-Bibliothek und für das Immunologische Screening benutzten infizierten Individuen müssen nicht von der gleichen Spezies sein. Die im Ergebnis dieser Methode isolierten cDNAs und ihre Expressionsprodukte und die gegen die Expressionsprodukte gerichteten Antikörper sind für die Charakterisierung und/oder das Einfangen des ätiologischen Erregers nützlich. Wie im folgenden ausführlicher beschrieben wird, wurde diese Methode erfolgreich zur Isolierung einer aus dem HCV-Genom gewonnenen Familie von cDNAs genutzt.The method used to identify and isolate the agent of NANBH is novel and can be used in the identification and / or isolation of previously uncharacterised pathogens containing a genome and those with a variety of diseases, including those caused by viruses, Viroids, bacteria, fungi and parasites are induced. In this method, a cDNA library was created from the nucleic acids present in the infected tissue from an infected individual. The library was created in a vector that allowed expression of the polypeptides encoded in the cDNA. Clones from host cells containing the vector expressing an immunologically reactive fragment of a polypeptide of the pathogen were selected by immunological screening of the library's expression products with an antibody-containing body component from another individual previously infected with the putative pathogen. The steps of the immunological screening procedure included the interaction of the expression products of the cDNA-containing vectors with the antibody-containing body component of a second infected individual and the detection of the formation of antibody-antigen complexes between the expressing product (s) and antibodies of the second infected one Individual. The isolated clones are further subjected to immunological screening procedures by interacting their expression products with the antibody-containing body components of the other suspected virus-infected individuals and with control individuals uninfected with the putative agent and the formation of antigen-antibody Complexes with antibodies from the infected individuals was detected; and the cDNA-containing vectors encoding polypeptides which are immunologically isolated from antibodies to infected individuals and from individuals suspected of being infected with the agent, but not with control individuals. The infected individuals used for construction of the cDNA library and for immunological screening need not be of the same species. The cDNAs isolated as a result of this method and their expression products and the antibodies directed against the expression products are useful for the characterization and / or trapping of the etiological agent. As described in more detail below, this method has been used successfully to isolate a family of cDNAs derived from the HCV genome.
Von einem Schimpansen mit chronischer HCV-lnfektion gesammeltes Serum, das · en hohen Virust'ter enthält, das heißt mindestens eine 10' Schimpanse-Infektionsdosis/ml (CID/ml), wurde zur Isolierung von viralen Partikeln verwendet; die aus diesen Partikeln isolierten Nucleinsäuren wurden als Matrize bei der Konstruktion einer cDNA-Bibliothek zum viralen Genom verwendet. Die Verfahren zur Isolierung von putativen HVC-Partikeln und für die Konstruktion der cDNA-Bibliothek in Lambda-gt 11 werden in Abschnitt IV. A. 1. diskutiert. Lambda-gt 11 ist ein Vektor, der speziell entwickelt wurde, um inserierte cDNAs als Fusionspolypeptide mit Beta-Galactosidase zu exprimjeren und eine große Anzahl rekombinante Phage mit spezifischen Antiseren gegen ein bestimmtes Antigen zu bilden. Die Lambda-gt 11-Bibliothek, hergestellt aus einer cDNA-Ansammlung, die cDNA von ungefähr mittlerer Größe von 200 Basenpnaren enthält, wurde bezüglich codierter Epitope gescreent, die spe; iell Seren binden könnten, die von zuvor mit NANB-Hepatitis erkrankten Patienten stammten. Huynh, T. V., et. al. (1985). Es wurde ι ungefähr 10' Phagen gescreent, und fünf positive Phagen wurden identifiziert, gereinigt und anschließend hinsichtlich der Spezifität der Bindung an Seren von verschiedenen Menschen und Schimpansen, die zuvor mit HCV-Agens infiziert wurden, getestet. Eine der Phagen, 5-1-1, hatte 5 der 8 getesteten menschlichen Seren gebunden. Diese Bindung schien für Seren von zuvor NANB-Hepatitisinfektionen ausgesetzten Patienten selektiv zu erfolgen, da 7 normale Blutspenderseren eine derartige Bindung nicht aufwiesen.Sera collected from a chimpanzee with chronic HCV infection containing high levels of virus, i.e., at least one 10 'chimpanzee infectious dose / ml (CID / ml), has been used to isolate viral particles; the nucleic acids isolated from these particles were used as templates in the construction of a cDNA library to the viral genome. The procedures for isolating putative HVC particles and for constructing the cDNA library in lambda gt 11 are discussed in Section IV. A. 1.. Lambda gt 11 is a vector designed specifically to express inserted cDNAs as beta-galactosidase fusion polypeptides and to produce a large number of recombinant phage with specific antisera to a particular antigen. The lambda gt 11 library, prepared from a cDNA library containing approximately 200-base cDNA size cDNA, was screened for coded epitopes containing spe; could bind sera derived from previously NANB hepatitis patients. Huynh, T.V., et. al. (1985). It was screened approximately 10 'phage and five positive phage were identified, purified and then tested for specificity of binding to sera from various humans and chimpanzees previously infected with HCV agent. One of the phages, 5-1-1, had bound 5 of the 8 human sera tested. This binding appeared to be selective for sera from patients previously exposed to NANB hepatitis infection since 7 normal blood donor sera did not exhibit such binding.
Die Sequenz der cDNA in dem rekombinanten Phage 5-1 -1 wurde ermittelt und in Figur 1 dargestellt. Das durch diese clonierte cDNA codierte Polypeptid, das in dem gleichen translational Raster wie die N-terminale Beta-Galactosidasekomponente des Fusionspolypeptids ist, wird über der Nucleotidsequenz gezeigt. Daher codiert dieses translational offene Leseraster ein Epitop oder Epitope, die speziell durch die Seren von Patienten mit NANB-Hepatitisinfektionen erkannt werden.The sequence of the cDNA in the recombinant phage 5-1-1 was determined and shown in FIG. The polypeptide encoded by this cloned cDNA, which is in the same translational pattern as the N-terminal beta-galactosidase component of the fusion polypeptide, is shown above the nucleotide sequence. Therefore, this translational open reading frame encodes an epitope or epitopes that are specifically recognized by the sera of patients with NANB hepatitis infections.
und/oder alternative Segmente der cDNA für das virale Genom enthielten. Die oben beschriebene Lambda-gt 11 -cDNA-and / or alternative segments of the cDNA for the viral genome. The lambda gt 11 cDNA described above
gescreent. Dieses Screening argab drei andere Clone, die als 81,1-2 und 91 identifiziert wurden; die in diesen Clonen enthaltenencDNAs wurden sequenziert, ijie'ie Abschnitt IV. A.3. und IV.A.4. Die Homologien zwischen den vier unabhängigen Clonenwerden in Figur 2 gezeigt, wo die Homologien durch vertikale Lir ien angezeigt ν 'erden. Nucleotidsequenzen sind ausschließlichin den Clonen 5-1-1,81 und 91 vorhanden und werden durch kleine Buchstaben bezeichnet.screened. This screening argab three other clones that were identified as 81,1-2 and 91; the cDNAs contained in these clones were sequenced, as described in Section IV. A.3. and IV.A.4. The homologies between the four independent clones are shown in Figure 2, where the homologies are indicated by vertical lines. Nucleotide sequences are present exclusively in clones 5-1-1,81 and 91 and are indicated by small letters.
unterscheiden sich nur in zwei Reginnen. Erstens ist die Nucleotidzahl 67 in Clon 1-2 ein Thymidin, während die anderen dreidiffer only in two reginnen. First, nucleotide number 67 in clone 1-2 is one thymidine, while the other three
anderen Clonan nicht vorhanden sind. Diese zusätzlir he Sequenz kann ein 5'-terminales cloniertes Artefakt sein; exterminateclonierte Artefakts werden im a'^cimeinen in de>n Produkten von cDNA-Verfahren beobachtet.other clonans are not present. This additional sequence may be a 5'-terminal cloned artifact; Extermine-cloned artifacts are observed in the majority of cDNA products.
überlappen. Die Sequenzen der resultierenden cDNAs, die in Clon 36 beziehungsweise Clon 32 vorhanden sind, werden in Figur5 und Figur 7 gezeigt.overlap. The sequences of the resulting cDNAs present in clone 36 and clone 32, respectively, are shown in FIG. 5 and FIG.
cDNAs aus der Lambda-gt 11-NANBV-cDNA-Bibliothek verwendet, o'ie die Clon-36-cDNA (Abschnitt IV.A.8.) überlappen.cDNAs from the lambda gt 11 NANBV cDNA library are used, or the clone 36 cDNA (Section IV.A.8.) overlap.
wurde als Clon 35 bezeichnet und die NANBV-cDNA-ί queni, die in diesem Clon enthalten ist, wird in Figur 8 gezeigt.was designated as clone 35 and the NANBV cDNA queni contained in this clone is shown in FIG.
downstream-HCV-cDNA-Sequenzen. Die Isolierung dib^r Clone wird später l·· Abschnitt IV.A. beschrieben.downstream HCV cDNA sequences. The isolation of clones will later be described in Section IV.A. described.
zusammengesetzte cDNA ein langes kontinuierliches offenes Leseraster enthält. Figur 26 zeigt die Sequenz derzusammengesetzten oDNA aus diesen C'onen gemeinsam mit den. darin codierten mutmaßlichen HCV-Polypeptid.composite cDNA contains a long continuous open reading frame. Figure 26 shows the sequence of the composite DNA from these Cones together with the. coded in it putative HCV polypeptide.
resultierenden Sequenzen (und ihre Komplements) sind hierin bereitgestellt, und die Sequenzen, oder irgendein Teil davon,können unter Verwendung von synthetischen Verfahren oder durch eine Kombination der synthetischen Verfahren mitresulting sequences (and their complements) are provided herein, and the sequences, or any part thereof, may be synthesized using synthetic methods or by a combination of the synthetic methods
werden.become.
entsprechend den Bestimmungen des Budapester Vertrages bei dar American Type Culture Collection (ATCC), 12301 Parklawnaccording to the provisions of the Budapest Treaty at the American Type Culture Collection (ATCC), 12301 Parklawn
Bei Bewilligung und Ausgabe diesor Anmeldung als ein Patent der Vereinigten Staaten werden alle Beschränkungen bezüglich der Verfügbarkeit dieser Hinterlegungen unwiderruflich aufgehoben; der Zugang zu den designierten Hinterlegungen wird während des Anhängigseins der obigen Anmeldung demjenigen ermöglicht, der durch den dafür unter 37CFR 1.14 und 35 USC 1.22 berechtigten Patentbeauftragten bestimmt wird. Darüber hinaus werden die bezeichneten Hinterlegungen über einen Zeitraum von dreißig (30) Jahren vom Datum der Hinterlegung an, oder für fünf (5) Jahre nach der letzten Anforderung an die Hinterlegung aufbewahrt; oder über die ge!:ande Lebensdauer des US-Patentüs, je nachdem, was länger ist. Diese ' Hinterlegungen und andere hierin erwähnte hinterlegte Materialier sind nur der Zweckdienlichkeit halber beabsichtigt und nicht erforderlich, um die vorliegende Erfindung im Sinne der Beschreibung in die Praxis umzusetzen. Die HCV-cDMA-Seiuenzon in allen der hinterlegten Materialien sind darin unter Bezugnahme darauf eingeschlos 'en.Upon granting and issuing this United States patent application, all restrictions on the availability of such deposits will be irrevocably canceled; Access to the designated deposits will be made possible during the pendency of the above application to the one designated by the patent agent authorized to do so under 37CFR 1.14 and 35 USC 1.22. In addition, the designated deposits will be held for a period of thirty (30) years from the date of deposit, or for five (5) years after the last filing request; or the life of the US patent, whichever is longer. These deposits and other deposited material as referred to herein are intended for convenience only and are not required to practice the present invention as the description proceeds. The HCV cDMA grade in all of the deposited materials are incorporated herein by reference.
Die obige Beschreibung, die sich mit dem ,walking" eines Genoms durch Isolieren überlappender cDNA-Sequenzen au» der HCV-Lambda-gt 11 -Bib':othek befaßt, stellt r<in Verfahren zur Verfügung, ' 'rch das cDNAs entsprechend dom gesamten HCV-Genom isoliert werden können. Für Fachleute ist jedoch klar, daß die darin bereitgestellte Information andere Verfahren für die Isolierung dieser CDNAs ermöglicht. Einige dieser Verfahren werden in Abschnitt IV.A., siehe unten, beschrieben.The above specification, au with the, walking "a genome by isolating overlapping cDNA sequences" of the HCV lambda gt 11 -Bib ': concerned othek represents r <in procedures are available,''the cDNAs rch according dom However, it will be appreciated by those skilled in the art that the information provided herein enables other methods of isolating these CDNAs, some of which are described in Section IV.A., infra, below.
I.B. Hersteilung von viralen Polypeptiden und Fragmenten I.B. Production of viral polypeptides and fragments
Die Verfügbarkeit von cDNA-Sequenzen, entweder von jenen, die durch Nutzung der in den Figuren 1 bis 26 dargestellten cDNA-Sequenzen isoliert wurden, wie weiter unten ausgeführt wird, wie auch der cDNA-Sequenzen ·η diesen Figuren, gestattet die Konstruktion der Expressionsvektoren, die die antigenwirksamen Regionen können aus den Übmzugs- oder Hüllantigenen oder aus Kernantigenen einschließlich zum Beispiel Polynucleotidbindungsproteinen, Pclynucleotidpolymerase(n) und anderen viralen Proteinen hergeleitet werden, die für die Repiikation und/oder Assemblierung (assembly) der Viruspartikel erforderlich sind. Die die gewünschten Polypeptide codierenden Fragmente werden aus cDNA-CIcnen unter Verwendung herkömmlicher Restriktionsdigestion oder synthetischer Verfahren abgeleitet und in Vektoren ligiert, die zum Beispiel Teile von Fusionssequenzen wie Beta-Galactosidase oder Superoxiddisrnutase (SOD), vorzugsweise SOD, enthalten.The availability of cDNA sequences, either those isolated by use of the cDNA sequences shown in Figures 1 to 26, as set forth below, as well as the cDNA sequences .eta. Η of these figures, permits the construction of the expression vectors The antigenic regions may be derived from the overmold or envelope antigens or from core antigens including, for example, polynucleotide binding proteins, polynucleotide polymerase (s), and other viral proteins required for the replication and / or assembly of the virus particles. The fragments encoding the desired polypeptides are derived from cDNA clones using conventional restriction digestion or synthetic methods and ligated into vectors containing, for example, portions of fusion sequences such as beta-galactosidase or superoxide dismutase (SOD), preferably SOD.
Verfahren und Vektoren, die für die Erzeugung von Polypeptiden nützlich sind, die ι usionssequenzen von SOD enthalten, werden in der EPO-Veiöffentlichungs-Nr.0196056, veröffentlicht am 10.Okt. 1986, beschrieben. Vektoren, die Fusionspolypeptide von SOD· und HCV-Polypeptiden, d.h. NANB5.,.!, NANB8, und C100-3 codieren, die in einer Zusammensetzung von HCV-cDNAs codiert sind, werden in den Abschnitten IV.B.1, IV.B.2 bzw. IV.8.4 beschrieben. Jeder gewünschte Abschnitt der HCV-cDNA, die ein offnes Leseraster in jedem der beiden codierten Stränge enthält, kann als rekombinantes Polypeptid, zum Beispiel als matures oder Fusionsprotein, gewonnen werden; alternativ dazu kann ein in der cDNA codiertes Polypeptid durch chemische Synthese hergestellt werden.Methods and vectors useful for the production of polypeptides containing synthetic sequences of SOD are described in EPO Publication No. 0196056, published Oct. 10, 1999. 1986, described. Vectors encoding fusion polypeptides of SOD · and HCV polypeptides, ie, NANB 5 .,!, NANB 8 , and C100-3 encoded in a composition of HCV cDNAs are described in Sections IV.B.1, IV.B.2 or IV.8.4 described. Any desired portion of the HCV cDNA containing an open reading frame in each of the two encoded strands may be recovered as a recombinant polypeptide, for example as a mature or fusion protein; alternatively, a polypeptide encoded in the cDNA can be prepared by chemical synthesis.
Die das gewünschte Polypeptid codierende cDNA, ganz gleich, ob in fusionierter oder maturer Form, und je nachdem, ob eine Signalsequenz, die Sekretion gestattet, enthalten ist oder nicht, kann in Expressionsvektoren ligiert werden, die für jeden Wirt geeignet sind. Sowohl eukaryontische als auch prokaryontische Wirtssysteme werden gegenwärtig bei der Bildung von rekombinanten Polypeptiden verwendet, und eine Zusammenfassung von einigen der üblichen Kontrollsysteme und Wirtszellinien wira in Abschnitt III.A. siehe unten, gegeben. Das Polypeptid wird dann aus lysierten Zellen oder aus dem Kulturmedium isoliert und in dem Umfange gereinigt, wie es für den beabsichtigten Verwendungszweck erforderlich ist. Die Reinigung kann nach im Fachgeschäft bekannten Verfahren, zum Beispiel Salzfraktioniei ung, Chromatographie auf lonenaustauschharzen, Affinitätschromatographie, Zentrifugation und so weiter erfolge t. Bezüglich der Vielfalt von Verfahren für die Reinigung von Proteinen siehe zum Beispiel „Methode in Enzymology" (Verfahren in der Enzymologie). Derartige Polypeptide können als Diagnosen verwendet werden, oder diejenigen, die Neutralisation von Antikörpern bewirken, können in Vakzine formuliert werden. Die gegen diese Polypeptide wirkenden Antikörper können auch als Diagnosen oder für die passive Immuntherapie verwendet werden. Daneben sind, wie hier in Abschnitt IU. später erörtert wird, die Antikörper zu diesen Polypeptiden für das Isolieren und Identifizieren der HCV-Partikel nützlich.The cDNA encoding the desired polypeptide, whether in fused or mature form, and whether or not a signal sequence that allows secretion, may or may not be ligated into expression vectors suitable for any host. Both eukaryotic and prokaryotic host systems are currently used in the production of recombinant polypeptides, and a summary of some of the common control systems and host cell lines is described in Section III.A. see below, given. The polypeptide is then isolated from lysed cells or from the culture medium and purified to the extent necessary for the intended use. The purification may be carried out by methods known in the art, for example, salt fractionation, chromatography on ion exchange resins, affinity chromatography, centrifugation and so on. For the variety of methods for purifying proteins, see, for example, "Method in Enzymology." Such polypeptides may be used as diagnoses, or those that cause neutralization of antibodies may be formulated in vaccines Also, as discussed later in Section IU, antibodies to these polypeptides are useful for isolating and identifying the HCV particles, as well as being useful as diagnoses or for passive immunotherapy.
Die HCV-Ar.tigene können auch aus HCV-Virionen isoliert werden. Die Virionen können in HCV-infizierten Zellen in der Gewebekultur oder in einem infizierten Wirt gezüchtet werden.The HCV arthotenes can also be isolated from HCV virions. The virions can be grown in HCV-infected cells in tissue culture or in an infected host.
Eine antigene Region ei;ie3 Polypeptide ist im allgemeinen relativ klein, typisch sind 8 bis 10 Aminosäuren oder eine geringere Länge. Fragmente von nur 5 Aminosäuren können eine antigene Region charakterisieren. Diese Segmente können Regionen charakterisieren. Diese Segmente können Regionen des HCV-Antigens entsprechen. Demzufolge können, bei Verwendung der cDNAs von HCV als Basis, DNAs, die kurze Segmente von HCV-Polypeptiden codieren, rekombinant entweder als Fusionsproteine oder als isolierte Polypeptide exprimiert werden. Außerdem können kurze Aminosäuresequenzen bequem durch chemische Synthese gewonnen werden. Zum Beispiel in dem Falle, wo das synthetisierte Polypeptid korrekt konfiguriert wird, um das richtige Epitopzu liefern, jedoch zu klein ist, um immunisierend zu wirken, kann es an einen geeigneten Trägerstoff gebunden werden.An antigenic region is generally relatively small, typically from 8 to 10 amino acids or a shorter length. Fragments of only 5 amino acids can characterize an antigenic region. These segments can characterize regions. These segments may correspond to regions of the HCV antigen. Thus, using the cDNAs of HCV as a base, DNAs encoding short segments of HCV polypeptides can be recombinantly expressed either as fusion proteins or as isolated polypeptides. In addition, short amino acid sequences can be conveniently obtained by chemical synthesis. For example, in the case where the synthesized polypeptide is correctly configured to provide the correct epitope but is too small to be immunogenic, it can be bound to a suitable carrier.
Eine Reihe von Techniken für die Erzielung derartiger Verbindung )ti sind den Fachleuten bekannt einschließlich der Bildung von Disulfidverbindungen unter Verwendung von N-Succinimidyl-3-(2-pyridylthio)propionat (SPDP) und Succinimidyl-4-(N-maleimidomethyl)cyclohexan-1 -carboxylat (SMCC), die von der Pierce Company, Rockford, lllionois, erworben wurden. (Falls das Peptid keine Sulfhydrylgruppe aufweist, kann dieses durch Addition eines Cystein-Restes bereitgestellt werden.) Diese Reagenzien bewirken eine Disulfidbindung zwischen ihnen und den Peptidcystein-Resten an einem Protein sowie eine Amidbindung durch das Epsilon-Amino an ein Lysin, oder anoere freie Aminogruppen in anderen. Die Vielfalt derartiger Disulfid/ Amid-bildender Agenzien ist bekannt, siehe zum Beispiel Immun. Rev. (1982) 62:185.A number of techniques for obtaining such compound (s) are known to those skilled in the art, including the formation of disulfide compounds using N-succinimidyl-3- (2-pyridylthio) propionate (SPDP) and succinimidyl-4- (N-maleimidomethyl) cyclohexane. 1-carboxylate (SMCC) purchased from the Pierce Company, Rockford, Illinois. (If the peptide does not have a sulfhydryl group, this can be provided by addition of a cysteine residue.) These reagents cause a disulfide bond between them and the peptide cysteine residues on a protein as well as an amide bond through the epsilon amino to a lysine, or anoer free Amino groups in others. The variety of such disulfide / amide-forming agents is known, see, for example, Immun. Rev. (1982) 62: 185.
Andere bifunktionelle Kopplungsagenzien bilden eher eine Thioether- als eine Disulfidverbindung. Viele dieser Thioetherbildenden Agenzien stehen handelsüblich zur Verfügung und umfassen wirksame Ester von 6-Maleimidocapronsäure, 2-Bromessigsäure, 2-lodessigsäure, 4-(N-Maleimidomethyl)-cyclohexan-1-carbonb.Sure und dergleichen. Die Carboxylgruppen können durch Kombination mit Succinimid oder 1-Hydroxyl-2-nitro-4-sulfonsäure-Natriumsalzaktiviort werden. Die vorstehend« Aufzählung ist als nicht erschöpfend anzusehen und Modifikationen der genannten Verbindungen können natürlich verwendet werden.Other bifunctional coupling agents form a thioether rather than a disulfide compound. Many of these thioether forming agents are commercially available and include effective esters of 6-maleimidocaproic acid, 2-bromoacetic acid, 2-iodoacetic acid, 4- (N-maleimidomethyl) -cyclohexane-1-carboxylic acid, and the like. The carboxyl groups may be activated by combination with succinimide or 1-hydroxyl-2-nitro-4-sulfonic acid sodium salt. The list above is not exhaustive and modifications of said compounds may of course be used.
Es kann jede Trägersubstanz verwendet werden, die ic bst nicht die Erzeugung von für den Wirt schädlichen Antikörpern induziert. Geeignete Trägermittel sind typischerweise große, langsam metabolisierto Makromoleküle wie Proteine; Polysaccharide wie Latex-funktionalisierte Sepharose, Agarose, Cellulose, Celluloseperlen und dergleichen; polymere Aminosäuren wie Polyglutaminsäure, Polylysin und dergleichen; Aminosäurecopolymere; und inaktive Viruspartikel, siehe zum Beispiel Abschnitt II.D. Besonders nützliche Proteinsubstrate sind Serumalbumine, „keyhole limpe'i" Hämocyrnin, Immunglobulinmoleküle, Thyroglobulin Eieralbumin, Tetanustoxoid und andere den Fachleuten allgemein bekannte Proteine.Any vehicle can be used that does not induce the generation of host-damaging antibodies. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins; Polysaccharides such as latex-functionalized sepharose, agarose, cellulose, cellulose beads and the like; polymeric amino acids such as polyglutamic acid, polylysine and the like; amino acid copolymers; and inactive virus particles, see, for example, Section II.D. Particularly useful protein substrates are serum albumins, keyhole limpet hemocyrin, immunoglobulin molecules, thyroglobulin, egg albumin, tetanus toxoid, and other proteins well known to those skilled in the art.
Die Immunogenizität der Epitope von HCV kann auch durch die Herstellung derselben in Säugetier- oder Hefesystemen, die mit Partikel bildenden Proteinen fusionieren und assemblieren, wie zum Beispiel das mit Hepatitis-B-Oberflächenantigen assoziierte, verstärkt werden. Die Konstrukte, in denen das NANBV-Epitop direkt an Partikel bildende Protein codierende Sequenzen gebunden ist, erzeugen Hybride, die bezüglich des HCV-Epitops immunisierend sind. Außerdem enthalten alle der hergestellten Vektoren gegenüber HBV spezifische Epitope mit verschiedenen Immunogenizitätsgraden wie zum Beispiel das pre-S-Peptid. Somit sind aus Partikel bildendem Protein konstruierte Partikel, die HCV-Sequenzen einschließen, bezüglich dem HCV und HBV immunisierend. Das Hepatitisoberflächonantigen (HBSAg) wurde in S. cerevlslae(Valenzuela u.a. (1982]) wie zum Beispiel auch in Säugetierzelten (Valenzuela, P. u.a. (1984)) vorhandenen Partikeln gebildet und assemblies. Die Bildung derartiger Partikel ergab, daß die Immunogenizität der Monomeruntereinheit verstärkt wird. Die Konstrukte können auch das immunodominante Fpitop von HBSAg enthalten, die 55 Aminosäuren der presurface (pre-S)-Region umfassen, Neurath u.a. (1985). Konstrukte der pre-S-HBSAg-Partikel, die in Hefe oxprimierbar sind, werden in der EPO 174444, veröffentlicht am 19.März 1986, offenbart; Hybride einschließlich heterologer viraler Sequenzen für die Hefeexpression werden in der EPO 175261, veröffentlicht am 26. März 1966, offenbart. Beide Anmeldungen werden hierin an den genannten Zessionär abgetreten und sind hierin durch Bezugnahme darauf eingeschlossen. Diese Konstrukte können auch in Säugetierzellen, wie in China-Hamster-Ovarium(CHO)-L'ellen, unter Verwendung eines SV40-Dihydrofolat-Reduktasevektors (Michelle u.a. [1984)) exprimiert werden.The immunogenicity of the epitopes of HCV may also be enhanced by producing them in mammalian or yeast systems that fuse and assemble with particle-forming proteins, such as those associated with hepatitis B surface antigen. The constructs in which the NANBV epitope is directly linked to particle-forming protein coding sequences produce hybrids that are immunogenic with respect to the HCV epitope. In addition, all of the vectors produced contain HBV specific epitopes with different degrees of immunogenicity, such as the pre-S peptide. Thus particles constructed from particle-forming protein which include HCV sequences are immunogenic with respect to HCV and HBV. The hepatitis surface antigen (HBSAg) was formed and assembled in S. cerevlslae (Valenzuela et al., 1982), as well as in mammalian tents (Valenzuela, P. et al., 1984) The formation of such particles revealed that the immunogenicity of the monomer subunit The constructs may also contain the immunodominant epitope of HBSAg comprising 55 amino acids of the presurface (pre-S) region, Neurath et al., (1985). Constructs of the pre-S-HBSAg particles that are capable of being expressed in yeast. are disclosed in EPO 174444, published March 19, 1986. Hybrids including heterologous viral sequences for yeast expression are disclosed in EPO 175261, published March 26, 1966. Both applications are hereby assigned to and are incorporated herein by reference These constructs may also be used in mammalian cells, such as Chinese hamster ovary (CHO) cells, using a s SV40 dihydrofolate reductase vector (Michelle et al. [1984]).
Außerdem können Teile der Partikel bildenden Protein codierenden Sequenz durch ein HCV-Editop codierende Codone ausgetauscht werden. Bei diesem Austausch können Regionen, die bei der Vermittlung der Aggregation der Einheiten nicht erforderlich sind, um immunisierende Partikel in Hefe odor Säugetieren zu bilden, getilgt werden, so daß auf diese Weise zusätzliche mit dem HCV-Epltop konkurrierende HBV-antigenische Stellen eliminiert werden.In addition, portions of the particle-forming protein coding sequence may be exchanged for codons encoding HCV editop. In this replacement, regions that are not required to mediate aggregation of the moieties to form immunizing particles in yeast or mammals can be eradicated, thus eliminating additional HBV antigenic sites competing with the HCV epitope.
Vakzine können aus einem oder mehreren immunisierenden Polypeptiden hergestellt werden, die aus einer HCV-cDNA wie auch aus den in den Figuren 1 bis 32 dargestellten cDNA-Sequenzen oder aus dem HCV-Genom, dem sie entsprechen, gewonnen werden. Die zwischen HCV und Flaviviren beobachtete Homologie liefert die Polypeptide betreffende Information, welche als Vakzine höchstwahrscheinlich am effektivsten sind wie auch hinsichtlich der Regionen des Genoms, in die sie codiert sind. Die allgemeine Struktur des Flavivirusgenoms wird bei Rice u.a. (1986) diskutiert. Es wird angenommen, daß die Flavivirusgenomische RNA die einzige Virus-spezifische mRNA-Spezies ist und sie wird in drei virale Strukturproteine translated, d. h. C, M und E wie auch in zwei große nichtstrukturelle Proteine, NV4 und NV5, und in eine Komplexgruppe kleinerer nir.htstruktureller Proteine. Es ist bekannt, daß sich die Hauptneutralisierungsepitope für Flaviviren im E-(Hüll)-Protein befinden (Roehring (1986]). Die das entsprechende HCV-E-Gen und Polypeptid codierende Region kann aufgrund der Homologie zum Flavivirus vorausgesagt werden. Somit können rekombinante Polypeptide umfassende Vakzine Epitope von HCV-E enthalten. Diese Polypeptide können in Bakterien-, Hefe- oder Säugetierzellen exprimiert werden, oder können wah'weise aus viralen Präparationen isoliert werden. Es wird auch angenommen, daß die anderen strukturellen Proteine ebenfalls Epitope enthalten, die schützende Anti-HCV-Antikörper bewirken. Folglich können auch in HCV-Vakzinen Polypeptide verwendet werden, die entweder einzeln oder in Kombination der Epitope E, C und M enthalten.Vaccines may be prepared from one or more immunogenic polypeptides derived from an HCV cDNA as well as from the cDNA sequences shown in Figures 1 to 32 or from the HCV genome to which they correspond. The homology observed between HCV and flaviviruses provides information concerning the polypeptides which are most likely to be most effective as vaccines as well as the regions of the genome in which they are encoded. The general structure of the flavivirus genome is described in Rice et al. (1986). It is believed that the flavivirus genomic RNA is the only virus-specific mRNA species and is translated into three viral structural proteins, i. H. C, M, and E as well as two large non-structural proteins, NV4 and NV5, and a complex group of minor non-structural proteins. It is known that the major neutralization epitopes for flaviviruses are in the E (envelope) protein (Roehring (1986).) The region encoding the corresponding HCV E gene and polypeptide can be predicted from homology to the flavivirus These polypeptides may be expressed in bacterial, yeast or mammalian cells, or may be isolated in isolation from viral preparations. It is also believed that the other structural proteins also contain epitopes Thus, HCV vaccines may also utilize polypeptides that contain E, C, and M, either individually or in combination of the epitopes.
Zusätzlich zu dem obigen ν · >rde nachgewiesen, daß die Immunisierung mit NS1 (nichtstrukturellen Protein 1) in Schutz gegen Gelbfieber resultiert (Schlesinger u.a. (1986]). Dieses ist wahr, wenn auch die Immunisierung nicht die Entstehung von neutralisierenden Antikörpern bewirkte. Somit ist wahrscheinlich, besonders da dieses Protein unter den Flaviviren äußerst konserviert zu sein scheint, dpß HCV-NS1 ebenfalls gegen HCV-lnfektion schützt. Darüber hinaus ist auch bekannt, daß nichtstrukturelle Proteine Schutz gegen virale Pathogenität bewirken, auch wenn sie nicht die Erzeugung von neutralisierenden Antikörpern verursachen.In addition to the above, it has been shown that immunization with NS1 (non-structural protein 1) results in protection against yellow fever (Schlesinger et al., 1986) .This is true, although immunization did not cause the formation of neutralizing antibodies is likely, especially since this protein appears to be highly conserved among the flaviviruses, which also protects HCV-NS1 against HCV infection In addition, it is also known that non-structural proteins provide protection against viral pathogenicity, even if they do not inhibit the production of neutralizing Cause antibodies.
Angesichts der obigen Ausführungen können multi valente Vakzine gegen HCV eine oder mehrere strukturelle Proteine, und/oder ein oder mehrere nichtstrukturelle Proteine einschließen. Diese Vakzine können zum Beispiel rekombinante HCV-Polypeptide und/oder aus Virionen isolierte Polypeptide enthalten. Außerdem ist es möglich, inaktiviertes HCV in Vakzinen zu verwenden; die Inaktivierung kann durch die Herstellung von Viruslysaten oder durch andere den Fachleuten bekannte Mittel erfolgen, die die Inaktivierung der Flaviviren bewirken, zum Beispiel durch die Behandlung mit organischen Lösungsmitteln oder Detergenzien, oder durch die Behandlung mit Formalin. Daneben können Vakzine auch aus abgeschwächten HCV-Stämmen hergestellt werden. Die Herstellung der abgeschwächten HCV-Stämme wird später beschrieben.In view of the above, multi-valent vaccines against HCV may include one or more structural proteins, and / or one or more non-structural proteins. These vaccines may contain, for example, recombinant HCV polypeptides and / or polypeptides isolated from virions. In addition, it is possible to use inactivated HCV in vaccines; inactivation may be by the production of viral lysates or by other means known to those skilled in the art which will cause the inactivation of the flaviviruses, for example by treatment with organic solvents or detergents, or by treatment with formalin. In addition, vaccines can also be produced from attenuated HCV strains. The production of the attenuated HCV strains will be described later.
Es ist bekannt, daß einige der in Flaviviren vorhandenen Proteino äußerst konservierte Regionen enthalten, so daß einige immunologische Quer-Rsaktivität zwischen HCV und anderen Flaviviren angenommen werden muß. Es ist möglich, daß zwischen den Flaviviren und HCV geteilte Epitope schützende Antikörper gegen eine oder mehrere Erkrankungen, die durch diese pathogenen Agenzien hervorgerufen wurden, bewirken. Daher könnte es möglich sein, Mehrzwerkvakzine auf der Grundlage dieses Wissens zu entwickeln.It is known that some of the proteins present in flaviviruses contain highly conserved regions, so that some immunological cross-Rsactivity must be assumed between HCV and other flaviviruses. It is possible that epitopes shared between the flaviviruses and HCV produce protective antibodies against one or more diseases caused by these pathogenic agents. Therefore, it may be possible to develop multivariate vaccines based on this knowledge.
Die Herstellung von Vakzinen, c'it ein immunisierendes Polypeptid(e) als wirksamen Bestandteil enthalten, ist den Fachleuten bekannt. Typisch ist die Herstellung derartiger Vakzine als injizierbare Stoffe, entweder als flüssige Lösungen oder Suspensionen; feste Formen, die für die Lösung oder Suspension in einer Flüssigkeit vor der Injektion geeignet sind, können ebenfalls hergestellt werden. Das Präparat kann auch emulgiert werden, oder das Protein kann in Liposome eingekapselt werden. Die immunisierenden Wirkstoffe werden oftmals mit pharmazeutisch annehmbaren und mit dem Wirkstoff verträglichen Trägersubstanzen gemischt. Geeignete Trägersubstanzen sind zum Beispiel Wasser, physiologische Kochsalzlösung, Dextrose, Glycerol, Ethanol usw. und Kombinationen davon. Falls gewünscht, können die Vakzine kleine Mengen von Hilfssubstanzen wie Benetzungs- oder Emulgiermittel, pH-Puffermittel und/oder Adjuvanzien enthalten, die die Wirksamkeit der Vakzine verstärken. Beispielsweise für wirksame Adj jvanzien schließen ein, sind jedoch darauf nicht beschränkt: Aluminiumhydroxid, N-Acetylmuramyl-L-threonyl-D-isoglutamin (thr-MPD), N-Acetyl-nor-muramyl-L-alanyl-D-isoglutamin(CGP 11637, bezeichnet als nor-MDP), N-Acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanin^-d'^'-dipalmitoyl-sn-' glycero-3-hydroxyphosphoryloxy)ethyl-amin (CGP 19835A, bezeichnet als MTP-PE) und RIBI, das drei aus Bakterien extrahierte Bestandteile enthält, Monophosphoryllipid A.TrehalosedimycclatundZellwandskeletonfMPL + TDM + CWS)in2%Squalene/ Tween-80-Emulsion. Die Wirksamkeit eines Adjuvans kann durch Messen der Antikörpermenge ermittelt werden, die gegen ein immunisierendes Polypeptid gerichtet ist, das eine HCV-antigene Sequenz enthält, die sich aus der Verabreichung dieses Polypeptids in Vakzine.-! ergibt, die ebenfalls aus verschiedenen Adjuvanzien bestehen:The preparation of vaccines containing an immunizing polypeptide (s) as an active ingredient is known to those skilled in the art. Typical is the production of such vaccines as injectables, either as liquid solutions or suspensions; Solid forms suitable for solution or suspension in a liquid prior to injection may also be prepared. The preparation may also be emulsified, or the protein may be encapsulated in liposomes. The immunizing agents are often mixed with pharmaceutically acceptable and drug-compatible excipients. Suitable carriers include, for example, water, physiological saline, dextrose, glycerol, ethanol, etc., and combinations thereof. If desired, the vaccines may contain small amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and / or adjuvants that enhance the effectiveness of the vaccine. For example, effective adjuvants include, but are not limited to, aluminum hydroxide, N-acetylmuramyl-L-threonyl-D-isoglutamine (thr-MPD), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine ^ -d'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) ethyl-amine (CGP 19835A, designated as MTP-PE) and RIBI containing three components extracted from bacteria, monophosphoryl lipid A.Trehalosedimycclat and cell wall skeleton fMPL + TDM + CWS) in 2% squalene / Tween-80 emulsion. The efficacy of an adjuvant can be determined by measuring the amount of antibody directed against an immunizing polypeptide containing an HCV antigenic sequence resulting from the administration of this polypeptide to vaccine. results, which also consist of different adjuvants:
Die Vakzine werden üblicherweise parenteral, durch Injektion zum Beispiel subkutan oder intramuskulär verabreicht. Weitere Rezepturen, die für andere Verabreichungsformen geeignet sind, schließen Suppositorien und in einigen Fällen orale Rezepturen ein. Suppositorien können traditionelle Binde· und Trägermittel, zum Beispiel Polyalkylenglycole oder Triglyceride umfassen; derartige Suppositorien können aus Gemischen gebildet werden, die einen Wirkstoffanteil im Bereich von 0,5% bis 10%, vorzugsweise von 1 % bis 2%, enthalten. Orale Rezepturen schließen solche normalerweise angewandten Trägersubstanzen ein wie zum Beispiel pharmazeutische Qualitäten von Mannitol, Lactose, Stärke, Magnesiumstearat, Natriumsaccharin, Cellulose, Magnesiumcarbonat und dergleichen. Diese Zusammensetzungen können die Form von Lösungen, Suspensionen, Tabletten, Pillen, Kapseln, langzeitwirkenden Rezepturen oder Pulvern aufweisen und 10% bis 95%des Wirkstoffes, vorzugsweise 25% bis 70%, enthalten.The vaccines are usually administered parenterally, by injection, for example, subcutaneously or intramuscularly. Other formulations suitable for other forms of administration include suppositories and, in some cases, oral formulations. Suppositories may include traditional binders and carriers, for example, polyalkylene glycols or triglycerides; Such suppositories may be formed from mixtures containing an active ingredient content in the range of 0.5% to 10%, preferably 1% to 2%. Oral formulations include such normally used excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like. These compositions may take the form of solutions, suspensions, tablets, pills, capsules, long-acting formulations or powders and contain from 10% to 95% of the active ingredient, preferably from 25% to 70%.
Die Proteine können in neutraler oder salziger Form in die Vakzine formuliert werden. Phs rmazeutisch annehmbare Salze umfassen Säureadditionssalze (die mit freien Aminogruppen des Peptids gebildet werden) und die mit anorganischen Säuren, zum Beispiel Chlorwasserstoff- oder Phosphorsäuren, oder solchen organischen Säuren wie Essig-, Oxal-, Tartar-, Maleinsäure usw., gebildet werden. Die mit den freien Carboxylgruppen gebildeten Salze können auch von anorganischen Basen, zum Beispiel Natrium-, Kalium-, Ammonium-, Calcium- oder EisendlD-hydroxiden, oder solchen organischen Basen wie Isopropylamin, Triethylamin, 2-Ethylaminoethanol, Histidin, Procain und dergleichen abgeleitet werden.The proteins can be formulated into the vaccine in neutral or saline form. Pharmaceutically acceptable salts include acid addition salts (formed with free amino groups of the peptide) formed with inorganic acids, for example hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, maleic acid, etc. The salts formed with the free carboxyl groups may also be derived from inorganic bases, for example, sodium, potassium, ammonium, calcium or ferric D-hydroxides, or such organic bases as isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine and the like become.
II.F. Dosierung und Verabreichung von VakzinenII.F. Dosage and administration of vaccines
Die Vakzine werden in einer mit der Dosierungsformulierung kompatiblen Weise verabreicht und in einer solchen Menge, die prophylaktisch und/oder therapeutisch wirksam ist. Die zu verabreichende Menge liegt im allgemeinen im Bereich von 5 Mikrogramm bis 250 Mikrogramm Antigen pro Dosis und hängt von der zu behandelnden Person ab, der Fähigkeit des Immunsystems zur Person, Antikörper zu synthetisieren und dem gewünschten Schutzgrad ab. Genaue Mengen des erforderlichen Wirkstoffes, der verabreicht werden soll, hängen von der Beurteilung des Arztes ab und können für jede Person unterschiedlich sein.The vaccines are administered in a manner compatible with the dosage formulation and in an amount which is prophylactically and / or therapeutically effective. The amount to be administered will generally range from 5 micrograms to 250 micrograms of antigen per dose and will depend on the subject being treated, the ability of the immune system to person to synthesize antibodies, and the degree of protection desired. Exact amounts of the required drug to be administered will depend on the judgment of the physician and may be different for each individual.
Das Vakzin kann als Einzeldosis oder vorzugsweise als mehrfache Dosis verabreicht werden. Eine Mehrfachdosisverordnung bedeutet, daß ein Hauptvakzinationsverlauf aus 1 bis 10 einzelnen Dosen bestehen kann, an die sich andere Dosen anschließen, die wehrend nachfolgender Zeitintervalle, die erforderlich sind, um die Immunitätsreaktion aufrechtzuerhalten oder wieder zu verstärken, zum Beispiel in 1 bis 4 Monat(en) eine zweite Dosis und falls erforderlich, nach mehreren Monaten eine weitere Dosis oder mehrere Dosen, verabreicht werden. Das Dosierungsschema wird auch, d. h. mindestens teilweise, anhand des Bedarfs des Individuums ermittelt und hängt von der Einschätzung des Artzes ab.The vaccine may be administered as a single dose or, preferably, as a multiple dose. A multi-dose regimen means that a main course of vaccination may consist of 1 to 10 individual doses followed by other doses required for subsequent intervals of time required to maintain or re-boost the immune response, for example, in 1 to 4 months (s ) a second dose and, if necessary, after several months another dose or multiple doses. The dosage regimen will also, i. H. at least in part, based on the needs of the individual and depends on the assessment of the physician.
Darüber hinaue kann das immunisierende HCV-Antigen(e) enthaltende Vakzin in Verbindung mit anderen immunoregulierenden Mitteln, zum Beispiel Immunoylobulinen, verabreicht werden.In addition, the vaccine containing the immunizing HCV antigen (s) may be administered in conjunction with other immunoregulatory agents, for example immuno-globulins.
II.G. Herstellung von Antikörpern gegen HCV-EpitopeII.G. Production of Antibodies to HCV Epitopes
Die wie zuvor geschildert hergestellten immunisierenden Polypeptide werden zur Erzeugung von Antikörpern, und zwar sowohl von polyclonalen als auch von monoclonalen, verwendet. Wenn polyclonale Antikörper gewünscht werden, wird ein ausgewähltes Säugetier (zum Beispiel eine Maus, Ziege, ein Kaninchen, Pferd usw.) mit einem Immunität erzeugenden Polypeptid, das ein oder mehrere HCV-b'pitop(e) trägt, immunisiert. Das Serum des immunisierten Tieres wird gesammelt und entsprechend den bekannten Prozeduren behandelt. Wenn das polyclonale Antikörper gegenüber HCV-Epitop enthaltene Serum Antikörper gegen andere Antigene enthält, können die polyclonalen Antikörper durch Immunoaffinitätschromatographie gereinigt werden. Techniken für die Erzeugung und Verarbeitung polyclonaler Antiseren sind im Fachgebiet bekannt, sieh"? zum Beispiel Mayer und Walker (1987).The immunogenic polypeptides prepared as described above are used to produce antibodies, both polyclonal and monoclonal. When polyclonal antibodies are desired, a selected mammal (for example, a mouse, goat, rabbit, horse, etc.) is immunized with an immunity-producing polypeptide carrying one or more HCV b'pitope (s). The serum of the immunized animal is collected and treated according to known procedures. When the polyclonal antibody to HCV epitope-containing serum contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for the generation and processing of polyclonal antisera are known in the art, see, for example, Mayer and Walker (1987).
Im anderen Falle können polyclonale Antikörper von einem Säugetier isoliert werden, das sich zuvor mit HCV infiziert hatte. Ein Beispiel für ein Reinigungsverfahren von Antikörpern gegen HCV-Epitope aus Serum von einem infizierten Individuum, das auf Affinitätschromatographie und unter Nutzung eines Fusionspolypeptids von SOD und eines innerhalb cDNA-Clon 5-1-1 codierten Polypeptide basiert, wird in Abschnitt V.E. dargestellt.Alternatively, polyclonal antibodies can be isolated from a mammal that has previously been infected with HCV. An example of a method of purifying antibodies to HCV epitopes from serum from an infected individual based on affinity chromatography using a fusion polypeptide of SOD and a polypeptide encoded within cDNA clone 5-1-1 is described in Section V.E. shown.
Monoclonale Antikörper, die gegen HCV-Epitope gerichtet sind, können durch einen Fachmann ebenfalls leicht hergestellt werden. Die generelle Verfahrensweise für die Herstellung monoclonaler Antikörper durch Hybridomas ist allgemein bekannt.Monoclonal antibodies directed against HCV epitopes can also be readily prepared by one skilled in the art. The general procedure for the production of monoclonal antibodies by hybridomas is well known.
Immortale Antikörper produzierende Zellinien können durch Zellfusion und auch durch andere Techniken, wie direkte Transformation von B-Lymphocyten mit geschwulstbildender DNA oder Transfektion mit dem Epstein-Barr-Virus, erzeugt werden. Siehe zum Beispiel M.Schreier u.a., (1980); Hammerling u.a. (1981); Kennott u.a., (1980); siehe auch US-Patent-Nr. 4,341,761; 4,399,121; 4,427,738; 4,444,887; 4,466,917; 4,472,500; 4,491,632 und 4,493,890. Gegen HCV-Epitode hergestellte monoclonale Antikörper können hinsichtlich ihrer unterschiedlichen Eigenschaften, d. h. Isotyps, Epitopaffinität usw. anhand von Listen gescreent warden.Immortal antibody-producing cell lines can be generated by cell fusion and also by other techniques, such as direct transformation of B lymphocytes with engrafting DNA or transfection with Epstein-Barr virus. See, for example, M. Schreier et al., (1980); Hammerling and others. (1981); Kennott et al., (1980); see also US patent no. 4,341,761; 4,399,121; 4,427,738; 4,444,887; 4,466,917; 4,472,500; 4,491,632 and 4,493,890. Monoclonal antibodies produced against HCV epitode can be analyzed for their different properties, i. H. Isotypes, epitope affinity, etc. are screened by means of lists.
Antikörper, sowohl monoclonale als auch polyclonale, die gegen HCV-Epitope gerichtet sind, sind besonders nützlich bei der Diagnose, und jene, die neutralisierend wirken, sind bei der passiven Immunotherapie nützlich. Monoclonale Antikörper können speziell dazu verwendet werden, Anti-Idiotypus-Antikörper zu entwickeln.Antibodies, both monoclonal and polyclonal, directed against HCV epitopes are particularly useful in diagnosis, and those that have a neutralizing effect are useful in passive immunotherapy. Monoclonal antibodies can be used specifically to develop anti-idiotypic antibodies.
Anti-Idiotypus-Antikörper sind Immunoglobuline, die ein „inneres Ebenbild" des Antigens des infektiösen Agens, gegen das der Schutz gewünscht wird, tragen. Siehe zum Beispiel Nisonoff, A., u.a. (1981) und Dreesman u. a. (1985).Anti-idiotypic antibodies are immunoglobulins which carry an "inner" image of the antigen of the infectious agent against which protection is desired See, for example, Nisonoff, A., et al., (1981) and Dreesman et al., (1985).
Techniken für die Züchtung von Anti-Idiotypus-Antikörpern sind im Fachgebiet allgemein bekannt. Siehe zum Beispiel Grzych (1985), MacNamara u.a. (1984) und Uytdehaag u.a. (1985). Diese Anti-Idiotypus-Antikörper können auch für die Behandlung von NANBH wie auch für eine Aufhellung der immunisierenden Regionen des HCV-Antigens nützlich sein.Techniques for the production of anti-idiotypic antibodies are well known in the art. See, for example, Grzych (1985), MacNamara et al. (1984) and Uytdehaag et al. (1985). These anti-idiotypic antibodies may also be useful for the treatment of NANBH as well as for the lightening of the immunizing regions of the HCV antigen.
H.H. Diagnostische Ollgonucleotldsonden und -kitsH. H. Diagnostic oligonucleotide probes and kits
Unter Verwendung der offenbarten Teile der isolierten HCV-cDNAs als Grundlage, einschließlich jener in den Figuren 1 bis 32, können Oligomero von ungefähr 8 Nucleotiden oder mehr, entweder durch Exzision oder synthetisch, hergestellt werden, die ' mit dem HCV-Genom hybridisieren und bei der Identifikation des Virusagens bzw. der Virusagenzien, sowie bei der Charakterisierung der Virusgenome wie auch beim Nachweis der Viren in erkrankten Menschen nützlich ist. Die Sonden für HCV-Polynucleotide (natürliche oder abgeleitete) sind von einer Länge, die den Nachweis von einzigartigen Virussequenzen durch Hybridisierung gestatten. Während 6 bis 8 Nucleotide eine bearbeitungsfähige Länge darstellen, werden Sequenzen von 10 bis 12 Nucleotiden bevorzugt, und etwa 20 Nucleotide erscheinen eine optimale Länge zu sein. Diese Sequenzen werden vorzugsweise aus Regionen abgeleitet, denen es an Heterogenität mangelt. Diese Sonden können unter Verwendung von Routinemethoden, einschließlich automatisierter Oligonucleotidsyntheseverfahren hergestellt werden. Unter den nützlichen Sonden sind zum Beispiel der Clon 5-1-1 und die hierin offenbarten zusätzlichen Clone wie auch die verschiedenen Oligomere, die bei der Sondierung derUsing the disclosed portions of the isolated HCV cDNAs as a base, including those in Figures 1 through 32, oligomers of approximately 8 nucleotides or more, either excisional or synthetic, can be prepared which hybridize to and hybridize with the HCV genome the identification of the virus agent or viral agents, as well as in the characterization of viral genomes as well as the detection of viruses in diseased people is useful. The probes for HCV polynucleotides (natural or derived) are of a length that allow the detection of unique viral sequences by hybridization. While 6 to 8 nucleotides represent a workable length, sequences of 10 to 12 nucleotides are preferred, and about 20 nucleotides appear to be of optimal length. These sequences are preferably derived from regions that lack heterogeneity. These probes can be made using routine methods, including automated oligonucleotide synthesis methods. Among the useful probes are, for example, clone 5-1-1 and the additional clones disclosed herein, as well as the various oligomers used in probing
cDNA-Bibliotheken, die im weiteren Text bekanntgegeben werden, nützlich sind. Ein Kompliment zu irgendeinem einzigartigen Teil des HCV-Genoms wird ausreichend sein. Für die Verwendung als Sondr. η ist die vollständige Komplementärität wünschenswert, obgleich dieses unnötig sein kann, da sich die Länge des Fragmentes vergrößert. Für die Verwendung derartiger Sonden als Diagnosemittel wird die zu analysierende biologische Probe wie Blut oder Serum, falls gewünscht, behandelt, um die darin enthaltenden Nucleinsäuren zu extrahieren. Die aus der Probe resultierende Nucleinsäure kann der Gelelektrophorese oder anderen Größentrennungsverfahren unterzogen werden; irn anderen Falle können die Nucleinsäureproben ohne Größentrennung punktförmig aufgebracht werden. Anschließend werden die Proben markiert. Geeignete Marki »rungen und Methoden für die Markierung der Proben sind im Fachgebiet bekannt und schließen zum Beispiel durch nick-Transl.ition oder Kinase, Biotin, fluoreszierende Sonden und chemilumineszente Sonden eingefügte radioaktive Markierungen bin. Die aus der Probe extrahierten Nucleinsäuren werden dann mit der markierten Sonde unter Hybridisierungsbedingungen, die geeigneten Kontrollen unterworfen sind, behandelt.cDNA libraries, which will be further discussed, are useful. A compliment to any unique part of the HCV genome will be enough. For use as Sondr. η, full complementarity is desirable, although this may be unnecessary as the length of the fragment increases. For use of such probes as diagnostic agents, the biological sample to be analyzed, such as blood or serum, is treated, if desired, to extract the nucleic acids contained therein. The nucleic acid resulting from the sample may be subjected to gel electrophoresis or other size separation methods; otherwise, the nucleic acid samples may be spotted without size separation. Subsequently, the samples are marked. Suitable labels and methods for labeling the samples are known in the art and include, for example, nick-translational or kinase, biotin, fluorescent probes, and chemiluminescent probes inserted radioactive tags. The nucleic acids extracted from the sample are then treated with the labeled probe under hybridization conditions subjected to appropriate controls.
Die Sonden können zu dem HCV-Genom vollständig komplementär gemacht werden. Daher sind gewöhnlich sehr strenge Kontrollbedingungen wünschenswert, um falsch-positive Resultate zu verhindern. Die strengen Kontrollbedingungen sollten jedoch nur angewendet werden, wenn die Sonden zu Regionen des Virusgenoms mit mangelnder Heterogenität komplementär sind.The probes can be made completely complementary to the HCV genome. Therefore, usually very strict control conditions are desirable to prevent false-positive results. However, the stringent control conditions should only be used if the probes are complementary to regions of the viral genome lacking heterogeneity.
Die stringenter Kontrolle unterworfene Hybridisierung wird durch eine Anzahl Faktoren während der Hybridisierung und während des Waschverfahrens bestimmt, einschließlich der Temperatur, lonenstärke, Zeitdauer und Formamidkonzentration. Diese Faktoren werden zum Beispiel von Maniatis, T. (1982) umrissen.The stringent control of hybridization is determined by a number of factors during hybridization and during the washing process, including temperature, ionic strength, time duration, and formamide concentration. These factors are outlined, for example, by Maniatis, T. (1982).
Im allgemeinen wird davon ausgegangen, daß die HCV-Genomsequenzen im Serum von infizierten Individuen in relativ niedrigen Anteilen, d.h. von ungefähr 102 bis 103 Sequenzen pro ml vorhanden sind. Diese Größenordnung kann es erforderlich machen, daß bei den Hybridisierungsassays Verstärkungstechniken angewendet werden. Derartige Techniken sind im Fachgebiet bekannt. Das von der Enzo Biochemical Corporation zur Verfügung gestellte „Bio-Bridge"-System verwendet zum Beispiel terminate Desoxynucleotidtransferase, um an eine DNA-Sonde nichtmodifizierte 3'-poly-dT-Schwänze anzufügen. Die poly-dT-tailed Sonde wird zur Targetnucleotidoequenz hybridisiert und anschließend zu einem Biotin modifizierten poly-A. Die PCT-Anmeldung 84/03520 und EPA 124221 beschreiben ein DNA-Hybridisierungsassay, indem: (i)Analyt zu einer einzelsträngigen DNA-Sonde hybridisiert wird, die zu einem Enzym-markierten Oligonucleotid komplementär ist; und (2) das resultierende ,tailed" Duplex wird zu einem Enzym-markierten Oligonucleotid hybridisiert. Die EPA 204510 beschreibt einen DNA-Hybridisierungsassay, bei dem Analyt-DNA mit einer Sonde in Berührung gebracht wird, die einen Schwanz hat, wie einen poly-dT-Schwanz, einen Verstärkerstrang, der eine Sequenz hat, die an den Schwanz der Sonde, wie eine poly-A-Sequenz, hybridisiert und in der Lage ist, eine Vielzahl markierter Stränge zu binden. Eine besonders wünschenswerte Technik kann zuerst die Amplifizierung der Target-HCV-Sequenzen in Seren auf ungefähr das lOOOOfache beinhalten, d. h. auf ungefähr 10e Sequenzen/ml. Dieses kann zum Beispiel durch die Technik vons Saiki u. a. (1986) erreicht werden. Die amplifizierte(n) Sequenz(en) kann bzw. können dann unter Nutzung eines Hybridisierungsassays, der in der gleichfalls anhängigen US-Anmeldung, Anwalt Docket-Nr.2300-0171, die am 15.Oktober 1987 eingereicht und an den darin genannten Zessionär abgetreten wurde und hiermit unter Bezugnahme darauf eingeschlossen ist, nachgewiesen werden. Dieser Hybridisierungsassay, der Sequenzen in einer Höhe von 106/ml nachweisen soll, nutzt Nucle!nsäuremultimere, die sich an die einzelsträngige Analyt-Nucleinsäure und ebenfalls an eine Vielzahl einzelsträngiger markierter Oligonucleotide binden. Ein geeigneter Lösungsphase-Sandwich-Assay, bei dem markierte Pclynucleotidsondon vorwendet v.erden können, und die Methoden für die Herstellung von Sonden werden in der EPO 225307(7), veröffentlicht am 16. Juni 1987, Anmeldeaktenzeichen· Nr.807,624 beschrieben, die an den hierin genannten Zessionär abgetreten und hiermit unter Bezugnahme darauf eingeschlossen wird.In general, it is believed that the HCV genome sequences are present in the serum of infected individuals at relatively low levels, ie, from about 10 2 to 10 3 sequences per ml. This magnitude may require that amplification techniques be used in the hybridization assays. Such techniques are known in the art. For example, the "Bio-Bridge" system provided by Enzo Biochemical Corporation uses terminal deoxynucleotide transferase to add unmodified 3'-poly-dT tails to a DNA probe The poly-dT tailed probe is hybridized to the target nucleotide sequence and subsequently to a biotin-modified poly A. PCT Application 84/03520 and EPA 124221 describe a DNA hybridization assay by: (i) analyte hybridizing to a single-stranded DNA probe that is complementary to an enzyme-labeled oligonucleotide and (2) the resulting tailed duplex is hybridized to an enzyme-labeled oligonucleotide. EPA 204510 describes a DNA hybridization assay in which analyte DNA is contacted with a probe having a tail, such as a poly-dT tail, an amplifier strand having a sequence attached to the tail of the probe, like a poly A sequence, hybridizes and is capable of binding a variety of labeled strands. A particularly desirable technique may first involve amplification of the target HCV sequences in sera to approximately lOOOOfache, ie to approximately 10 ml sequences e /. This can be achieved, for example, by the technique of Saiki et al. (1986). The amplified sequence (s) may then be determined using a hybridization assay as described in co-pending U.S. Application, Attorney Docket No. 2300-0171 filed October 15, 1987 and assigned to the assignee hereof has been assigned and is hereby incorporated by reference. This hybridization assay, which should detect sequences at a level of 10 6 / ml, uses Nucle ! acid multimers that bind to the single-stranded analyte nucleic acid and also to a plurality of single-stranded labeled oligonucleotides. A suitable solution phase sandwich assay wherein labeled nucleotide London can be used and methods for preparing probes are described in EPO 225307 (7), published June 16, 1987, Application Serial No. 807,624, which is incorporated herein by reference assigned to the assignee herein and incorporated herein by reference.
Die Sonden können in Diagnose-Kits verpackt werden.The probes can be packaged in diagnostic kits.
Diagnose-Kits beinhalten die Sonden-DNA, die markiert sein kann; im anderem Fall kann die Sonden-DNA nicht markiert sein und die Zusatzstoffe für die Markierung können in dem Kit enthalten sein. Der Kit kann auch andere geeignete verpackte Reagenzien und Materialien enthalten, die für das spezielle Hybridisierungsprotokoll benötigt werden, wie zum Beispiel Standards und auch Vorschriften für die Durchführung des Tests.Diagnostic kits include the probe DNA, which may be labeled; otherwise, the probe DNA may not be labeled and the label additives may be included in the kit. The kit may also contain other suitable packaged reagents and materials needed for the particular hybridization protocol, such as standards and also requirements for performing the assay.
II.I. Immunobssay und Diagnose-KitsII.I. Immunoassay and diagnostic kits
Beide Polypeptide, die immunologisch mit HCV-Antikörper enthaltendem Serum reagieren, zum Beispiel jene, die von den Clonen abgeleitet oder in diesen codiert wurden und in Abschnitt IV.A. beschnei >n sind, sowie deren Zusammensetzungen (siehe Abschnitt IV.A.) und die Antikörper, die gegen die HCV-spezifischen Epitop ·, in diesen Polypeptiden entwickelt wurden, siehe zum Beispiel Abschnitt IV.E, sind bei Immunoassays zum Nachweis der Anwesenheit von HCV-Antikörpern, oder hinsichtlich der Anwesenheit des Virus und/oder viraler Antigene in biologischen Proben, einschließlich zum Beispiel Blut- oder Serumproben nützlich. Die Gestaltung der Immunoassays wird häufig verändert und eine Vielzahl davon ist im Fachgebiet bekannt. Der Immunoassay kann zum Beispiel ein Virusantigen nutzen, zum Beispiel ein Polypeptid, das von irgendeinem der HCV-cDNA enthaltenden Clone abgeleitet wurde, siehe Abschnitt IV.A., oder von den zusammengesetzten cDNAs, die von den cDNAs in diesen Clonen abgeleitet wurden, oder vom HCV-Genom, von dem die cDMA in diesen Clonen abgeleitet wurde; im anderen Falle kann der Immunoassay eine Kombination der aus diesen Quellen abgeleiteten Virusantigene verwenden. Es kann zum Beispiel verwendet werden: ein monoclonaler Antikörper, der gegen ein Virusepitop(e) gerichtet ist, eine Kombination von monoclonalen Antikörpern, die gegen ein Virusantigen gerichtet ist, monoclonal Antikörper, die gegen unterschiedliche Virusantigene gerichtet sind, polyclonale Antikörper, die gegen das gleiche Virusantigen gerichtet sind, oder polyclonale ' Antikörper, die gegen unterschiedliche Virusantigene gerichtet sind. Die Protokolle können zum Beispiel auf Konkurrenz-, oder auf direkten Reaktions- oder auf sandwichartigen Assays basieren. Die Protokolle können zum Beispiel auch feste Unterlagen verwenden, oder können durch Immunopräzipitation zustande kommen. Die meisten Assays beinhalten die Verwendung eines markierten Antikörpers oder Polypeptids; die Markierungen können zum Beispiel durch fluoreszierende, chemilumineszente, radioaktive oder Farbmoleküle erfolgen. Assays, di» die Signale aus der Sonde verstärken, sind ebenfalls bekannt; Beispiel dafür sind Assays, die Biotin und Avidin nutzen sowie Enzym markierte und indirekte Immunoassays wie die ELISA-Assays. Das Flavivirusmodell für HCV gestattet Voraussagen bezüglich der wahrscheinlichen Lokalisation von Diagnose-Epitopen für Virion-Strukturproteine. Die C-, pre-M-, M- und Ε-Domänen enthalten wahrscheinlich alle Epitope signifikanten Potentials für . Nachweis von Virusantigenen und besonders für Diagnosen. Desgleichen wird angenommen, daß die Domänen der nichtstrukturellen Proteine wichtige Diagnoseepitope (zum Beispiel NS5, das eine mutmaßliche Polymerase codiert; und NS1, dasein mutmaßliches Komplement bindendes Antigen codiert) enthalten. Rekombinante Polypeptide, oder virale Polypeptide, die Epitope eus diesen spezifischen Domänen einschließen, können für den Nachweis von Virusantikörpern in infizierten Blutspendern und infizierten Patienten nützlich sein.Both polypeptides that react immunologically with HCV antibody-containing serum, for example, those derived from or encoded by the clones and described in Section IV.A. and the compositions thereof (see Section IV.A.) and the antibodies raised against the HCV-specific epitope in these polypeptides, see, for example, Section IV.E, are detectable for presence in immunoassays of HCV antibodies, or the presence of the virus and / or viral antigens in biological samples, including, for example, blood or serum samples. The design of immunoassays is frequently altered and a variety of them are known in the art. The immunoassay may, for example, utilize a viral antigen, for example a polypeptide derived from any of the HCV cDNA-containing clones, see Section IV.A., or from the composite cDNAs derived from the cDNAs in these clones, or from the HCV genome from which the cDMA was derived in these clones; otherwise, the immunoassay may use a combination of viral antigens derived from these sources. For example, a monoclonal antibody directed against a virus epitope (s), a combination of monoclonal antibodies directed against a viral antigen, monoclonal antibodies directed against different viral antigens, polyclonal antibodies raised against the virus antigen are directed to the same viral antigen, or polyclonal 'antibodies directed against different viral antigens. For example, the protocols may be based on competitive, direct reaction or sandwich assays. For example, the protocols may also use solid support or may be by immunoprecipitation. Most assays involve the use of a labeled antibody or polypeptide; the labels can be made, for example, by fluorescent, chemiluminescent, radioactive or color molecules. Assays that amplify the signals from the probe are also known; Examples include assays that use biotin and avidin as well as enzyme-labeled and indirect immunoassays such as the ELISA assays. The flavivirus model for HCV allows predictions regarding the likely location of diagnostic epitopes for virion structural proteins. The C, pre-M, M, and Ε domains likely contain all epitopes of significant potential for. Detection of virus antigens and especially for diagnoses. Likewise, it is believed that the domains of the non-structural proteins contain important diagnostic epitopes (for example, NS5 encoding a putative polymerase and NS1 encoding a suspected complement-binding antigen). Recombinant polypeptides, or viral polypeptides, that include epitopes from these specific domains may be useful for the detection of virus antibodies in infected blood donors and infected patients.
Außerdem können die gegen B- und/oder M-Proteine gerichteten Antikörper bei Immunoassays für den Nachweis von Virusantigenen in Patienten mit HCV-verursachter NANBH und bei infizierten Blutspendern verwendet werden. Darüber hinaus können diese Antikörper besonders nützlich sein beim Aufspüren von Spendern und Patienten in der akuten Phase.In addition, antibodies directed against B and / or M proteins can be used in immunoassays for the detection of viral antigens in patients with HCV-induced NANBH and in infected blood donors. In addition, these antibodies may be particularly useful in detecting donors and patients in the acute phase.
Kits, die für die Immunodiagnose geeignet sind und die die entsprechenden markierten Reagenzien enthalten, werden durch Verpackung der zweckdienlichen Materialien, einschließlich der erfindungsgemäßen Polypeptide, die HCV-Epitope oder Antikörper, die gegen HCV-Epitope gerichtet sind, in geeigneten Containern enthalten, gemeinsam mit den verbleibenden Reagenzien und Stoffen, die für die Durchführung des Assays erforderlich sind, wie auch einem geeigneten Satz Assayvorschriften konstruiert.Kits suitable for immunodiagnosis and containing the corresponding labeled reagents are co-packaged with appropriate containers by packaging the appropriate materials, including the polypeptides of the invention, which have HCV epitopes or antibodies directed against HCV epitopes the remaining reagents and materials required to perform the assay, as well as a suitable set of assay protocols.
IU. Weitere Chsrakteilslerung des HCV-Genoms, der Virionen und Virusantigene unter Verwendung von aus der cDNA vom Virusgenom abgeleiteten SondenIU. Further fragmentation of the HCV genome, virions and viral antigens using probes derived from the viral genome cDNA
Die HCV-cDNA-Sequenzinformation in den Clonen, die in Abschnitt IV.A. beschrieben und in den Figuren 1 bis 32 dargestellt werden, richtet sich gegen HCV-Epitope, die bei der Diagnose und/oder Behandlung von f iCV-verursachter NANBH nützlich sein würden.The HCV cDNA sequence information in the clones described in Section IV.A. and described in Figures 1 to 32 are directed against HCV epitopes which would be useful in the diagnosis and / or treatment of fiCV-induced NANBH.
Die cDNA-Sequenzinformatic η in den zuvor erwähnten Clonen ist für das Design von Sonden für die Isolierung von zusätzlichen cDNA-Sequenzen nützlich, die von bis jetzt Undefinierten Regionen des HCV-Genoms bzw. der HCV-Genome abgeleitet werden, von denen die in Abschnitt IV.A. beschriebenen cDNAs in Clonen gewonnen wurden. Zum Beispiel können die markierten Sonden, die eine Sequenz von ungefähr 8 oder mehr Nucleotide und vorzugsweise 20 oder mehr Nucleotide enthalten, die aus Regionen in der Nähe der 5'-Termini oder 3'-Termini der Familie der HCV-cDNA-Sequenzen abgeleitet wurden und in den Figuren 1,3,6,9,14 und 32 gezeigt werden, zur Isolierung überlappender cDNA-Sequenzen aus HCV-cDNA-Bibliotheken verwendet werden. Diese Sequenzen, die die cDNAs in den zuvor erwähnten Clonen überlappen, die aber auch Sequenzen enthalten, die aus den Regionen des Genoms, aus dem die cDNAs in den zuvor erwähnten Clonen nicht abgeleitet werden, herrühren, können dann zum Synthetisieren von Sonden für die Identifikation der anderen überlappenden Fragmente, die nicht notwendigerweise die cDNAs in den in Abschnitt IV.A. beschriebenen Clonen überlappen, verwendet werden. Sofern dac HCV-Genom segmentiert wird und dio Segmente keine gemeinsamen Sequenzen aufweisen, ist es möglich, das gesamte bzw. die gesamten Virusgenom(e) unter Verwendung der Technik der Isolierung von überlappenden cDNAs, die von dem bzw. den Virusgenom(en) abgeleitet sind, zu sequenzieren. Obgleich es unwahrscheinlich ist, falls das Genom ein segmentiertes Genom ist, das keine gemeinsamen Sequenzen aufweist, kann die Sequenz des Genoms durch serologisches Screening der Lambdagt11-HCV-cDNA-Bibliotheken ermittelt werden, wie bei der Isolierung von Clon 5-1-1, durch Sequenzieren von cDNA-lsolaten und durch Verwendung der isolierten cDNAs zum Isolieren überlappender Fragmente, indem die für die Isolierung und Sequenzierung der Clone in Abschnitt IV.A. beschriebene Technik angewandt wurde. Im anderen Falle könnte die Charakterisierung der Genomsegmente aus dem aus den gereinigten HCV-Pfirtikeln isolierten Virusgenom(en) stammen. Verfahren für die Reinigung der HCV-Partikel und für den Nachweis derselben während des Reinigungsverfahrens werden hier weiter untenstehend beschrieben. Verfahren für die Isolierung der Polynucleotidgenome aus Viruspartikeln sind im Fachgebiet bekannt, und ein anwendbares Verfahren wird in Beispiel IV.A.1. dargestellt. Die isolierten Genomsegmente könnten anschließend doniert und sequenziert werden. Somit ist es mit der darin bereitgestellten Information möglich, das bzw. die gesamten HCV-Genom(e) ungeachtet seiner bzw. ihrer Natur zu clonen und zu sequenzieren.The cDNA sequence informatic η in the aforementioned clones is useful for the design of probes for the isolation of additional cDNA sequences derived from hitherto undefined regions of the HCV genome or genomes, of which those described in Section IV.A. described cDNAs were obtained in clones. For example, the labeled probes containing a sequence of about 8 or more nucleotides and preferably 20 or more nucleotides derived from regions near the 5 'termini or 3' termini of the family of HCV cDNA sequences and Figures 1,3,6,9,14 and 32 are used to isolate overlapping cDNA sequences from HCV cDNA libraries. These sequences, which overlap the cDNAs in the aforementioned clones but which also contain sequences derived from the regions of the genome from which the cDNAs are not derived in the aforementioned clones, can then be used to synthesize probes for identification the other overlapping fragments, which do not necessarily contain the cDNAs in Section IV.A. overlap described clones used. If the HCV genome is segmented and the segments do not share common sequences, it is possible to derive all or the entire viral genome (s) using the technique of isolating overlapping cDNAs derived from the virus genome (s) are to be sequenced. Although unlikely, if the genome is a segmented genome that does not share common sequences, the sequence of the genome can be determined by serological screening of the Lambdagt11 HCV cDNA libraries, as in the isolation of clone 5-1-1, by sequencing cDNA isolates and using the isolated cDNAs to isolate overlapping fragments, using the methods described for the isolation and sequencing of the clones in Section IV.A. described technique has been applied. In the other case, the characterization of the genome segments could be derived from the virus genome (s) isolated from the purified HCV pesticides. Methods for purifying the HCV particles and for detecting them during the purification process are described hereinbelow. Methods for the isolation of polynucleotide genomes from virus particles are known in the art, and an applicable method is described in Example IV.A.1. shown. The isolated genome segments could then be cloned and sequenced. Thus, with the information provided therein, it is possible to clone and sequence the entire HCV genome (s) regardless of its nature.
Methoden für die Konstruktion von cDNA-Bibliotheken sind im Fachgebiet bekannt und werden im vorstehenden wie auch weiter unten erörtert; eine Methode für die Konstruktion von HCV-cDNA-Bibliotheken in Lambda-gtl 1 wird in Abschnitt IV.A. im weiteren Text erörtert. Die für das Screening mit Nucleinsäuresonden nützlichen cDNA-Bibiiotheken können auch in anderen im Fachgebiet bekannten Vektoren konstruiert werden, zum Beispiel Lambda-gtiO (Huynh u.a. [1985]). Die HCV-abgeleitete cDNA, die durch aus den cDNAs in den Figuren 1 bis 32 abgeleitete Sonden nachgewiesen wurde und aus den aus diesen cDNAs abgeleiteten Polynucleotiden synthetisierten Sonden, kann aus dem Clon durch Digestion des isolierten Polynucleotide mit dem bzw. den geeigneten Restriktionsenzym(en) isoliert und sequenziert werden. Siehe zum Beispiel Abschnitt IV.A.3. und IV.A.4. bezüglich der für die Isolierung und Sequenzierung der HCV-cDNA, die die HCV-cDNA in Clon 5-1-1 überlappt, verwendeten Techniken; die Abschnitte IV.A.5. bis IV.A.7. bezüglich der Isolierung und Sequenzierung von HCV-cDNA, die die in Clon 81 überlappt, und Abschnitt IV.A.8. und IV.A.9. bezüglich der Isolierung und Sequenzierung eines Clons, der einen anderen Clon (Clon 36) überlappt, der Clon 81 überlappt.Methods for the construction of cDNA libraries are known in the art and are discussed above and below; a method for the construction of HCV cDNA libraries in lambda gt11 is discussed in Section IV.A. discussed further below. The cDNA libraries useful for screening with nucleic acid probes can also be constructed in other vectors known in the art, for example lambda gtiO (Huynh et al. [1985]). The HCV-derived cDNA detected by probes derived from the cDNAs in Figs. 1 to 32 and probes synthesized from the polynucleotides derived from these cDNAs can be prepared from the clone by digesting the isolated polynucleotide with the appropriate restriction enzyme (s) ) and sequenced. See, for example, Section IV.A.3. and IV.A.4. regarding the techniques used for the isolation and sequencing of the HCV cDNA overlapping the HCV cDNA in clone 5-1-1; Sections IV.A.5. to IV.A.7. for the isolation and sequencing of HCV cDNA overlapping those in clone 81 and Section IV.A.8. and IV.A.9. regarding the isolation and sequencing of a clone that overlaps another clone (clone 36) that overlaps clone 81.
Die aus diesen überlappenden HCV-cDNAs abgeleitete Sequenzinformation ist für die Bestimmung von Homologie und Heterogenitätsgebieten innerhalb des bzw. der Virusgenom(e) nützlich, die wiederum auf die Anwesenheit von unterschiedlichen Genomstämmen hinweisen könnten, und/oder auf Populationen von defekten Partikeln. Sie sind ebenfalls für das Design der Hybridisierungssonden nützlich, um HCV oder HCV-Antigene oder HCV-Nucleinsäuren in biologischen Proben festzustellen, und während der Isolierung von HCV (wird weiter unten erörtert) die in Abschnitt II.G. beschriebenen Techniken zu nutzen. Darüber hinaus können die überlappenden cDNAs verwendet werden, um Expressionsvektoren für aus dem bzw. den HCV-Genom(en) abgeleitete Polypeptide zu erzeugen, dio auch die in den Clonen 5-1-1,36,81,91 und 1-2 und in den anderen in Abschnitt IV.A. beschriebenen Clonen codierten Polypeptide codieren. Diese Techniken für die Erzeugung dieser HCV-Epitode enthaltenden Polypeptide und für Antikörper, die gegen die in ihnen enthaltenen HCV-Epitope gerichtet sind wie auch ihre Verwendungsmöglichkeiten werden analog zu jenen für Polypeptide beschrieben, die aus NANBV-cDNA-S«quenzen abgeleitet wurden und in den Clonen 5-1 -1 -, 32,35,36,1 -2,81 und 91 enthalten sind und im vorstehenden sowie im nachstehenden Text erörtert werden.The sequence information derived from these overlapping HCV cDNAs is useful for the determination of homology and heterogeneity regions within the virus genome (s), which in turn could indicate the presence of different genome strains, and / or populations of defective particles. They are also useful for the design of the hybridization probes to detect HCV or HCV antigens or HCV nucleic acids in biological samples, and during the isolation of HCV (discussed below) those described in Section II.G. to use the techniques described. In addition, the overlapping cDNAs can be used to generate expression vectors for polypeptides derived from the HCV genome (s), including those in clones 5-1-1, 36, 81, 91 and 1-2 and in the others in Section IV.A. encode encoded polypeptides. These techniques for the generation of these HCV epitope-containing polypeptides and for antibodies directed against the HCV epitopes they contain as well as their uses are described analogously to those for polypeptides derived from NANBV cDNA sequences and Clones 5-1-1, 32,35,36,1, -2,81 and 91 are included and discussed in the preceding and following text.
In der Familie der cDNA-Sequenzen codierte, in den Cionen 5-1-1,32,35,36,81,91,1-2 und in den anderen in Abschnitt IV.A. bechriebenon Clonon ist Antigen bzw. sind Antigene enthalten, die Epitope aufweisen, die gegenüber HCV einzigartig erscheinen, das heißt Antikörper, die gegen diese Antigene gerichtet sind, sind bei den mit HAV oder HBV infizierten Individuen und bei nicht mit HCV infizierten Individuen abwesend (siehe in Abschnitt IV.B. aufgeführte serologische Daten). Darüber hinaus zeigt ein Vergleich der Sequonzinformation dieser cDNAs mit den Sequenzen von HAV, HBV, HDV und mit den genomischen Sequenzen in der Genbank, daß zwischen diesen cDNAs und den Polynucleotidsequenzen dieser Quellen eine minimale Homologie besteht. Folglich können Antikörper, die gegen innerhalb der cDNAs dieser Clone codierten Antigene gerichtet sind, zur Identifizierung von BB-NANBV-Partikeln verwendet werden, die aus infizierten Individuen isoliert wurden. Außerdem sind sie auch für die Isolierung von NANBH-Wirkstoff(en) nützlich.Encoded in the family of cDNA sequences, in the cions 5-1-1,32,35,36,81,91,1-2 and in the others in Section IV.A. beongton clonon is antigen or contains antigens that have epitopes that appear unique to HCV, that is, antibodies directed against these antigens are absent in the individuals infected with HAV or HBV and in non-HCV infected individuals (see serological data listed in section IV.B.). Moreover, comparison of the sequence information of these cDNAs with the sequences of HAV, HBV, HDV and genomic sequences in the library shows that there is minimal homology between these cDNAs and the polynucleotide sequences of these sources. Thus, antibodies directed against antigens encoded within the cDNAs of these clones can be used to identify BB-NANBV particles isolated from infected individuals. In addition, they are also useful for the isolation of NANBH active agent (s).
HCV-Partikel können aus den Seren von BB-NANBV-infizierten Individuen oder aus Zellkulturen durch im Fachgebiet bekannte Methoden, einschließlich zum Beispiel auf der Größendiskriminierung basierende Techniken wie Sedimentations- oder Exclusionsmethoden oder auf der Dichte basierende Techniken wie Ultrazentrifugieren in Dichtegradienten, oder Präzipitation mit Agenzien wie Polyethylenglycol oder Chromatographie auf einer Vielzahl von Materialien wie anionische oder kationische Austausr.hmaterialien, und Materialien, die aufgrund von Hydrophobie binden, wie auch Affinitätssäulen isoliert werden. Während der Isolierungsprozedur kann die Anwesenheit von HCV durch die Hybridisierungsanalyse des extrahierten Genoms ermittelt werden, wobei Sonden verwendet werden, die von im vorstehenden beschriebenen HCV-cDNAs abgeleitet wurden, oder durch Immunoassay (siehe Abschnitt D.I.), wobei als Sonden gegen HCV-Antigene gerichtete Antikörper genutzt werden, die innerhalb der Familie der in den Figuren 1 bis 32 gezeigten cDNA-Sequenzen codiert sind, und auch gegen HCV-Antigene gerichtet sind, die innerhalb der im vorstehenden erörterten überlappenden HCV-cDNA-Sequenzen codiert sind. Die Antikörper können monoclonal oder polyclonal sein, und es kann wünschenswert sein, die Antikörper vor ihrer Verwendung im Immunoassay zu reinigen. Ein Reinigungsverfahren für polyclonale Antikörper, die gegen Antigen(e) gerichtet sind, die innerhalb Clon 5-1-1 codiert sind, wird in Abschnitt IV.E. beschrieben; analoge Reinigungsverfahren können für gegen andere HCV-Antigene gerichtete Antikörper eingesetzt werden.HCV particles may be obtained from the sera of BB-NANBV-infected individuals or from cell cultures by methods known in the art, including, for example, techniques based on size discrimination, such as sedimentation or exclusion methods or density-based techniques such as ultracentrifugation in density gradients, or precipitation with Agents such as polyethylene glycol or chromatography on a variety of materials such as anionic or cationic Austausr.hmaterialien, and materials that bind due to hydrophobicity, as well as affinity columns are isolated. During the isolation procedure, the presence of HCV can be determined by hybridization analysis of the extracted genome using probes derived from the HCV cDNAs described above or by immunoassay (see section DI), using as probes against HCV antigens Antibodies encoded within the family of cDNA sequences shown in Figures 1 to 32 and also directed against HCV antigens encoded within the overlapping HCV cDNA sequences discussed above. The antibodies may be monoclonal or polyclonal, and it may be desirable to purify the antibodies prior to use in the immunoassay. A purification procedure for polyclonal antibodies directed against antigen (s) encoded within clone 5-1-1 is described in Section IV.E. described; Analogous purification methods can be used for antibodies directed against other HCV antigens.
Antikörper, die gegen HCV-Antigene gerichtet sind, die innerhalb der Familie von in den Figuren 1 bis 32 gezeigten cDNAs codiert sind wie auch jene, die innerhalb überlappender HCV-cDNAs codiert und die an feste Unterlagen geheftet sind, sind für die Isolierung von HCV durch die Immunoaffinitätschromatographie nützlich. Techniken für die Immunaffinitätschromatographie sind im Fachgebiet bekannt, einschließlich Techniken für die Anheftung von Antikörpern an feste Unterlagen, so daß sie ihre immunoselektive Aktivität behalten; die Techniken können aus jenen bestehen, in denen die Antikörper an die Unterlage adsorbiert werden (siehe zum Beispiel Kurstak in »Enzyme Immunodiagnosis", Seite 31 bis 37) wie auch aus jenen, in denen die Antiköroer kovalent an die Unterlage gebunden werden. Im allgemeinen ähneln die Techniken jenen, die für die kovalente Bindung von Antigenen an eine feste Unterlage verwendet werden und die in Abschnitt II.C. allgemein beschrieben werden; Spacer-Gruppen können jedoch in die bifunktionellen Kupplungsmittel eingeschlossen werden, so daß die Antigenbindungsstelle des Antikörpers zugänglich bleibt.Antibodies directed against HCV antigens encoded within the family of cDNAs shown in Figures 1 to 32, as well as those encoding within overlapping HCV cDNAs and attached to solid supports are for the isolation of HCV useful by immunoaffinity chromatography. Techniques for immunoaffinity chromatography are known in the art, including techniques for attaching antibodies to solid supports so that they retain their immunoselective activity; the techniques may consist of those in which the antibodies are adsorbed to the support (see, for example, Kurstak in "Enzyme Immunodiagnosis," pages 31-37) as well as those in which the antibodies are covalently bound to the support The techniques are similar to those used for the covalent attachment of antigens to a solid support and are generally described in Section II.C., However, spacer groups can be included in the bifunctional coupling agents so that the antigen binding site of the antibody remains accessible ,
Während der Reinigungsprozedur kann die Anwesenheit von HCV durch Nucleinsäurehybridisierung nachgewiesen und/odor überprüft worden, indem als Sonden von der Familie der HCV-cDNA-Sequenzen, dargestellt in den Figuren 1 bis 32, abgeleitete Polynucleotide verwendet werden wie auch solche, die von überlappenden HCV-cDNA-Sequenzen abgeleitet und im vorstehenden Text beschrieben wurden. In diesem Falle würden die Fraktionen unter Bedingungen behandelt, die Auseinanderreißen der Viruspartikel bewirken, zum Beispiel mit Detergenzien in Anwesenheit von Chelatbildnern und in Anwesenheit von viralen Nucleinsäuren, die durch in Abschnitt H.H. beschriebene Hybridierungstechniken ermittelt wurden. Weitere Bestätigung, daß die isolierten Partikel die Wirkstoffe sind, die HCV induzieren, können durch Infizieren von Schimpansen mit den isolierten Viruspartikeln mit anschließender Bestimmung, ob die NANBH-Symptome aus dar Infektion herrühren, gewonnen werden.During the purification procedure, the presence of HCV can be detected and / or verified by nucleic acid hybridization using polynucleotides derived as probes from the family of HCV cDNA sequences shown in Figures 1 to 32 as well as those derived from overlapping HCV cDNA sequences were derived and described in the text above. In this case, the fractions would be treated under conditions causing disruption of the virus particles, for example with detergents in the presence of chelators and in the presence of viral nucleic acids prepared by the methods described in section H.H. described hybridization techniques were determined. Further confirmation that the isolated particles are the drugs that induce HCV can be gained by infecting chimpanzees with the isolated virus particles, then determining whether the NANBH symptoms result from the infection.
Virale Partikel aus den gereinigten Präparationen können dann weiterhin charakterisiert werden. Die genomische Nucleinsäure wurde gereinigt. Auf der Grundlage ihrer Sensitivität zur RNase, und nicht DNase I, sieht es so aus, als ob das Virus aus einem RNA-Genom zusammengesetzt ist. Siehe Beispiel IV.C.2., weiter unten. Die Strängigkeit und Zirkularität oder Nichtzirkularität kann durch im Fachgebiet bekannte Techniken, einschließlich zum Beispiel ihrer Sichtbarmachung durch Elektronenmikroskopie, ihrer Migration bei den Dichtigkeitsgradienten und ihrer Sedimentationscharakteristika ermittalt werden. Auf der Grundlage der Hybridisierung dos eingefangenen (captured) HCV-Genoms an die negativen Stränge von HCV-cDNAs scheint es, daß das HCV aus einem positiv-strängigen RNA-Genom (siehe Abschnitt IV. H. 1.) besteht. Techniken wie diese werden zum Beispiel in ,Methods in Enzymology" beschrieben. Außerdem kann die gereinigte Nucleinsäure cloniert und sequenziert werden mittels bekannter Techniken, einschließlich Reverser Transkriptase, da das genomische Material RNA ist. Siehe zum Beispiel Maniatis (1982) und Glover (1985). Bei Verwendung der aus den viralen Partikeln abgeleiteten Nucleinsäure ist es möglich, das gesamte Genom zu sequenzieren, je nachdem, ob es oder ob es nicht segmentiert ist. Die Untersuchung der Homologie des innerhalb des kontinuierlichen offenen Leserahmens von kombinierten Clonen 141 bis 390 (siehe Figur 26) codierten Polypeptide zeigt, daß das HCV-Polypeptid Homologieregionen bei den entsprechenden Proteinen in den konservierten Regionen der Flaviviren enthält. Ein Beispiel dazu wird in Abschnitt I IV.H.3. beschrieben. Diese Feststellung weist viele wichtige Aspekte auf. Erstens steht dieser Beweis in Verbindung mit den Ergebnissen, daß das HCV ein positivsträngiges Genom enthält, dessen Größe ungefähr 10000 Nucleotide umfaßt, in Einklang mit der Vermutung, daß das HCV ein Flavivirus oder ein flaviarttges Virus ist. Im allgemeinen weisen Flavivirus-Virionen und ihre Genome eine relativ konsistente Struktur und Organisation auf, die bekannt sind. Siehe Rice u.a. (1988) sowie Brinton, M.A. (1988). Folglich können die die strukturellen Gene codierenden Polypeptide C, pre-M/M und E im 5'-Terminus des Genoms upstream von Clon 14i lokalisiert werden. Darüber hinaus können unter Einbeziehung des Vergleiches mit anderen Flaviviren Voraussagen hinsichtlich der genauen Lokalisation der diese Proteine codierenden Sequenzen gemacht werden.Viral particles from the purified preparations can then be further characterized. The genomic nucleic acid was purified. Based on their sensitivity to RNase, rather than DNase I, it looks like the virus is composed of an RNA genome. See Example IV.C.2., Below. Stringency and circularity or non-circularity may be detected by techniques known in the art, including, for example, their visualization by electron microscopy, their migration in the density gradients, and their sedimentation characteristics. Based on the hybridization of the captured HCV genome to the negative strands of HCV cDNAs, it appears that the HCV consists of a positive-stranded RNA genome (see Section IV. H. 1.). Techniques such as these are described, for example, in "Methods in Enzymology." In addition, the purified nucleic acid can be cloned and sequenced by known techniques, including reverse transcriptase, since the genomic material is RNA. See, for example, Maniatis (1982) and Glover (1985). By using the nucleic acid derived from the viral particles, it is possible to sequence the entire genome, depending on whether it is unsegmented or not.The study of the homology of within the continuous open reading frame of combined clones 141 to 390 (see Figure 26) shows that the HCV polypeptide contains regions of homology to the corresponding proteins in the conserved regions of the flaviviruses, an example of which is described in Section IV.H.3.-This finding has many important aspects this evidence in conjunction with the findings that the HCV is a positive-stranded Genome, the size of which is about 10,000 nucleotides, in line with the presumption that the HCV is a flavivirus or a flaviarttges virus. In general, flavivirus virions and their genomes have a relatively consistent structure and organization that are known. See Rice et al. (1988) and Brinton, M.A. (1988). Thus, the structural genes encoding polypeptides C, pre-M / M and E can be located in the 5 'terminus of the genome upstream of clone 14i. In addition, predictions regarding the exact location of the sequences encoding these proteins can be made, including comparison with other flaviviruses.
Die Isolierung der Sequenzen upstream von jenen in Clon 141 kann auf vielfache Weise erfolgen und die hierin zur Verfügung gestellten Informationen sind für einen Fachmann einleuchtend. Zum Beispiel kann dia Genom-,walking'-Technikzur Isolierung anderer S^uemen angewendet werden, die 5' zu jenen in Cton 14 i sind, die jedoch jenen Clon überlappen; dieses führt wiederui ι zur Isolierung zusätzlicher Sequenzen. Diese Technik ist ausführlich in Abchnitt IV. A., siehe weiter unten, dargestellt. Es ist zum Beispiel bekannt, daß die Flaviviren konservierte Epitope und Regionen von konservierten Nucleinsäuresequenzen besitzen. Polynucleotide, die die konservierten Sequenzen enthalten, können als Sonden verwendet werden, die das HCV-Genom binden und somit seine Isolierung gestatten. Daneben können diese konservierten Sequenzen in Verbindung mit den aus den HCV-cDNAs, siehe Figur 22, abgeleiteten zum Design von Startern für die Verwendung in Systemen eingesetzt werden, die Genomsequenzen upstream von denen in Clon 14 i unter Verwendung der Polymerasokettenreaktionstechnologie amplifizieren. Ein Beispiel dafür wird im weiteren Text beschrieben.Isolation of the sequences upstream of those in clone 141 can be accomplished in a variety of ways, and the information provided herein will be apparent to one skilled in the art. For example, the genomic "walking" technique can be used to isolate other frames that are 5 'to those in Cton 14 i, but which overlap that clone; this leads again to the isolation of additional sequences. This technique is detailed in Section IV. A., below. For example, it is known that the flaviviruses have conserved epitopes and regions of conserved nucleic acid sequences. Polynucleotides containing the conserved sequences can be used as probes that bind the HCV genome, thus allowing its isolation. In addition, these conserved sequences, in conjunction with those derived from the HCV cDNAs, see Figure 22, can be used to design starters for use in systems that amplify genome sequences upstream of those in clone 14 i using polymerase chain reaction technology. An example of this will be described below.
Die Struktur des HCV kann ebenfalls ermittelt und seine Komponenten isoliert werden. Die Morphologie und Größe kann zum Beispiel durch Elektrcnenmikroskopie bestimmt werden. Die Identifizierung und Lokalisierung von spezifischen Viruspolypeptidantigenen wie .coat" oder Hüllantigene, oder innere Antigene wie Nucleinsäurebindungsproteine, Kernantigene und Polynucleotidpolymerase(n) können ebenfalls ermittelt werden durch zum Beispiel Bestimmung, ob die Antigene als größte oder kleinste Viruskomponenten vorhanden sind, wie auch durch die Nutzung der gegen die spezifischen Antigene, die innerhalb von isolierten cDNAs als Sonden codiert sind, gerichteten Antikörper. Diese Information ist für das Design von Vakzinen nützlich, zum Beispiel kann es günstig sein, ein äußeres Antigen in ein Vakzinpräparat einzubeziehen. Mul'iivalente Vakzine können zum Beispiel ein aus dem Genom, das ein Strukturprotein codiert, zum Beispiel E, abgeleitetes Polypeptid wie auch ein Polypeptid aus einem anderen Teil des Genoms, zum Beispiel ein... (Textstelle unlesbar, d. Übers.) Polypeptid enthalten.The structure of HCV can also be determined and its components isolated. The morphology and size can be determined, for example, by electron microscopy. The identification and localization of specific viral polypeptide antigens such as coat or envelope antigens, or internal antigens such as nucleic acid binding proteins, core antigens and polynucleotide polymerase (s) can also be determined by, for example, determining whether the antigens are present as the largest or smallest virus components, as well as by Use of antibodies directed against the specific antigens encoded within isolated cDNAs as cDNA probes This information is useful for the design of vaccines, for example, it may be beneficial to include an external antigen in a vaccine preparation for example, a polypeptide derived from the genome encoding a structural protein, for example E, as well as a polypeptide from another part of the genome, for example, a polypeptide (text location unreadable, i.e., trans.).
Die Annahme, daß HCV ein Flavivirus oder ein flaviartiges Virus ist, liefert auch Informationen über Methoden für das wachsende HCV. Der Terminus „flaviartig" bedeutet, daß das Virus einen signifikanten Anteil an Homologie gegenüber den bekannten konservierten Regionen der Flaviviren aufweist und daß der größere Teil des Genoms ein einzelner offener Leserahmen ist. Methoden für die Züchtung von Flaviviren sind den Fachleuten bekannt (siehe zum Beispiel die Reviews von Brinton [1986] Slollar, V. [1980]). Im allgemeinen können geeignete Zellen oder Zellinien für die Züchtung von HCV diejenigen einschließen, die dafür bekannt sind, daß sie die Flavivirus-Replikation unterstützen, zum Beispiel folgende: Affennieren-Zellinien (z. B. HK3, VERQ); Schweinenieren-Zellinien (z. B. PS); Baby-Hamsterniere-Zellinien (z. B. 6HK); Mäuse-Makrophage-Zellinien (z.B. P388D1, MK1, MmI); Human-Makrophagezellinien(z.B. U-937); periphere Humanblutleucocyten, adhärente Humanmonocyten; Hepatocyten oder Hepatocyt-Zellinien (z. B. HUH 7, HEPC2); Embryo- oder embryonale Zellen (z. B. Hühnerembryofibroblasten oder Zellinien, die von wirbellosen Tieren) vorzugsweise von Insekten (z.B. Drosophila-Zellinien), oder besonders bevorzugt von Gliederfüßlern, zum Beispiel Moskito-Zellinien (z. B. Albopictus, Aedes aegypti, Cutex tritaeniorhynchus) oder Zecken-Zellinien (z. B. RML-14, Dermacentor parumaportus) abgeleitet sind.The assumption that HCV is a flavivirus or a flavivirus also provides information on methods for growing HCV. The term "flavi-like" means that the virus has a significant proportion of homology to the known conserved regions of the flavivirus and that the major part of the genome is a single open reading frame Methods for the production of flaviviruses are known to those skilled in the art (see, for example the reviews of Brinton [1986] Slollar, V. [1980]). In general, suitable cells or cell lines for the growth of HCV may include those known to support flavivirus replication, for example the following: monkey kidney Cell lines (e.g., HK 3 , VERQ); porcine kidney cell lines (e.g., PS); baby hamster kidney cell lines (e.g., 6HK); mouse macrophage cell lines (eg, P388D1, MK1, MmI); Human macrophage cell lines (eg U-937); peripheral human blood leucocytes, adherent human monocytes; hepatocytes or hepatocyte cell lines (e.g., HUH 7, HEPC2); embryonic or embryonic cells (e.g., chicken embryo fibroblasts or cell lines, e.g. e of invertebrates), preferably insects (eg Drosophila cell lines), or more preferably arthropods, for example mosquito cell lines (e.g. Albopictus, Aedes aegypti, Cutex tritaeniorhynchus) or tick cell lines (eg, RML-14, Dermacentor parumaportus).
Es ist möglich, daß primäre Hepatocyten gezüchtet werden können und anschließend mit HCV infiziert werden; oder im anderen Falle könnten die Hepatocytkulturen aus den Lebern der infizierten Individuen (z.B. Menschen oder Schimpansen) gewonnen werden. Im letzteren Falle ist ein Beispiel das einer Zelle, die in vivo infiziert und in vitro übertragen wird. Darüber hinaus können verschiedene Immortalizationsmethoden eingesetzt werden, um von Hepatocytkulturen abgeleitete Zellinien zu gewinnen. Zum Beispiel können primäre Leberkulturen (vor und nach Anreicherung der Hepatocyt-Population) mit einer Anzahl Zellen fusionieren, um ihre Stabilität aufrechtzuerhalten. Es können zum Beispiel auch Kulturen mit transformierenden Viren infiziert werden, oder mit transformierenden Genen transferiert werden, um permanente oder semipermanente Zellinien zu erzeugen. Außerdem können zum Beispiel Zellen in Leberkulturen zu etablierten Zellinien verschmolzen werden (z. B. HepG 2). Methoden für die Zellfusion sind im Fachgebiet bekannt und schließen zum Beispiel die Verwendung von Fusionsagenzien wie auch Polyethylenglycol, Sendai-Virus und Epstein-Barr-Virus ein. Wie bereits erörtert, ist das HCV ein Flavivirus oder ein flaviartiges Virus. Daher ist wahrscheinlich, daß die HCV-Infektion von Zellinien durch im Fachgebiet bekannte Techniken für die Infizierung der Zellen mit Flaviviren durchgeführt werden kann. Diese umfassen zum Beispiel Inkubieren der Zellen mit Viruspräparaten unter Bedingungen, die den Viruseintriit in die Zelle gestatten. Darüber hinaus ist es möglich, die Virusproduktion durch Transferieren der Zellen mit isolierten Viruspolynucleotiden zu erreichen. Es ist bekannt, daß Togavirus- und Flavivirus-RNAs bei einer Anzahl von Wirbeltier-Zellinien (Pfefferkorn und Shapiro [1974]) und in einer Moskito-Zellinie (Peleg [1969]) übertragbar sind.It is possible that primary hepatocytes can be cultured and subsequently infected with HCV; or otherwise, the hepatocyte cultures could be recovered from the livers of the infected individuals (e.g., humans or chimpanzees). In the latter case, an example is that of a cell that is infected in vivo and transferred in vitro. In addition, various immortalization methods can be used to recover cell lines derived from hepatocyte cultures. For example, primary liver cultures (before and after accumulation of the hepatocyte population) may fuse with a number of cells to maintain their stability. For example, cultures may also be infected with transforming viruses or transferred with transforming genes to produce permanent or semi-permanent cell lines. In addition, for example, cells in liver cultures can be fused to established cell lines (eg, HepG 2). Methods for cell fusion are known in the art and include, for example, the use of fusion agents such as polyethylene glycol, Sendai virus and Epstein-Barr virus. As already discussed, HCV is a flavivirus or a flavivirus. Therefore, it is likely that HCV infection of cell lines can be performed by techniques known in the art for infecting cells with flaviviruses. These include, for example, incubating the cells with virus preparations under conditions that allow virus entry into the cell. In addition, it is possible to achieve virus production by transferring the cells to isolated viral polynucleotides. It is known that togavirus and flavivirus RNAs are transmissible in a number of vertebrate cell lines (Pfefferkorn and Shapiro [1974]) and in a mosquito cell line (Peleg [1969]).
Methoden für das Transfoktieren von Gewebekulturzellen mit RNA-Duplexen, positiv-strängigen RNAs und DNAs (einschließlich cDNAs) sind im Fachgebiet bekannt und schließen zum Beispiel Techniken ein, wie die Elektroporation und Präzipitation mit DEAE-Dextran oder Calciumphosphat. Eine ergiebige Quelle für HCV-RNA kann mittels der Durchführung der in vltro-Transkription einer dem vollständigen Genom entsprechenden HCV-cDNA gewonnen werden. Die Transfektion mit diesem Material oder mit clonierter HCV-cDNA müßte in die Virusreplikation und in die In vltro-Propagation des Virus resultieren. Zu den gezüchteten Zellen können zusätzlich tierische Modellsysteme für die virale Replikation eingesetzt werden; tierische Systeme, in denen Flaviviren vorkommen, sind den Fachleuten bekannt (siehe zum Beispiel „Review" von Monath [1986]). Somit kann die HCV-Replikation nicht nur in Schimpansen auftreten, sondern zum Beispiel auch in Krallenaffen und säugenden Mäusen.Methods for transfecting tissue culture cells with RNA duplexes, positive-stranded RNAs and DNAs (including cDNAs) are known in the art and include, for example, techniques such as electroporation and precipitation with DEAE-dextran or calcium phosphate. A rich source of HCV RNA can be obtained by performing the in vitro transcription of a full-genome HCV cDNA. Transfection with this material or with cloned HCV cDNA would have to result in viral replication and in virus propagation of the virus. In addition to the cultured cells, animal model systems for viral replication can be used; animal systems in which flaviviruses occur are known to those skilled in the art (see, for example, "Review" by Monath [1986]). Thus, HCV replication can occur not only in chimpanzees, but also in marmosets and suckling mice, for example.
Die Verfügbarkeit von Zellkulturen und tierischen Modellsystemen für HCV gestattet auch das Screening hinsichtlich Antivirusagenzien, die die HCV-Replikation inhibieren und besonders hinsichtlich jener Agenzien, die vorzugsweise Zellwachsturn und -multiplikation erlauben, während die virale Replikation inhibiert wird. Diese Screening-Methoden sind den Fachleuten bekannt. Im allgemeinen werden die Antivirusagenzien in einer Anzahl von Konzentrationen hinsichtlich ihres Effektes, die virale Replikation in Zellkultursystemen zu verhindern, die die virale Replikation unterstützen, und dann hinsichtlich einer Inhibierung der Infektiosität oder viralen PathogenitSt (und einem geringen Anteil von Toxizität) in einem tierischen Modellsystem getestet.The availability of cell cultures and animal model systems for HCV also allows screening for antiviral agents that inhibit HCV replication, and particularly for those agents that preferentially allow cell growth and multiplication while inhibiting viral replication. These screening methods are known to those skilled in the art. In general, the antiviral agents become effective in a number of concentrations in their effect of preventing viral replication in cell culture systems that support viral replication and then inhibiting infectivity or viral pathogenicity (and a low level of toxicity) in an animal model system tested.
Die darin für den Nachweis von HCV-Antigenen und HCV-Polynucleotiden zur Verfügung gestellten Methoden und Zusammensetzungen sind für das Screening von Antivirusagenzien insofern nützlich, als sie eine Alternative und vielleicht ein sensitiveres Mittel für den Nachweis des Einflusses des Agens auf die virale Replikation bereitstellen als der Zell-Plaque-Assay oder IDso-Assay. Die hierin beschriebenen HCV-Polynucleotidsonden können zum Beispiel zum Quantifizieren der Menge erzeugter viraler Nucleinsäuren in einer Zellkultur verwendet werden. Dieses könnte zum Beispiel durch Hybridisiorung oder .competition" (Konkurrenz)-Hybridisierung der infizierten Zellnucleinsäuren mit einer markierten HCV-Polynucleotidsonde durchgeführt werden. Anti-HCV-Antikörper können zum Beispiel auch zur Identifizierung und Quantifizierung von HCV-Antigen(en) in den Zellkulturen unter Verwendung des hierin beschriebenen Immunoassay eingesetzt werden. Da es außerdem wünschenswert sein kann, HCV-Antigene in den infizierten Zellkulturen durch einen „competition'-Assay zu quantifizieren,The methods and compositions provided herein for the detection of HCV antigens and HCV polynucleotides are useful for the screening of antiviral agents in that they provide an alternative and perhaps a more sensitive means of detecting the effect of the agent on viral replication the cell plaque assay or IDso assay. The HCV polynucleotide probes described herein can be used, for example, to quantify the amount of viral nucleic acids produced in a cell culture. This could be done, for example, by hybridization or "competition" hybridization of the infected cell nucleic acids with a labeled HCV polynucleotide probe Anti-HCV antibodies may also be used, for example, to identify and quantify HCV antigen (s) in cell cultures Since it may also be desirable to quantify HCV antigens in the infected cell cultures by a competition assay,
sind die in den hierin beschriebenen cDNAs codierten Polypeptide bei diesen .competition'-Assays nützlich. Im allgemeinen würde ein aus der HCV-cDNA abgeleitetes rekombinantes HCV-Polypeptid markiert sein, und die Inhibierung der Bindung dieses markierten Polypeptide an ein HCV-Polypeptid infolge des in dem Zellkultursystem erzeugten Antigans würde überwacht werden. Darüber hinaus sind die Techniken besonders in Fällen nützlich, wo das HCV in der Lage sein kann, in einer Zellinie zu replizieren ohne Zelltod zu verursachen.For example, the polypeptides encoded in the cDNAs described herein are useful in these "competition" assays. In general, a recombinant HCV polypeptide derived from the HCV cDNA would be labeled and inhibition of binding of this labeled polypeptide to an HCV polypeptide due to the antigan produced in the cell culture system would be monitored. In addition, the techniques are particularly useful in cases where the HCV may be able to replicate in a cell line without causing cell death.
U.M. Preparation von abgeschwächten HCV-StimmenAROUND. Preparation of attenuated HCV votes
Zusätzlich zu dem obigen und unter Verwendung der Gewebekultursysteme und/oder tierischer Modellsysteme kann es möglich sein, abgeschwächte HCV-Stämme zu isolieren. Diese Stämme würden sich für Vakzine eignen oder für das Isolieren von Virusantigenen. Abgeschwächte Stämme sind nach mehrfachen Passagen in Zellkulturen und/oder einem tierischen Modell isolierbar. Der Nachweis eines abgeschwächten Stammjs in einem infizierten Kalb oder Individuum wird durch im Fachgebiet bekannte Techniken erreicht und könnte zum Beispiel die Verwendung von Antikörpern zu einem oder mehreren in HCV als Sonde codierten Epitopen für die Verwendung eines Polynucleotide einschließen, das eine HCV-Sequenz von mindestens etwa ... (unvollständig d. Übers.) Nucleotid als eine als Sonde erhält. Im anderen Falle oder außerdem kann ein abgeschwächter Stamm unter Verwendung der hierin zur Verfügung gestellten genomischen Information von HCV und unter Verwendung rekombinanter Techniken konstruiert werden. Im allgemeinen würde man versuchen, eine Region des Genoms auszulöschen, die zum Beispiel eine Polypeptid bezogene Pathogenizität codiert, die aber virale Replikation erlaubt. Außerdem würde die Genomkonstruktion die Expression eines Epitops gestatten, das die Neutralisierung der Antikörper für das HCV bewirkt. Das veränderte Genom könnte dann zum Transformieren von Zellen genutzt werden, die die HCV-Replikation erlauben, und die unter diesen Bedingungen gewachsenen Zellen gestatten die virale Replikation.In addition to the above and using the tissue culture systems and / or model animal systems, it may be possible to isolate attenuated HCV strains. These strains would be suitable for vaccines or for isolating viral antigens. Attenuated strains are isolatable after multiple passages in cell cultures and / or an animal model. Detection of an attenuated parent in an infected calf or individual is accomplished by techniques known in the art and could include, for example, the use of antibodies to one or more epitopes encoded in HCV as a probe for the use of a polynucleotide having an HCV sequence of at least about ... (incomplete ds) nucleotide as a probe. Alternatively, or in addition, an attenuated strain may be constructed using the genomic information provided herein of HCV and using recombinant techniques. In general, one would try to eradicate a region of the genome that, for example, encodes polypeptide-related pathogenicity but allows viral replication. In addition, genome construction would allow the expression of an epitope that causes neutralization of antibodies to HCV. The altered genome could then be used to transform cells that permit HCV replication, and the cells grown under these conditions allow for viral replication.
Die abgeschwächten HCV-Stämme sind nicht nur für Vakzinzwecke nützlich, sondern auch als Quellen für die kommerzielle Produktion von Virusantigen, da die Verarbeitung dieser Viren weniger stringente Schutzmaßnahmen für die in der Virusproduktion und/oder Produktion viraler Produkte involvierten Mitarbeiter erfordern würde.... (Textanschluß fehlt d. Übers.)The attenuated strains of HCV are useful not only for vaccine purposes but also as sources of commercial production of viral antigen, since processing these viruses would require less stringent protection measures for the coworkers involved in viral production and / or production of viral products .... (Text connection is missing ds.)
..., ob die Antigene als größte oder kleinste virale Komponenten vorhanden sind, wie auch durch die Nutzung von gegen die spezifischen Antigene, die in den isolierten cDNAs als Sonden codiert sind, gerichtete Antikörper. Diese Information ist bei dem Design von Vakzinen nützlich, zum Beispiel kann es sich als günstig erweisen, ein äußeres Antigen in eine Vakzinpräparation einzuschließen. Multivalente Vakzine können zum Beispiel ein Polypeptid umfassen, das von einem ein Strukturprotein, zum Beispiel E, codierenden Genom abgeleitet ist, wie auch einem Polypeptid aus einem anderen Teil des Genoms, zum Beispiel ein nichtstrukturelles oder strukturelles Polypeptid.... whether the antigens are present as largest or smallest viral components, as well as by the use of antibodies directed against the specific antigens encoded in the isolated cDNAs as probes. This information is useful in the design of vaccines, for example, it may prove beneficial to include an external antigen in a vaccine preparation. For example, multivalent vaccines may comprise a polypeptide derived from a genome encoding a structural protein, for example E, as well as a polypeptide from another part of the genome, for example a non-structural or structural polypeptide.
III. Allgemeine MethodenIII. General methods
Die allgemeinen Techniken, die für das Extrahieren des Genoms aus einem Virus verwendet werden, für das Herstellen und Sondieren einer cDNA-Bibliothek, Sequenzieren der Clone, Konstruieren von '.xpressionsvektoren, Transformieren der Zellen, für das Durchführen immunologischer Tests wie Radioimmunoassays und El iSA-Assays, für das Züchten von Zellen in Kulturen und dergleichen sind im Fachgebiet bekannt, und es stehen Laborhandbüc > tr zur Verfügung, die diese Techniken beschreiben Der folgende Text stellt einen allgemeinen Leitfaden dar, der einige gegen , artig verfügbare Quellen für solche Prozeduren und Materialien, die bei der Ausführung derselben nützlich sind, aufzeigt.The general techniques used to extract the genome from a virus, for preparing and probing a cDNA library, sequencing the clones, constructing expression vectors, transforming the cells, performing immunological assays such as radioimmunoassays and ElisA Assays, for culturing cells in cultures and the like are well known in the art, and there are handbooks describing these techniques. The following text provides a general guide to some of the readily available sources of such procedures and methods Materials that are useful in the execution of the same shows.
III. A. Wirte und ExpressionskontrollsequenzenIII. A. hosts and expression control sequences
Sowohl prokaryontische als auch eukaryontische Wirtszellen können für die Expression der gewünschten codierenden Sequenzen verwendet werden, wenn geeignete Kontrollsequer^en, die mit dem gekennzeichneten Wirt kompatibel sind, verwendet werden. Unter den prokaryontischen Wirten ist E. coil der am häufigsten verwendete. Expressionskontrollsequenzen für Prokaryonten beinhalten Promotoren, die wahlweise Operatorportionen enthalten und Ribosombino'ungsstellen. Transfervektoren, die mit den prokeryontischen Wirten kompatibel sind, werden üblicherweise von zum Beispiel pBR 322, einem Operone enthaltenden Plasmid, abgeleitet, die Ampicillin- und Tetracyclinresistenz verleihen, und verschiedenen puC-Vektoren, die auch Sequenzen enthalten, die antibiotische Resistenzmarker übertragen. Diese Marker können dazu eingesetzt werden, erfolgreiche Transformanten durch Selektion zu gewinnen. Die üblicherweise verwendeten prokaryontischen Kontrollsequenzen beinhalten Beta-Lactamase (Penicillinase) und Lactose-Promotersysteme (Chang, u.a. 11977)), Tryptophan-(trp)-Promotorsystem (Goeddel u.a. (198O]) und den Lambda- abgeleiteten PL-Promotor und die N-Gen-Ribosom-Bindungsstelle (Shimatake u. a. (1981 ]) und den Hybrid-tac-Promotor (De Boer u. a. (1983)), der von den Sequenzen der trp- und lac-UV5-Promotoren abgeleitet ist. Die vorstehenden Systeme sind besonders kompatibel mit E. coil; wenn gewünscht, können andere prokaryontische Wirte wie Ciämme von Bacillus oder Pseudomonas mit den entsprechenden Kontrollsequenzen verwendet werden.Both prokaryotic and eukaryotic host cells may be used for the expression of the desired coding sequences if appropriate control sequestrants compatible with the labeled host are used. Among prokaryotic hosts E. coil is the most commonly used. Prokaryote expression control sequences include promoters optionally containing operator portions and ribosome binding sites. Transfer vectors that are compatible with the prokeryotic hosts are commonly derived from, for example, pBR 322, an operon-containing plasmid conferring ampicillin and tetracycline resistance, and various puC vectors, which also contain sequences that confer antibiotic resistance markers. These markers can be used to obtain successful transformants by selection. The commonly used prokaryotic control sequences include beta-lactamase (penicillinase) and lactose promoter systems (Chang, et al., 11977)), tryptophan (trp) promoter system (Goeddel et al. (198O)), and the lambda-derived PL promoter and N-type promoter. Gene ribosome binding site (Shimatake et al., 1981) and the hybrid tac promoter (De Boer et al., 1983) derived from the sequences of the trp and lac UV5 promoters The above systems are particularly compatible with E. coli, if desired, other prokaryotic hosts such as Bacillus or Pseudomonas clades can be used with the appropriate control sequences.
Eukaryontische Wirte enthalten in den Kultursystemen Hefe- und Säugetierzellen. Saccharomyce* cerevlslae und Saccharomycei carlsbergensfs sind die am meisten verwendeten Hefewirte und sind auch günstige Pilzwerte. Hefekompatible Vektoren tragen Marker, die die Selektion von erfolgreichen Transformanten durch Übertragen von Prototropie auf auxotrophe Mutanten oder Resistenz gegenüber Schwermetallen auf wilde Stämme gestatten. Hefekompatible Vektoren können denEukaryotic hosts contain yeast and mammalian cells in the culture systems. Saccharomyces * cerevlslae and Saccharomyces carlsbergensfs are the most widely used yeast hosts and are also favorable fungal values. Yeast-compatible vectors carry markers that allow the selection of successful transformants by conferring prototropy on auxotrophic mutants or resistance to heavy metals on wild strains. Yeast-compatible vectors can use the
2 Mikron-Replikationsstartpunkt (Broach u.a. (1983]), die Kombination von CDN3 und ARS1 oder andere Mittel für die Sicherstellung der Replikation einsetzen, wie auch Sequenzen, die in die Inkorporation eines geeigneten Fragmentes in das Wirtszellengenom resultieren. Kontrollsequenzen für Hefevektoren sind im Fachgebiet bekannt und umfassen Promotoren für die Synthese von glycolytischen Enzymen (Hess u.a. (1968); Holland u.a. (1978]), einschließlich des Promoters für2 micron origin of replication (Broach et al., 1983), the combination of CDN3 and ARS1, or other means for ensuring replication, as well as sequences resulting in the incorporation of a suitable fragment into the host cell genome Control sequences for yeast vectors are well known in the art and include promoters for the synthesis of glycolytic enzymes (Hess et al. (1968); Holland et al. (1978)), including the promoter for
3 Phosphoglyceratkinasen (Hitzeman [198O)). Terminatoren können ebenfalls einbezogen werden, wie jene, die aus dem Enolasegen abgeleitet wurden (Holland (1981)). Besonders nützlich sind Kontrollsysteme, die Glyceraldehyd-3-phosphatdehydrogenase-(GAPDH)-Promotor oder Alcohol-dehydrogenase-(ADH)-regulierbaren Promotor, ebenfalls von GAPDH abgeleitete Terminatoren, und wenn Sekretion gewünscht wird, Jeader"-Sequenz aus Hefe-Alpha-Faktoren umfassen. Außerdem können die transkriptionale Regulatorregion und die transkriptionale Initiierungsregion, die operabel miteinander verbunden sind, von der Art sein, daß sie natürlicherweise nicht in dem Wildtyp-Organismus assoziiert sind. Diese Systeme3 phosphoglycerate kinases (Hitzeman [198O)]. Terminators may also be included, such as those derived from the enolase gene (Holland (1981)). Particularly useful are control systems, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter or alcohol dehydrogenase (ADH) -regulatable promoter, also GAPDH-derived terminators, and, if secretion is desired, yeast alpha-alpha sequence. In addition, the transcriptional regulatory region and the transcriptional initiation region that are operably linked to each other may be of the nature that they are not naturally associated in the wild-type organism
werden ausführlich in der EPO 120551, veröffentlicht am 3.Oktober 1984; EP0116201, veröffentlicht am 22. August 1984, und EPO 164446, veröffentlicht am 18. Dezember 1985, beschrieben, die alle an den hierin genannten Zessionär abgetreten werden und hierdurch unter Bezugnahme darauf eingeschlossen sind.are described in detail in EPO 120551, published October 3, 1984; EP0116201, published August 22, 1984, and EPO 164446, published December 18, 1985, all of which are assigned to the assignee hereof and are hereby incorporated by reference.
Säugetierzellinien, die als Wirte für die Expression zur Verfügung stehen, sind im Fachgebiet bekannt und schließen viele immortalisierte Zellinienein, die von der American Type Culture Collection (ATCC) zur Verfügung gestellt werden einschließlich HeLa-Zellen, China-Hamster-Ovarium-ICHOI-Zellen, Baby-Hamsterniere-(BHK)-Zellen und eine Reihe anderer Zellinien. Geeignete Promotoren für Säugetierzellen sind im Fachgebiet bekannt und schließen virale Promotoren ein wie jene aus Simian-Virus 40 (SV 40) (Fiers [1978)), Rous sarcoma-Virus (RSV), Adenovirus (ADV) und Bovino-Papillom-Virus (BPV). Säugetierzellen können auch Terminatorsequenzen und Poly(A)-Additionssequenzen erfordern; Verstärkersequenzen, die die Expression erhöhen, können ebenfalls eingeschlossen werden sowie Sequenzen, die die Amplifizierung der Gene bewirken, können auch wünschenswert sein. Diese Sequenzen sind im Fachgebiet bekannt. Für die Replikation in Säugetierzellen geeigente Vektoren können virale Replikone oder Sequenzen enthalten, die die Integration geeigneter Sequenzen garantieren, die NANBV-Epitopo in das Wirtgenom codieren.Mammalian cell lines available as hosts for expression are known in the art and include many immortalized cell lines provided by the American Type Culture Collection (ATCC) including HeLa cells, China hamster ovary ICHOI cells , Baby Hamster Kidney (BHK) cells and a number of other cell lines. Suitable promoters for mammalian cells are known in the art and include viral promoters such as simian virus 40 (SV 40) (Fiers [1978]), rous sarcoma virus (RSV), adenovirus (ADV), and bovine papilloma virus ( BPV). Mammalian cells may also require terminator sequences and poly (A) addition sequences; Enhancer sequences that increase expression may also be included, as well as sequences that effect the amplification of the genes may also be desirable. These sequences are known in the art. Vectors suitable for replication in mammalian cells may contain viral replicons or sequences that guarantee the integration of appropriate sequences encoding NANBV epitope into the host genome.
Die Transformation kann durch irgendeine bekannte Methode für die Einführung von Polynucleotiden in eine Wirtszelle, einschließlich zum Beispiel Verpacken des Polynucleotide in ein Virus und Transduktion einer Wirtszelle mit dem Virus, und durch direkte Aufnahme des Polynucleotide erfolgen. Die angewendete Tiansformationsprozedur hängt von dem zu transformierenden Wirt ab. Die Transformation von E. coli-Wirtszellen mit Lambda-gt 11, die BB-NANBV-Sequenzen enthalten, wie zum Beispiel in dem später folgenden Abschnitt .Beispiele" erörtert. Die bakterielle Transformation durch direkte Aufnahme beinhaltet im allgemeinen die Behandlung mit Calcium oder Rubidiumchlorid (Cohen (1972]); Maniatis [1982]). Die Hefetransformation durch direkte Aufnahme kenn unter Verwendung der Methode von Hinnen u.a. (1978) durchgeführt werden. Die Säugetierzellentransformation durch direkte Aufnahme kann unter Verwendung der Calciumphosphat-Präzipitationsmethode von Graham und Van der Eb (1978) oder den verschiedenen bekannten Modikationen davon durchgeführt werden.Transformation may be by any known method for introducing polynucleotides into a host cell, including, for example, packaging the polynucleotides into a virus and transducing a host cell with the virus, and by directly uptake of the polynucleotides. The applied transformation procedure depends on the host to be transformed. Transformation of E. coli host cells with lambda gt 11 containing BB-NANBV sequences as discussed, for example, in the later section below "Examples." Bacterial transformation by direct uptake generally involves treatment with calcium or rubidium chloride (Cohen (1972)); Maniatis [1982]). Yeast transformation by direct uptake can be performed using the method of Hinnen et al., (1978). Mammalian cell transformation by direct uptake can be performed using the calcium phosphate precipitation method of Graham and Van der Eb (1978) or the various known modifications thereof.
Die Vektorkonstruktion erfolgt mit Techniken, die im Fachgebiet bekannt sind. Das sequenzspezifische Schneiden wird durch die Behandlung mit geeigneten Restriktionsenzymen unter Bedingungen durchgeführt, die generell durch den Hersteller dieser kommerziell verfügbaren Enzyme spezifiziert werden. Im allgemeinen werden etwa 1 Mikrogramm Plasmid oder DNA-Sequenz durch 1 Einheit Enzym in etwa 20 Mikroliter Pufferlösung durch Inkubation über 1 bis 2 Stunden bei 37°C geschnitten. Nach der Inkubation mit dem Restriktionsenzym wird das Protein durch Phenol/Chloroform-Extraktion entfernt und die PNA durch Präzipitation mit Ethanol zurückgewonnen. Die geschnittenen Fragmente können unter Verwendung von Polyacrylamid oder Agarosegel-Elektrophoresetechniken entsprechend den allgemeinen Prozeduren, die in „Methods in Enzymology" (1980) 65: 499-560 dargestellt sind, getrennt werden.The vector construction is accomplished by techniques known in the art. Sequence-specific cleavage is performed by treatment with appropriate restriction enzymes under conditions generally specified by the manufacturer of these commercially available enzymes. In general, about 1 microgram of plasmid or DNA sequence is cut by 1 unit of enzyme in about 20 microliters of buffer solution by incubation for 1 to 2 hours at 37 ° C. After incubation with the restriction enzyme, the protein is removed by phenol / chloroform extraction and the PNA recovered by precipitation with ethanol. The cut fragments can be separated using polyacrylamide or agarose gel electrophoresis techniques according to the general procedures outlined in "Methods in Enzymology" (1980) 65: 499-560.
Geschnittene Fragmente mit kohäsiven Enden können bei Verwendung von E. coll-DNA-Polymerase I (Klenow) in Anwesenheit geeigneter Deoxynucleotidtriphophaten (dNTPs), die in dem Gemisch vorhanden sind, glatte Enden aufweisen. Die Behandlung mit S1 -Nuclease, die in die Hydrolyse beliebiger einzelsträngiger DNA-Abschnitte resultiert, kann auch durchgeführt werden. Ligationen werden unter Verwendung von Standardpuffern und Temperaturbedingungen durchgeführt, die T4-DNA-Ligase und ATP verwenden; Ligationen von kohäsiven Enden erfordern weniger Αϊ γ- und weniger Ligase als Ligationen von glatten Enden. Wenn Vektorfragmente als Teil eines Ligationsgemisches verwendet werden, wird das Vektorfragment oftmals mit bakterieller alkalischer Phosphatase (BAP) oder alkalischer Kälberdarm-Phosphatase behandelt, um das 5'-Phosphat zu entfernen und somit die Re-Iigaiion des Vektors zu verhindern; im anderen Falle kann die Restriktionsenzym-Digestion ungewünt hter Fragmente zur Verhinderung der Ligation eingesetzt werden. Ligationsgemische werden in geeigneto Clonierungswirte wie E. coli transformiert, und erfolgreiche Transformanten werden zum Beispiel durch antibiotische Resistenz selektioniert und für die korrekte Konstruktion gescreent.Cut fragments with cohesive ends may have blunt ends when using E. coli DNA polymerase I (Klenow) in the presence of appropriate deoxynucleotide triphosphates (dNTPs) present in the mixture. Treatment with S1 nuclease resulting in the hydrolysis of any single-stranded DNA segments can also be performed. Ligations are performed using standard buffers and temperature conditions using T4 DNA ligase and ATP; Ligation of cohesive ends requires less Αϊ γ and less ligase than blunt end ligations. When vector fragments are used as part of a ligation mixture, the vector fragment is often treated with bacterial alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase to remove the 5'-phosphate and thus prevent re-ligiation of the vector; otherwise, restriction enzyme digestion of unwanted fragments can be used to prevent ligation. Ligation mixtures are transformed into suitable cloning hosts such as E. coli, and successful transformants are selected, for example, by antibiotic resistance and screened for correct construction.
Synthetische Oligonucleotide können unter Verwendung automatischer Oligonucleotidsynthesizer, wie von Warner (1984) beschrieben, hergestellt werden. Falls gewünscht, können die synthetischen Stränge mit 3Jp durch die Behandlung mit Polynucleotidkinase in Anwesenheit von "p-ATP, unter Anwendung von Standardbedingungen für die Reaktion markiert werden.Synthetic oligonucleotides can be made using automated oligonucleotide synthesizers as described by Warner (1984). If desired, the synthetic strands can be labeled with 3J p by treatment with polynucleotide kinase in the presence of "p-ATP, using standard conditions for the reaction.
DNA-Sequenzen, einschließlich der aus den cDNA-Bibliotheken isolierten, können durch bekannte Techniken, einschließlich zum Beispiel gerichteter Mutagenese wie von Zoller (1982) beschrieben, modifiziert werden. Kurzum, die zu modifizierende DNA wird in ein Phage als eine einzelst.ängige Sequenz verpackt und in eine doppelsträngige DNA mit DNA-Polymerase umgewandelt, wobei als Starter ein synthetisches Oligonucleotid verwendet wird, das zu dem Teil der DNA komplementär ist, das modifiziert werden soll, und das die gewünschte Modifikation in seiner eignen Sequenz enthält. Die sich ergebende doppelsträngige DNA wird in ein Phage transformiert, der das Wirtsbakterium unterstützt. Die Kulturen der transformierten Bakterien, die Replikationen jeden Stranges des Phage enthalten, werden in Agar plattiert, um Plaques zu erhalten. Theoretisch enthalten 50% der neuen Plaques Phage mit mutierter Sequenz. Die restlichen 50% weisen die ursprüngliche Sequenz auf. Replikate der Plaques werden an die markierte synthetische Sonde bei Temperaturen und Bedingungen hybridisiert, die die Hybridisierung mit dem korrekten Strang gestatten, jedoch nicht mit der unveränderten Sequenz. Die durch Hybridisierung identifizierten Sequenzen werden wiedergewonnen und cloniert.DNA sequences, including those isolated from the cDNA libraries, can be modified by known techniques, including, for example, directed mutagenesis as described by Zoller (1982). In short, the DNA to be modified is packaged into a phage as a single-stranded sequence and converted to a double-stranded DNA with DNA polymerase, using as a starter a synthetic oligonucleotide that is complementary to the portion of the DNA that is to be modified , and which contains the desired modification in its own sequence. The resulting double-stranded DNA is transformed into a phage that supports the host bacterium. The cultures of transformed bacteria containing replications of each strand of phage are plated in agar to obtain plaques. Theoretically, 50% of the new plaques contain phage with mutated sequence. The remaining 50% have the original sequence. Replicas of the plaques are hybridized to the labeled synthetic probe at temperatures and conditions that permit hybridization with the correct strand, but not with the unaltered sequence. The sequences identified by hybridization are recovered and cloned.
DNA-Bibliothem können unter Verwendung des Verfahrens von Grundstein und Hogness (1975) sondiert werden. Kurz gesagt, bei diesem Verfahren wird die zu sondierende DNA auf Nitrocellulosefiitern immobilisiert, denaturiert und pre-hybridisiert mit einem Puffer, der 0 bis 50% Formamid, 0.75M NaCI, 75mM Na-Citrat, 0,02% (M/V) von jeweils Rinderserumalbumin,DNA libraries can be probed using the method of Grundstein and Hogness (1975). Briefly, in this method, the DNA to be probed is immobilized on nitrocellulose fibrils, denatured and pre-hybridized with a buffer containing 0 to 50% formamide, 0.75M NaCl, 75 mM Na citrate, 0.02% (M / V) of bovine serum albumin,
Polyvinylpyrollidon sowie Ficoll, 5OmM Na-Phosphat (pH = 6,5), 0,1 % SDS und 100 Mikrogramm/ml „carricr"-denaturierte DNA enthält. Der Prozentanteil Formamid in dem Puffer wie auch die Zeit- und Temperaturbedingungen der Pre-Hybridisierung und anschließende Hybridisierungsschritte hängen von der erforderlichen Stringenz ab. Oligomere Sonden, die weniger stringente Bedingungen erfordern, werden im allgemeinen mit niedrigeren prozentuellen Anteilen von Formamid, niedrigeren Temperaturen und längeren Hybridisierungszeiten eingesetzt. Sonden, die über 30 bis 40 Nucleotide wie die aus cDNA oder genomischen Sequenzen abgeleiteten enthalten, verlangen im allgemeinen höhere Temperaturen, zum Beispiel etwa 40°C bis 42°C, und einen hohen Formamidanteil, zum Beispiel 50%. Anschließend an die Pre-Hybridisierung wird die 5'-32p-markierte Oligonucleotidsonde zu dem Puffer zugesetzt, und die Filter werden unter Habridisierungsbedingungen in diesem inkubiert. Nach dem Waschen werden die behandelten Filter Autoradiographie unterzogen, um die Lage der hybridisierten Sonde zu zeigen; die DNA in entsprechenden Lokalisationen auf den originalen Agarplatten wird als Quelle der gewünschten DNA verwendet.Polyvinylpyrollidone and Ficoll, 50 mM Na-phosphate (pH = 6.5), 0.1% SDS and 100 micrograms / ml carricr-denatured DNA. The percent formamide in the buffer as well as the time and temperature conditions of the pre- Hybridization and subsequent hybridization steps are dependent upon the requisite stringency Oligomeric probes requiring less stringent conditions are generally employed at lower percentages of formamide, lower temperatures, and longer hybridization times Probes greater than 30 to 40 nucleotides such as those of cDNA or cDNA generally derived from genomic sequences generally require higher temperatures, for example, about 40 ° C. to 42 ° C., and a high formamide content, for example 50%. Subsequent to pre-hybridization, the 5'- 32 p-labeled oligonucleotide probe becomes the Buffer is added and the filters are incubated under Habridisierungsbedingungen in this After washing, the b subjected filters to autoradiography to show the location of the hybridized probe; the DNA in appropriate locations on the original agar plates is used as the source of the desired DNA.
Für Routinevektorkonstruktionen werden Ligationsgemische im E. coll-Stamm-HB 101 oder einem anderen geeigneten Wert transformiert, und erfolgreiche Transformanten werden duich antibiotische Resistenz oder andere Marker selektioniert. Plasmide aus den Transformanten werden dann entsprechend der Methode von Clewell u.a. (1969), üblicherweise durch Verfolgung der Chloramphenicol-Amplifizierung (Clewell (1972]) hergestellt. Die DNA wird isoliert und analysiert auf der Grundlage der Restriktionsenzymanalyse und/oder Sequenzierung. Die Sequenzierung kann mittels der Dideoxy-Methode von Sanger u.a. (1977) durchgeführt worden, die weiterhin von Messing u.a. (1981) oder durch die Methode von Maxam u.a. (1980) beschrieben wurde. Probleme mit der Bandenkompression, die manchmal in den GC-reichen Regionen beobachtet werden, wurden durch die Verwendung von T-Deazoguanosin entsprechend Barr u.a. (1986) überwunden.For routine vector designs, ligation mixtures are transformed into E. coli strain HB 101 or other appropriate value, and successful transformants are selected for antibiotic resistance or other markers. Plasmids from the transformants are then purified according to the method of Clewell et al. (1969), usually prepared by following the chloramphenicol amplification (Clewell (1972)) The DNA is isolated and analyzed on the basis of restriction enzyme analysis and / or sequencing The sequencing can be carried out by the dideoxy method of Sanger et al (1977) Further described by Messing et al. (1981) or by the method of Maxam et al. (1980) Problems with band compression sometimes observed in the GC-rich regions were identified by the use of T-deazoguanosine according to Barr et al (1986).
Der Enzym-gekoppelte immunologische Test (ELISA) kann eingesetzt werden, um entweder Antigen- oder Antikörperkonzentrationen zu messen. Diese Methode hängt von der Konjugation eines Enzyms entweder zu einem Antigen oder Antikörper ab und nutzt die gebundene Enzymaktivität als quanitative Markierung. Um den Antikörper zu messen, wird das bekannte Antigen an eine feste Phase fixiert '.z. B. eine Mikroplatte oder einen Kunststofftiegel), mit Testserumverdünnungen inkubiert, gewaschen, mit Antiimmunoglobulin inkubiert, das mit einem Enzym markiert ist, und wiederum gewaschen. Für die Markierung geeignete Enzyme sind im Fachgebiet bekannt und umfassen zum Beispiel Meerrettichperoxidase. Die an die feste Phase gebundene Enzymaktivität wird durch die Zugabe des spezifischen Substrats gemessen, und die Bestimmung der Produktbildung oder Substratverwertung erfolgt kolorimetrisch. Die gebundene Enzymaktivität ist eine direkte Funktion der Menge gebundenen Antikörpers.The enzyme-linked immunological assay (ELISA) can be used to measure either antigen or antibody levels. This method depends on the conjugation of an enzyme to either an antigen or antibody, and uses the bound enzyme activity as a quanitative label. To measure the antibody, the known antigen is fixed to a solid phase . A microplate or plastic crucible), incubated with test serum dilutions, washed, incubated with anti-immunoglobulin labeled with an enzyme, and washed again. Suitable enzymes for labeling are known in the art and include, for example, horseradish peroxidase. The enzyme activity bound to the solid phase is measured by the addition of the specific substrate, and the determination of product formation or substrate utilization is colorimetric. The bound enzyme activity is a direct function of the amount of bound antibody.
Zur Messung des Antigens wird ein bekannter spezifischer Antikörper an die feste Phase fixiert, das das Antigen enthaltende Testmaterial wird zugesetzt, nach Inkubierung der festen Phase gewaschen und ein zweiter Enzym-markierter Antikörper zugegeben. Nach dem Waschen wird das Substrat zugefügt, und die Enz/maktivität wird kolorimetrisch bewertet und zur Antigenkonzentration in Beziehung gesetzt.To measure the antigen, a known specific antibody is fixed to the solid phase, the antigen-containing test material is added, washed after incubation of the solid phase, and a second enzyme-labeled antibody is added. After washing, the substrate is added and the enzyme activity is colorimetrically evaluated and related to antigen concentration.
Im Untenstehenden werden erfindungsgemäße Beispiele beschrieben, die nur zur Veranschaulichung dienen und den Geltungsbereich der vorliegenden Erfindung nicht einschränken. Angesichts der vorliegenden Erfindung sind den ständig auf diesem Gebiet arbeitenden Fachleuten zahlreiche Ausführungsformen im Geltungsbereich der Ansprüche offenbar. Die zum Beispiel in Abschnitt IV. A. geschilderten Prozeduren können, falls gewünscht, müssen jedoch nicht wiederholt werden, da für die Konstruktion der gewünschten Nucleotidsequenzen Techniken auf der Grundlage der durch die Erfindung gelieferten Informationen zur Verfügung stehen. Die Expression wird in E. coil veranschaulicht, es stehen jedoch auch andere Systeme zur Verfügung, die in Abschnitt III A. ausführlicher geschildert werden. Zusätzlich von der genomischen Struktur abgeleitete Epitope können ebenfalls produziert und dazu verwendet werden, Antikörper wie im weiteren Text beschrieben, zu erzeugen.In the following, examples according to the invention are described which are given by way of illustration only and do not limit the scope of the present invention. In view of the present invention, numerous embodiments within the scope of the claims are apparent to those skilled in the art. However, the procedures outlined, for example, in Section IV. A. may, if desired, need not be repeated, as techniques for constructing the desired nucleotide sequences are available based on the information provided by the invention. Expression is illustrated in E. coli, but other systems are available, which are described in more detail in Section III A. In addition, epitopes derived from the genomic structure may also be produced and used to generate antibodies as described below.
IV.A. Herstellung, Isolierung und Sequenzierung von HCV-cDNA IV.A.1. Herstellung von HCV-cDNAIV.A. Preparation, isolation and sequencing of HCV cDNA IV.A.1. Preparation of HCV cDNA
Die Quelle des NANB-Agens war ein von einem Schimpansen mit chronischer NANBH abgeleiteter Plasma-Pool. Der Schimpanse wurde experimentell mit Blut von einem anderen Schimpansen mit chronischer NANBH infiziert, die wiederum aus der Infektion mit HCV in einer kontaminierten Konzentrationsmenge mit Faktor 8, das von gesammelten Human-Serum abgeleitet wurde, herrührte. Der Schimpansen-Plasma-Pool wurde durch Kombinieren vieler individueller Plasmaproben, die einen hohen Grad von Alaninamir.otransferaseaktivität aufwiesen, hergestellt, diese Aktivität resultierte aus der hepatitischen Schädigung infolge der HCV-lnfektion. Da 1 ml einer 10"6-Verdünnung dieses gesammelten und intravenös verabreichten Serums iit anderen Schimpansen NAN-BH verursachte, sein CID (Zytomegaliesyndrom) war mindestens 10'/ml, d. h., es hatte einen höh in infektiösen Virustiter.The source of the NANB agent was a plasma pool derived from a chimpanzee with chronic NANBH. The chimpanzee was experimentally infected with blood from another chimpanzee with chronic NANBH, which in turn resulted from infection with HCV in a contaminated concentration level with factor 8 derived from pooled human serum. The chimpanzee plasma pool was prepared by combining many individual plasma samples that had a high degree of alanine aminotransferase activity, this activity resulting from hepatic injury due to HCV infection. Since 1 ml of a 10 "6 dilution of this collected and intravenous serum iit other chimpanzees NAN-BH caused, its CID (Zytomegaliesyndrom) was at least ', 10 / ml that is, it had a höh in infectious virus titer.
Eine cDNA-Bibliothek aus dem Plasma-Pool mit hohem Titer wurde wie folgt erzeugt. Zuerst wurc-än virale Partikel aus dem Plasma isoliert; eine90-ml-Aliquote wurde mit 310ml einer 5OmM Tris-HCI, pH 8,0,1 mM EDTA, '0OmM NaCI enthaltenden Lösung verdünnt. Reste wurden durch 20min Zentrifugieren bei 15000 χ g bei 200C entfernt. Vire ο Partikel in dem resultierenden Überstehonden wurden anschließend pelletiert durch Zentrifugieren in einem Beet man-SW28-Rotor bei 28000 U/min über 5 Stunden bei 20'C. Zur Freisetzung des viralen Genoms wurden die Partikel du -ch Suspendieren du Pellets in 15ml Lösung, die 1 % Natriumdodecylsulfat (SDS), 1OmM EDTA, 1OmM Tris-HCI, pH 7,5, enthielt sowie auch 2mg/nr.l Proteinase k aufgebrochen und anschließend bei 450C über 90min inkubiert. Die Nucleinsäuren wurden durch Zugabe von 0,8 Mikrogramm MS 2 Bacteriophage RNA als Trägersubstanz isoliert, und das Gemisch wurde viermal mit einem 1:1 -GemischA cDNA library from the high titer plasma pool was generated as follows. First, viral particles were isolated from the plasma; A 90 ml aliquot was diluted with 310 ml of a 50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.1 mM NaCl-containing solution. Residues were removed by centrifugation at 15,000 g for 20 min at 20 ° C. Vire o particles in the resulting supernatant were then pelleted by centrifugation in a Beetman SW28 rotor at 28,000 rpm for 5 hours at 20 ° C. To release the viral genome, the particles du suspending ch du pellets were resuspended in 15 ml solution containing 1% sodium dodecyl sulfate (SDS), 1OmM EDTA, 1OmM Tris-HCl, pH 7.5, as well as 2 mg / nr.l proteinase k broken and then incubated at 45 0 C for 90 min. The nucleic acids were isolated by the addition of 0.8 micrograms of MS 2 bacteriophage RNA as a carrier, and the mixture was washed four times with a 1: 1 mixture
von Phenol:Chloroform (Phenol gesättigt mit 0,5M Tris-HCI, pH 7,5,0,1 % (V/V) Beta-Mercoaptoethanol, 0,1 % (M/V) Hydroxychinolin extrahiert, und anschließend zweimal mit Chloroform extrahiert. Die wäßrige Phase wurde vor der Präzipitation mit 2,5 Volumen absolutes Ethanol und Stehenlassen über Nacht bei -20T mit 1-Butanol konzentriert. Die Nucleinsäure wurde durch Zentrifugieren in einem Bsckman-SW41 -Rotor bei 40000U/min über 90min bei 40C zurückgewonnen und in Wasser gelöst, das mit 0,05% (V/V) Diethylpyrocarbonat behandelt und im Autoklaven gekocht wurde. Die durch das oben geschilderte Verfahren gewonnene Nucleinsäure (< 2 Mikrogramm) wurde mit 17,5mM CH3HgOH denaturiert; cDNA wurde unter Verwendung dieser denaturierten Nucleinsäure als Matrize synthetisiert und in die EcoRI-Stelle von Phage Lambda-gt 11 unter Verwendung von durch Huynh (1985) beschriebenen Methoden cloniert, außer daß die zufälligen Starter Oligo(dT)-12-18 während der Synthese des ersten cDNA-Stranges durch Umkehrtranskriptase ersetzten (Taylor u.a. |1976]). Die resultierenden doppelsträngigen cDNAs wurden entsprechend der Größe auf einer Sepharose-CL-4 B-Säule fraktioniert; eluiertes Material von ungefähr mittlerer Größe 400,300,200 und 100 Basenpaaren wurden in den cDNA-Pools 1,2, 3 bzw. 4 gepoolt. Die Lambda-gt 11 -cDNA-Bibliothek wurde aus der cDNA in Pool 3 erzeugt.of phenol: chloroform (phenol saturated with 0.5M Tris-HCl, pH 7.5.0.1% (v / v) beta-mercoaptoethanol, 0.1% (w / v) hydroxyquinoline extracted, and then twice with chloroform extracted. the aqueous phase was concentrated prior to precipitation with 2.5 volumes of absolute ethanol and allowed to stand overnight at -20T with 1-butanol. the nucleic acid was collected by centrifugation in a SW41-Bsckman -rotor at 40000U / min over 90min at 4 0 C and dissolved in water, which was treated with 0.05% (v / v) diethylpyrocarbonate and autoclaved The nucleic acid (<2 micrograms) recovered by the above procedure was denatured with 17.5 mM CH 3 HgOH; was synthesized using this denatured nucleic acid as a template and cloned into the EcoRI site of phage lambda-gt 11 using methods described by Huynh (1985), except that the random starters oligo (dT) -12-18 were synthesized during synthesis of the first cDNA-S tranges replaced by reverse transcriptase (Taylor et al., 1976]). The resulting double-stranded cDNAs were fractionated according to size on a Sepharose CL-4 B column; Approximately 400,300,200 and 100 base pair eluted material were pooled in cDNA pools 1,2, 3 and 4, respectively. The lambda gt 11 cDNA library was generated from the cDNA in pool 3.
Die Lambda-gt 11 -cDNA-Bibliothek, die aus Pool 3 erzeugt wurde, wurde auf Epitope gescreent, die spezifisch von einem zuvor an NANBH erkrankten Patienten abgeleitetes Serum binden können. Unter Verwendung der Methoden von Huynh u.a. (1i85) wurden etwa 10* Phagen mit Patientenseren gescreent, außer daß gebundene Human-Antikörper mit Schaf-Ar.ti-Human-Ig-Antiseren, die mit 125I readioaktiv markiert wurden, nachgewiesen werden konnten. Fünf positive Phagen wurden identifiziert und gereinigt. Die fünf positiven Phagen wurden anschließend hinsichtlich Spezifizität der Bindung an Seren von 8 unterschiedlichen, zuvor mit der NANBH-Agens infizierten Menschen unter Verwendung der gleichen Methode getestet. Vier der Phagen codierten ein Polypeptid, das immunologisch mit nur einem Human-Serum reagierte, d.h. dem einen, das für das primäre Screening der Phage-Bibliothek eingesetzt wurde. Der fünfte Phage (5-1-1) codierte ein Polypeptid, das immunologisch mit 5 der 8 getesteten Seren reagierte. Darüber hinaus reagierte dieses Polypeptid immunologisch nicht mit Seren von 7 normalen Blutspendern. Deshalb sieht es so aus, als ob Clon 5-1-1 ein Polypeptid codiert, das immunologisch speziell durch Seren von NAND-Patienten erkannt wird.The lambda gt 11 cDNA library generated from pool 3 was screened for epitopes that can specifically bind serum derived from a patient previously on NANBH. Using the methods of Huynh et al. (1i85), approximately 10 * phages were screened with patient sera except that bound human antibodies could be detected with sheep Ar.ti human Ig antisera labeled 125 I readiolactively. Five positive phages were identified and purified. The five positive phage were then tested for specificity of binding to sera from 8 different humans previously infected with the NANBH agent using the same method. Four of the phage encoded a polypeptide that was immunologically reactive with only one human serum, ie, the one used for primary screening of the phage library. The fifth phage (5-1-1) encoded a polypeptide that immunologically reacted with 5 of the 8 sera tested. In addition, this polypeptide did not react immunologically with sera from 7 normal blood donors. Therefore, it appears that clone 5-1-1 encodes a polypeptide which is recognized immunologically specifically by sera from NAND patients.
IV.A.2. Sequenzen der HCV-cDNA in rekombinantem Phage 5-1-1 und vom innerhalb dor Sequenz codierten Polypeptid Die cDNA in rekombinantem Phage 5-1-1 wurde nach einer Methode von Sanger u.a. (1977) sequenziert. Die cDNA wurde im wesentlichen mit EcoRI ausgeschnitten und unter Verwendung von Gelelektrophorese durch Größenfraktionierung isoliert. Die EcoRI-Restriktionsfragmente wurden subcloniert in die M 13-Vektoren mp 18 und mp 19 (Messing [1983]) und unter Verwendung der Dideoxyketten-Terminationsmethode von Sanger u.a. (1977) sequenziert. Die gewonnene Sequenz wird in Figur 1 gozeigt. Das in Figur 1 codierte Polypeptid, das in der HCV-cDNA codiert ist, befindet sich in dem gleichen translational Rahmen wie die N-terminale Beta-Galactosidasekomponente, an die es fusioniert ist. Wie in Abschnitt IV. A. gezeigt wird, codiert der translational offene Leserahmen (ORF) von 5-1 -1 ein Epitop bzw. Epitope, die speziell von Seren von mit NANBH-Infektionen konfrontierten Patienten und Schimpansen erkannt werden.IV.A.2. Sequences of the HCV cDNA in Recombinant Phage 5-1-1 and the Polypeptide Encoded Within the Sequence The cDNA in recombinant phage 5-1-1 was analyzed by a method of Sanger et al. (1977). The cDNA was excised substantially with EcoRI and isolated by gel fractionation using gel electrophoresis. The EcoRI restriction fragments were subcloned into the M13 vectors mp18 and mp19 (Messing [1983]) and using the dideoxy chain termination method of Sanger et al. (1977). The sequence obtained is shown in FIG. The polypeptide encoded in Figure 1, encoded in the HCV cDNA, is in the same translational framework as the N-terminal beta-galactosidase component to which it is fused. As shown in Section IV. A., the translational open reading frame (ORF) of 5-1-1 encodes an epitope or epitopes specifically recognized by sera from NANBH infection-confronting patients and chimpanzees.
Zur cDNA in Clon B-1 -1 überlappende HCV-cDNA wurde durch Screening der gleichen Lambda-gt 11-Bibliothek, die wie in Abschnitt IV. A. 1. beschrieben geschaffen wurde, mit einem aus der Sequenz der HCV-cDNA in den Clonen 5-1 -1, wie in Figur 1 dargestellt, abgeleiteten synthetischen Polynucleotid gewonnen. Die Sequenz des für das Screening verwendeten Polynucleotids war:HCV cDNA overlapping the cDNA in clone B-1-1 was screened by screening the same lambda gt 11 library as described in Section IV. A. 1. with one from the sequence of the HCV cDNA in FIGS Clones 5-1 -1, as shown in Figure 1, derived derived synthetic polynucleotide. The sequence of the polynucleotide used for the screening was:
5'-TCC CTT GCT CGA T3T ACG GTA AGT GCT GAG AGC5'-TCC CTT GCT CGA T3T ACG GTA AGT GCT GAG AGC
GAG GT-3'.GAG GT-3 '.
gescreent. Ungefähr 1 in 50000 Clonen hybridisierte mit dieser Sonde. Drei Clone, die cDNAs enthielten, hybridisierten mit dersynthetischen Sonde, die mit 81,1-2 und 91 numeriert ist.screened. About 1 in 50,000 clones hybridized to this probe. Three clones containing cDNA hybridized to the synthetic probe numbered 81.1-2 and 91.
.Die Nucleotid-Sequenzen der drei cDNAs in den Clonen 81,1-2 und 91 wurden im wesentlichen wie in Abschnitt IV. A.?.The nucleotide sequences of the three cDNAs in clones 81, 1-2 and 91 were essentially as described in Section IV. A.
beschrieben ermittelt. Die Sequenzen dieser Clone im Verhältnis zur HCV-r.DNA-Sequenz in Phage 5-1-1 werden in Figur 2dargestellt, die den Strang zeigt, der das nachgewiesene HCV-Epitop codiert und wo die Homologien in den Nu' 'eotidsequenzendurch vertikale Linien zwischen den Sequenzen angedeutet werden.described determined. The sequences of these clones relative to the HCV rDNA sequence in phage 5-1-1 are shown in Figure 2, which shows the strand encoding the HCV epitope detected and where the homologies in the nucleotide sequences are by vertical lines be indicated between the sequences.
oder T diese Position einnehmen.or T occupy this position.
sind. Diese Basenpaare treten am Start der cDNA-Sequenz in 5-1 -1 auf und werden durch kleine Buchstaben angezeigt. Auf derare. These base pairs occur at the start of the cDNA sequence in 5-1-1 and are indicated by small letters. On the
defekten HCV-Genomen abgeleitet wurde; alternativ dazu könnte die 28-bp-Region ein terminaler Artefakt in Clon 5-1 -1 sein.defective HCV genome was derived; alternatively, the 28 bp region could be a terminal artifact in clone 5-1-1.
daß diese Sequenzen n'.cht in anderen cDNAs gefunden wurden, da cDNAs, die diese Regionen überlappen, bis jetzt noch nichtisoliert wurden.that these sequences were not found in other cDNAs since cDNAs overlapping these regions have not yet been isolated.
in Figur 3 dargestellt. In dieser Figur sind jedoch die einzigartigen 28 Basenpaare von Clon 5-1 -1 weggelassen worden. Die Figurzeigt auch die Sequenz des in dem ORF der zusammengesetzten HCV-cDNA codierten Polypeptids.shown in FIG. In this figure, however, the unique 28 base pairs of clone 5-1-1 have been omitted. The figure also shows the sequence of the polypeptide encoded in the ORF of the composite HCV cDNA.
Die Isolierung der HCV-cDNA-Sequenzen upstream von, und die jene in Clon-81-cDNA überlappen, wurde wie folgt durchgeführt. Die Lambda-gtH-cDNA-Bibliothek, die entsprechend Abschnitt IV.A.1. hergestellt wurde, wurde durch Hybridisierung mit einer synthetischen Polynucleotidsonde, die zu einer 5'-terminalen Sequenz von Clon 81 homolog war, gescreent. Die Sequenz von Clon 81 wird in Figur 4 dargestellt. Die Sequenz des für das Screening verwendeten synthetischen Polynucleotide lautete:The isolation of the HCV cDNA sequences upstream of and overlapping those in clone 81 cDNA was performed as follows. The lambda gtH cDNA library described in Section IV.A.1. was screened by hybridization with a synthetic polynucleotide probe homologous to a 5'-terminal sequence of clone 81. The sequence of clone 81 is shown in FIG. The sequence of the synthetic polynucleotides used for the screening was:
5' CTG TCA GGT ATG ATT GCC GGC TTC CCG GAC 3'.5 'CTG TCA GGT ATG ATT GCC GGC TTC CCG GAC 3'.
Die Methoden waren im wesentlichen die von Huynh (1985) beschriebenen, auSer daß die Bibliothekiilter zwei Waschungen unter stringenten Bedingungen unterzogen wurden, d.h., die Waschungen wurden in 5x SSC, 0,1 % SDS bei 55°C und jeweils über 30min durchgeführt. Ungefähr 1 in 50000 Clonen hybridisierte mit dar Sonde. Ein positiver rekom. ianter Phage, der cDNA enthielt, die mit der Sequenz hybridisierte, wurde isoliert und gereinigtThe methods were essentially those described by Huynh (1985), except that the library filters were subjected to two washes under stringent conditions, i.e., the washes were performed in 5x SSC, 0.1% SDS at 55 ° C, and each for 30 min. About 1 in 50,000 clones hybridized with the probe. A positive rekom. iant phage containing cDNA that hybridized to the sequence was isolated and purified
Dieser Phage wurde mit Clon 36 numeriert. This phage was numbered 36.
Downstram-cDNA-Sequenzen, die die Carboxyi-Ende-Sequenzen in Clon-81 -cDNA überlappen, wurden untor Vorwendung eines Verfahrens, das dem für die Isolierung von upstream-cDNA-Sequenzen ähnelt, isoliert, außer daß eine synthetische Oligonucleotid-Sonde, die zu einer 3'-terminalen Sequenz von Clon 81 homolog ist, hergestellt wurde. Die Sequenz des synthetischen Polynucleotide, die für das Screening eingesetzt wurde, lautete:Downstram cDNA sequences overlapping the carboxy terminus sequences in clone 81 cDNA were isolated except that a method similar to that for isolation of upstream cDNA sequences was used except that a synthetic oligonucleotide probe, which is homologous to a 3'-terminal sequence of clone 81. The sequence of the synthetic polynucleotides used for the screening was:
5' TTT GGC TAG TGG TTA GTG GGC TGG TGA CAG 3'5 'TTT GGC TAG TGG TTA GTG GGC TGG TGA CAG 3'
Ein positiver rekombinanter Phage, der cDNA enthielt, die mit dieser letzten Sequenz hybridisierte, wurde isoliert und gereinigt und mit Clon 32 numeriert.A positive recombinant phage containing cDNA that hybridized to this last sequence was isolated and purified and numbered with clone 32.
doppelsträngige Sequenz dieser cDNA, ihre Überlappungsregion mit der HCV-cDNA in Clon 81 und das durch den ORF codiertedouble-stranded sequence of this cDNA, its overlap region with the HCV cDNA in clone 81 and that encoded by the ORF
codieren die ORFs in den Clonen 36 und 81 in Kombination ein Polypeptid, das einen Teil eines großen HCV-Antigensrepräsentiert. Die Sequenz dieses mutmaßlichen HCV-Polypeptids und die es codierende doppelsträngige DNA-Sequenz, dieaus den kombinierten ORFs der HCV-cDNAs der Clone 36 und 81 abgeleitet ist, wird in Figur 6 gezeigt.In combination, the ORFs in clones 36 and 81 encode a polypeptide representing part of a large HCV antigen. The sequence of this putative HCV polypeptide and the double-stranded DNA sequence encoding it derived from the combined ORFs of the HCV cDNAs of clones 36 and 81 are shown in FIG.
unterschiedlichen Quellen abgeleitet wurde. Ein Fragment der cDNA enthielt 418 aus dem HCV-Genom abgeleitete Nucleotide;das andere Fragment umfaßte 172 aus dem Bactenophage-MS2-Genom abgeleitete l.'ucleotide, das während der Präparationder Lambdagtl 1-Plasma-cDNA-Bibliothok als Träger vorwendet wurde.was derived from different sources. One fragment of the cDNA contained 418 nucleotides derived from the HCV genome, the other fragment comprised 172 l.'ucleotides derived from the Bactenophage MS2 genome, which was used as a carrier during the preparation of the Lambdagtl 1 plasma cDNA library.
enthält ein kontinuierliches ORF, das sich in dem gleichen translational Rahmen befindet wie das durch Clon 81 codiertecontains a continuous ORF that is in the same translational frame as that encoded by clone 81
auf der 5 -Region von Clon 36 basierte. Die Sequenz dos für das Screening verwendeten synthetischen Polynucleotide W8".based on the 5 region of clone 36. The sequence of the synthetic polynucleotides W8 "used for the screening.
5' AAG CCA CCG TGT GCG CTA GGG CTC AAG CCC 3'5 'AAG CCA CCG TGT GCG CTA GGG CTC AAG CCC 3'
Ungefähr 1 in 50000 Clonen hybridisierte mit der Sonde. Der isolierte, gereinigte Clon des rekombinanten Phage, die cDNA enthielt, die an d!ese Sequsnz hybridisierte, wurde Clon 35 genannt.About 1 in 50,000 clones hybridized to the probe. The isolated, purified clone of the recombinant phage containing cDNA attached to d ! Seezusnz hybridized, clone 35 was named.
Die Nucleotid-Sequenz der cDNA in Clon 35 wuide im wesentlicnen wie in Abschnitt IV.A.2. beschrieben ermittelt. Die Sequenz, ihre Überlappungsregion mit der der cDNA in Clon 36 und das darin codierte mutmaßliche Polypeptid, werden in Figur 8 gezeigt. Clon 35 enthält offensichtlich einen einzelnen kontinuierlichen ORF, der in den gleichen translationalen Γ 'imen ein Poiypeptid codiert wie das durch Clon 36, Clon 81 und Clon 32 codierte. Figur 9 zeigt die Sequenz des langen kontinuierlichen ORFs, die durch die Clone 35,36,81 und 32 reicht und gemeinsam mit dem mutmaßlichen HCV-Polypeptid darin codiert ist. Diese kombinierte Sequenz ist unter Verwendung anderer unabhängiger cDNA-Clone, die aus der gleichen Lambda-gt11 -cDNA-Sibliothek abgeleitet wurden, bestätigt worden.The nucleotide sequence of the cDNA in clone 35 was essentially as described in Section IV.A.2. described determined. The sequence, its region of overlap with that of the cDNA in clone 36, and the putative polypeptide encoded therein are shown in FIG. Clone 35 apparently contains a single continuous ORF encoding a polypeptide peptide encoded by clone 36, clone 81 and clone 32 in the same translational Γ '. Figure 9 shows the sequence of the long continuous ORF which extends through clones 35, 36, 81 and 32 and is coded with the putative HCV polypeptide therein. This combined sequence has been confirmed using other independent cDNA clones derived from the same lambda gt11 cDNA library.
Die Isoliert ng ven HCV-cDNA-Sequenzen upstream von, und die jene in Clon-35-cDNA überlappen, wurde wie in Abschnitt IV.A.8. beschrieben für jene durchgeführt, die Clon-36-cDNA überlappen, außer daß das synthetische Polynucleotid auf der 5'-Region von Clon 35 basierte. Die Sequenz des für das Screening verwendeten synthetischen Polynucleotide war:The isolation of HCV cDNA sequences upstream from and overlapping those in clone 35 cDNA was performed as described in Section IV.A.8. described for those overlapping clone 36 cDNA, except that the synthetic polynucleotide was based on the 5 'region of clone 35. The sequence of the synthetic polynucleotides used for the screening was:
-24- 287 1 (K-24- 287 1 (K
5' CAG GAT GCT GTG TCC CGC ACT CAA CGT 3'5 'CAG GAT GCT GTG TCC CGC ACT CAA CGT 3'
Ungefähr 1 in 50000 Clonen hybridisierte mit der Sonde. Der isolierte, gereinigte Clon von rekombinanter Phage, der cDNA enthielt, die an diese Sequenz hybridisierte, wurde Clon 37b genannt.About 1 in 50,000 clones hybridized to the probe. The isolated, purified clone of recombinant phage containing cDNA that hybridized to this sequence was named clone 37b.
Die Nucleotid-Sequenzder cDNA in Clon 37 b wurde im wesentlichen wie in Abschnitt IV.A.2. beschrieben ermittelt. Die St ' onz, ihre Überlappungsregion mit der dar cDNA in Clon 35 und das darin codierte mutmaßliche Polypeptid werden in Figur ο dargestellt.The nucleotide sequence of the cDNA in clone 37b was prepared essentially as described in Section IV.A.2. described determined. The St 'onz, its overlap region with the cDNA in clone 35, and the putative polypeptide encoded therein are shown in Figure o.
Das 5'-terminale Nucleotid von Clon 35 ist ein T, wohingegen das entsprechende Nucleotid in Clon 37b ein A ist. Die cDNAs aus drei anderen unabhängigen Clonen, die während der Prozedur isoliert wurden, in der Clon 37 b entsprechend der Beschreibung in Abschnitt IV.A.10. isoliert wurde, wurden ebenfalls sequenziert. Die cDNAs aus diesen Clonen enthalten ebenfalls ein A in d'.^ser Position. Somit kann das 5'-terminale T in Clon 35 ein Artefakt der Clonierungsprozedur sein. Es ist bekannt, daß Artefakts oftmals an den 5'-Termini von cDNA-Molekülen auftreten.The 5'-terminal nucleotide of clone 35 is a T, whereas the corresponding nucleotide in clone 37b is A. The cDNAs from three other independent clones isolated during the procedure, in clone 37b, as described in Section IV.A.10. was isolated were also sequenced. The cDNAs from these clones also contain an A in this position. Thus, the 5'-terminal T in clone 35 can be an artifact of the cloning procedure. It is known that artifacts often occur at the 5 'termini of cDNA molecules.
Clon 37 b enthält offensichtlich einen kontinuierlichen offenen Leserahmen (ORF), der ein Polypeptid codiert, welches eine Fortsetzung des Poiypeptids ist, das in dem sich durch die überlappenden Clone, 36,36,81 und 32 erstreckenden offenen Leserahmen codiert ist.Clone 37b apparently contains a continuous open reading frame (ORF) encoding a polypeptide which is a continuation of the polypeptide encoded in the open reading frame extending through the overlapping clones, 36, 36, 81 and 32.
Die Isolierung von HCV-cDNA-Sequeizon ,downstream" von Clon 32 wurde wie folgt durchgeführt. Zuerst wurde Clon da isoliert, wobei eine synthetische Hybridisierungssonde verwendet wurde, die auf der Nucieotidsequenz der HCV-cDNA-Sequenz in Clon 32 basierte. Die Methode entsprach im wesentlichen der in Abschnitt IV.A.5. beschriebenen, nur daß die Sequenz der synthetischen Sonde so aussah:The isolation of HCV cDNA sequeizon "downstream" from clone 32 was performed as follows: First, clone was isolated using a synthetic hybridization probe based on the nucleotide sequence of the HCV cDNA sequence in clone 32. The method was equivalent essentially that described in Section IV.A.5., except that the sequence of the synthetic probe looked like this:
5 AGT GCA GTG GAT GAA CCG GCT GAT AGC CTT 3'.5 AGT GCA GTG GAT GAA CCG GCT GAT AGC CTT 3 '.
Unter Verwendung der Nucieotidsequenz von Clon da wurde ein weiteres synthetisches Nucleotid synthetisiert, das die folgende Sequenz hatte:Using the nucleotide sequence of clone da, another synthetic nucleotide was synthesized which had the following sequence:
5' TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'.5 'TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'.
Screening der Lambda-gt11 -Bibliothek unter Verwendung der von Clon da abgeleiteten Sequenz als Sonde ergab ungefähr 1 in 50000 positiven Kolonien. Ein isolierter gereinigter Clon, der mit dieser Sonde hybridisierte, wurde Clon 33b genannt.Screening of the lambda gt11 library using the clon da-derived sequence as a probe gave approximately 1 in 50,000 positive colonies. An isolated purified clone that hybridized with this probe was named clone 33b.
Die Nucieotidsequenz der cDNA in Clon 33b wurde im wesentlichen wie in Abschnitt IV.A.2. beschrieben bestimmt. Die Sequenz, ihre Region der Überlappung mit der der cDNA in Clon 32 und das darin codierte putative Polypeptid sind in Figur 11 dargestellt. Clon 33b enthält augenscheinlich einen kontinuierlichen offenen Leserahmen, der eine Erweiterung der offenen Leserahmen π den überlappenden Clonen, 37b, 35,36,81 und 32 ist. Das in Clon 33b codierte Polypeptid befindet sich im gleichen translational Rahmen wi 3 das im erweiterten offenen Leserahmen dieser überlappenden Clone codie. te.The nucleotide sequence of the cDNA in clone 33b was prepared essentially as described in Section IV.A.2. described determined. The sequence, its region of overlap with that of the cDNA in clone 32, and the putative polypeptide encoded therein are shown in FIG. Clone 33b evidently contains a continuous open reading frame which is an extension of the open reading frames π to the overlapping clones, 37b, 35, 36, 81, and 32. The polypeptide encoded in clone 33b is in the same translational framework as in the extended open reading frame of these overlapping clones. te.
Zur Isolierung von HCV-cDNAs, die die cDNAs in Clon 37b und in Clon 33b überlapper·, wurden die folgenden synthetischen Oligonucleotidsonden, die von den cDNAs in jenen Clonen abgeleitet wurden, verwendet, um die Lambda-gt11-Bibliothek zu „scree/ien", wobei im wesentlichen die in Abschnitt IV.A.3. beschriebene Methode angewendet wurde. Die Sonden:To isolate HCV cDNAs overlapping the cDNAs in clone 37b and in clone 33b, the following synthetic oligonucleotide probes derived from the cDNAs in those clones were used to scree / lambda the lambda gt11 library essentially using the method described in Section IV.A.3.
5' CAG GAT GCT GTC TCC CGC ACT CA/ CCT C 3'5 'CAG GAT GCT GTC TCC CGC ACT CA / CCT C 3'
5' TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'5 'TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'
wurden verwendet, um Kolonien zu finden, die HCV-cDNA-Sequenzen enthalten, die jene in den Clonen 37 b bzw. 3 b überlappen. Etwa 1 in 50000 Kolonien wurde mit jeder Sonde festgestellt. Ein Clon, der cDNA enthielt, die „upstream" von der cDNA in Clon 37 b war und diese überlappte, wurde Clon 40b genannt. Ein Clon, der cDNA enthielt, die »downstream" von der cDNA in clon 33 b war und diese überlappte, wurde Clon 25c genannt.were used to find colonies containing HCV cDNA sequences that overlap those in clones 37b and 3b, respectively. About 1 in 50,000 colonies were detected with each probe. A clone containing cDNA "upstream" from and overlapping the cDNA in clone 37b was named clone 40b, a clone containing cDNA "downstream" from cDNA in clone 33b and overlapping it Clone was named 25c.
bestimmt. Die Sequenzen von 40b und 25c, ihre Überlappungsregionen mit den oDNAs in den Clonen 37 b und 33 b und die darincodierten putativen Polypeptide werden in Figur 12 (Clon 40b) und in Figur 13 (Cl^i 25c) dargestellt.certainly. The sequences of 40b and 25c, their overlap regions with the oDNAs in clones 37b and 33b, and the darincodinated putative polypeptides are shown in Figure 12 (clone 40b) and in Figure 13 (Cl ^ i 25c).
während der Prozedur isoliert wurden, in der Cion 40b isoliert wurde, Beschreibung in Abschnitt IV.A.14., ebenfalls sequenziert.during the procedure in which Cion 40b was isolated, described in Section IV.A.14., also sequenced.
Die Clone 40b und 25c enthalten augenscheinlich jeweils einen offenen Leserahmen (ORF), der eine Erweiterung des kontinuierlichen offenen Leserahmens in den vorher sequenzierten Clonen ist. Die Nucleotidsequenz des offenen Leserahmens, die durch die Clone 40b, 37 b, 35,36,81,32,33b und 25c verläuft und die Aminosäuresequenz des darin codierten putativen Polypeptide werden in Figur 14 dargestellt. In der Figur wurden die potentiellen Artefakte von der Sequenz weggelassen, und statt dessen sind die entsprechenden Sequenzen in nicht-5'-terminalen Regionen multipler Überlappungsclone dargestellt.Clones 40b and 25c evidently each contain an open reading frame (ORF) which is an extension of the continuous open reading frame in the previously sequenced clones. The nucleotide sequence of the open reading frame passing through clones 40b, 37b, 35, 36, 81, 32, 33b and 25c and the amino acid sequence of the putative polypeptides encoded therein are shown in FIG. In the figure, the potential artifacts have been omitted from the sequence, and instead the corresponding sequences are shown in non-5'-terminal regions of multiple overlap clones.
IV.A.16. Herstellung einer zusammengesetzten HCV-cDNA aus den cDNAs in den Clonen 36,81 und 32 Die zusammengesetzte HCV-cDNA, C100, wurde wie folgt konstruiert. Zuerst wurden die cDNAs aus den Clonen 36,31 und 32 mit EcoRI ausgeschnitten. Das EcoRI-Fragment der cDNA von jedem Clon wurde individuell in die EcoRI-Stelle des Vektors pGEM3-blue (Promega Biotec) cloniert. Die entstehenden rekombinanten Vektoren, die dia cDNAs der Clone 36,81 und 32 enthielten, wurden pGEM3-blue/36, pGEM3-blue/81 bzw. pGEM3-blue/3 genannt. Die angemessen orientierte pGEM3-blue/81-Rekombinante wurde mit Nael und Narl digeriert, und das große (~2850bp) Fragment wurde gereinigt und mit dem kleinen (~570bp) Nael/Narl-gercinigten Restriktionsfragment von pGEM3-blu9/36 ligiert. Diese Zusammensetzung der cDNAs der Clone 36 und 81 wurde verwendet, um einen weiteren pGEM3-blue-Vektor zu erzeugen, der den kontinuierlichen HCV-ORF enthielt, der in der Überlappungs-cDNA innerhalb dieser Clone enthalten war. Dieses neue Plasmid wurde dann mit PVuII und EcoRI digeriert, um ein Fragment von etwa 680bρ freizusetzen, das dann mit dem kleinen (580 bp) Pvull/EcoRI-Fragment ligiert wurde, welches von dem entsprechend orientierten pGEM3-blue/32-Plasmid isoliert w:irde, und die zusammengesetzte cDNA aus den Clonen 36,81 und 32 wurde in den EcoRI-linearisierten Vektor pSODcf 1 ligiert, der in Abschniit IV.B.1. beschrieben wird, und der verwendet wurde, um Clon 5-1 -1 in Bakterien zu exprimieren. Rekombinanten, die das ~1270bp-EcoRI-Fragment von zusammengesetzter HCV-cDNA (C 100) enthalten, wurden selektioniert, und die cDNA von den Plasmiden wurde mit EcoRI ausgeschnitten und gereinigt.IV.A.16. Preparation of a Composite HCV cDNA from the cDNAs in Clones 36, 81 and 32 The composite HCV cDNA, C100, was constructed as follows. First, the cDNAs from clones 36, 31 and 32 were excised with EcoRI. The EcoRI fragment of the cDNA from each clone was individually cloned into the EcoRI site of the vector pGEM3-blue (Promega Biotec). The resulting recombinant vectors containing cDNAs of clones 36, 81 and 32 were named pGEM3-blue / 36, pGEM3-blue / 81 and pGEM3-blue / 3, respectively. The appropriately oriented pGEM3 blue / 81 recombinant was digested with Nael and NarI, and the large (~ 2850bp) fragment was purified and ligated to the small (~ 570bp) Nael / NarI-truncated restriction fragment of pGEM3-blu9 / 36. This composition of the cDNAs of clones 36 and 81 was used to generate another pGEM3 blue vector containing the continuous HCV ORF contained in the overlap cDNA within these clones. This new plasmid was then digested with PVuII and EcoRI to release a fragment of about 680bp, which was then ligated to the small (580 bp) Pvull / EcoRI fragment isolated from the appropriately oriented pGEM3-blue / 32 plasmid : and the composite cDNA from clones 36, 81 and 32 was ligated into the Eco RI-linearized vector pSODcf 1 described in Section IV.B.1. and was used to express clone 5-1-1 in bacteria. Recombinants containing the ~ 1270bp EcoRI fragment of composite HCV cDNA (C100) were selected and the cDNA from the plasmids was excised with EcoRI and purified.
IV.A.17. Isolierung und Nucleotldsequenzen von HCV-cDNAs In Clon 14I,11b,7f,7e, 8h, 33c, 14c, 8f, 33f, 33g und 39cc DieHCV-cDNAsinclonKi, 11b,7f,7e(8h,33c, 14c,8f,33f,33gund39cwurdendurchdieTechnikderIs lierungüberlappender cDNA-Fragmente aus der Iambda-gt11-Bibliothek von HCV-cDNAs isoliert, die in Abschnitt IV.A.1. beschrieben werden. Die angewendete Technik entsprach im wesentlichen der Beschreibung in Abschnitt IV.A.3., ausgenommen, daß die verwendeten Sonden aus der Nucleotidsequenz der zuletzt isolierten Clone des 5'- und dos 3'-Endes der kombinierten HCV-Sequenzen entworfen wurden. Die Frequenz der Clone, die mit den nachstehend beschriebenen Sonden hybridisierten, betrug etwa jeweils 1 in 50000.IV.A.17. Isolation and Nucleotide Sequences of HCV cDNAs In clones 14I, 11b, 7f, 7e, 8h, 33c, 14c, 8f, 33f, 33g and 39cc, the HCV cDNAs clone Ki, 11b, 7f, 7e ( 8h, 33c, 14c, 8f, 33f, 33g and 39c were isolated by the technique of ligating overlapping cDNA fragments from the Iambda gt11 library of HCV cDNAs described in Section IV.A.1 .. The technique used was essentially as described in Section IV.A.3., Except that the probes used were designed from the nucleotide sequence of the last isolated clones of the 5 'and the 3' end of the combined HCV sequences The frequency of the clones that hybridized with the probes described below was about 1 in every 50,000.
Die Nucleotldsequenzen der HCV-cDNAs in den Clonen 14i, 7f, 7e, 8h, 33c, 14c, 8f, 33f, 33g und 39c wurden im wesentlichen entsprechend der Beschreibung in Abschnitt IV.A.2. bestimmt, ausgenommen, daß die aus diesen Phagen ausgeschnittene cDNA an die Stelle der aus Clon 5-1 -1 isolierten cDNA gesetzt wurde.The nucleotide sequences of the HCV cDNAs in clones 14i, 7f, 7e, 8h, 33c, 14c, 8f, 33f, 33g, and 39c were prepared essentially as described in Section IV.A.2. except that the cDNA excised from these phages was substituted for the cDNA isolated from clone 5-1-1.
Clon 33c wurde unter Verwendung einer Hybridisierungssonde isoliert, die auf der Sequenz von Nucleotiden in Clon 40b basierte. Die Nucleotidsequenz von Clon 40b wird in Figur 12 dargestellt. Die Nucleotidsequenz der zur Isolierung von 33c verwendeten Sonde war:Clone 33c was isolated using a hybridization probe based on the sequence of nucleotides in clone 40b. The nucleotide sequence of clone 40b is shown in FIG. The nucleotide sequence of the probe used to isolate 33c was:
5' ATC AGG ACC GGG GTG AGA ACA ATT ACC ACT 3'5 'ATC AGG ACC GGG GTG AGA ACA ATT ACC ACT 3'
codierten Aminosäuren zeigt.coded amino acids shows.
5' AGA GAC AAC CAT GAG GTC CCC GGT GTT C 3'.5 'AGA GAC AAC CAT GAG GTC CCC GGT GTT C 3'.
Die Sequenz der HCV-cDNA in C!on 8h und die Überlappung mit der in Clon 33c und die darin codierten Aminosäuren sind in Figur 16 gezeigt.The sequence of the HCV cDNA in C! On 8h and the overlap with that in clone 33c and the amino acids encoded therein are shown in FIG.
Clon 7 e wurde unter Verwendung einer Sonde isoliert, die auf der Sequenz der Nucleotide in Clon 8 h basierte. Die .Nucleotidesequenz der Sonde warClone 7e was isolated using a probe based on the sequence of nucleotides in clone 8 h. The nucleotide sequence of the probe was
5' TCG GAC CTT TAC CTG GTC ACG AGG CAC 3'.5 'TCG GAC CTT TAC CTG GTC ACG AGG CAC 3'.
dargestellt.shown.
5' ACC TTC CCC ATT AAT GCC TAC ACC ACG GGC 3'.5 'ACC TTC CCC ATT AAT GCC TAC ACC ACG GGC 3'.
Die Sequenz der HCV-cDNA in Clon 14c, ihre Überlappung mit der in Clon 25c und die darin codierten Aminosäuren sind in Figur 18 dargestellt.The sequence of the HCV cDNA in clone 14c, its overlap with that in clone 25c and the amino acids encoded therein are shown in FIG.
Clon 8f wurde unter Verwendung einer Sonde isoliert, die auf der Sequenz von Nucleotiden in Clon 14c basierte. Die Nucleotidesequenz der Sonde warClone 8f was isolated using a probe based on the sequence of nucleotides in clone 14c. The nucleotide sequence of the probe was
5' TCC ATC TCT CAA GGC AAC TTG CAC CGC TAA 3'.5 'TCC ATC TCT CAA GGC AAC TTG CAC CGC TAA 3'.
Die Sequenz von HCV-CDNA in Clon 8f, ihre Überlappung mit der in Clon 14c und die darin codierten Aminosäuren sind in Figur 19 dargestellt.The sequence of HCV-CDNA in clone 8f, their overlap with that in clone 14c and the amino acids encoded therein are shown in FIG.
Clon 33f wurde unter Einsatz einer Sonde isoliert, die auf der in Clon 8f vorhandenen Nucleotidsequenz basierte. Die Nucleotidsequenz der Sonde warClone 33f was isolated using a probe based on the nucleotide sequence present in clone 8f. The nucleotide sequence of the probe was
5' TCC ATG GCT GTC CGC TTC CAC CTG CAA AGT 3'.5 'TCC ATG GCT GTC CGC TTC CAC CTG CAA AGT 3'.
Die Suquenz von HCV-cDNA in Clon 33f, ihre Überlappung mit der in Clon 8f und die darin codierten Aminosäuren werden in Figur 20 gezeigt.The sequence of HCV cDNA in clone 33f, its overlap with that in clone 8f and the amino acids encoded therein are shown in FIG.
Clon 33g wurde unter Verwendung einer Sonde isoliert, die auf der Sequenz von Nucleotiden in Clon 33f basierte. Die Nucleotidsequenz der Sonde warClone 33g was isolated using a probe based on the sequence of nucleotides in clone 33f. The nucleotide sequence of the probe was
5' GCG ACAATA CGA CAA CAT CCT CTG AGC CCG 3'.5 'GCG ACAATA CGA CAA CAT CCT CTG AGC CCG 3'.
Die Sequenz von HCV-cDNA in Clon 33g, ihre Überlappung mit der in Clon 33f und die darin codierten Aminosäuren sind in Figur 21 dargestellt.The sequence of HCV cDNA in clone 33g, its overlap with that in clone 33f and the amino acids encoded therein are shown in FIG.
Clon 7 f wurde unter Einsatz einer Sonde isoliert, die auf der Sequenz von Nucleotiden in Clon 7e basierte. Die Nuclootidsequenz der Sonde warClone 7f was isolated using a probe based on the sequence of nucleotides in clone 7e. The nucleotide sequence of the probe was
5'AGCAGACAAGGGGCCTCCTAGGGTGCATAATs'.5'AGCAGACAAGGGGCCTCCTAGGGTGCATAATs'.
Die Sequenz von HCV-cDNA in Clon 7f, ihre Überlappung mit Clon 73 und die darin codierten Aminosäuren sind in Figur 22 dargestellt.The sequence of HCV cDNA in clone 7f, its overlap with clone 73, and the amino acids encoded therein are shown in FIG.
Clon 11b wurde unter Verwendung einer Sonde isoliert, die auf der Sequenz von Clon 7 f basierte. Die Nucleoiidsequenz warClone 11b was isolated using a probe based on the sequence of clone 7f. The nucleoide sequence was
5' CAC CTA TGT TTA TAA CCA TGT CAC TCC TCT 3'.5 'CAC CTA TGT TTA TAA CCA TGT CAC TCC TCT 3'.
Die Sequenz der HCV-cDNA in Clon 11b, ihre Überlappung mit Clon 7f und die darin codierten Aminosäuren sind in Figur 23 dargestellt.The sequence of the HCV cDNA in clone 11b, its overlap with clone 7f, and the amino acids encoded therein are shown in FIG.
Clon 14 i wurde unter Verwendung einer Sonde isoliert, die auf der Sequenz von Nucleotiden in Clon 11b basierte. Die Nucleotidsequenz der Sonde warClone 14 i was isolated using a probe based on the sequence of nucleotides in clone 11b. The nucleotide sequence of the probe was
5' CTC TGT CAC CAT ATT ACA AGC GCT ATA TCA 3'.5 'CTC TGT CAC CAT ATT ACA AGC GCT ATA TCA 3'.
Die Sequenz der HCV-cDNA in Clon 14 i, ihre Überlappung mit 11 b und die darin codierten Aminosäuren sind in Figur 24 dargestellt.The sequence of the HCV cDNA in clone 14 i, its overlap with 11 b and the amino acids encoded therein are shown in FIG.
Clon 39c wurde unter Einsatz einer Sonde isoliert, die auf der Sequenz von Nucleotiden in Clon 33g basierte. Die Nucleotidsequenz der Sonde warClone 39c was isolated using a probe based on the sequence of nucleotides in clone 33g. The nucleotide sequence of the probe was
5' CTC GTT GCTACG TCA CCA CAA TTT GGT GTA 3'.5 'CTC GTT GCTACG TCA CCA CAA TTT GGT GTA 3'.
Die Sequenz von HCV-cDNA in Clon 39c, ihre Überlappung mit Clon 33g und die darin codierten Aminosäuren sind in Figur 25 dargestellt.The sequence of HCV cDNA in clone 39c, its overlap with clone 33g, and the amino acids encoded therein are shown in FIG.
IV.A.18. Die von Isolierten, HCV-cDNA enthaltenden Clonen abgeleitete zusammengesetzte HCV-cDNA-Sequenz Die HCV-cDNA-Sequenzen in den oben beschriebenen isolierten Clonen wurden in einer Linie angefordert, um eine zusammengesetzte HCV-cDNA-Sequenz zu schaffen. Die in der 5'-3'-Richtung angeordneten isolierten Clone sind: 14 i, 7 f, 7e, 8 h, 33c, 40b, 37 b, 35,36,81,32,33b, 25c, 14c, 8f, 33f, 33g und 39c. Eine von den isolierten Clonen abgeleitete zusammengesetzte HCV-cDNA-Sequenz und die darin codierten Aminosäuren sind in Figur 26 dargestellt.IV.A.18. The Composite HCV cDNA Sequence Derived from Isolated, HCV cDNA-containing Clones The HCV cDNA sequences in the isolated clones described above were requested in a line to create a composite HCV cDNA sequence. The isolated clones arranged in the 5'-3 'direction are: 14i, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f , 33g and 39c. A composite HCV cDNA sequence deduced from the isolated clones and the amino acids encoded therein are shown in FIG.
Bei der Schaffung der zusammengesetzten Sequenz wurden die folgenden Sequenzheterogenitäten berücksichtigt. Clon 33c enthält dine HCV-cDNA von 800 Basenpaaren, die die cDNAs in den Clonen 40 b und 37c überlappt. In Clon 33c sowie in 5 'anderen überlappenden Clonen ist Nucleotid 789 ein G. In Clon 37 b (siehe Abschnitt IV.A.11.) ist das entsprechende Nucleotid jedoch ein A. Diese Sequenzdifferenz schafft in den darin codierten Aminosäuren eine augenscheinliche Heterogenität, und zwar CYS oder TYR für G bzw. A. Diese Heterogenität kann hinsichtlich der Proteinfaltung wichtige Verzweigungen (ramifications) haben.In creating the composite sequence, the following sequence heterogeneities were considered. Clone 33c contains the 800 base pair HCV cDNA that overlaps the cDNAs in clones 40b and 37c. In clone 33c, as well as in 5 'other overlapping clones, nucleotide 789 is a G. In clone 37b (see Section IV.A.11.), However, the corresponding nucleotide is an A. This sequence difference creates apparent heterogeneity in the amino acids encoded therein. CYS or TYR for G and A, respectively. This heterogeneity may have important ramifications in protein folding.
Nucleotidrest 2 in Clon-8h-HCV-cDNA ist ein T. Wie jedoch nachstehend aufgezeigt wird, ist der entsprechende Rest in Clon 7 e ein A, Außerdem wird ein A in dieser Position auch in 3 anderen isolierten überlappenden Clonen gefunden. So kann der T-Rest in Clon 8h ein Clonierungsartefact darstellen. Deshalb wird der Rest in dieser Position in Figur 26 als ein A bezeichnet.Nucleotide residue 2 in clone 8h HCV cDNA is T. However, as shown below, the corresponding residue in clone 7 e is an A. In addition, an A in this position is also found in 3 other isolated overlapping clones. Thus, the T residue in clone 8h may represent a cloning artifact. Therefore, the remainder in this position is designated as an A in FIG.
Das 3'-terminale Nucleotid in Clon-8f-HCV-cDNA ist oin G. Der entsprechende Rest in Clon 33f und in zwei anderen überlappenden Clonen ist jedoch ein T. Deshalb wird der Rest in dieser Position in Figur 26 als ein T bezeichnet.The 3 'terminal nucleotide in clone 8f HCV cDNA is oin G. The corresponding residue in clone 33f and in two other overlapping clones, however, is T. Therefore, the remainder in this position in Figure 26 is designated as T.
Die 3'-terminsle Sequenz in Clon-33f-HCV-cDNA ist TTGC. Die entsprechende Sequenz in Clon 33g und in zwei anderen überlappenden Clonen ist jedoch ATTC. Deshalb ist in Figur 26 die entsprechende Region als ATTC dargestellt.The 3 'terminal sequence in clone 33f HCV cDNA is TTGC. However, the corresponding sequence in clone 33g and in two other overlapping clones is ATTC. Therefore, in Fig. 26, the corresponding region is shown as ATTC.
Nucleotidrest 4 in Clon-33g-HCV-cDNA ist ein T. In Clon 33f und in zwei anderen überlappenden Clonen ist der entsprechende Rest jedoch ein A. Deshalb wird der entsprechende Rest in Figur 26 als ein A bezeichnet.Nucleotide residue 4 in clone 33g HCV cDNA is a T. In clone 33f and in two other overlapping clones, however, the corresponding residue is an A. Therefore, the corresponding residue in Figure 26 is designated A.
Das 3'-Ende von Clon 14i ist AA, während das entsprechende Dinucleotid in Clon 11 b und in drei anderen Clonen TA ist. Deshalb wird in Figur 26 der TA-Rest dargestellt.The 3 'end of clone 14i is AA, while the corresponding dinucleotide in clone is 11b and in three other clones TA. Therefore, the TA remainder is shown in FIG.
Die Auflösung der anderen Sequenzheterogenitäten wird vorstehend diskutiert.The resolution of the other sequence heterogeneities is discussed above.
Eine Untersuchung der zusammengesetzten HCV-cDNA zeigt, daß sie einen großen offenen Leserahmen enthält. Das deutet darauf hin, daß das Virusgenom in ein großes Polypeptid translated wird, das gleichzeitig mit oder anschließend an die Translation prozessiert wird.Examination of the composite HCV cDNA reveals that it contains a large open reading frame. This suggests that the viral genome is translated into a large polypeptide which is processed simultaneously with or subsequent to translation.
IV.A.19. Isolierung und Nucleotldsequenzen von HCV-cDNAsln den Clonen 12f,35f, 19g,26g und 15e Die HCV-cDNAs in den Clonen 12 f, 35f, 19g, 26g und 15 e wurden im wesentlichen nach der in Abschnitt IVA17. beschriebenen Technik isoliert, ausgenommen, daß die Sonden wie unten angegeben waren. Die Frequenz von Clonen, die mit den Sonden hybridisierten, betrug in jedem Fall etwa 1 in 50000. Die Nucleotidsequenzen der HCV-cDNAs in diesen Clonen wurde im wesentlichen gemäß der Beschreibung in Abschnitt IV.A.2. bestimmt, ausgenommen daß die cDNA aus den angegebenen Clonen anstelle der aus Clon 5-1 -1 isolierten cDNA eingesetzt wurde.IV.A.19. Isolation and Nucleotide Sequences of HCV cDNAs in Clones 12f, 35f, 19g, 26g, and 15e The HCV cDNAs in clones 12f, 35f, 19g, 26g, and 15e were prepared essentially as described in Section IVA17. technique except that the probes were as indicated below. The frequency of clones that hybridized with the probes was in each case about 1 in 50,000. The nucleotide sequences of the HCV cDNAs in these clones were essentially as described in Section IV.A.2. except that the cDNA from the indicated clones was used in place of the cDNA isolated from clone 5-1-1.
Die Isolierung von Clon 12 f, der cDNA .upstream" von der HCV-cDNA in Figur 26 enthält, erfolgte unter Verwendung einer Hybridisierungssonde, die auf der Sequenz von Nucleotiden in Clon 14 i basierte. Die Nucleotidsequenz der Sonde warIsolation of clone 12f containing cDNA "upstream" from the HCV cDNA in Figure 26 was performed using a hybridization probe based on the sequence of nucleotides in clone 14i. The nucleotide sequence of the probe was
5' TQC TTG TGG ATG ATG CTA CTC ATA TCC CTA 3'.5 'TQC TTG TGG ATG ATG CTA CTC ATA TCC CTA 3'.
Die HCV-cDNA-Sequenz von Clon 12 f, ihre Überlappung mit Clon 14 i und die darin codierten Aminosäuren werden in Figur 27 dargestellt.The HCV cDNA sequence of clone 12f, its overlap with clone 14i, and the amino acids encoded therein are shown in FIG.
Die Isolierung von Clon 35f (? schlecht leserlich), der cDNA „downstream" von der HCV-cDNA in Figur 26 enthält, wurde unter Verwendung einer Hybridisierungssonde durchgeführt, die auf der Sequenz der Nucleotide in Clon 39c basierte. Die Nucleotidsequenz der Sonde warThe isolation of clone 35f (poorly legible) containing cDNA "downstream" from the HCV cDNA in Figure 26 was carried out using a hybridization probe based on the sequence of nucleotides in clone 39c The nucleotide sequence of the probe was
5'AGCAGCGGCGTCAAAAGTGAAGGCTAACTTs'.5'AGCAGCGGCGTCAAAAGTGAAGGCTAACTTs'.
Die Sequenz von Clon 35f, ihre Überlappung mit der Sequenz in Clon 39c und die darin codierten Aminosäuren sind in Figur dargestellt.The sequence of clone 35f, its overlap with the sequence in clone 39c, and the amino acids encoded therein are shown in FIG.
Die Isolierung von Clon 19g erfolgte unter Einsatz eir-ar Hybridisierungssonde, die auf der 3'-Sequenz von Clon 35 f basierte. Die Nucleotidsequenz der Sonde warClone 19g was isolated using an eir-ar hybridization probe based on the 3 'sequence of clone 35f. The nucleotide sequence of the probe was
5' TTC TCG TAT GAT ACC CGC TGC TTT GAC TCC 3'.5 'TTC TCG TAT GAT ACC CGC TGC TTT GAC TCC 3'.
Die HCV-cDNA-Sequenz von Clon 19g, ihre Überlappung mit der Sequenz in Clon 35 f und die darin codierten Aminosäuren werden in Figur 29 dargestellt.The HCV cDNA sequence of clone 19g, its overlap with the sequence in clone 35f, and the amino acids encoded therein are shown in FIG.
Die Isolierung von Clon 26g erfolgte unter Verwendung einer Hybridisierungssonde, die auf der 3'-Sequenz von Clon 19g basierte. Die Nucleotidsequenz der Sonde warIsolation of clone 26g was done using a hybridization probe based on the 3 'sequence of clone 19g. The nucleotide sequence of the probe was
5' TGT GTG GCG ACG ACT TAG TCG TTA TCT GTG 3'.5 'TGT GTG GCG ACG ACT TAG TCG TTA TCT GTG 3'.
Die HCV-cDNA-Sequenz von Clon 26g, ihre Überlappung mit der Sequenz in Clon 19g und die darin codierten Aminosäuren werden in Figur 30 dargestellt.The HCV cDNA sequence of clone 26g, its overlap with the sequence in clone 19g, and the amino acids encoded therein are shown in FIG.
Clon 15e wurde unter Verwendung einer Hybridisierungssonde isoliert, die auf der 3'-Sequenz von Clon 26g basierte. Die Nucleotidsequenz der Sonde warClone 15e was isolated using a hybridization probe based on the 3 'sequence of clone 26g. The nucleotide sequence of the probe was
5' CAC ACT CCA GTC AAT TCC TGG CTA GGC AAC 3'.5 'CAC ACT CCA GTC AAT TCC TGG CTA GGC AAC 3'.
Die HCV-cDNA-Sequenz von Clon 15e, ihre Überlappung mit der Sequenz in Clon 26g und die darin codierten Aminosäuren werden in Figur 31 dargestellt.The HCV cDNA sequence of clone 15e, its overlap with the sequence in clone 26g, and the amino acids encoded therein are shown in FIG.
Die in diesem Abschnitt beschriebenen Clone wurden unter den in Abschnitt H.A. beschriebenen Bedingungen bei der ATCC hinterlegt und erhielten die folgenden Zugriffsnurnmern:The clones described in this section were prepared under the conditions described in section H.A. deposited with the ATCC and received the following access nomenclatures:
Lambda-gt11 ATCC-No. HinterlegungsdatumLambda-gt11 ATCC-No. deposit date
Clon 12 f 40514 10. Novermer 1988Clon 12 f 40514 10th Novermer 1988
Clon 35 f 40511 10. November 1988Clone 35 f 40511 November 10, 1988
Clon15e 40513 10. November 1988Clon15e 40513 November 10, 1988
Clon K 9-1 40512 10. November 1988Clone K 9-1 40512 November 10, 1988
Die HCV-cDNA-Sequenzen in den oben beschriebenen isolierten Clonen wurden in einer Linie angeordnet, um die zusammengesetzte HCV-cDNA-Sequenz zu schaffen. Die in der 5'-3'-Richtung angeordneten isolierten Clone sind:The HCV cDNA sequences in the isolated clones described above were aligned to create the composite HCV cDNA sequence. The isolated clones arranged in the 5'-3 'direction are:
12f, 14i, 7f, 7e, 8h, 33c,40b,37b, 35,36,81,32,33b, 25c, 14c, 8f, 33f, 33g,39c, 35f, 19g, 26g und 15e.12f, 14i, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g and 15e.
Eine von den isolierten Clonen abgeleitete zusammengesetzte HCV-cDNA-Sequenz und die darin codierten Aminosäuren sind in Figur 32 dargestellt.A composite HCV cDNA sequence deduced from the isolated clones and the amino acids encoded therein are shown in FIG.
IV.A.20. Alternative Methode der Isolierung von cDNA-Sequenzen .upstream" von der HCV-cDNA-Sequenz In Clon 12f Auf der Basis der größten 3'-HCV-Sequenz in Figur 32, die von der HCV-cDNA in Clon 12f abgeleitet ist, werden kleine synthetische Oligonucleotidprimer von Reverser Transkriptase synthetisiert und zur Bindung an die entsprechende Sequenz in HCV-genomischer RNA, zum Starten der Reversen Transkription der «upstream" Sequenzen, verwendet. Die Primer-Sequenzen sind proximal zu der bekannten 5'-terminalen Sequenz von Clon 12 f, aber ausreichend .downstream", um den Entwurf vonSondensequonzen .upstream" von den Primer-Sequenzen zu gestatten. Bekannte Standardmethoden des Startens und Cionierens werden angewendet. Die entstehenden cDNA-Bibliotheken werden mit Sequenzen .uptstream" von den Bindungsorten (priming sites) gescreent (wie von der erläuterten Sequenz bei Clon 12 f hergleitet). Die HCV-genomische RNA wird entweder aus Plasma- oder Leberproben von Schimpansen mit NANBH oder aus analogen Proben von Menschen mit NANBH gewonnen.IV.A.20. Alternative Method of Isolation of cDNA Sequences .upstream "from the HCV cDNA Sequence In clone 12f. Based on the largest 3 'HCV sequence in Figure 32 derived from the HCV cDNA in clone 12f, small ones become synthetic oligonucleotide primers synthesized from reverse transcriptase and used to bind to the corresponding sequence in HCV genomic RNA to initiate reverse transcription of the upstream sequences. The primer sequences are proximal to the known 5'-terminal sequence of clone 12f, but sufficiently "downstream" to allow the design of probe sequences "upstream" from the primer sequences. Known standard startup and execution methods are used. The resulting cDNA libraries are screened with sequences "upstream" from the priming sites (as derived from the illustrated sequence at clone 12 f). HCV genomic RNA is either extracted from plasma or liver samples from chimpanzees with NANBH or from analog samples obtained from humans using NANBH.
IV.A.21. Alternative Methode unter Ausnutzung von »Teilen" zur Isolierung von Sequenzen aus der 5'-terminalen Region des HCV-GenomsIV.A.21. Alternative method using "parts" to isolate sequences from the 5'-terminal region of the HCV genome
Zur Isolierung der extremen 5'-terminalen Sequenzen des HCV-RNA-Genoms wird das cDNA-Produkt der ersten Runde der Reversen Transkription, die mit der Template-RNA duplexiert wird, mit Oligo-C-.tailed". Das wird erreicht, indem das Produkt in Anwesenheit von CTP mit terminaler Transferase inkubiert wird. Die zweite Runde der cDNA-Synthese, die das Komplement des ersten cDNA-Stranges liefert, erfolgt unter Verwendung von Oligo-G als Primer für die Reverse-Transkriptase-Reaktion. Die Quellen für genomische HCV-RNA werden in Abschnitt IV.A.20. beschrieben. Die Methoden für .tailing" mit... (unleserliche Stelle) sind wie in Maniatis et al. (1982). Die oDNA-Produkte werden dann cloniert, gescreent und sequenziert.To isolate the extreme 5'-terminal sequences of the HCV RNA genome, the cDNA product of the first round of reverse transcription duplexed with the template RNA is oligo-C-tailed The second round of cDNA synthesis, which provides the complement of the first cDNA strand, is performed using Oligo-G as the primer for the reverse transcriptase reaction Genomic HCV RNA is described in Section IV.A.20 .. The methods for tailing with ... (illegible site) are as described in Maniatis et al. (1982). The oDNA products are then cloned, screened and sequenced.
Diese Methode basiert auf früher angewendeten Methoden zur Clonierung von cDNAs von Flavivirus-RNA. Bei dieser Methode wird die RNA denaturierenden Bedingungen unterzogen, um sekundäre Strukturen am 3'-Ende zu entfernen, und wird dann unter Verwendung von rATP als Substrat mit Poly-A-Polymerase .tailed". Die Reverse Transkription der Poly-A-„tailed"-RNA wird durch Reverse Transkriptase katalysiert, wobei Oligo-dT als Primer eingesetzt wird. Die zweiten cDNA-Stränge werden synthetisiert, die cDNA-Produkte werden cloniert, gescreent und sequenziert.This method is based on previously used methods for cloning cDNAs of flavivirus RNA. In this method, the RNA is subjected to denaturing conditions to remove secondary structures at the 3 'end, and is then tailed using rATP as a substrate with poly A polymerase. The reverse transcription of the poly A tailed "RNA is catalyzed by reverse transcriptase using oligo-dT as a primer. The second cDNA strands are synthesized, the cDNA products are cloned, screened and sequenced.
IV.A.23. Schaffung von Lambda-gtH-HCV-cDNA-Bibllotheker, die größere cDNA-lnserts enthalten Die zur Schaffung und zum Screening der Lambda-gtl 1 -Bibliothek angewendeten Methode entspricht im wesentlichen der Beschreibung in Abschnitt IV.A.1., ausgenommen, daß die Bibliothek aus einem Pool größerer cDNAs erzeugt wird, die aus der Sepharose-CL-AB-Säulo (7 unleserlich) eluiert wurden.IV.A.23. Creation of Lambda gtH HCV cDNA libraries containing larger cDNA inserts. The method used to create and screen the lambda gt11 library is essentially as described in Section IV.A.1., Except that the library is generated from a pool of larger cDNAs eluted from the Sepharose CL-AB column (7 illegible).
IV.A.24. Schaffung von HCV-cDNA-Blbllotheken unter Verwendung synthetischer Ollgomere als Primer Neue HCV-cDNA-Bibliotheken wurden aus der RNA hergestellt, die von dem in Abschnitt IV.A.1. beschriebenen infektiösen Schimpansenplasmapool gewonnen wurde, und aus der Poly-A+-Fraktion, die von der Leber dieses infizierten Tieres gewonnen wurde. Die cDNA wurde im wesentlichen gemäß der Beschreibung von Gubler und Hoffman (1983) konstruiert, ausgenommen, daß die Primer für die Synthese des ersten cDNA-Strangos zwei synthetische Oligomere waren, die auf der Sequenz des oben beschriebenen HCV-Genoms basierten. Primer, die auf der Sequenz von Clon 11 b und 7e basierten, warenIV.A.24. Creation of HCV cDNA Blotlibraries Using Synthetic Ollgomers as Primers. New HCV cDNA libraries were prepared from RNA derived from that described in Section IV.A.1. obtained from the infectious chimpanzee plasma pool and from the poly-A + fraction recovered from the liver of this infected animal. The cDNA was constructed essentially as described by Gubler and Hoffman (1983), except that the primers for the synthesis of the first cDNA strand were two synthetic oligomers based on the sequence of the HCV genome described above. Primers based on the sequence of clones 11b and 7e were
5' CTG GCT TGA AGA ATC 3' h?w5 'CTG GCT TGA AGA ATC 3' h? W
AGT TAG GCT GGT GAT TAT GC 3'. AGT TAG GCT GGT GAT TAT GC 3 '.
Die entstehenden DNAs wurden in Lambda-Bakteriophage-Vektoren cloniert und mit verschiedenen anderen synthetischen Oligomeren, deren Sequenz auf der HCV-Sequenz, in Figur 32, basierte, gescreent.The resulting DNAs were cloned into lambda bacteriophage vectors and screened with various other synthetic oligomers whose sequence was based on the HCV sequence, Figure 32.
Antigeneantigens
pSODcf 1 (Steimer et al. (1986]) auf folgende Weise.pSODcf 1 (Steimer et al. (1986)) in the following manner.
ligiert, die durch die Restriktionsenzyme geschaffen wurde:ligated created by the restriction enzymes:
5' GAT CCT GGA ATT CTG ATA A 3' 3' GA CCT TAA GAC TAT TTT AA 5'5 'GAT CCT GGA ATT CTG ATA A 3' 3 'GA CCT TAA GAC TAT TTT AA 5'
Das das Insert enthaltende Plasmid wurde mit EcoRI restringiert (restricted). Das HCV-cDNA-lnsert in Clon 5-1 -1 wurde mit EcoRI ausgeschnitten und in diese EcoRI-linearisierte Plasmid-DNA ligiert. Das DNA-Gemisch wurde verwendet, um den E. coli-Stamm D1210 (Sadler et al. (198O]) zu transformieren. Rekombinanten mit der 5-1-1-cDNA in der richtigen Orientierung für die Expression des ORF, siehe Figur 1, wurden durch Restriktionskartierung und Nucleotidsequenzierung identifiziert. Rekombinante Bakterien von einem Clon wurden durch Züchten der Bakterien in Anwesenheit von IPTG zur Expression des SOD-NANB6.,.,-Polypeptide induziert.The plasmid containing the insert was restricted with EcoRI. The HCV cDNA insert in clone 5-1-1 was excised with EcoRI and ligated into this EcoRI-linearized plasmid DNA. The DNA mixture was used to transform E. coli strain D1210 (Sadler et al., 198O) Recombinants with the 5-1-1 cDNA in the correct orientation for expression of the ORF, see Figure 1 were identified by restriction mapping and nucleotide sequencing Recombinant bacteria from a clone were induced by culturing the bacteria in the presence of IPTG for expression of the SOD-NANB 6 , ·, - polypeptides.
Die in Clon 81 enthaltene HCV-cDNA wurde als ein SOD-NANB8,-Fusionspolypeptid exprimiert. Die Methode zur Herstellung des dieses Fusionspolypeptid codierenden Vektors war analog zu der Methode, die für die Schaffung des SOD-NANB6.,., codierenden Vektors eingesetzt wurde, mit dem Unterschied, daß die Quelle der HCV-cDNA Clon 81 war, der gemäß der Beschreibung in Abschnitt IV.A.3. isoliert wurde und für den die DNA-Sequenz gemäß der Beschreibung in Abschnitt IV.A.4. ermittelt wurde. Die Nucleotidsequenz der HCV-cDNA in Clon 81 und die putative Aminosäuresequenz des darin codierten Polypeptids sind in Figur 4 dargestellt.The HCV cDNA contained in clone 81 was expressed as a SOD-NANB 8 , fusion polypeptide. The method for preparing the vector encoding this fusion polypeptide was analogous to the method used to create the SOD-NANB 6 .,., Vector, except that the source of the HCV cDNA was clone 81, which was prepared according to the description in Section IV.A.3. and for which the DNA sequence described in Section IV.A.4. was determined. The nucleotide sequence of the HCV cDNA in clone 81 and the putative amino acid sequence of the polypeptide encoded therein are shown in FIG.
Das HCV-cDNA-lnsert in Clon 81 wurde mit EcoRI ausgeschnitten und in pSODcf 1 ligiert, das den Linker (siehe IV.B.1.) enthielt und durch Behandlung mit EcoRI linearisiert wurde. Das DNA-Gemisch wurde zur Ttansformierung des E. coll-Stammes D1210 verwendet. Rekombinanten mit der Clon-81-HCV-cDNA in der richtigen Orientierung für die Expression des in Figur 4 dargestellten ORF (offener Leserahmen) wurden durch Restriktionskartierung und Nucleotidsequenzierung identifiziert. Rekombinante Bakterien von einem Clon wurden durch Züchten der Bakterien in Anwesenheit von IPTG zur Expression des .ciOD-NANBB1-Polypeptids induziert.The HCV cDNA insert in clone 81 was excised with EcoRI and ligated into pSODcf 1 containing the linker (see IV.B.1.) And linearized by treatment with EcoRI. The DNA mixture was used to transform E. coli strain D1210. Recombinants with the clone 81 HCV cDNA in the correct orientation for the expression of the ORF (open reading frame) shown in Figure 4 were identified by restriction mapping and nucleotide sequencing. Recombinant bacteria from a clone were obtained by culturing the bacteria in the presence of IPTG for expression of the. c iOD-NANB B1 polypeptide induced.
IV.B.3. Identifizierung des in Clon 5-1-1 codierten Polypeptide als ein HCV- und NANBH-assozliertes Antigen Das in der HCV-cDNA von Clon 5-1 -1 codierte Polypeptid wurde als ein NANBH-assoziiertes Antigen identifiziert, indem demonstriert wurde, daß Seren von mit NANBH infizierten Schimpansen und Menschen immunologisch mit dem Fusionspolypeptid, SOD-NANB6.,.,, reagierten, welches zusammengesetzt ist aus Superoxiddismutase an seinem N-Terminus und dem »in-frame" 5-1-1-Antigen an seinem C-Terminus. Das erfolgte durch »Western blotting" (Towbin et al. [1979]) in folgenderWeise.IV.B.3. Identification of the Polypeptides Encoded in Clone 5-1-1 as an HCV and NANBH Associated Antigen The polypeptide encoded in the HCV cDNA of clone 5-1-1 was identified as a NANBH-associated antigen by demonstrating that sera of NANBH -infected chimpanzees and humans immunologically reacted with the fusion polypeptide, SOD-NANB 6 , 10, which is composed of superoxide dismutase at its N-terminus and the in-frame 5-1-1 antigen at its C This was done by Western blotting (Towbin et al., 1979) in the following manner.
Ein rekombinanter Bakterienstamm, der mit einem das SOD-NANB5.,.i-Polypeptid codierenden.Expressionsvektortransformiert war, siehe Beschreibung in Abschnitt IV.B.I., wurde durch Züchtung in Anwesenheit von IPTG zur Expression des Fusionspolypeptids induziert. Das gesamte Bakterienlysat wurde der Elektrophorese durch Polyacrylamidgele in Anwesenheit von SDS nach Laemmli (1970) unterzogen. Die separierten Polypeptide wurden auf Nitrocellulosefilter übertragen (Towbin et al. [1979]). Die Filter wurden dann in dünne Streifen geschnitten, und die Streifen wurden einzeln mit den unterschiedlichen Schimpansen- und Humanseren inkubiert. Gebundenn Antikörper wurden durch weitere Inkubation mit '"!-markiertem Schaf-Anti-Human-Ig, gemäß der Beschreibung in Abschnitt IV.A.1., nachgewiesen.A recombinant bacterial strain transformed with an expression vector encoding the SOD-NANB 5. , I polypeptide, as described in Section IV.BI, was induced by growth in the presence of IPTG to express the fusion polypeptide. All bacterial lysate was electrophoresed through polyacrylamide gels in the presence of SDS according to Laemmli (1970). The separated polypeptides were transferred to nitrocellulose filters (Towbin et al., 1979). The filters were then cut into thin strips and the strips were individually incubated with the different chimpanzee and human sera. Bound antibodies were detected by further incubation with ''! -Labeled sheep anti-human Ig as described in Section IV.A.1.
Die Charakterisierung der für die »Western blots" verwendeten Schimpansenseren und die Ergebnisse, dargestellt in der Fotografie der autoradiografiscri aufgenommenen Streifen, sind in Figur 33 zu sehen. Polypeptide enthaltende Nitrocellulosestreifen wurden mit Seren inkubiert, die von Schimpansen zu unterschiedlichen Zeitpunkten während der akuten NANBH-(Hutchinson-Stamm)-lnfektionen (spur [lane] 1-16), Hepatitis-A-Infektionen (Spur 17-24 und 26-33) und Hepatitis-B-Infektionen (Spur 34-44) gewonnen wurden. Die Spuren 25 und 45 zeigen positive Kontrollen, bei denen die Immunoblots mit Serum von dem Patienten inkubiert wurden, der zur Identifizierung des rekombinanten Clons 5-1-1 beim ursprünglichen Screening der Lambda-gt11 -cDNA-Bibliothek (siehe Abschnitt IV.A.1.) genommen wurde. Die in den Kontrollspuren 25 und 45 in Figur 23 sichtbare Bande widerspiegelt die Bindung von Antikörpern an die NANB6.,.,-Komponente des SOD-Fusionspolypeptids. Diese Antikörper wnisen nicht nur eine Bindung an SOD auf, da dieses ebenfalls als negative Kontrolle in diese Proben eingeschlossen wurde, sin wären als eine Bande erschienen, die signifikant schneller als das SOD-NANB6.,.,-Fusionspolypeptid migriert.The characterization of the chimpanzee sera used for Western blots and the results presented in the photograph of the autoradiographic strips are shown in Figure 33. Polypeptide-containing nitrocellulose strips were incubated with sera obtained from chimpanzees at different times during the acute NANBH (Hutchinson strain) infections (lane 1-16), hepatitis A infections (lanes 17-24 and 26-33), and hepatitis B infections (lanes 34-44) and Figure 45 shows positive controls in which the immunoblots were incubated with serum from the patient used to identify the recombinant clone 5-1-1 in the original screening of the lambda gt11 cDNA library (see Section IV.A.1.). The band visible in control lanes 25 and 45 in Figure 23 reflects the binding of antibodies to the NANB 6 ,., component of the SOD fusion polypeptide Binding to SOD, since this was also included as a negative control in these samples, would have appeared as a band migrating significantly faster than the SOD-NANB 6 .,., Fusion polypeptide.
Die Spuren 1-16 von Figur 33 zeigen die Antikörperbindung in Serumproben von 4 Schimpansen. Die Proben wurden unmittelbar vor der Infektion mit NANBH und dann während der akuten Infektion gewonnen. Die Figur vermittelt folgendes: Während in den Serumproben, die vor der Verabreichung des infektiösen HCV-lnoculum und während der frühen akuten Phase der Infektion gewonnen wurden. Antikörper, die immunologisch mit dem SOD-NANB5.,.,-Polypeptid reagierten, fehlten, induzierten alle 4 Tiere schließlich während des letzten Teils der akuten Phase oder im Anschluß daran zirkulierende Antikörper gegen dieses Polypeptid. Zusätzliche Bande, die bei den Schimpansen Nr.3 und 4 auf den Immunoblots beobachtet wurden, waren auf Hintergrundbindung (background binding) an Wirtsbakterienproteine zurückzuführen. Im Gegensatz zu den Resultaten, die mit Seren von mit NANBH infizierten Schimpansen gewonnen wurden, wurde die Entwicklung von Antikörpern gegen die NANBe-t-i-Komponente des Fusionspolypeptids bei 4 Schimpansen, die mit HAV infiziert waren, bzw. 3 Schimpansen, die mit HBV infiziert waren, nicht beobachtet. Die einzige Bindung war in diesen Fällen Hintergrundbindung an Wirtsbakterienproteine, die auch bei den HCV-infizierten Proben auftrat. Die Charakterisierung der für die »Western blots" verwendeten Humanseren und die Ergebnisse, die in der Fotografie der autoradiografisch aufgenommenen Streifen gezeigt sind, sind in Figur 34 zu sehen. Polypeptide enthaltende Nitrocellulosestreifen wurden mit Seren inkubiert, die von Menschen zu unterschiedlichen Zeitpunkten während der Infektion mit NANBH (Spur 1-21), HAV (Spur 33-40) und HBV (Spur 41-49) gewonnen wurden. Die Spuren 25 und 50 zeigen positive Kontrollen, bei denen die Immunoblots mit Patientenserum inkubiert wurden, das beim ursprünglichen Screening der <?bsn beschriebenen Lambda-gt11 -Bibliothek verwendet wurde. Die Spuren 22-24 und 26-32 zeigen »nicht infizierte" Koni ro'ien, bei denen die Seren von .normalen" Blutspendern stammten.Lanes 1-16 of Figure 33 show antibody binding in serum samples from 4 chimpanzees. The samples were obtained immediately before infection with NANBH and then during the acute infection. The figure provides as follows: While in serum samples obtained prior to administration of the infective HCV inoculum and during the early acute phase of infection. Antibodies immunoreactive with the SOD-NANB 5 ,., Polypeptide were absent, eventually inducing all 4 animals during the final part of the acute phase, or antibodies to this polypeptide thereafter. Additional bands observed on chimpanzees Nos. 3 and 4 on the immunoblots were due to background binding to host bacterial proteins. In contrast to the results obtained with sera from NANBH-infected chimpanzees, the development of antibodies against the NANBe-ti component of the fusion polypeptide has been in 4 chimpanzees infected with HAV and 3 chimpanzees infected with HBV, respectively were not observed. The only binding in these cases was background binding to host bacterial proteins, which also occurred in the HCV-infected samples. The characterization of the human sera used for the Western blots and the results shown in the photograph of the autoradiographically picked strips are shown in Figure 34. Polypeptide-containing nitrocellulose strips were incubated with sera from humans at different time points during infection NANBH (lane 1-21), HAV (lane 33-40), and HBV (lane 41-49). Lanes 25 and 50 show positive controls in which the immunoblots were incubated with patient serum which was used in the initial screening of the patient Lanes 22-24 and 26-32 show "uninfected" conidia in which the sera were derived from "normal" blood donors.
Wie aus Figur 34 ersichtlich ist, enthielten die Seren von neun NANBH-Patienten, einschließlich das zum Screening der L>mbdagti 1-Bibliothek verwendete Serum, Antikörper gegen die NANB6.,.,-Komponente des Fusionspolypeptids. Die Seren ve·, drei Patienton mit NANBH enthielten diese Antikörper nicht. Es ist möglich, daß sich die Anti-NANBs.,.,-Antikörper bei diesen Patienten zu einem späteren Zeitpunkt entwickeln. Es ist auch möglich, daß dieser Reaktionsmangel von einem unterschiedlichen NANBV-Agens resultierte, das bei den Individuen, von denen das nicht ansprechende Serum genommen wi'rde, auslösend für die Krankheit war.As can be seen in Figure 34, the sera from nine NANBH patients, including the serum used to screen the L mbdagti 1 library, contained antibodies to the NANB 6 ,., Component of the fusion polypeptide. The sera, three patients with NANBH did not contain these antibodies. It is possible that the anti-NANBs.,.., - develop antibodies in these patients at a later date. It is also possible that this lack of response resulted from a different NANBV agent that was causative for the disease in the individuals from whom the unresponsive serum was taken.
Figur 34 zeigt auch, daß Seren von vielen mit HAV und HBV infizierten Patienten keine AmI-NANB5.,.,-Antikörper enthielten, und daß diese Antikörper auch nicht in den Seren von »normalen" Kontrollen vorhanden waren. Obgleich ein HAV-Patient (Spur 36) augenscheinlich Anti-NANB^.,.,-Antikörper hat, ist es möglich, daß dieser Patient vorher mit HCV infiziert war, da die Inzidenz von NANBH sehr hoch ist und da sie oft subklinisch verläuft.Figure 34 also shows that sera from many patients infected with HAV and HBV did not contain AmI-NANB 5 .,... Antibodies, and that these antibodies were not present in the sera of "normal" controls, although an HAV patient (Lane 36) evidently anti-NANB ^.,., - antibodies, it is possible that this patient was previously infected with HCV, since the incidence of NANBH is very high and because it is often subclinical.
Diese serologischen Untersuchungen zeigen, daß die cDNA in Clon 5-1-1 Epitope codiert, die von Seren von mit BB-NANBV infizierten Patienten und Tieren spezifisch erkannt werden. Außerdem wird die cDNA augenscheinlich nicht von dem Primatengenom hergeleitet. Eine von Clon 5-1-1 oder von Clon 81 hergestellte Hybridisierungssonde hybridisierte unter Bedingungen, wo einzigartige, »single-copy'-Gene nachweisbar waren, nicht an .Southern blots" von Kontroll-Human- und -Schimpansen-genomischer DNA von nicht infizierten Individuen. Diese Sonden Hybridisierten auch nicht an »Southern blots" von Kontroll-Rinder-genomischer DNA.These serological studies show that the cDNA in clone 5-1-1 encodes epitopes specifically recognized by sera from BB-NANBV infected patients and animals. In addition, the cDNA apparently is not derived from the primate genome. A hybridization probe made by clone 5-1-1 or clone 81 did not hybridize to Southern blots of control human and chimpanzee genomic DNA under conditions where unique, single-copy genes were detectable These probes also did not hybridize to Southern blots of control bovine genomic DNA.
IV.B.4. Expression de* t.i einer Zusammensetzung der HCV-DNAs In Clon 36,81 und 32 codierten Polypeptids Das HCV-PoIypeptid, welches in dem offenen Leserahmen codiert ist, der sich durch Clon 36,81 und 32 erstreckt, wurde mit SOD als ein Fusionspolypeptid exprimiert. Das erfolgte durch Inserieren der zusammengesetzten cDNA (composite cDNA), C100, in eine Expreosionskassette, die das Human-Superoxiddismutase-Gen enthält. Inserieren der Expressionskassette in einen Hefeexpressionsvektor und Exprimieren des Polypeptids in Hefe.IV.B.4. Expression de ti * a composition of the HCV-DNAs in clone 36,81 and 32 The HCV polypeptide encoded PoIypeptid which is encoded in the open reading frame which extends by clone 36,81 and 32 was expressed as a fusion polypeptide with SOD , This was done by inserting the composite cDNA, C100, into an exposition cassette containing the human superoxide dismutase gene. Inserting the expression cassette into a yeast expression vector and expressing the polypeptide in yeast.
Eine Expressionskassette, die die von Clon 36,81 und 32 abgeleitete C 100-cDNA enthielt, wurde konstruiert, indem das ecow.Frigm.nt jn dje EcoRI-Stello des Vektors pS3-5G (auch pS356 genannt) inseriert wurde, wobei das Plasmid pS3-56c10o gewonnen wurde. Die Konstruktion von C100 ist in vorstehendem Abschnitt IV.A.16. beschrieben.An expression cassette containing the C "100" cDNA derived from clones 36, 81 and 32 was constructed by inserting the "ecow.Frigm.nt" into the " EcoRI" Stello of the vector pS3-5G (also called pS356), the plasmid pS3-56 c10 o was obtained. The construction of C100 is in Section IV.A.16 above. described.
Vektor pS3-56, der ein pBR322-Derivat ist, enthält eine Expressionskassette, die aus dem ADH2/GAPDH-Hybrid-Hefepromotor „upstream" von den Human-Superoxiddismutasegen und einem »downstream" GAPDH-Transkriptionsterminator zusammengesetzt ist. Eine ähnliche Kassette, die diese Kontrollelemente und das Superoxiddismutase-Gen enthält, ist bei Cousens et al. (1987) und in der gleichfalls anhängigen Anmeldung GPO 196056, veröffentlicht am I.Oktober 1986, die gemeinschaftliches Eigentum des Zessionärs dieser Anmeldung ist, beschrieben. Die Kassette in pS3-56 unterscheidet sich jedoch von der bei Cousens et al. (1987), wo das heterologe Proinsulingen und das Immunoglobulin »hinge" (Scharnier) deletiert werden, und wo sich an gln,M der Superoxiddismutase eine Adaptorsequenz anschließt, die eine EcoRI-Stelle enthält. Die Sequenz des Adaptors ist:Vector pS3-56, which is a pBR322 derivative, contains an expression cassette composed of the ADH2 / GAPDH hybrid yeast promoter "upstream" of the human superoxide dismutase gene and a "downstream" GAPDH transcription terminator. A similar cassette containing these control elements and the superoxide dismutase gene is described in Cousens et al. (1987) and co-pending application GPO 196056, published October 1, 1986, which is the common property of the assignee of this application. The cassette in pS3-56, however, differs from that in Cousens et al. (1987), where the heterologous proinsulin gene and the immunoglobulin hinge are deleted, and where an adapter sequence containing an Eco RI site joins gln M of the superoxide dismutase The sequence of the adapter is:
5'-AAT TTG GGA ATT CCA TAA TGA G -3'5'-AAT TTG GGA ATT CCA TAA TGA G -3 '
ACCCTTAAGGTATTACTCAGCTACCCTTAAGGTATTACTCAGCT
Die EcoRI-Stelle gestattet die Insertion von heterologen Sequenzen, die bei Expression von einem die Kassette enthaltenden Vektor Polypeptide liefern, die über einen die Aminosäuresequenz:The EcoRI site allows the insertion of heterologous sequences which, when expressed by a vector containing the cassette, yield polypeptides having an amino acid sequence:
-asn-leu-gly-ile-ar-Asn-leu-gly-ile-ar-
enthaltenden Oligopeptidlinker an Superoxiddismutase fusioniert werden.containing oligopeptide linker are fused to superoxide dismutase.
Eine Probe von pS 356 wurde am 29. April 1988 unter den Bedingungen des Budapester Vertrages b li der American Type Culture Collection (ATCC), 12301 Parklawn Dr., Rockville, Maryland 20853, hinterlegt und erhielt die Zugrift.'nummer 67683. Die Bedingungen bezüglich Verfügbarkeit und Zugriff zu dem hinterlegten Material und bezüglich Erhal'.ung des hinterlegten Materials entsprechen den in Abschnitt H.A. spezifizierten für Stämme, die NANBV-cDNAs enthal'dt. Diese Hinterlegung soll nur eine Erleichterung bieten, aber nicht die praktische Ausführung der Erfindung im Hinblick PajI die hier gegebene Beschreibung darstellen. Das hinterlegte Material ist hierin durch Bezugnahme eingeschlossen.A sample of pS 356 was deposited on April 29, 1988 under the terms of the Budapest Treaty b li of the American Type Culture Collection (ATCC), 12301 Parklawn Dr., Rockville, Maryland 20853, and was given accession number 67683. Conditions regarding availability and access to the deposited material and regarding the preservation of the deposited material correspond to those in section HA specified for strains containing NANBV cDNAs. This deposit is intended to provide relief, but not the practical implementation of the invention in terms of PajI the description given here. The deposited material is incorporated herein by reference.
Nach der Isolierung von Rekombinanten, die das C 100-cDNA-lnsert in der richtigen Orientierung enthalten, wurde die die C 100-cDNA enthaltende Expressionskassette mit BamMI aus pS3-56cioo ausgeschnitten, und ein die Kassette enthaltendes Fragment von ~3400bp wurde isoliert und gereinigt. Dieses Fragment wurde dann in die BamHI-Stelle des Hefevektors ρ AB 24 inseriert.After isolation of recombinants containing the C 100 cDNA insert in the correct orientation, the expression cassette containing the C 100 cDNA was excised from pS3-56cioo with BamMI and a ~ 3400 bp fragment containing the cassette was isolated and purified , This fragment was then inserted into the BamHI site of yeast vector ρ AB24.
Plasmid pAB24, dessen signifikante Merkmale in Figur 35 dargestellt sind, ist ein Hefe-„shuttle"-Vektor, der die komplette 2-Mikrometer-Sequenz für Replikation (Broach [1981 ]) und pBR322-Sequenzen enthält. Er enthält auch das von Plasmid YEp24 (Botstein et al. [1979)) abgeleitete Hefe-URA3-Gen und das von Plasmid pC1 /1 abgeleitete Hefe-LEU2d-Gen. EPO Veröffentlichungs-Nr. 116.201. Plasmid ρ AB 24 wurde beschrieben in US-Anmeldeaktenzeichen 138.894, dessen Eigentümer der hier angegebene Zessionär ist. Plasmid pAB24 wurde konstruiert, indem YEp24 mit EcoRI digeriert wurde und der Vektor religiert wurde, um die partielle 2-Mikrometer-Sequenz zu entfernen. Das entstehende Plasmid, YEP24de1taRI wurde durch Digestion mit CIaI linearisiert und mit dem kompletten 2-Mikrometer-Plasmid, das mit CIaI linoarisiert worden war, (!giert. Das resultierende Plasmid, pCBou wurde dann mit Sbal digeriert, und das 8605 bp-Vektorfragment wurde gelisoliert. Dieses isolierte Xbal-Fragment wurde mit einem 4460bp-Sbal-Fragment, welches das von pCI/1-isolierte LEUM-Gen enthielt, ligiert. Die Orientierung des LEUM-Gens hat die gleiche Richtung wie das URA3-Gen. Die Insertion der Expression erfolgte an der einzigartigen EcoRI-Stelle der pBR322-Sequenz (? unleserliche Stelle), wodurch das Gen bezüglich bakterieller Resistenz gegenüber Tetracyclin unterbrochen wurde.Plasmid pAB24, the significant features of which are shown in Figure 35, is a yeast "shuttle" vector containing the complete 2-micron sequence for replication (Broach [1981]) and pBR322 sequences, and also contains that of plasmid YEp24 (Botstein et al., 1979)) derived yeast URA3 gene and the yeast LEU 2d gene derived from plasmid pC1 / 1 EPO Publication No. 116,201 Plasmid ρ AB 24 has been described in US Application Serial No. 138,894. The plasmid pAB24 was constructed by digesting YEp24 with EcoRI and religating the vector to remove the 2 micron partial sequence The resulting plasmid, YEP24de1taRI, was linearized by digestion with ClaI and ligated to the plasmid pAB24 The resulting plasmid, pCBou, was then digested with SbaI and the 8605 bp vector fragment was gel isolated This isolated XbaI fragment was m to a 4460bp SbaI fragment containing the pCI / 1-isolated LEU M gene. The orientation of the LEU M gene is in the same direction as the URA3 gene. Insertion of the expression was at the unique EcoRI site of the pBR322 sequence (illegible site), disrupting the gene for bacterial resistance to tetracycline.
Das rekombinante Plasmid, das die SOD-C 100-Expressionskassette, pAB24100-3, enthielt, wurde in den Hefestamm JSC308 . sowie in andere Hefestämme transformiert. Die Zellen wurden nach der Beschreibung von Hinnen et al. (1978) transformiert und auf uraselektive Platten plattiert. Einzelne Kolonien wurden in leuselektive Medien inokuliert und bis zur Sättigung gezüchtet. Die Kultur wurde durch Züchten in YEP mit Gehalt von 1 % Glucose zur Expression des SOD-Polypeptids (genannt C100-3) induziert. Stamm ISC308 ist vom Genotyp MAT, leu2, ura3(del) DM15 (GAP/ADR 1), der am ADR1-Locus integriert ist. Bei JSC308 resultiert Überexpression des positiven Aktivatorgenproduktes ADR1 in Hyperderepression (im Verhältnis zu einer ADR1-Wildtyp-Kontrolle) und signifikant höheren Ausbeuten an exprimierten heterologen Proteinen, wenn solche Proteine über ein ADH 2-UAS-Reguliersystem synthetisiert werden. Die Konstruktion des Hefestammes JSC308 wird in der gleichfalls anhängigen Anmeldung, US-Anmeldeaktenzeichen (Attorney Docket No. (Anwaltsaktennummerl 2300-0229), offenbart, die gleichzeitig hiermit eingereicht wurde und hier durch Bezugnahme eingeschlossen ist. Eine Probe von JSC308 wurde am 5. Mai 1988 beim ATCC unter den Bedingungen des Budapester Vertrages hinterlegt und erhielt die Zugriffsnummer 20879. Die Bedingungen bezüglich Verfügbarkeit und Zugriff zu dem hinterlegten Material und bezüglich Erhaltung der Hinterlegung sind die gleichen wie die in Abschnitt U.A. für HCV-cüNAs enthaltende Stämme spezifizierten.The recombinant plasmid containing the SOD-C 100 expression cassette, pAB24100-3, was inserted into the yeast strain JSC308. and transformed into other yeast strains. The cells were prepared as described by Hinnen et al. (1978) and plated on ura-selective plates. Individual colonies were inoculated into leuselective media and grown to saturation. The culture was induced by growth in YEP containing 1% glucose for expression of the SOD polypeptide (called C100-3). Strain ISC308 is of the genotype MAT, leu2, ura3 (del) DM15 (GAP / ADR1) integrated at the ADR1 locus. In JSC308, overexpression of the positive activator gene product ADR1 results in hyperderepression (relative to an ADR1 wild-type control) and significantly higher yields of expressed heterologous proteins when such proteins are synthesized via an ADH 2 UAS regulatory system. The construction of yeast strain JSC308 is disclosed in co-pending application U.S. Attorney Docket No. (Attorney Docket No. 2300-0229), filed concurrently herewith and incorporated herein by reference A sample of JSC308 was made on May 5 Deposited with the ATCC under the terms of the Budapest Treaty in 1988 and received accession number 20879. The terms of availability and access to the deposited material and conservation of deposit are the same as those specified in section UA for strains containing HCV cuNAs.
Das in pAB24C100-3 codierte komplette CIOO-3-Fusionspolypeptid sollte 154 Aminosäuren von Human-SOD am Amino-Terminus, 5 vom die EcoRI-Stelle enthaltenden synthetischen Adaptor abgeleitete Aminsäurereste, 363 von C100-cDNA abgeleitete Aminosäurereste und 5 Carboxy-terminale Aminosäuren enthalten, die von der MS 2-Nucleotidsequenz abgeleitet sind, die der HCV-cDNA-Sequenz in Clon 32 benachbart ist. (Siehe Abschnitt IV.A.7.) Die putative Aminosäuresequenz des Carboxy-Terminus dieses Polypeptids, beginnend am vorletzten Ala-Rest von SOD, wird in Figur 34 dargestellt. Ebenfalls dargestellt ist die diesen Abschnitt des Polypeptids codierende Nucleotidsequertz.The complete CIOO-3 fusion polypeptide encoded in pAB24C100-3 should contain 154 amino acids of human SOD at the amino terminus, 5 from the EcoRI site-containing synthetic adapter-derived amino acid residues, 363 C100 cDNA-derived amino acid residues, and 5 carboxy-terminal amino acids derived from the MS 2 nucleotide sequence adjacent to the HCV cDNA sequence in clone 32. (See Section IV.A.7.) The putative amino acid sequence of the carboxy terminus of this polypeptide starting at the penultimate Ala residue of SOD is shown in FIG. Also shown is the nucleotide sequence encoding this portion of the polypeptide.
IV.B.5. Identifizierung des In C100 codierten Polypeptide alt ein NANBH-asiozllerte* Antigen Das aus Plasmid pAB24C 100-3 in Hefestamm JSC308 exprimierte CIOO-3-Fusionspolypeptid wurde in bezug auf Größe charakterisiert, und das in C100 codierte Polypeptid wurde aufgrund seiner immunologischen Reaktionsfähigkeit mit Sorum von oinem Menschen mit chromatischer NANBH als ein NANBH-assoziiertes Antigen identifiziert.IV.B.5. Identification of In C100 Encoded Polypeptides a NANBH-Asociated * Antigen The CIOO-3 fusion polypeptide expressed from plasmid pAB24C 100-3 in yeast strain JSC308 was characterized for size, and the polypeptide encoded in C100 was identified as having Sorum immunoreactivity identified a human with chromatic NANBH as a NANBH-associated antigen.
Das C100-3-PoIypeptid, das gemäß der Beschreibung in Abschnitt IV.B.4. exprimiert wurde, wurde folgendermaßen analysiert. Hefe-JSC-308-Zellen wurden mit ρ AB 24 oder mit pAB24C100-3 transformiert und wurden zur Expression des heterologen Plasmid-codierten Polypeptide induziert. Die induzierten Hefezellen in 1 ml Kultur (OD6M„ni~20) wurden durch einminütige Zentrifugation bei 10000 U/min pelletiert und wurden lysiert, indem sie kräftig (10x 1 min) mit 2 Volumen Lösung und 1 Volumen Glasperlen (0,2 Nanometer Durchmesser) verwirbelt wurden. Die Lösung enthielt 5OmM Tris-HCI, pH 8,0,1 mM EDTA, 1 mM Phenylmethylsulfonylfluorid (PMSF) und 1 Mikrogramm/ml Pepstatin. Unlösliches Material im Lysat, das das CIOO-3-Polypeplici enthielt, wurde durch Zentrifugation gesammelt (10000U/min über einen Zeitraum von 5 Minuten) und durch 5minütiges Sieden in Laemmli-SDS-Probenpuffer gelöst. (Siehe Laemmli [197O)). Eine Polypeptidmenge, die der in 0,3ml der induzierten Hefekultur äquivalent war, wurde Elektrophorese durch 10%ige Polyacrylamidgele in Anwesenheit von SDS nach Laemmli (1970) unterzogen. Proteinstandards wurden auf den Gelen co-elektrophoretisiert. Die exprimierten Polypeptide enthaltende Gele wurden entweder mit Coomassie-Brillantblau gefärbt oder «Western blotting" nach der Beschreibung in Abschnitt iV.B.2. unterzogen, wobei Serum von einem Patienten mit chronischer NANBH genommen wurde, um die immunologische Reaktionsfähigkeit der aus pAB 24 und aus pAB24C1OO-3 exprimierten Polypeptide zu bestimmen. Die Resultate sind in Figur 37 dargestellt. In Figur 37A wurden die Polypeptide mit Coomassie-Brillantblau gefärbt. Die unlöslichen Polypeptide von mit ρ AB 24 transformiertem JSC308 und von zwei weiteren Kolonien von mit pAB24C100-3 sind in den Spuren 1 (pAB24) bzw. 2 und 3 zu sehen. Ein Vergleich von Spur 2 und 3 mit Spur 1 zeigt die induzierte Expression eines Polypeptide entsprechend einer relativen Molekülmasse von ~ 54 000 Dalton aus mit pAB24C100-3transformiertem JSC 308, die nicht in mit pAB 24 transformiertem JSC308 induziert wird. Dieses Polypeptid wurd durch den Pfeil angezeigt. Figur 37B zeigt die Resultate der .Western blots" der in mit pAB24 (Spur 1) oder mit pAB24C100-3 (Spur 2) transformiertem Hefestamm JSC308 exprimierten unlöslichen Polypeptide. Die aus pAB24 exprimierten Polypeptide waren mit Serum von einem Menschen mit NANBH immunologisch nicht reaktionsfähig. Wie jedoch durch den Pfeil angegeben wird, exprimierte mit pAB24C100-3 transformierter JSC 308 ein Polypeptid mit einer relativen Molekülmasse von ~54 000 Dalton, das mit dem Human-NANBH-Serum reagierte. Die anderen immunologisch reaktionsfähigen Polypeptide in Spur 2 können Degradations- und/oder Aggregationsprodukte dieses ~54000-Dalton-Polypeptids sein.The C100-3 polypeptide prepared as described in Section IV.B.4. was expressed as follows. Yeast JSC-308 cells were transformed with ρ AB 24 or with pAB24C100-3 and were induced to express the heterologous plasmid-encoded polypeptides. The induced yeast cells in 1 ml of culture (OD 6M "ni-20) were pelleted by centrifugation at 10,000 rpm for 1 minute and were lysed by vigorous (10x 1 min) with 2 volumes of solution and 1 volume of glass beads (0.2 nanometers) Diameter) were swirled. The solution contained 50 mM Tris-HCl, pH 8.0.1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 microgram / ml pepstatin. Insoluble material in the lysate containing the CIOO-3 polypeptide was collected by centrifugation (10,000 rpm for 5 minutes) and dissolved in Laemmli SDS sample buffer for 5 minutes. (See Laemmli [197O]). A polypeptide amount equivalent to that in 0.3 ml of the induced yeast culture was subjected to electrophoresis through 10% polyacrylamide gels in the presence of SDS according to Laemmli (1970). Protein standards were co-electrophoresed on the gels. The gels containing expressed polypeptides were either stained with Coomassie Brilliant Blue or subjected to Western blotting as described in section IV.B.2., Taking serum from a patient with chronic NANBH to assess the immunological responsiveness of pAB 24 and pAB 24 The results are shown in Figure 37. In Figure 37A, the polypeptides were stained with Coomassie Brilliant Blue The insoluble polypeptides of JSC308 transformed with ρ AB 24 and of two further colonies of pAB24C100-3 are in lanes 1 (pAB24) and 2 and 3. A comparison of Lanes 2 and 3 with lane 1 shows the induced expression of a ~ 54,000 dalton molecular weight polypeptide from JSC 308 transformed with pAB24C100-3 which was not is induced in JSC308 transformed with pAB 24. This polypeptide was indicated by the arrow Figure 37B shows the results of. Western blots of the insoluble polypeptides expressed in yeast strain JSC308 transformed with pAB24 (lane 1) or with pAB24C100-3 (lane 2). The polypeptides expressed from pAB24 were not immunologically reactive with human serum with NANBH. However, as indicated by the arrow, JSC 308 transformed with pAB24C100-3 expressed a ~ 54,000 dalton molecular weight polypeptide that reacted with the human NANBH serum. The other immunologically reactive polypeptides in lane 2 may be degradation and / or aggregation products of this ~54,000 dalton polypeptide.
exprimiert wurde, gereinigt.was purified.
pH 12,0 extrahiert, und C100-3 in der verbleibenden unlöslichen Fraktion wurde in Puffer mit SDS-Gehalt löslich gemacht.pH 12.0 was extracted and C100-3 in the remaining insoluble fraction was solubilized in SDS-containing buffer.
einem gleichen Volumen Glasperlen (0,45 bis 0,50mm Durchmesser) gemischt, und das Gemisch wurde beian equal volume of glass beads (0.45 to 0.50 mm in diameter) and the mixture was added
wurden getrennt, und die Glasperlen wurden dreimal mit dem gleichen Volumen von Puffer A wie die anfänglich eingesetztenwere separated and the glass beads were washed three times with the same volume of Buffer A as that initially used
gewonnen, indem das Homogenat 15 Minuten bei 40C zentrifugiert wurde, die Pellets im doppelten Volumen von Puffer A wiedie anfänglich eingesetzten Zellen resuspendiert wurden, und das Material durch 15minütiges Zentrifugieren bei 7000 χ grepelletiert wurde. Dieser Waschvorgang wurde dreimal wiederholt.by centrifuging the homogenate at 4 ° C. for 15 minutes, resuspending the pellets in twice the volume of buffer A as the cells initially used, and pelletizing the material by centrifuging at 7,000 ° C. for 15 minutes. This washing was repeated three times.
pH-Wert der Suspension wurde durch Zusatz von 0,2 Volumen 0,4 M Na-Phosphatpuffer, pH 12,0, eingestellt. Nach dem Mischenwurde die Suspension 15 Minuten bei 4"C bei 7000 χ g zentrifugiert, und die überstehende Flüssigkeit wurde entfernt. DiepH of the suspension was adjusted by adding 0.2 volume of 0.4 M Na phosphate buffer, pH 12.0. After mixing, the suspension was centrifuged at 4 ° C for 15 minutes at 7000 g and the supernatant was removed
suspendiert wurden, wobei ein Suspensionsvolumen verwendet wurde, das zweimal dem der anfänglich eingesetzten Zellenentsprach. Daran schloß sich 15minütiges Zentrifugieren bei 40C bei 7000 χ g an.were suspended, using a suspension volume that was twice that of the cells initially used. This was followed by 15 minutes centrifugation at 4 0 C at 7000 g.
2%iges SDS wurde zugesetzt. Nach dem Mischen der Suspension wurde sie 15 Minuten lang bei 4°C bei 7000 χ g zentrifugiert.2% SDS was added. After mixing the suspension, it was centrifuged at 4 ° C for 15 minutes at 7000 g.
gesammelt.collected.
~ 54 000 Dalton.~ 54,000 daltons.
IV.C.1. Identifizierung von an HCV-cDNA hybridisierender RNA in der Leber eines Schimpansen mit NANBH Es wurde nachgewiesen, daß RNA aus der Leber eines Schimpansen, der NANBH hatte, eine RNA-Spezies enthielt, die an in Clon 81 enthaltende HCV-cDNA hybridisierte, und zwar durch .Northern blotting* auf folgende Weise.IV.C.1. Identification of RNA hybridizing to HCV cDNA in a chimpanzee liver with NANBH It was demonstrated that chimpanzee liver liver having NANBH contained an RNA species that hybridized to HCV cDNA containing clone 81 by .Northern blotting * in the following way.
RNA wurde aus Leberbiopsiematerial des Schimpansen isoliert, wovon das Plasma mit dem hohen Titer (siehe Abschnitt IV.A.1.) unter Anwendung von Techniken gewonnen wurde, die bei Maniatis et al. (1982) für die Isolierung von totaler RNA aus Säugetierzellen und für ihre Trennung in PoIy-A+- und PoIy-A"-Fraktionen beschrieben wurden. Diese RNA-Fraktionen wurden Elektrophorese auf einem Formaldehyd/Agarose-Gel (1 % Masse/Vol.) unterzogen und auf Nitrocellulose transferiert. (Maniatis et al. [1982]). Die Nitrocellulosefilter wurden mit radioaktiv markierter HCV-cDNA von Clon 81 hybridisiert (siehe Fig. 4 bezüglich der Nucleotidsequenz des Inserts). Zur Herstellung der radioaktiv markierten Sonde wurde das aus Clon 81 isolierte HCV-cDNA-Insert durch „nick'-Translation unter Verwendung von DNA-Polymerase I (Maniatis et al. (1982)) radioaktiv markiert. Die Hybridisierung erfolgte 18 Stunden bei 420C in einer Lösung, die 10% (Masse/Vol.) Dextransulfat, 50% (Masse/Vol.) deionisiertes Formamid, 75OmM NaCI, 75mM Na-Citrat, 2OmM Na2HPO4, pH6,5,0,1 % SDS, 0,02% (Masse/Vol.) Rinderserumalbumin (BSA = bovine serum albumin),0,02% (MasseAvOI.) Ficoll-400,0,02% (Masse/Vol.) Polyvinylpyrrolidon, 100 Mikrogramm/ml Salmspermien-DNA, die durch Beschallung geschert und denaturiert worden war, und 10eCPM/ml der „nick"-translatierten cDNA-Sonde enthielt.RNA was isolated from chimpanzee liver biopsy material from which the high titer plasma (see Section IV.A.1.) Was recovered using techniques described in Maniatis et al. (1982) for the isolation of total RNA from mammalian cells and for their separation into poly A + and poly A "fractions These RNA fractions were electrophoresed on a formaldehyde / agarose gel (1% mass / vol Maniatis et al., 1982.) The nitrocellulose filters were hybridized with radiolabelled HCV cDNA from clone 81 (see Figure 4 for the nucleotide sequence of the insert) radioactively labeled the HCV cDNA insert isolated from clone 81 by "nick" translation using DNA polymerase I (Maniatis et al., 1982) Hybridization was carried out at 42 ° C. for 18 hours in a solution containing 10 % (W / v) dextran sulfate, 50% (mass / volume) deionized formamide, 75 mM NaCl, 75 mM Na citrate, 20 mM Na 2 HPO 4 , pH 6.5, 0.1% SDS, 0.02% (mass / Vol.) Bovine serum albumin (BSA), 0.02% (mass AvOI) Ficoll-400.0.02% (w / v) Polyv inylpyrrolidone, 100 micrograms / ml salmon sperm DNA sheared and denatured by sonication containing 10 e CPM / ml of the nick-translated cDNA probe.
Eine autoradiographische Aufnahme des gesondeten Filters wird in Fig. 38 gezeigt. Spur 1 enthält "p-markierte Restriktionsfragmentmarker. Die Spuren 2-4 enthalten Schimpansenleber-RNA wie folgt: Spur 2 enthält 30 Mikrogramm totale RNA; Spur 3 enthält 30 Mikrogramm PoIy-A--RNA; und Spur 4 enthält 20 Mikrogramm PoIy-A+-RNA. Wie in Fig.32 gezeigt, enthält die Leber des Schimpansen mit NANBH eine heterogene Population von verwandten Poly-A*-RNA-Molekülen, die an die HCV-DNA-Sonde hybridisiert und die augenscheinlich etwa 5000 bis etwa 11000 Nucleotide groß ist. Diese RNA, die an die HCV-cDNA hybridisiert, könnte Virusgenome und/oder spezifische Transkripte des Virusgenoms darstellen.An autoradiographic image of the separate filter is shown in FIG. Lane 1 contains "p-labeled restriction fragment markers. Lanes 2-4 contain chimpanzee liver RNA as follows: lane 2 contains 30 micrograms of total RNA, lane 3 contains 30 micrograms of poly A - RNA, and lane 4 contains 20 micrograms of poly-A + RNA. As shown in Figure 32, the liver of the chimpanzee with NANBH contains a heterogeneous population of related poly a + RNA molecules which hybridizes to the HCV-DNA probe and the apparently about 5000 to about 11000 nucleotides This RNA, which hybridizes to the HCV cDNA, could be viral genomes and / or specific transcripts of the virus genome.
Das in nachstehendem Abschnitt IV.C.2. beschriebene Experiment bestätigt die Vermutung, daß HCV ein RNA-Genom enthält.The following in section IV.C.2. described experiment confirms the assumption that HCV contains an RNA genome.
IV.C.2. Identifizierung von HCV-abgelelteter RNA Im Serum von Infizierten Individuen Nucleinsäuren wurden aus Partikeln isoliert, die, wie in Abschnitt IV.A.1. beschrieben, aus Schimpansen-NANBH-Plasma mit hohem Titer isoliert wurden. Aliquoten (die 1 m! Originalplasma äquivalent waren) der isolierten Nucleinsäuren wurden in 20 Mikroliter 5OmM Hepes, pH7,5,1 mM EDTA und 16 Mikrogramm/ml hefelöslicher RNA resuspendiert. Die Proben wurden durch 5minütiges Sieden mit anschließendem sofortigen Frosten denaturiert und mit RNase A (5 Mikroliter mit Gehalt an 0,1 mg/ml RNase A in 25mM EDTA, 4OmM Hepes, pH7,5) oder mit DNAse I (5 Mikroliter mit Gehalt von 1 Einheit DNase I in 1OmM MgCI2,25mM Hepes, pH7,5) behandelt. Kontrollproben wurden ohne Enzym inkubiert. Nach der Inkubation wurden 230 Mikroliter eiskaltes 2XSSC mit Gehalt an 2 Mikrogramm/ml hefelöslichor RNA zugesetzt, und die Proben wurden auf einem Nitrocellulosefilter filtriert. Die Filter wurden mit einer cDNA-Sonde von Clon 81 hybridisiert, die durch „nick'-Translation 32p-markiert worden war. Fig. 39 zeigt eine autoradiographische Aufnahme des Filters. Hybridisierungssignale wurden in den DNase-behandelten Proben und Kontrollproben (Spuren 2 bzw. 1) nachgewiesen, aber nicht in der RNase-behandelten Probe (Spur 3). Da also RNase-A-Behandlung die von den Partikeln isolierten Nucleinsäuren zerstörten und DNase-Behandlung keinen Effekt hatte, kann man als erwiesen annehmen, daß das HCV-Genom aus RNA besteht.IV.C.2. Identification of HCV Derived RNA in the Serum of Infected Individuals Nucleic acids were isolated from particles which, as described in Section IV.A.1. isolated from high titer chimpanzee NANBH plasma. Aliquots (equivalent to 1 m of original plasma) of the isolated nucleic acids were resuspended in 20 microliters of 50 mM Hepes, pH7.5, 1 mM EDTA, and 16 micrograms / ml yeast-soluble RNA. The samples were denatured by boiling for 5 minutes with subsequent immediate freezing and RNase A (5 microliters containing 0.1 mg / ml RNase A in 25 mM EDTA, 40 mM Hepes, pH 7.5) or DNAse I (5 microliters containing 1 unit DNase I in 10 mM MgCl 2 , 25 mM Hepes, pH 7.5). Control samples were incubated without enzyme. After incubation, 230 microliters of ice-cold 2XSSC containing 2 micrograms / ml of yeast soluble RNA was added and the samples were filtered on a nitrocellulose filter. The filters were hybridized with a cDNA probe of clone 81 which had been 32p-labeled by nick translation. Fig. 39 shows an autoradiographic image of the filter. Hybridization signals were detected in the DNase-treated and control samples (lanes 2 and 1, respectively) but not in the RNase-treated sample (lane 3). Thus, because RNase-A treatment destroyed the nucleic acids isolated from the particles and DNase treatment had no effect, it can be assumed that the HCV genome consists of RNA.
IV.C.3. Nachwels von HCV-Nucleinsiuresequenzen In Leber- und Plasmaproben von Schimpansen mit NANBH abgeleitetenampliflzlertenNuclelnsauresequenzenIV.C.3. Detection of HCV nucleic acid sequences In liver and plasma samples from chimpanzees, NANBH derived amplified nucleic acid sequences
In der Leber und im Plasma von Schimpansen mit NANBH und bei Kontrollschimpansen vorhandene HCV-Nucleinsäuren wurden im wesentlichen unter Anwendung der von Saiki et al. (1986) beschriebenen PCR-Technik (PCR = polymorase chain reachon) amplifiziert. Die Primer-Oligonucleotide wurden von den HCV-cDNA-Sequenzen in Clon 81 oder Clon 36 und 37 abgeleitet. Die amplifizierten Sequenzen wurden durch Gelolektrophorese und .Southern blotting" nachgewiesen, wobei als Sonden das geeignete cDNA-Oligomer mit einer Sequenz von der Region zwischen, aber nicht einschließlich, der beiden Primer verwendet wurde.In the liver and plasma of chimpanzees with NANBH and in control chimpanzees existing HCV nucleic acids were essentially using the Saiki et al. (1986) PCR technique (PCR = polymorase chain reachon) amplified. The primer oligonucleotides were derived from the HCV cDNA sequences in clone 81 or clones 36 and 37. The amplified sequences were detected by gel electrophoresis and Southern blotting using as probes the appropriate cDNA oligomer having a sequence from the region between, but not including, the two primers.
Proben von RNA mit HCV-Sequenzen, die durch das Amplifikationssystem untersucht werden sollten, wurden aus Leberbiopsienmaterial von drei Schimpansen mit NANBH und von zwei Kontrolls :himpansen isoliert. Die Isolierung der RNA-Fraktion erfolgte durch die in Abschnitt IV.C.1. beschriebene Guanidiniumthiocyan itprozedur.Samples of RNA with HCV sequences to be examined by the amplification system were isolated from liver biopsy material from three chimpanzees with NANBH and from two control phalanxes. The isolation of the RNA fraction was performed by the methods described in Section IV.C.1. Guanidiniumthiocyan itprozedur described.
Durch das Amplifikationssystem zu untersuchende RNA-Proben wurden auch aus d >m Plasma von zwei Schimpansen mit NANBH und von einem Kontrollschimpansen sowie von einem Pool von Plasmen von Kontrollschimpansen isoliert. Ein infizierter Schimpanse hatte einen CID/ml gleich oder größer als 10', und der andere infizierte Schimpanse hatte einen CID/ml gleich oder größer als 10s.RNA samples to be tested by the amplification system were also isolated from the plasma of two chimpanzees with NANBH and a control chimpanzee, as well as a pool of control chimpanzee plasmas. One infected chimpanzee had a CID / ml equal to or greater than 10 ', and the other infected chimpanzee had a CID / ml equal to or greater than 10 seconds .
Die Nucleinsäuren wurden folgendermaßen aus dem Plasma extrahiert. Entweder 0,1 ml oder 0,01 ml Plasma wurden auf ein Endvolumen von 1,0ml verdünnt, und zwar mit einer TENB/Proteinase-K/SDS-Lösung (0.05M Tris-HCI, pH8,0,0,001 M EDTA, 0,1 M NaCI, 1 mg/ml Proteinase K und 0,5% SDS) mit einem Gehalt von 10 Mikrogramm/ml Polydenylsäure, und 60 Minuten bei 37X inkubiert. Nach dieser Proteinase-K-Digestion wurden die resultierenden Plasmafraktionen durch Extraktion mit TE-10,OmM Tris-HCI, pH 8,0,1 mM EDTA)-gesättigtem Phenol deproteinisiert. Die Phenolphase wurde durch Zentrifugation abgetrennt und mit 0,1 % SDS enthaltendem TENB reextrahiert. Die entstehenden wäßrigen Phasen von jeder Extraktion wurden gepooit und zweimal mit einom gleichen Volumen von Phenol/Chloroform/Isoamylalcohol (1:1 [99:2]) und dann zweimal mit einem gleichen Volumen eines 99:1 -Gemisches aus Chloroform/Isoamylaleohol extrahiert. Nach der Phasentrennung durch Zentrifugation wurde die wäßrige Phase auf eine Endkonzentratin von 0,2 M Na-Acetat gebracht, und die Nucleinsäuren wurden durch den Zusatz von zwei Volumen Ethanol ausgefällt. Die ausgefällten Nucleinsäuren wurden durch Ultrazentrifugation in einem SW-41-Rotor bei 38K 60 Minuten lang bei 40C rückgewonnen.The nucleic acids were extracted from the plasma as follows. Either 0.1 ml or 0.01 ml of plasma was diluted to a final volume of 1.0 ml with a TENB / Proteinase K / SDS solution (0.05M Tris-HCl, pH 8.0, 0.01 M EDTA, 0 , 1 M NaCl, 1 mg / ml proteinase K and 0.5% SDS) containing 10 micrograms / ml polydenylic acid, and incubated at 37X for 60 minutes. After this proteinase K digestion, the resulting plasma fractions were deproteinized by extraction with TE-10, OmM Tris-HCl, pH 8.0.1 mM EDTA) -saturated phenol. The phenol phase was separated by centrifugation and reextracted with TENB containing 0.1% SDS. The resulting aqueous phases from each extraction were puffed and extracted twice with an equal volume of phenol / chloroform / isoamyl alcohol (1: 1 [99: 2]) and then twice with an equal volume of a 99: 1 mixture of chloroform / isoamyl alcohol. After phase separation by centrifugation, the aqueous phase was brought to a final concentration of 0.2 M Na-acetate and the nucleic acids were precipitated by the addition of two volumes of ethanol. The precipitated nucleic acids were recovered by ultracentrifugation in a SW-41 rotor at 38K for 60 minutes at 4 0 C.
Außerdem wurden das Schimpansenplasma mit dem hohen Titer und das gesammelte Kontrollplasma abwechselnd nach dem Verfahren von Chomcyzaki und Sacchi (1987) mit 50 Mikrogramm Poly-A-Träger extrahiert. Sei dieser Verfahrensweise wird eine Säureguanidiniumthiocyanatextraktion angewendet. RNA wurde durch 10 Minuten lange Zentrifugation bei 10000U/min bei 40C in einer Eppendorf-Microfuge rückgewonnen.In addition, the high titer chimpanzee plasma and the collected control plasma were alternately extracted by the method of Chomcyzaki and Sacchi (1987) with 50 micrograms of poly A carrier. Using this procedure, acid guanidinium thiocyanate extraction is used. RNA was recovered by centrifugation for 10 minutes at 10000U / min at 4 0 C in an Eppendorf microfuge.
In zwei Fällen wurden vor der Synthese von cONA in der PCR-Reaktion die durch die Proteinase-K/SDS/Phenol-Methode auc dem Plasma extrahierten Nucleinsäuren weiter gereinigt, indem sie an S- und S-Elutip-R-Säulen gebunden und aus ihnen oluiert werden. Das Verfahren wurde nach den Richtlinien des Herstellers durchgeführt.In two cases, prior to the synthesis of cONA in the PCR reaction, the nucleic acids extracted from the plasma by the proteinase K / SDS / phenol method were further purified by binding to and from S and S-Elutip R columns be oluiert them. The procedure was carried out according to the manufacturer's guidelines.
Die als Matrize für die PCR-Reaktion verwendete cDNA wurde von den nach vorstehender Beschreibung hergestellten Nucleinsäuren (entweder totale Nucleinsäuren oder RNA) abgeleitet. Im Anschluß an die Ethanolpräzipitation wurden die präzipitierten Nucleinsäure getrocknet und in DEPC-behandeltem destilliertem Wasser resuspendiert. Sekundäre Strukturen in den Nucleinsäuren wurden durch lOminütiges Halten bei 650C getrennt, und die Proben wurden sofort auf Eis gekühlt. cDNA wurde unter Verwendung von 1 bis 3 Mikrogramm totaler Schimpansen-RNA aus der Leber oder von aus 10 bis 100 Mikrolitern Plasma extrahierten Nucleinsäuren (oder RNA) synthetisiert. Bei der Synthese wurde Reverse Tr. nskriptase verwendet, und sie erfolgte in einem 25-Mikroliter-Reaktionsgefäß nach dem vom Hersteller, BRL, spezifizierten Protokoll. Bei den Primern für die cDNA-Synthese handelte es sich um diejenigen, die auch bei der nachstehend beschriebenen PCR-Reaktion verwendet wurden. Alle Reaktionsgemische für die cDNA-Synthese enthielten 23 Einheiten des RNAase-lnhibitors RNASIN1" (Fisher/Promega). Im Anschluß an die cDNA-Synthese wurden die Reaktionsgemische mit W. serverdünnt, 10 Minuten gekocht und schnell auf Eis gekühlt.The cDNA used as template for the PCR reaction was derived from the nucleic acids prepared as described above (either total nucleic acids or RNA). Following ethanol precipitation, the precipitated nucleic acid was dried and resuspended in DEPC-treated distilled water. Secondary structures in the nucleic acids were separated by lOminütiges holding at 65 0 C, and the samples were immediately cooled on ice. cDNA was synthesized using 1 to 3 micrograms of total chimpanzee RNA from the liver or nucleic acids (or RNA) extracted from 10 to 100 microliters of plasma. In the synthesis, Reverse Tr. nskriptase and was carried out in a 25 microliter reaction vessel according to the protocol specified by the manufacturer, BRL. The primers for cDNA synthesis were those also used in the PCR reaction described below. All reaction mixtures for cDNA synthesis contained 23 units of the RNAase inhibitor RNASIN 1 "(Fisher / Promega) Following cDNA synthesis, the reaction mixtures were boiled with W. server diluted, 10 minutes and rapidly cooled on ice.
Die PCR-Reaktionen wurden im wesentlichen nach den Richtlinien des Herstellers ausgeführt (Cetus-Perkin-Elmer), mit Ausnahme des Zusatzos von 1 Mikrogramm RNase A. Die Reaktionen wurden in einem Endvolumen von lOOMikroliter durchgeführt. Die PCR-Technik erfolgte in 35 Zyklen mit einem Temperaturregime von 370C, 72°C und 94°0. Die Primer für die cDNA-Synthese und für die PCR-Reaktionen wurden von den HCV-cDNA-Sequenzen in (lon 81, Clon 36 oder Clon 37 b abgeleitet. (Die HCV-cDNA-Sequenzen von Clon 81,36 und 37 b sind in den Figuren 4,5 bzw. 10 dargestellt.) Die Sequenzen der beiden von Clon 81 abgeleiteten 16-mer Primer waren:The PCR reactions were carried out essentially according to the manufacturer's guidelines (Cetus-Perkin-Elmer), with the exception of the addition of 1 microgram of RNase A. The PCR technique was carried out in 35 cycles with a temperature regime of 37 0 C, 72 ° C and 94 ° 0. The primers for cDNA synthesis and for the PCR reactions were derived from the HCV cDNA sequences in (lon 81, clone 36 or clone 37b. (The HCV cDNA sequences of clones 81, 36 and 37 are b shown in Figures 4,5 and 10, respectively). The sequences of the two 16-mer primers derived from clone 81 were:
5'CAA TCA TAC CTG ACA G 3'und 5' GAT AAC CTC TGC CTG A 3'.5'CAA TCA TAC CTG ACA G 3 'and 5' GAT AAC CTC TGC CTG A 3 '.
Die Sequenz des Primers von Clon 36 war: 5' GCA TGT CAT GAT GTA T 3'The sequence of the primer of clone 36 was: 5 'GCA TGT CAT GAT GTA T 3'
Die Sequenz des Primers von Clon 37 b war: 5' ACA ATA CGT GTG TCA C 3'. The sequence of the clone 37 b primer was: 5 'ACA ATA CGT GTG TCA C 3'.
Bei den PRC-Reaktionen bestanden die Primerpaare entweder aus den beiden von Clon 81 abgeleiteten 16-mer von Clon 36 und dem 16-mer von Clon 37b.For the PRC reactions, the primer pairs consisted of either the two clon 81 derived 16-mer from clone 36 and the 16-mer from clone 37b.
Die Produkte der PCR-Reaktion wurden durch T ennung der Produkte durch Alkaligelelektrophorese, gefolgt von .Southern blotting" und Nachweis der ampüfizierten HCV-cDNA-Sequenzen mit einer "p-markierten internen Oligonucleotidsonde, die von einer nicht die Primer überlappenden Region der HCV-cDNA abgeleitet worden war, analysiert. Die PCR-Reaktionsgemische wurden mit Phenol/Chioroform extrahiert, und die Nucleinsäuren wurden aus der wäßrigen Phase mit Salz und Ethanol präzipitiert. Die präzipitierten Nucleinsäuren wurden durch Zentrifugation gesammelt und in destilliertem Wasser gelöst. Aliquoten der Proben wurden auf 1,8%igen alkalischen Agarosegelen der Elektrophorese unterzogen. Einzelsträngige DNAs mit einer Länge von 60,108 und 161 Nucleotiden wurden auf Gelen als „Marker" für die relative Molekülmasse co-elektrophoretisiert. Nach der Elektrophorese wurden die DNAs in dem Gel auf Biorad-Zet&-SondenTH-Papier transferiert. Prähybridisierung und Hybridisierung sowie Waschbedingungen entsprachen der Spezifikation des Herstellers (Biorad).The products of the PCR reaction were prepared by labeling the products by alkali gel electrophoresis followed by Southern blotting and detection of the amplified HCV cDNA sequences with a p-labeled internal oligonucleotide probe derived from a non-primer overlapping region of the HCV cDNA. cDNA was derived. The PCR reaction mixtures were extracted with phenol / chloroform and the nucleic acids were precipitated from the aqueous phase with salt and ethanol. The precipitated nucleic acids were collected by centrifugation and dissolved in distilled water. Aliquots of the samples were electrophoresed on 1.8% alkaline agarose gels. Single-stranded DNAs of 60.108 and 161 nucleotides in length were co-electrophoresed on gels as "molecular weight markers." After electrophoresis, the DNAs in the gel were transferred to Biorad-Zet & probes TH paper, prehybridization and hybridization, and washing conditions complied with the manufacturer's specification (Biorad).
Die für Hybridisierung/Nachweis der amplifizierten HCV-cDNA-Sequenzen verwendeten Sonden waren die folgenden. Wurde das PCR-Primerpaar von Clon 81 gewonnen, war die Sonde ein 108-mer mit einer Sequenz, die der in der Region zwischen den Sequenzen der beiden Primer gelegenen entsprach. Wurde das PCR-Primerpaar von Clon 36 und Clon 37 b abgeleitet, war die Sonde das von Clon 35 abgeleitete „nick'-translatierte HCV-cDNA-lnsert. Die Primer werden von den Nucleotiden 155-170 des Clon-37 b-lnserts und den Nucleotiden 206-268 des Clon-36-lnsorts abgeleitet. Das 3'-Ende des HCV-cDNA-lnserts in Clon 35 überlappt die Nucleotide 1-186 des Inserts in Clon 36; und das 5'-Ende des Clon-35-lnserts überlappt die Nucleotide 207-269 des Inserts in Clon 37b. (Vergleiche Figuren 5,8 und 10). So überspannt das cDNA-lnsert in Clon 35 einen Teil der Region zwischen den Sequenzen der von Clon 36 und Clon 37 b abgeleiteten Primer und ist nützlich als Sonde für die amplifizierten Sequenzen, die diese Primer einschließen.The probes used for hybridization / detection of the amplified HCV cDNA sequences were as follows. When the PCR primer pair was recovered from clone 81, the probe was a 108 mer with a sequence corresponding to that in the region between the sequences of the two primers. When the PCR primer pair was derived from clone 36 and clone 37b, the probe was the clone 35-derived nick-translated HCV cDNA insert. The primers are derived from nucleotides 155-170 of the clone 37 b insert and nucleotides 206-268 of the clone 36 site. The 3 'end of the HCV cDNA insert in clone 35 overlaps nucleotides 1-186 of the insert in clone 36; and the 5 'end of the clone 35 insert overlaps nucleotides 207-269 of the insert in clone 37b. (Compare Figures 5, 8 and 10). Thus, the cDNA insert in clone 35 spans a portion of the region between the sequences of clones derived from clone 36 and clone 37b and is useful as a probe for the amplified sequences that include these primers.
Die Analyse der RNA aus den Leberproben erfolgte nach der obigen Prozedur unter Einsatz beider Gruppen Primer und Sonden. Die RNA aus der Leber der drei Schimpansen mit NANBH lieferte positive Hybridisierungsergebnisse für Amplifikationssequenzen der erwarteten Größe (161 und 586 Nucleotide für 81 bzw. 36 und 37 b), während die Kontrollschimpansen negative Hybridisierungsergebnisse lieferten. Die gleichen Ergebnisse wurden erzielt, wenn das Experiment dreimal wiederholt wurdo.Analysis of the RNA from the liver samples was done according to the above procedure using both primer and probe groups. RNA from the liver of the three chimpanzees with NANBH provided positive hybridization results for amplification sequences of the expected size (161 and 586 nucleotides for 81 and 36 and 37b, respectively) while the control chimpanzees gave negative hybridization results. The same results were obtained when the experiment was repeated three times.
Die Analyse der Nucleinsäuren und RNA aus dem Plasma erfolgte ebenfalls nach der obigen Prozedur unter Einsatz der Primär und der Sonde von Clon 81. Die Plasmen stammten von zwei Schimpansen mit NANBH, von einem Kontrollschimpansen und gepoolten Plasmen von Kontrollschimpansen Beide NANBH-Plasmen enthielten Nucleinsäuren/RNA, was bei dem PCR-amplifizierten Assay zu positiven Ergebnissen führte, während beide Kontrollplasmen negative Resultate lieferten. Diese Resultate wurden mehrere Male in Wiederholungstests erzielt.The analysis of the nucleic acids and RNA from the plasma was also carried out according to the above procedure using the primary and probe of clone 81. The plasmas were from two chimpanzees with NANBH, a control chimpanzee and pooled plasma of control chimpanzees. Both NANBH plasmas contained nucleic acids / RNA, which gave positive results in the PCR-amplified assay, while both control plasmas gave negative results. These results were obtained several times in retest tests.
IV.D. Radlolmmunoassay zum Nachwels von HCV-Antikorpern im Serum von infizierten Individuen Festphasen-Radioimmunoassays zum Nachweis von Antikörpern gegen HCV-Antigene wurden auf der Basis von TSU und Herzenberg (1980) entwickelt. Mikrotiterplatten (Immulon 2, Removawell-Streiien) werden mit HCV-Epitope enthaltenden gereinigten Polypeptiden beschichtet. Die beschichteten Platten werden mit Humanserumproben inkubiert, von denen angenommen wird, daß sie Antikörper gegen die HCV-Epitope enthalten, oder mit geeigneten Kontrollen. Während derIV.D. Radiolum immunoassay for the detection of HCV antibodies in the serum of infected individuals. Solid phase radioimmunoassays for the detection of antibodies to HCV antigens were developed on the basis of TSU and Herzenberg (1980). Microtiter plates (Immulon 2, Removawell Strei) are coated with purified polypeptides containing HCV epitopes. The coated plates are incubated with human serum samples suspected of containing antibodies to the HCV epitopes, or with appropriate controls. During the
Inkubation wird der Antikörper, sofern vorhanden, immunologisch an das Fes'phasen-Antigen gebunden. Nach Entfernen des ungebundenen Materials und Waschen der M'krotiterplatten werden Komplexe von Human-Antikörper-NANBV-Antigen durch Inkubation mit '"l-markiertem Schaf-Anti-Human-Immunoglobulin nachgewiesen. Ungebundener markierter Antikörper wird durch Aspiration entfernt, und die Platten werden gewaschen. Die Radioaktivität in einzelnen Vertiefungen wird bestimmt; die Menge gebundenen Human-Anti-HCV-Antikörpern ist proportional zur Radioaktivität in der Vertiefung.Incubation, the antibody, if any, is immunologically linked to the Fes'phase antigen. After removal of the unbound material and washing of the M'crotiter plates, complexes of human antibody NANBV antigen are detected by incubation with l-labeled sheep anti-human immunoglobulin Unbound labeled antibody is removed by aspiration and the plates are harvested The radioactivity in individual wells is determined and the amount of bound human anti-HCV antibodies is proportional to the radioactivity in the well.
Das Fusionspolypeptid SOD-NANB6.,.,' exprimiert in rekombinanten Bakterien, wie in Abschnitt IV.B.1. beschrieben, wurde aus den rekombinanten E. coil durch differentials Extraktion der Zellenextrakto mit Harnstoff und anschließender Chromatographie auf Anionen- und Kationenaustauschersäulen wie folgt gereinigt.The fusion polypeptide SOD-NANB 6 .,... 'Expresses in recombinant bacteria as described in Section IV.B.1. was purified from the recombinant E. coli by differential extraction of the cell extract with urea and subsequent chromatography on anion and cation exchange columns as follows.
Aufgetaute Zellen von 1 Liter Kultur wurden in 10 nM 20%iger (Masse/Vol.) Sucrose mit Gehalt von 0,01 M Tris-HCI, pH 8,0, resuspendiert, und 0,4ml 0,5M EDTA. ?·Ά 8,Ov urdei. zugesetzt. Nach 5 Minuten bei 00C wurde das Gemisch 10 Minuten bei 4000 x g zentrifugiert. Das entstehende Pellet wurde in 10mi 25%iger (Masse/Vol.) Sucrose mit einem Gehalt von 0,05 N Tris-HCI, pH 8,0,1 mM Phenylmethylsulfonylfluorid (PMSF) und 1 Mikrogramm/ml Pepstatin A suspendiert, woran sich die Zugabe von 0,5ml Lysozym (10 mg/ml) ur.d Inkubation bei O0C über einen Zeitraum von 10 Minuten anschloß. Nach dem Zusatz von 10mir/oigem(Vol./Vol.)TritonX-100in0,05MTris-HCI,pH8,0,1mMEDTA,wurdedaiGemischweitere 10 MinutenbeiO°C unter gelegentlichem Schütteln inkubiert. Die entstehende viskose Lösung wurde homogenisiert, indem sie 6mal durch eine sterile hypoderme Nadel mit einer Feinheit von 20 Gauge geleitet und 25 Minuten bei 13000 χ g zentrifugiert wurde. Das pelletierte Material wurde in 5ml 0,01 M Tris-HCI, pH 8,0, suspendiert, und die Suspension wurde 10 Minuten lang bei 4000 χ g zentrifugiert. Das Pellet, das SOD-NANBs.,.,-Fusionsprotein enthielt, wurde in 5ml 6M Harnstoff in 0,02 M Tris-HCI, pH 8,0,1 mM Dithiotreitol (Puffer A) gelöst und auf eine mit Puffer A ausgeglichene Säule von Q-Sepharose Fast Flow gegeben. Polypeptide wurden mit einem linearen Gradienten von 0,0 bis 0,3M NaCI in Puffer A eluiert. Nach der Elution wurden die Fraktionen durch Polyacrylamidgelektrophorese in Anwesenheit von SDS zur Bestimmung ihres Gehaltes an SOD-NANB5.,., analysiert. Fraktionen, die dieses Polypeptid enthielten, wurden gesammelt und gegen 6M Harnstoff in 0,02 M Natriumpho'.pnatpulfer, pH 6,0,1mM Dithiothreitol (Puffer B) dialysiert. Die dialysierte Probe wurde auf eine mit Puffer 8 ausgeglichene Säule von S-Sepharose Fast Flowgegeben, und Polypeptide wurden mit einem linearen Gradienten von 0,0to 0,3 M NaCI in Puffer B eluiert. Die Fraktionen wurden durch Polyacrylamidgelektrophorese auf die Anwesenheit von SOD-NAP 3s-m hin analysiert, und die geeigneten Fraktionen wurden gepoolt.Thawed 1 liter culture cells were resuspended in 10 mM 20% (mass / volume) sucrose containing 0.01 M Tris-HCl, pH 8.0, and 0.4 ml 0.5 M EDTA. ? · Ά 8, Ov urdei. added. After 5 minutes at 0 0 C, the mixture was centrifuged for 10 minutes at 4000 xg. The resulting pellet was suspended in 10mL of 25% (mass / volume) sucrose containing 0.05N Tris-HCl pH 8.0.1mM phenylmethylsulfonyl fluoride (PMSF) and 1 microgram / ml Pepstatin A followed by followed by the addition of 0.5 ml lysozyme (10 mg / ml) incubation at 0 ° C over a period of 10 minutes. After the addition of 10% (v / v) Triton X-100 in 0.05 M Tris HCl, pH 8.0, 1 mM EDTA, the mixture was further incubated at 0 ° C for 10 minutes with occasional shaking. The resulting viscous solution was homogenized by passing 6 times through a 20 gauge sterile hypodermic needle and centrifuging at 13,000 g for 25 minutes. The pelleted material was suspended in 5 ml of 0.01 M Tris-HCl, pH 8.0, and the suspension was centrifuged at 4000 g for 10 minutes. The pellet containing SOD-NANBs.,., - fusion protein was dissolved in 5 ml of 6M urea in 0.02M Tris-HCl, pH 8.0.1mM dithiothreitol (buffer A), and placed on a buffer A balanced column given by Q-Sepharose Fast Flow. Polypeptides were eluted with a linear gradient of 0.0 to 0.3 M NaCl in Buffer A. After elution, the fractions were analyzed by polyacrylamide gel electrophoresis in the presence of SDS to determine their content of SOD-NANB 5 .,. Fractions containing this polypeptide were collected and dialysed against 6M urea in 0.02M sodium phosphate buffer, pH 6.0.1 mM dithiothreitol (Buffer B). The dialyzed sample was loaded onto a buffer 8 equilibrated column of S-Sepharose Fast Flow, and polypeptides were eluted with a linear gradient of 0.0 to 0.3 M NaCl in buffer B. The fractions were analyzed for the presence of SOD-NAP 3s-m by polyacrylamide gel electrophoresis and the appropriate fractions were pooled.
Das fertige SOD-NANB6.:.,-Polypeptidpräparat wurde durch Elektrophorese auf Polyacrylamidgelen in Anwesenheit von SDS untersucht. Auf der Basis dieser Analyse war das Präparat zu mehr als 80% rein.The final SOD-NANB 6 .: -, polypeptide preparation was examined by electrophoresis on polyacrylamide gels in the presence of SDS. Based on this analysis, the preparation was more than 80% pure.
rekombinantem E. coil durch differentielle Extraktion der Zellenextrakte mit Harnstoff, gefolgt von Chromatographie aufrecombinant E. coli by differential extraction of the cell extracts with urea, followed by chromatography
beschriebenen Prozedur (siehe Abschnitt IV.D.1.), gereinigt.described procedure (see Section IV.D.1.).
untersucht. Auf der Basis dieser Analyse war das Präparat zu mehr als 50% rein.examined. Based on this analysis, the preparation was more than 50% pure.
IV.D.3. Nachwels von Antikörpern gegen HCV-Epitope durch Festphasen-Radiolmmunoassay Serumproben von 32 Patienten, bei denen ΝΛΝΒΗ diagnostiziert worden war, wurden durch Radioimmunoassay (RIA) analysiert, um zu ermitteln, ob Antikörper gegen in Fusionspolypeptiden SOD-NANB6.,.ι und SOD-NANB1I vorhandene HCV-Epitope nachweisbar waren.IV.D.3. Detection of Antibodies Against HCV Epitopes by Solid-Phase Radiolum Immunoassay Serum samples from 32 patients diagnosed with ΝΛΝΒΗ were analyzed by radioimmunoassay (RIA) to determine whether antibodies to fusion polypeptides SOD-NANB 6 , ι, and SOD -NANB 1 I existing HCV epitopes were detectable.
Mikrotiterplatten wurden mit SOD-NANB6.,., oder SOD-NANB,, beschichtet, die nach den Abschnitten IV.D.1. bzw. IV.D.2. partiell gereinigt worden waren. Die Assays wurden wie folgt ausgeführt. 100-Milliliter-Aliquoten mit einem Gehalt von 0,1 bis 0,5 Mikrogramm SODNANB6.,., oder SOD-NANBj, in 0,125 M Na-Boratpuffer, pH 8,3,0,07 5,M NaCI (BBS) wurden in jede Vertiefung einer Mikrotiterplatte (Dynatech Immulon 2 Rmovawell-Streifen) gegeben. Die Platte wurde über Nacht bei 40C in einer feuchten Kammer inkubiert, wonach die Proteinlösung entfernt wurde und die Vertiefungen dreimal mit BBS mit einem Gehalt von 0,02% Triton X-100 (BBST) gewiischen wurden. Zur Verhinderung nichtspezifi&cher Bindung wurden die Vertiefungen mit Rinderserumalbumin (BSA) unter Zusatz von 100 Mikroiitern einer 5 mg/ml Lösung von BSA in BBS überzogen, woran sich Inkuuation bei Raumtemperatur über einen Zeitraum von einer Stunde anschloß. Nach dieser Inkubation wurde die BSA-Lösung entfernt. Die Polypeptide in den beschichteten Vertiefungen wurden mit Serum zur Reaktion gebracht, indem 100 Mikroliter Serumproben, verdünnt im Verhältnis 1:100 in 0,01 M Na-Phosphatpuffer, pH 7,2,0,15 M NaCI (PES) mit einem Gehalt von 10mg/ml BSA, zugesetzt wurden und die Vertiefungen mit dem Serum 1 Stunde bei 370C inkubiert wurden. Nach der Inkubation wurden die Serumproben durch Aspiration entfernt, und die Vertiefungen wurden 5mal mit BBST gewaschen. An die Fusionspolypep'ide gebundenes AnIi-NANB6.,., und Anti-NANB(, wurde durch die Bindung von '"l-markiertom F'(ab)rSchaf-Anti-Human-lgG an die beschichteten Vertiefungen bestimmt. Aliquote Mengen von 100 Mikroiitern der markierten Sonde (spezifische Aktivität 5-20 Mikrocurie/Mikrogramm) wurden in jede Vertiefung gegeben, und die Platten wurden eine Stunde lang bei 370C inkubiert, woran sich Entfernung von überschüssiger Sonde durch Aspiration und 5 Wäschen mit BBST anschlossen. Die Menge Radioaktivität, die in jeder Vertiefung gebunden war, wurde durch Zählen in einem Zähler, der Gammastrahlung nachweist, bestimmtMicrotiter plates were coated with SOD-NANB 6 .,., Or SOD-NANB ,, which was prepared according to Sections IV.D.1. or IV.D.2. had been partially cleaned. The assays were performed as follows. 100 milliliter aliquots containing 0.1 to 0.5 micrograms SODNANB 6 .,., Or SOD-NANBj, in 0.125 M Na borate buffer, pH 8.3, 0.07 5, M NaCl (BBS). were added to each well of a microtiter plate (Dynatech Immulon 2 Rmovawell strips). The plate was incubated overnight at 4 ° C. in a humid chamber, after which the protein solution was removed and the wells were bled three times with BBS containing 0.02% Triton X-100 (BBST). To prevent nonspecific binding, the wells were coated with bovine serum albumin (BSA) with the addition of 100 μL of a 5 mg / ml solution of BSA in BBS, followed by room temperature incubation over a period of one hour. After this incubation, the BSA solution was removed. The polypeptides in the coated wells were reacted with serum by adding 100 microliter of serum samples diluted 1: 100 in 0.01 M Na phosphate buffer, pH 7.2, 0, 15 M NaCl (PES) containing 10 mg / ml BSA were added and the wells were incubated with the serum for 1 hour at 37 0 C. After incubation, the serum samples were removed by aspiration and the wells were washed 5 times with BBST. AnIi-NANB 6 .,., And anti-NANB ( , was bound to the fusion polypeptides by the binding of '' L-tagged F '(ab) r sheep anti-human IgG to the coated wells amounts of 100 Mikroiitern the labeled probe (specific activity 5-20 microcuries / microgram) were added to each well, and the plates were incubated for one hour at 37 0 C, followed by joined removal of excess probe by aspiration and 5 washes with BBST The amount of radioactivity bound in each well was determined by counting in a counter that detects gamma radiation
Die Ergebnisse des Nachweises von AnIi-NANB6.,., und Anti-NANBg, in Individuen mit NANBH sind in Tabelle 1 angegeben.The results of detection of AnIi-NANB 6 .,., And anti-NANBg in individuals with NANBH are given in Table 1.
Patientenbezugs nummerPatient reference number
S/NS / N
Diagnosediagnosis
1 Von diesen Patienten stehen sequentielle Serumproben zur Verfugung.1 Of these patients, sequential serum samples are available.
2 IVD = Intravenous Drug User (Benutzer intravenöser Drogen).2 IVD = intravenous drug user.
3 AVH - Akute Virushepatitis.3 AVH - acute viral hepatitis.
4 PT = Post transfusion (nach Transfusion).4 PT = post-transfusion (after transfusion).
Wie a JS Tabelle 1 ersichtlich ist, waren 19 von 32 Seren von Patienten, bei denen NANBH diagnostiziert worden war, in bezug auf Antikörper, die gegen in SOD-NANB6.,., und SOD-NANB81 vorhandene HCV-Epitope gerichte' waren, positiv. Die positiven Serumproben waren jedoch nicht gleichermaßen immunologisch reaktionsfähig mit S0D-NANB6.M und SOD-NANB81. Serumproben von Patient Nr. 1 waren positiv gegenüber SOD-NAN81, aber nicht gegenüber SOD-NANB5.,.,. Serumproben von den Patienten Nr. 10,15 und 17 waren positiv gegenüber SOD-NANB5-M, aber nicht gegenüber SOD-NANB81. Serumproben von den Patienten Nr.3,8,11 und 12 reagiorten gleichermaßen mit beiden Fusionspolypeptiden, während Serumproben von den Patienten Nr.2,4,7 und 9 gegenüber SOD-NANB6.!., eine 2- bis 3mal stärkere Reaktion aufwiesen als gegenüber SOD-NANB8). Diese Resultate lassen schließen, daß NANB6.).) und NANB8, mindestens drei verschiedene Epitope enthalten können, d.h. es ist möglich, daß jedes Polypeptid mindestens ein einzigartiges Epitop enthält und daß die beiden Polypeptide mindestens ein Epitop teilen.As can be seen in Table 1, 19 out of 32 sera from patients diagnosed with NANBH had antibodies to antibodies against 'HCV epitopes present in SOD-NANB 6 .,., And SOD-NANB 81 '. were positive. However, the positive serum samples were not equally immunologically reactive with S0D-NANB6.M and SOD-NANB 81 . Patient No. 1 serum samples were positive for SOD-NAN 81 but not SOD-NANB 5 .,.,. Serum samples from patients # 10, 15 and 17 were positive for SOD-NANB 5 -M, but not for SOD-NANB 81 . Serum samples from patients Nos. 3, 8, 11 and 12 reacted equally with both fusion polypeptides, while serum samples from patients Nos. 2, 4, 7 and 9 compared to SOD-NANB 6 .!., Had a 2 to 3 times greater response as compared to SOD-NANB 8 ). These results suggest that NANB 6. ).) And NANB 8 may contain at least three different epitopes, ie, it is possible that each polypeptide contains at least one unique epitope and that the two polypeptides share at least one epitope.
IV.D.4. Spezifitat der Festphasen-RIA bezüglich NANBHIV.D.4. Specificity of the solid phase RIA with respect to NANBH
Die Spezifität der Festphasen-Radioimmunoassays bezüglich NANBH wurde getestet, indem man den Assay auf der Basis von Serum von mit HAV oder mit HBV infizierten Pa'.enten und Seren von Kontrollindividuen durchführte. Die Assays unter Einsatz von teilweise gereinigtem SOD-NANB6.,., und SOD-NANB8, wurden im wesentlichen gemäß der Beschreibung in Ausschnitt IV.D.3. durchgeführt, mit dem Unterschied, daß die Si>ren von Patienten stammten, bei denen vorher HAV oder HBV diagnostiziert worden war, oder von Individuen, die Blutspender waren. Die Resultate für Seren von HAV- und HBV-infizierten Patienten sind in Tabelle 1 dargestellt. Der Radioimmunoassay wurde unter Verwendung von 11 Serumpumpen von HAV-infizierten Patienten und 20 Serumprobon von HBV-infizierten Patienten getestet.The specificity of solid phase radioimmunoassays for NANBH was tested by performing the assay on the basis of serum from HAV or HBV infected patients and sera from control individuals. Assays using partially purified SOD-NANB 6 ,., And SOD-NANB 8 were made essentially as described in Section IV.D.3. except that the sires were from patients previously diagnosed with HAV or HBV, or from individuals who were blood donors. The results for sera from HAV and HBV infected patients are shown in Table 1. The radioimmunoassay was tested using 11 serum pumps of HAV-infected patients and 20 serum samples of HBV-infected patients.
Wie in Tabelle 1 dargestellt, zeigte koines dieser Seren eine positive immunologische Reaktion mit den BB-NANBV-Epitope enthaltenden Fusionspolypeptidut:.As shown in Table 1, coins of these sera showed a positive immunological reaction with the fusion polypeptide containing BB-NANBV epitopes.
Der RIA unter Verwendung des NANBt.,.,-Antigens wurde benutzt, um die immunologische Reaktionsfähigkeit von Serum von Kontrollindividuen zu bestimmen. Von 230 Serumproben, die von den normalen Blutspendern stammten, zeigten nur zwei positive Reaktionen bei der RIA (Daten nicht dargestellt). Es ist möglich, daß die be'.den Blutspender, von denen diese Serumproben stammten, früher einmal HCV ausgesetzt waren.The RIA using the NANBt.,., Antigen was used to determine the immunological responsiveness of serum from control individuals. Of 230 serum samples from normal blood donors, only two showed positive responses in RIA (data not shown). It is possible that the blood donors from which these serum samples originated were once exposed to HCV.
IV.D.5. Reaktionsfähigkeit von NANB41., Im Verlaufe der NANBH-InfektlonIV.D.5. Reactivity of NANB 41 , during NANBH infection
Die Anwesenheit von AnIi-NANB6.,.,-Antikörpern im Verlaufe der NANBH-Infek'.ion von zwoi Patienten und vier Schimpansen wurde mit RIA gemäß der Beschreibung in Abschnitt IV.D.3. verfolgt. Außerdem wurde der Radioimmunoassay zur Bestimmung der A nwosenheit oder Abwesenheit von Anti-NANBuo-Antikörpern im Verlaufe der HAV- und HBV-Infektion bei infizierten Schimpansen angewendet.The presence of AnIi-NANB 6 .,... Antibodies in the course of NANBH infection of two patients and four chimpanzees was assessed with RIA as described in Section IV.D.3. tracked. Also, the radioimmunoassay was used to determine the A nwosenheit or absence of anti-NANBuo antibodies in the course of HAV and HBV infection in chimpanzees infected applied.
Die in Tabelle 2 dargestellten Ergebnisse zeigen, daß bei Schimpansen und bei Menschen AnU-NANB6.,.,-Antikörper nach Einsetzen der akuten Phase der NANBH-Infektion nachgewiesen wurden. In Seru-nproben von mit HAV- oder HBV-infizierten Schimpansen wurden keine AnU-NANB6.,.,-Antikörper nachgewiesen. Somit dier en AnIi-NANB6.,.,-Antikörper als Anzeiger (marker) für die ECV-Exposition eines Individuums.The results presented in Table 2 show that in chimpanzees and in humans, AnU-NANB 6 .,... Antibodies were detected after onset of the acute phase of NANBH infection. No AnU-NANB 6 .,., - antibodies were detected in sera samples from HAV- or HBV-infected chimpanzees. Thus, the AnIi-NANB 6 .,., - antibody as an indicator (marker) for the ECV exposure of an individual.
Serokonversion in sequentiellen Serumproben von Hepatitispatienten und -schirr,pansen unter Verwendung von 5-1-1-AntigenSeroconversion in sequential serum samples from hepatitis patients and cirrhotics, rumen using 5-1-1 antigen
'T = Tag der anfänglichen Probenahme'T = day of initial sampling
Auf der Grundlage der spezifischen immunologischen Reaktivität des SOD-NaNB5.!.,-Polypeptide mit den Antikörpern in Serumproben von Patient 3n mit NANBH wurde ein Verfahren zur Reinigung der Serumantikörper, die immunologisch mit dem • (den) Epitop(en) in NANB6.,.! reagieren, entwickelt.Based on the specific immunological reactivity of the SOD-NaNB 5 .!. Polypeptides with the antibodies in patient 3n serum samples with NANBH, a procedure was developed for the purification of serum antibodies immunogenic with the epitope (s) in NANB 6th ,.! react, developed.
Bei diesem Verfahren wird die Affinitätschromatographie ausgenutzt. Gereinigtes SOD-NANB6.!.i-Polypeptid (siehe Abschnitt IV.D.I) wurde an eine unlösliche Unterlage geknüpft, wobei das immobilisierte Polypeptid seine Affinität für den Antikörper gegen NANB5.,., behält. Der Antikörper in Sorumproben v/ird an dem matrixgebundenen Polypeptid absorbiert. Nach dem Waschen zum Entfernen der unspezifisch gebundenen Materialien und ungebundenen Materialien wird der gebundene Antikörper durch Änderung des pH-Wertes und/oder chaotrope Reagenzien, wie zum Beispiel Harnstoff, aus dem gebundenen SOD-HCV-Polypeptid freigesetzt.In this method, the affinity chromatography is exploited. Purified SOD-NANB 6 .!. I polypeptide (see Section IV.DI) was attached to an insoluble support, with the immobilized polypeptide retaining its affinity for the antibody to NANB 5 .,. The antibody in Sorum samples is absorbed on the matrix-bound polypeptide. After washing to remove the non-specifically bound materials and unbound materials, the bound antibody is released from the bound SOD-HCV polypeptide by changing the pH and / or chaotropic reagents, such as urea.
Nitrocellulosemembranen, die gebundenes SOD-NANB6.,., enthalten, wurden folgendermaßen hergestellt. Eine Nitrocellulosemembran, 2,1 cm Sartorius mit einer Porengröße von 0,2 pm, wurde dreimal 3 Minuten lang mit BBS gewaschen. SOD-NANB5.!.ι wurde durch Inkubation des gereinigten Präparats in BBS bei Raumtemperatur für 2 Stunden an die Membran gebunden; bei einer alternativen Art und Weise wurde über Nacht bei 40C inkubiert. Die das gebundene Antigen enthaltende Lösung wurde entfernt und das Filter wurde dreimal jeweils drei Minuten lang mit BBS gewaschen. Die verbliebenen aktiven Stellen auf der Membran wurden durch 30minütige Inkubation mit einer BSA-Lösung von 5 mg/ml blockiert. Überschüssige BSA wurde duich fünfmaliges Waschen der Membran mit BBS und dreimaligem Waschen mit destilliertem Wasser entfsrnt. Die das Virusantigen und BSA enthaltende Membran wurde anschließend mit 0,05M Glycinhydrochlorid, pH 2,5,0,1 OMN aCI (GIyHCI) 15 Minuten lang behandelt und anschließend durch drei dreiminütige Waschungen mit PBS'. aiterbehandelt. Die polyclonalen Anti-NANB^.,.,-Antikörper wurden durch zweistündige Inkubation der das Fusionspolypeptid enthaltenden Membranen mit Serum aus einem Individuum mit NANBH isoliert. Nach der Inkubation wurden die Filter fünfmal mit BBS und zweimal mit destilliertem Wasser gewaschen. Die gebundenen Antikörper wurden dsmn durch 5 Elutionen von GIyHCI, wobeiNitrocellulose membranes containing bound SOD-NANB 6. , Were prepared as follows. A nitrocellulose membrane, 2.1 cm Sartorius with a pore size of 0.2 μm, was washed three times with BBS for 3 minutes. SOD-NANB 5. ! Ι was bound to the membrane by incubation of the purified preparation in BBS at room temperature for 2 hours; in an alternative manner, incubation was carried out at 4 ° C. overnight. The solution containing the bound antigen was removed and the filter was washed three times with BBS for three minutes each. The remaining active sites on the membrane were blocked by incubation with a 5 mg / ml BSA solution for 30 minutes. Excess BSA was removed by washing the membrane five times with BBS and washing three times with distilled water. The membrane containing the viral antigen and BSA was then treated with 0.05M glycine hydrochloride, pH 2.5.0.1 OMN aCl (Gly HCl) for 15 minutes followed by three 3-minute washes with PBS '. aiterbehandelt. The polyclonal anti-NANB ^.,... Antibodies were isolated by incubating the fusion polypeptide-containing membranes with serum from one subject with NANBH for two hours. After incubation, the filters were washed five times with BBS and twice with distilled water. The bound antibodies were dsmn by 5 elutions of GIyHCl, where
jede Elution 3 Minuten dauerte, aus jedem Filter entfernt. Der pH-Wert der Eluate wurde auf 8,0 eingestellt, indem jedes Eluet !n einem Reagenzglas gesammelt wurde, das 2,0M Tris HCI mit einem pH-Wert von 8,0 enthielt. Die Rückgewinnung des Anti NANBe-M-Antikörpers nach der Affinitätschromatographie betrug etwa 50%.each elution took 3 minutes, removed from each filter. The pH of the eluates was adjusted to 8.0 by collecting each eluent in a test tube containing 2.0M Tris HCl at pH 8.0. The recovery of the anti-NANBe-M antibody after affinity chromatography was about 50%.
Die dos gebundene Virusantigen enthaltenden Nitrocellulosemombranen können mehrmals ohne nennenswerte Abnahme de: Bindungskapazität verwendet werden. Zur Wiederverwendung werden die Membranen, nachdem die Antikörper eluiert worden sind, dreimal jeweils 3 Minuten lang mit BBS gewaschen. Anschließend werden sie bei 40C in BBS aufbewahrt.The dos bound virus antigen-containing Nitrocellulosemombranen can repeatedly without significant loss en: used binding capacity. For reuse, after the antibodies have eluted, the membranes are washed 3 times with BBS 3 times each for 3 minutes. Then they are stored at 4 0 C in BBS.
IV.F. Das Etnfangen von HCV-Partikeln aus Infiziertem Plasma mittels gereinigter Human-polyclonaler-Antl-HCV-Antlkörper; Hybridisierung der NuclelnsSure In den eingefangenen Partikeln an HCV-cDNAIV.F. The capture of HCV particles from infected plasma by purified human polyclonal anti-HCV antibodies; Hybridization of Nuclofenic Acid In Captured Particles to HCV cDNA
gereinigter Human-polyclonaler-Anti-HCV-Antikörper, die an Polystyrenperlen gebunden waren, isoliert.purified human polyclonal anti-HCV antibody bound to polystyrene beads.
codierte Polypeptiod SOD-HCV verwendet wurde. Zur Reinigung wurde das in Abschnitt IV.E. beschriebene Verfahrenangewandt.coded polypeptide SOD-HCV was used. For purification, the procedure described in Section IV.E. described method applied.
(1 Mikrogramm/ml in Borat-gepufferter Salzlösung, pH 8,5) inkubiert wurde. Nach der Inkubation über Nacht würden die Perleneinmal mitTBST(5OmM irisHCI,pH8,0,15OmM NaCI,0,05%[V/V]Tween 20)und anschließend mit Phosphat-gepufferter(1 microgram / ml in borate-buffered saline, pH 8.5). After overnight incubation, the beads were washed once with TBST (50 mM IrisHCl, pH 8.0, 15 mM, NaCl, 0.05% [V / V] Tween 20) and then with phosphate buffer
durch Gesamt-Human-Immunoglobulin ersetzt wurden.were replaced by total human immunoglobulin.
aliquote Menge (1ml) des mit NANBV-infizierten Schimpansenplasmas wurde 3 Stunden lang bei 370C mit je 5 Perlen, dieentweder mit Anti-NANB^M-Antikörpern oder mit Kontrollimmunoglubulinen beschichtet waren, inkubiert. Die Perlon wurdendreimal mit TBST gewaschen.aliquot (1ml) of the with NANBV infected chimpanzee plasma was coated for 3 hours at 37 0 C with 5 beads, dieentweder with anti-NANB ^ M-antibodies or with Kontrollimmunoglubulinen incubated. The perlon was washed three times with TBST.
Die aus den mit AnU-NANB5.,.,-Antikörpern eingefangenen Partikeln freigesetzte Nucleinsäurekomponente wurde auf Hybridisierung an HCV-cDNA, die aus Clon 81 abgeleitet worden war, analysiert.The nucleic acid component released from the particles captured with AnU-NANB 5 .,... Antibodies was analyzed for hybridization to HCV cDNA derived from clone 81.
HCV-Partikel wurden aus mit NANBH-infiziertem Schimpansenplasma wie in Abschnitt IV.F.1. beschrieben eingefangen. Zur Freisetzung der Nucleinsäuren aus den Partikeln wurden die gewaschenen Perlen 60 Minuten bei 370C mit 0,2ml Lösung pro Perle inkubiert, wobei die Lösung Proteinase k (1 mg/ml), 1OmM Tris HCI, pH 7,5 1OmM EDTA, 0,25% (M/V) SDS, 10 Mikrogramm/ml lösliche Hefe-RNA enthielt, die überstehende Lösung wurde entfernt. Das Überstehende wurde mit Phenol und Chloroform extrahiert, und die Nucleinsäuren wurden über Nacht bei -20°C präzipitiert. Das Nucleinsäurepräzipitat wurde durch Zentrifugieren gesammelt, getrocknet und in 5OmM Hepes, pH 7,5, gelöst. Genau gleiche Mengen der löslichen Nucleinsäuren aus den Proben, die von den mit Anti-NANBj.,.,-Antikörpern beschichteten Perlen und von den Gesamt-Human-Immunoglobulin enthaltenden Kontrollperlen stammten, wurden auf die Nitrocellulosefilter filtriert. Die Filter wurden mit einer 32P-markierten, „nick"-translatierten Sonde, die aus dem gereinigtem HCV-cDNA-Fragment in Clon 81 hergestellt worden war, hybridisiert. Die Verfahren zur Herstellung der Sonde und zur Hybridisierung sind in Abschnitt IV.C.1. beschrieben. Autoradiogramme eines sondierten Filters, das die Nucleinsäuren aus Partikeln enthielt, die durch die Perlen, die Anti-NANB6.,.,-Antikörper enthielten, eingefangen wurden, werden Figur 34 gezeigt. Der mit Hilfe des AnU-NANB5.,.,-Antikörpers (Ai, A2) gewonnene Extrakt ergab im Verhältnis zu dem Kontroll-Antikörperextrakt (A3, A4) und zur Kontroll-Hefe-RNA 'B1, B2) klare Hybridisiersignale. Die aus 1 pg, 5pg, und 10pg des gereinigten cDNA-Fragmentes von Cion 81 bestehenden Standards werden in C1-3 gezeigt.HCV particles were prepared from NANBH-infected chimpanzee plasma as described in Section IV.F.1. captured captured. To release the nucleic acids from the particles, the washed beads were incubated for 60 minutes at 37 0 C with 0.2 ml per bead solution, wherein the solution of proteinase K (1 mg / ml), 1OmM Tris HCl, pH 7.5 1OmM EDTA, 0 , 25% (M / V) SDS, contained 10 micrograms / ml of soluble yeast RNA, the supernatant was removed. The supernatant was extracted with phenol and chloroform, and the nucleic acids were precipitated overnight at -20 ° C. The nucleic acid precipitate was collected by centrifugation, dried and dissolved in 50 mM Hepes, pH 7.5. Exactly equal amounts of the soluble nucleic acids from the samples derived from the anti-NANBj.,., Antibody-coated beads and the control beads containing the total human immunoglobulin were filtered on the nitrocellulose filters. The filters were hybridized with a 32 P-labeled "nick" -translated probe prepared from the purified HCV cDNA fragment in clone 81. The procedures for probe preparation and hybridization are described in Section IV.C. Fig. 34. Autoradiograms of a probed filter containing the nucleic acids from particles captured by the beads containing anti-NANB 6 .,..., Antibodies are shown in Figure 34. Using the AnU-NANB 5 .,., - Antibody (Ai, A 2 ) obtained extract in relation to the control antibody extract (A 3 , A 4 ) and the control yeast RNA 'B 1 , B 2 ) clear hybridization signals pg, 5pg, and 10pg of the purified cDNA fragment of Cion 81 are shown in C1-3.
Diese Ergebnisse zeigen, daß die aus NANBH-Plasma durch Anii-NANB^.,.,-Antikörper eingefangenen Partikel Nucleinsäuren enthalten, die mit HCV-cDNA in Clon 81 hybridisieren und liefern somit einen weiteren Beweis, daß die cDNAs in diesen Clonen pus dem ätiologischen Erreger von NANBH abgeleitet wurden.These results indicate that the particles captured from NANBH plasma by Anii-NANB ^,..., - antibodies contain nucleic acids that hybridize to HCV cDNA in clone 81, thus providing further evidence that the cDNAs in these clones are pus etiological agents were derived from NANBH.
IV.G. Immunologische Reaktivität von C100-3 mit gereinigten AnU-NANBn1-AnUkO rpern Die immunologische Reaktivität des C 100-3-Fusionspolypeptids mit AnU-NANB5.,.,-Antikörpern wurde durch ein Radioimmunuassay bestimmt, wobei die an eine feste Phase gebundenen Antigene mit gereinigten AnU-NANB5.,.,-Antikörpern geprüft wurden und der Antigen-Antikörper-Xomplex mit "'!-markierten Schaf-Anti-Human-Antikörpern nachgewiesen wurde. Die immunologische Reaktivität von C 100-3-PoIypeptid wurde mit der von SOD-NANB5.,.,-Antigen verglichen. Das Fusionspolypeptid C100-3 wurde synthetisiert und gereinigt wie in Abschnitt IV.B.5. bzw. in Abschnitt IV.B.6. beschrieben. Das Fusionspolypeptid SOD-NANB5.,., wurde wie in Abschnitt IV.B.1. bzw. in Abschnitt IV.D.1. beschrieben synthetisiert und gereinigt. Die gereinigten AnIi-NANB5.,.,-Antikörper wurden, wie in Abschnitt IV.E. beschrieben, gewonnen. Aliquote Mengen von 100 Mikrolitern, die unterschiedliche Mengen gereinigtes C 100-3-Antigen in 0.125M Na-Boratpuffer, pH 8,3,0,075M NaCI (BBS) enthielten, wurden in jede Vertiefung einer Mikrotiterplatte gegeben (Dynatech Immolon 2 Removawell Strips). Die Platte wurde über Nacht in einer Feuchtekammer bei 40C inkubiert, danach wurde die Protainlösung entfernt und die Vertiefungen wurden dreimal mit BBS, die 0,02% Triton X-100 (B3ST) enthielt, gewaschen. Zur Vermeidung von unspezifischen Bindungen wurden die Vertiefungen mit BSA beschichtet, indem 100 Mikroliter einer 5-mg/ml-Lösung BSA in BBS zugegeben wurden und anschließend 1 Stunde bei Raumtemperatur inkubiert wurde, wonach die überschüssige BSA-Lösung entfernt wurde. Die Polypeptide in den beschichteten Vertiefungen wurdon mit gereinigten AnU-NANB5.,.,-Antikörpern zur Reaktion gebracht, indem 1 Mikrogramm Antikörper/Vertiefung zugefügt wurde, und die Proben 1 Stunde bei 37°C inkubiert wurden. Nach der Inkubation wurde die überschüssige Lösung durch Ansaugen entfernt und die Vertiefungen wurden fünfmal mit BBSTIV.G. Immunological Reactivity of C100-3 with Purified AnU-NANBn 1 Antibodies The immunological reactivity of the C 100-3 fusion polypeptide with AnU-NANB 5 .,... Antibodies was determined by radioimmunoassay using the solid phase-bound antigens with purified AnU-NANB 5 .,., - antibodies and the antigen-antibody complex was detected with ''! labeled sheep anti-human antibodies of SOD-NANB 5 .,., - Antigen The fusion polypeptide C100-3 was synthesized and purified as described in Section IV.B.5 and Section IV.B.6, respectively The fusion polypeptide SOD-NANB 5 . , was synthesized and purified as described in Section IV.B.1 and Section IV.D.1, respectively. The purified AnIi-NANB 5 .,., - antibodies were purified as described in Section IV.E. Aliquots of 100 microliters containing varying amounts of purified C 100-3 antigen i n 0.125M Na borate buffer, pH 8.3.0.075M NaCl (BBS) was added to each well of a microtiter plate (Dynatech Immolon 2 Removawell Strips). The plate was incubated overnight in a humid chamber at 4 0 C, after which the Protainlösung was removed and the wells were washed three times with BBS containing 0.02% Triton X-100 (B3ST). To avoid nonspecific binding, the wells were coated with BSA by adding 100 microliters of a 5 mg / ml solution of BSA in BBS and then incubating for 1 hour at room temperature, after which the excess BSA solution was removed. The polypeptides in the coated wells were reacted with purified AnU-NANB 5 .,., Antibodies by adding 1 microgram of antibody / well, and the samples were incubated for 1 hour at 37 ° C. After incubation, the excess solution was removed by aspiration and the wells were washed five times with BBST
gewaschen. An die Fusionspolypeptide gebundener AnU-NANB6.,., wurde durch die Bindung von '"!-markiertem F'(ab)2 Schaf-Anti-Human-lgG an die beschichteten Vertiefungen nachgewiesen. Aliquote Mengen von 100 Mikrolitern markierter Sonde (spezifische Aktivität 5-20 Mikrocuries/Mikrogramm) wurden in jede Vertiefung gegeben, die Platten wurden 1 Stunde bei 370C inkubiert, und danach wurde die überschüssige Sonde durch Ansaugen entfernt und es wurde fünfmal mit BBST gewaschen. Die in jeder Vertiefung gebundene Radioaktivität wurde durch Zählen in einem Gammasirahlenzähler bestimmt. In Tabelle 3 werden die Ergebnisse der immunologischen Reaktivität von C100 mit gereinigtem AnU-NANB6.,., im Vergleich zu derjenigen von NANB5.,.) mit den gereinigten Antikörpern gezeigt.washed. AnU-NANB 6 .,., Bound to the fusion polypeptides, was detected by binding of '' labeled F '(ab) 2 sheep anti-human IgG to the coated wells, aliquots of 100 microliters of labeled probe (specific activity 5-20 micro Curies / microgram) were added to each well, the plates were incubated for 1 hour at 37 0 C, and then the excess probe was removed by aspiration and washed five times with BBST. the bound in each well radioactivity was Table 3 shows the results of the immunological reactivity of C100 with purified AnU-NANB 6 .,., Compared to that of NANB 5 .,.) With the purified antibodies.
Die Ergebnisse in Tabelle 3 zeigen, daß AnIi-NANB6.,., ein Epitop (bzw. Epitope) in der CIOO-Komponente des C100-3-Polypeptids erkennt. Somit teilen sich NANB6.,., und C100 ein gemeinsames Epitop (Epitope). Die Ergebnisse deuten darauf hin, daß die cDNA-Sequenz, die für diese(s) NANBV-Epitop(e) codiert, sowohl in Clon 5-1-1 als auch in Clon 81 vorhanden ist.The results in Table 3 show that AnIi-NANB 6 .,., Recognizes an epitope (or epitopes) in the CIOO component of the C100-3 polypeptide. Thus, NANB 6 ,., And C100 share a common epitope (epitope). The results indicate that the cDNA sequence encoding this NANBV epitope (s) is present in both clone 5-1-1 and clone 81.
Das HCV-Genom wurde in bezug auf seine Strängigkeit charakterisiert, indem die Nucleinsäureiraktion aus den Partikeln, die an den mit Anti-NANB6.,.,-Antikörpern beschichteten Polystyrenperlen eingefangen wurden, isoliert wurde, und festgestellt wurde, ob die isolierte Nucleinsäure mit Plus- und/oder Minus-Strängen der HCV-cDNA hybridisierte.The HCV genome was characterized for strandability by isolating nucleic acid irrigation from the particles captured on the polystyrene beads coated with anti-NANB6.,., Antibody and determining whether the isolated nucleic acid was positive and / or minus strands of the HCV cDNA hybridized.
Wie in Abschnitt IV.F.1. beschrieben, wurden Partikel aus dem mit HCV infizierten Schimpansenplasma unter Verwendung von mit immungereinigtem AmI-NANB5.,.,-Antikörper beschichtete Polystyrenperlen eingefangen. Die Nucleinsäurekomponente der Partikel wurde mittels desin Abschnitt IV.F.2. beschriebenen Verfahrens freigesetzt. Aliquote Mengen der isolierten genomischen Nucleinsäure, die 3ml des Hochtiterplasmas entsprachen, wurden auf Nitrocellulosefilter übertragen. Als Kontrollen wurden aliquote Mengen von denaturierter HCV-cDNA aus Clon 81 (2 Picogramm) ebenfalls auf die gleichen Filter übertragen. Die Filter wurdenmit einem 32P- Tiarkierten Gemisch von Plus- odereinem Gemisch von Minus-Strängen von einzelsträngigerDNA.dieaus HCV-cDNAs cloniert wurde, sondiert; die cDNAs wurden aus den Clonen 40b, 81 und 25c ausgeschnitten. Die einzelsträngigenSondon wurden gewonnen, indem die HCV-cDNAsdurch EcoRI aus den Clonen 81,40b und 25c ausgeschnitten wurden, und diecDNA-Fragmente in M13-Vektoren, mp 18 und mp 19 cloniert wurden (Messing (1983J). Die MIS-Clonewurdensequenziert.umzubestimmen.obsiediePlus-oderMinus-SträngederDNA.dieausdenHCV-cDNAsabgeleitet waren,enthielten. Die Sequenzierung erfolgte mit dem Didesoxy-Kettenabbruch-Verfahren nach Sanger und Mitarbeitern (1977). Aus einem Satz von Duplikatfiltern, die aliquote Mengen des HCV-Genoms enthielten, das aus den eingefangenen Partikeln isoliert worden war, wurde jedes Filter entweder mit Plus- oder mit Minus-Strang-Sonden, die aus den HCV-cDNAs abgeleitet worden waren, hybridisiert. Figur 41 zeigt dia beim Sondieren des NANBV-Genoms gewonnenen Autoradiogramme, wobei das Sondengemisch aus den Clonen 81,40b und 25c abgeleitet war. Dieses Gemisch wurde zur Erhöhung der Sensitivität des Hybridisierungsassays benutzt. Die Proben in Liste I wurden mit dem Plus-Strang-Sonden-Gemisch hybridisiert. Die Proben in Liste Il wurden durch Hybridisierung mit dem Minus-Strang-Sonden-Gemisch hybridisiert. Die Zusammensetzung der Proben in den Listen t, 1S Immunoblots wird i> > Tabelle 4 dargestellt.As in Section IV.F.1. described particles from the HCV-infected chimpanzee plasma were captured using immunopurified AmI-NANB 5. , -, Antibody coated polystyrene beads. The nucleic acid component of the particles was analyzed by means of the procedure described in Section IV.F.2. released process described. Aliquots of isolated genomic nucleic acid corresponding to 3 ml of the high titer plasma were transferred to nitrocellulose filters. As controls, aliquots of denatured HCV cDNA from clone 81 (2 picograms) were also transferred to the same filters. The filters were probed with a 32 P-labeled mixture of plus or a mixture of minus strands of single-stranded DNA from the HCV cDNAs; the cDNAs were excised from clones 40b, 81 and 25c. The single-stranded London were obtained by excising the HCV cDNAs by EcoRI from clones 81, 40b and 25c, and cloning the cDNA fragments into M13 vectors, mp 18 and mp 19 (Messing (1983).) The MIS clones were sequenced The sequencing was done with the dideoxy chain termination method of Sanger and co-workers (1977). From a set of duplicate filters containing aliquots of the HCV genome derived from the HCV genomes Each filter was hybridized with either plus or minus strand probes derived from the HCV cDNAs Figure 41 shows the autoradiographs obtained on probing of the NANBV genome, with the probe mixture of was derived from clones 81, 40b and 25c, and was used to increase the sensitivity of the hybridization assay Strand-probe mixture hybridized. The samples in List II were hybridized by hybridization to the minus strand-probe mixture. The composition of the samples in the lists t, 1 S immunoblots is shown in Table 4.
1 HCV-Genom > 1 HCV genome >
2 ·2 ·
3 · CDNA813 · CDNA81
4 —- CDNA81 4 - CDNA81
* ist eine nicht beschriebene Probe* is an unspecified sample
Wie aus don Ergebnissen in Figur 41 ersichtlich wird, hybridisiert nur die Minus-Strang-DNA-Sonde mit dem isolierten HCV-Genom. Dieses Ergebnis läßt in Verbindung mit dem Ergebnis, daß das Genom gegenüber RNase und nicht gegenüber DNase (siehe Abschnitt IV.C.2.) sensitiv ist, darauf schließen, daß das Genom von NANBV eine positiv-strängige RNA ist. Diese Daten sowie die Daten aus den anderen Labors in bezug auf die physikalisch-chemischen Eigenschaften eines vermutlichen NANBV stimmen mit der Möglichkeit überein, daß das HCV zu don Flaviviridae gehört. Die Möglichkeit, daß das HCV eine neue Klasse eines Viruserregers darstellt, ist jedoch · -i<-h nicht ausgeschaltet.As can be seen from the results in Figure 41, only the minus strand DNA probe hybridizes to the isolated HCV genome. This result, coupled with the finding that the genome is sensitive to RNase and not to DNase (see Section IV.C.2.), Suggests that the genome of NANBV is a positive-stranded RNA. These data, as well as the data from the other laboratories regarding the physicochemical properties of a probable NANBV, are consistent with the possibility that the HCV belongs to don Flaviviridae. However, the possibility that the HCV represents a new class of viral agent is not disabled.
IV.H.2. Nachwels von Sequenzen In eingefangenen Partikeln, die bei Ampliflkation durch PCR an aus Clon 81 abgeleiteter HCV-cDNA hybridisierenIV.H.2. Detection of Sequences In Captured Particles that hybridize upon amplification by PCR to clone 81-derived HCV cDNA
Die RNA in eingefangenen Partikeln wurde, wie im Abschnitt IV.H.1. beschrieb en, gewonnen. Die Analyse nach Sequenzen, die an der aus Clon 81 abgeleiteten HCV-cDNA hybridisieren, erfolgte unter Anwendung des PCR-Amplifikationsverfahrens, wie es in Abschnitt IV.C.3. beschrieben ist, mit der Ausnahme, daß dio Hybridisiersonde ein Kinase-Oligonucleotid, das aus der cDNA-Sequenz von Clon 81 abgeleitet worden war, war. Die Ergebnisse zeigten, daß die amplifizierten Sequenzen mit der von Clon 81 abgeleiteten HCV-cDNA-Sonde hybridisierten.The RNA in trapped particles was purified as described in Section IV.H.1. described, won. Analysis for sequences that hybridize to the clone 81-derived HCV cDNA was performed using the PCR amplification method as described in Section IV.C.3. with the exception that the hybridization probe was a kinase oligonucleotide derived from the cDNA sequence of clone 81. The results showed that the amplified sequences hybridized with the clone 81-derived HCV cDNA probe.
IV.H.3. Homologie zwischen dem Nicht-Struktur-Protein des Dengue-Flavivirus (MNWWVD 1) und den HCV-Polypeptiden, die durch den kombinierten ORF der Clone 141 bis 39c codiert sindIV.H.3. Homology between dengue flavivirus non-structural protein (MNWWVD 1) and the HCV polypeptides encoded by the combined ORF of clones 141 to 39c
Wie in Figur 26 gezeigt, enthalten die kombinierten HCV-cONAs der Clone 14i bis 39c einen kontinuierlichen ORF. Das darin codierte Polypeptid wurde auf Sequenzhomologie mit der Region des Nicht-Struktur-Polypeptids bzw. der Nicht-Struktur-Peptide im Dengue-Flavivirus (MNWVD 1) analysiert. Für die auf dem Computer durchgeführte Analyse wurde die Dayhoffsche Protein-Datenbank verwendet. Die Ergebnisse werden in Figur 47 gezeigt, in der das Symbol (:) eine exakte Homologie und das Symbol (.) einen konservativen Ersatz in der Sequenz angibt; die Striche zeigen Räume an, die in die Sequenz inseriert wurden, um die größte Homologie zu erreichen. Wie aus der Figur ersichtlich wird, gibt es zwischen der in der HCV-cDNA codierten Sequenz und dem (den) Nicht-Struktur-Polypeptid(en) des Dengue-Virus eine signifikante Homologie. Zusätzlich zu der in Figur 42 gezeigten Homologie enthielt die Analyse des Polypeptidsegmentes, das in einor Region in Richtung des 3'-Endes der cDNA codiert ist, ebenfalls Sequenzen, die zu Sequenzen in der Dengue-Polymerase homolog sind. Von Folgen ist auch die Entdeckung, daß die vorschriftsmäßige Gly-Asp-Asp-(GDD)-Sequenz, von der man glaubte, daß sie RNA-abhängige RNA-Polymerasen wichtig sei, in dem in HCV-cDNA codierten Polypeptid enthalten ist, und zwar an einem Ort, der mit dem im Dengue-2-Virus übereinstimmt. (Diese Daten werden nicht gezeigt.)As shown in Figure 26, the combined HCV cONAs of clones 14i to 39c contain a continuous ORF. The polypeptide encoded therein was analyzed for sequence homology with the region of the non-structural or non-structural dengue flavivirus peptides (MNWVD 1). For the analysis performed on the computer, the Dayhoff protein database was used. The results are shown in Figure 47, in which the symbol (:) indicates exact homology and the symbol (.) Indicates a conservative replacement in the sequence; the dashes indicate spaces that have been inserted into the sequence to achieve the greatest homology. As can be seen from the figure, there is significant homology between the sequence encoded in the HCV cDNA and dengue virus non-structural polypeptide (s). In addition to the homology shown in Figure 42, analysis of the polypeptide segment encoded in one region towards the 3 'end of the cDNA also contained sequences homologous to sequences in dengue polymerase. Also of consequence is the discovery that the regulatory Gly-Asp-Asp (GDD) sequence believed to be important for RNA-dependent RNA polymerases is contained in the polypeptide encoded in HCV cDNA, and although in a place that is consistent with the Dengue-2 virus. (This data is not shown.)
IV.H.4. HCV-DNA ist in mit NANBH-infiziertem Gewebe nicht feststellbarIV.H.4. HCV DNA is not detectable in NANBH-infected tissue
Zwei Arten von Untersuchungen liefern Ergebnisse, die darauf hindeuten, daß HCV-DNA in Gewebe aus einem Individuum mit NANBH nicht nachweisbar ist. Diese Ergebnisse liefern zusammen mit denen in den Abschnitten IV.C. und IV.H.2. den Beweis, daß das HCV kein DNA-enthaltendes Virus ist, und daß seine Replikation ohne Einbeziehung von cDNA abläuft.Two types of studies provide results suggesting that HCV DNA is undetectable in tissue from an individual with NANBH. These results, together with those in Sections IV.C. and IV.H.2. evidence that the HCV is not a DNA-containing virus and that its replication proceeds without cDNA involvement.
IV.H.4.a. Southern-blotting-VerfahrcnIV.H.4.a. Southern blotting Verfahrcn
Zur Feststellung, ob NANBH-infizierte Schimpansenleber nachweisbare HCV-DNA (oder HCV-cDNA) enthält, wurden Restriktionsenzymfragmente von DNA mittels Southern .blotting" aus dieser Quelle isoliert und die .blots" wurden mit 32P-markierter HCV-cDNA sondiert. Die Ergebnisse zeigten, daß die markierte HCV-cDNA nicht an der aus der infizierten Schimpansenleber übertragenen DNA hybridisierte. Sie hybridisierte auch nicht an der zur Kontrolle aus normaler Schimpansenleber übertragenen DNA. Im Gegenteil, in einer positiven Kontrolle hybridisierte eine markierte Sonde des Beta-Interferon-Gens stark an Southern .blots" von Restriktionsenzym-digerierter Human-Plazenta-DNA. Diese Systeme waren dazu gedacht, eine Einzelkopie des Gens nachzuweisen, das mit der markierten Sonde nachgewiesen werden sollte. Aus der Leber von zwei Schimpansen mit NANBH wurden DNAs isoliert. Aus nicht infizierter Schimpansenleber und aus Humanplazentas wurden Kontroll-DNAs isoliert. Das Verfahren zur Extraktion von DNA wurde im wesentlichen nach Maniatis und Mitarbeitern (1988) durchgeführt, und die Proben wurden während des Isolierungsprozesses mit RNase behandelt. Beide DNA-Proben wurden entweder mit EcoRI, Mbol oder Hincll (12 Mikrogramm) nach der Vorschrift des Herstellers behandelt. Die digerierten DNAs wurden dann weiter durch Elektrophorese auf 1%igen neutralen Agarosegelen, durch Southern .blotting" auf Nitrocellulose behandelt, und das übertragene Material hybridisierte mit der entsprechenden .nick"-translatierten Sonden-cDNA (3x10' Zählungen pro Minute/ml Hybridisiergemisch). Die DNA aus infizierter Schimpansenleber und normaler Leber wurde mit 32P-markierter HCV-cDNA aus den Clonen 36 plus 81 hybridisiert; die DNA aus Humanplazenta wurde mit 32P-markierter DNA aus dem Beta-Interferon-Gen hybridisiert. Nach der Hybridisierung wurden die .blots" unter strengen Bedingungen gewaschen, d.h. mit einer Lösung, die 0,1 χ SSC, 0,1 % SDS enthielt und bei einer Temperatur von 690C. Die Beta-Interferon-Gen-DNA wurde, wie von Houghton und Mitarbeitern (1981) beschrieben, hergestellt.To determine whether NANBH-infected chimpanzee liver contains detectable HCV DNA (or HCV cDNA), restriction enzyme fragments of DNA were isolated from this source by Southern blotting and the "blots" were probed with 32 P-labeled HCV cDNA. The results showed that the labeled HCV cDNA did not hybridize to the DNA transferred from the infected chimpanzee liver. It also did not hybridize to the DNA transferred for control from normal chimpanzee liver. On the contrary, in a positive control, a labeled probe of the beta interferon gene hybridized strongly to Southern blot of restriction enzyme-digested human placental DNA These systems were designed to detect a single copy of the gene labeled with the labeled probe DNAs were isolated from the liver of two chimpanzees with NANBH Control DNAs were isolated from uninfected chimpanzee liver and from human placentas The DNA extraction procedure was performed essentially according to Maniatis and coworkers (1988), and the samples Both DNA samples were treated with either EcoRI, Mbol or HincII (12 micrograms) according to the manufacturer's instructions The digested DNAs were then further analyzed by electrophoresis on 1% neutral agarose gels, by Southern blotting treated on nitrocellulose, and the transferred material hybridized with the corresponding "nick" -translated probe cDNA (3x10 'counts per minute / ml of hybridization mixture). The DNA from infected chimpanzee liver and normal liver was hybridized with 32 P-labeled HCV cDNA from clones 36 plus 81; the human placenta DNA was hybridized with 32 P-labeled DNA from the beta interferon gene. After hybridization, the "blots" were washed under stringent conditions, ie with a solution containing 0.1% SSC, 0.1% SDS and at a temperature of 69 ° C. The beta interferon gene DNA was as described by Houghton and coworkers (1981).
IV.HAb. Ampllfikatlon durch die PCR-TechnlkIV.HAb. Amplification by the PCR Technlk
Um festzustellen, ob die HCV-DNA in Leber aus Schimpansen mit NANBH nachzuweisen sei, v/urde DNA aus dem Gewebe isoliert und dem PCR-Amplifikations-Nachweisverfahren unter Verwendung von Primern und Sondenpolynucleotiden, die aus HCV-cDNA aus Clon 81 abgeleitet worden waren, unterzogen. Als negative Kontrollen wurden DNA-Proben, die aus nicht infizierten HepG 2-Gewebekulturzellen und aus voraussichtlich nicht infizierter Hu.Tianplazenta isoliert worden war, verwendet. Als positive Kontrollen erwiesen sich Proben, der negativen Kontroll-DNAs, denen eine bekannte relativ kleine Menge (250 Moleküle) des HCV-cDNA-lnserts aus Clon 81 zugefügt worden war. Um zusätzlich zu bestätigen, daß DNA-Fraktionen (RNA-Fraktionen? engl. Kopie schwer lesbar), die aus der gleichen Leber von Schimpansen mit NANBH isoliert worden waren, Seq jenzen enthielten, die zur HCV-cDNA-Sonde komplementär sind, wurde das PCR-Amplifikations-Nachweissystem auch an 'den isolierten RNA-Proben angewandt.To determine whether the HCV DNA in chimpanzee liver was to be detected with NANBH, DNA was isolated from the tissue and PCR amplification detection method using primers and probe polynucleotides derived from clone 81 HCV cDNA , subjected. As negative controls, DNA samples isolated from uninfected HepG 2 tissue culture cells and from suspected uninfected Hu. Tianplacenta were used. As positive controls, probes, the negative control DNAs to which a known relatively small amount (250 molecules) of the HCV cDNA insert from clone 81 had been added, appeared. In addition, to confirm that DNA fractions (RNA fractions which are difficult to read copy) isolated from the same liver of chimpanzees with NANBH contained sequences complementary to the HCV cDNA probe, PCR amplification detection system also applied to the isolated RNA samples.
Bei diesen Untersuchungen wurden die DNAs durch das in Abschnitt IV.H.4.a. beschriebene Verfahren isoliert und die RNAs wurden im wesentlichen nach der Beschreibung von Chirgwin und Mitarbeitern (1981) extrahiert.In these studies, the DNAs were amplified by the procedure described in Section IV.H.4.a. were isolated and the RNAs were extracted essentially as described by Chirgwin and coworkers (1981).
DNA-Proben wurden aus 2 infizierten Schimpansenlebern, aus nicht infizierten HepG 2-Zellen und aus Humanplazenta isoliert. Ein Mikrogramm jeder DNA wurde mit Hindill nach den Anweisungen des Herstellers digeriert. Die digerierten Proben wurden durch PCR amplifiziert und der Nachweis der amplifizierten HCV-cDNA erfolgte im wesentlichen nach der Beschreibung in Abschnitt IV.C.3., mit der Ausnahme, daß die Reverse Transkriptasestufe weggelassen wurde. Die PCR-Primer und die Sonde wurden aus HCV-cDNA-Clon-81 gewonnen und sind in Abschnitt IV.C.3. beschrieben. Vor der Amplifikation wurde für positive Kontrollen eine 1-Mikrogramm-Probe jeder DNA durch den Zusatz von 250 Molekülen von aus Clon 81 isoliertem HCV-cDNA-Insert .spiked". Zur Feststeilung, ob HCV-Sequenzen in RNA, die aus den Lebern von Schimpansen mit NANSH isoliert worden waren, vorhanden waren, wurden Proben mit einem Gehalt von 0,4 Mikrogramm Gesamt-RNA einem im wesentlichen wie in Abschnitt IV.C.3. beschriebenen Amplifikationsprozeß unterzogen, wobei jedoch bei einigen Proben als eine negative Kontrolle die Reverse Transkriptase weggelassen wurde. Die PCR-Primer und die Sonde wurden aus HCV-cDNA-Clon 81 wie im vorangegangenen beschrieben, gewonnen.DNA samples were isolated from 2 infected chimpanzee livers, from uninfected HepG 2 cells and from human placenta. One microgram of each DNA was digested with HindIII according to the manufacturer's instructions. The digested samples were amplified by PCR and the detection of the amplified HCV cDNA was performed essentially as described in Section IV.C.3., Except that the reverse transcriptase step was omitted. The PCR primers and probe were recovered from HCV cDNA clone 81 and are described in Section IV.C.3. described. Prior to amplification, a 1 microgram sample of each DNA was "spiked" for positive controls by the addition of 250 molecules of HCV cDNA insert isolated from clone 81. For the determination of whether HCV sequences in RNA derived from the livers of When chimpanzees were isolated with NANSH, samples containing 0.4 micrograms of total RNA were subjected to an amplification process essentially as described in Section IV.C.3, but with some samples as a negative control, the reverse The PCR primer and probe were recovered from HCV cDNA clone 81 as described previously.
Die Ergebnisse zeigten, daß die amplifizierten Sequenzen, die zu der HCV-cDNA-Sonde komplementär sind, weder in den DNAs aus infizierter Schimpansenleber noch in den negativen Kontrollen nachweisbar waren. Im Gegenteil, wenn die Proben, einschließlich der DNA aus infizierter Schimpansenleber vor der Amplifikation mit der HCV-cDNA .spiked" wurden, wurden die Sequenzen aus Clon 81 in allen positiven Kontrollproben nachgewiesen. Außerdem wurden in den RNA-Untersuchungen amplifizierte HCV-cDNA-Sequenzen aus Clon 81 nur nachgewiesen, wenn Reverse Transkriptase verwendet wurde, was stark darauf hindeutet, daß die Ergebnisse nicht durch eine DNA-Kontamination herbeigeführt wurden.The results showed that the amplified sequences complementary to the HCV cDNA probe were detectable neither in the infected chimpanzee liver DNAs nor in the negative controls. On the contrary, if the samples, including the DNA from infected chimpanzee liver, were "spiked" with the HCV cDNA prior to amplification, the sequences from clone 81 were detected in all positive control samples and amplified HCV cDNAs were also amplified in the RNA assays. Clone 81 sequences were detected only when reverse transcriptase was used, strongly suggesting that the results were not due to DNA contamination.
Diese Ergebnisse zeigen, daß Hepatozylen aus Schimpansen mit NANBH keine oder nicht nachweisbare Anteile von HCV-DNA enthalten. Auf der Grundlage der „Spiking"-Untersuchung kann man sagen, falls HCV-DNA vorhanden ist, dann zu einem Anteil von weit unter 0,06 Kopien pro Hepatozyte. Im Gegenteil, die HCV-Sequenzen in der Gesamt-RNA aus den gleichen Leberproben ließen sich mit der PCR-Technik leicht nachweisen.These results indicate that hepatocytes from chimpanzees with NANBH contain no or undetectable levels of HCV DNA. Based on the "spiking" study, it can be said that if HCV DNA is present then it accounts for well below 0.06 copies per hepatocyte, on the contrary, the HCV sequences in the total RNA from the same liver samples could easily be detected with the PCR technique.
Alle Proben wurden mit Hilfe von HCV-C100-3 mit ELISA getestet. Dieser Assay benutzt das HCV-c 100-3-Antigen (das wie in Abschnitt IV.B.5. beschrieben synthetisiert und gereinigt wurde) und ein Meerrettich-Peroxidase-(HRP)-Konjugat von Mausmonoclonalem-Anti-Human-lgG.All samples were tested by ELISA using HCV-C100-3. This assay uses the HCV c 100-3 antigen (synthesized and purified as described in Section IV.B.5.) And a horseradish peroxidase (HRP) conjugate of mouse monoclonal anti-human IgG.
Die mit dem HCV-c 100-3-Antigen beschichteten Platten wurden folgendermaßen vorbereitet. Eine Lösung aus Beschichtungspuffer (5OmM Na-Borat, pH 9,0), 21 ml/Platte, BSA (25 Mikrogramm/ml), c100-3 (2,50 Mikrogramm/ml) wurde unmittelbar vor Zugabe auf die Removeawell-Immulon-I-Platten (Dynatech Corp.) zubereitet. Nach fünfminütigem Mischen wurden 0,2 ml/Vertiefung der Lösung auf die Platten gegeben, sie wurden abgedeckt und 2 Stunden bei 370C inkubiert, wonach die Lösung durch Absaugen entfernt wurde. Die Vertiefungen wurden einmal mit 400 Mikrolitern Waschpuffer (10OmM Natriumphosphat, pH 7,4,14OmM Natriumchlorid, 0,1 % [M/V] Casein, 1 % (M/V| Triton X-100,0,01 % [M/V) Thimerosal) gewaschen. Nach Entfernung der Waschlösung wurden 200 Mikroliter/Vertiefung Postcoat-Lösung (1OmM Natriumphosphat, pH 7,2,15OmM Natriumchlorid, 0,1 % (M/V) Casein und 2mM Phenylmethylsulfonylfluorid (PMSF) zugegeben, die Platten wurden lose abgedeckt, um eine Verdunstung zu vermeiden, und wurden 30 Minuten bei Raumtemperatur so stehen gelassen. Anschließend wurden die Vertiefungen zur Entfernung der Lösung abgesaugt und trocken über Nacht ohne Erhitzen lyophilisiert. Die vorbereiteten Platten können bei 2-8°C in verschlossenen Aluminiumbehältern aufbewahrt werden. Zur Durchführung des ELISA-Tests wurden 20 Mikroliter Serumprobe oder Kontrollprobe in eine Vertiefung gegeben, die 200 Mikroliter Probenverdünnungsmittel (10OmM Natriumphosphat, pH 7,4,50OmM Natriumchlorid, 1 mM EDTA, 0,1 % (M/V) Casein, 0,015% [M/V] Therosal, 1 % [M/V] Triton X-100,100 Mikrogramm/ml Hefeextrakt) enthielt. Die Platten wurden verschlossen und zwei Stunden bei 370C inkubiert, wonach die Lösung durch Absaugen entfernt wurde. Die Vertiefungen wurden mit 400 Mikrolitern Waschpuffer (Phosphat-gepufferte Salzlösung [PBS), die 0,05% Tween 20 enthielt) gewaschen. Die gewaschenen Vertiefungen wurden mit 200 Mikrolitern Maus-Anti-Hurrvn-lgG-HRP-Konjugat, das in einer Lösung aus Ortho-Konjugat-Verdünnungsmittel (1OmM Natriumphosphat, pH 7,2,15OmM Natriumchlorid, 50% (V/V) Fötalrinderserum, 1 % (V/V) wärmbbehandeltes Pferdeserum, 1 mM K3Fe(CN)8,0,05% (M/V| Tween 20,0,02% [M/V] Thimerosal) enthalten war, behandelt. Die Behandlung dauerte 1 Stunde bei 370C, danach wurde die Lösung durch Absaugen entfernt und die Vertiefungen wurden mit Waschpuffar gewaschen, der ebenfalls wieder durch Absaugen entfernt wurde. Zur Bestimmung der Menge des gebundenen Enzymkonjugats wurden 200 Mikroliter der Substratlösung (10mg O-Phenylendiamindihydrochlorid pro 5ml Developer-Lösung) zugegeben. Die Developer-Lösung enthält 5OmM Natriumeitrat, das mit Phosphorsäure auf pH 5,1 eingestellt war, und 0,6 Mikroliter/ml 30%iges H]O]. Die Platten mit der Substratlösung wurden im Dunkeln 30 Minuten bei Raumtemperatur inkubiert, die Reaktionen wurden durch Zugabe von 50 Mikroliter/ml 4 N Schwefelsäure gestoppt und die Extinktionswerte (OD) wurden bestimmt.The plates coated with the HCV c 100-3 antigen were prepared as follows. A solution of coating buffer (50 mM Na-borate, pH 9.0), 21 ml / plate, BSA (25 micrograms / ml), c100-3 (2.50 micrograms / ml) was added to the Removeawell Immulon immediately before addition. I plates (Dynatech Corp.). After mixing for 5 minutes, 0.2 ml / well of the solution was added to the plates, they were covered and incubated at 37 ° C. for 2 hours, after which the solution was removed by suction. The wells were washed once with 400 microliters of wash buffer (10 mM sodium phosphate, pH 7.4.14 mM sodium chloride, 0.1% M / V casein, 1% (M / V) Triton X-100.0.01% [M / V]. V) thimerosal). After removal of the wash solution, 200 microliters / well of postcoat solution (10 mM sodium phosphate, pH 7.2, 15 mM sodium chloride, 0.1% (w / v) casein, and 2 mM phenylmethylsulfonyl fluoride (PMSF) were added, the plates were loosely capped to give a And allowed to stand for 30 minutes at room temperature, then the wells were aspirated to remove the solution, and lyophilized dry overnight without heating.The prepared plates can be stored at 2-8 ° C in sealed aluminum containers ELISA assays were performed in a well containing 20 microliters of serum sample or control sample containing 200 microliters of sample diluent (10 mM sodium phosphate, pH 7.4, 50 mM sodium chloride, 1 mM EDTA, 0.1% (M / V) casein, 0.015% [M]. V] Therosal, 1% [w / v] Triton X-100,100 micrograms / ml yeast extract) was prepared. the plates were sealed and incubated for two hours at 37 0 C, after which the solution by suction, was removed. The wells were washed with 400 microliters of wash buffer (phosphate buffered saline [PBS] containing 0.05% Tween 20). The washed wells were washed with 200 microliters of mouse anti-Hurrvn IgG HRP conjugate dissolved in a solution of orthoconjugate diluent (10 mM sodium phosphate, pH 7.2, 125 mM sodium chloride, 50% (v / v) fetal bovine serum, 1% (v / v) of heat-treated horse serum containing 1 mM K 3 Fe (CN) 8 , 0.05% (M / V | Tween 20.0.02% [M / V] thimerosal) took 1 hour at 37 0 C, after which the solution was removed by aspiration and the wells were washed with Waschpuffar, which was also removed by aspiration. to determine the amount of bound enzyme conjugate, 200 microliters of substrate solution (10 mg O-phenylenediamine dihydrochloride per 5 ml The Developer solution contains 5 mM sodium citrate adjusted to pH 5.1 with phosphoric acid and 0.6 microliters / ml of 30% H] O]. The plates with the substrate solution were allowed to stand in the dark for 30 minutes incubated at room temperature, the reactions were monitored by addition e of 50 microliters / ml of 4N sulfuric acid stopped and absorbance values (OD) were determined.
Die im folgenden vorgestellten Beispiele zeigen, daß der Screening-ELISA mit Mikrotiterplatte unter Verwendung von HCV-C100-3-Antigen einen hohen Spezifitätsgrad aufweist, wie durch dio Anfangsrate der Reaktivität von etwa 1 % mit einer Wiederholungsreaktivitätsrate von etwa 0,5% Zufall3spendern bewiesen wird. Der Assay ist in der Lage, die Immunreaktion sowohl in der postakuten Phase der Infektion als auch während der chronischen Krankheitsphase nachzuweisen. Außerdem kann dteser Test zum Nachweis bei einigen Proben angewandt werden, die in den Surrogattests für NANBH negativ bewertet wurden. Diese Proben stammen von Individuen mit einer NANBH-Vorgeschichte oder von Spendern, die von einer NANBH-Übertragung betroffen sind (engl. donors implicated in NANBH transmission). In den im folgenden beschriebenen Beispielen werden die folgenden Abkürzungen verwendet:The examples presented below demonstrate that the microtiter plate screening ELISA using HCV C100-3 antigen has a high degree of specificity, as evidenced by the initial rate of reactivity of about 1% with a repeat-response rate of about 0.5% random donors becomes. The assay is capable of detecting the immune response both during the post-acute phase of the infection and during the chronic disease phase. In addition, this test can be used for detection on some samples that have been negatively evaluated in the surrogate tests for NANBH. These samples are from individuals with a NANBH history or from donors implicated in NANBH transmission (donors implicated in NANBH transmission). In the examples below, the following abbreviations are used:
Eine Gruppe von 1056 Proben (Frischseren) von stichprobenmäßig ausgewählten Blutspendern wurde von der Irwin Memorial Blood Bank, San Francisco, Kalifornien, erhalten. Die Testergebnisse aus diesen Proben werden in einem Histogramm zusammengefaßt, das die Verteilung der Extinktionswerte (Figur 37) zeigt. Wie aus Figur 37 ersichtlich wird, liegen 4 Proben bei > 3, eine Probe zwischen 1 und 3,5 Proben zwischen 0,4 und 1 und die restlichen 1046 Proben liegen bei <0,4, wobei über 90% dieser Proben <0,1 anzeigen.A panel of 1056 samples (fresh sera) from randomly selected blood donors was obtained from Irwin Memorial Blood Bank, San Francisco, California. The test results from these samples are summarized in a histogram showing the distribution of extinction values (Figure 37). As can be seen from FIG. 37, 4 samples are> 3, one sample between 1 and 3.5 samples between 0.4 and 1 and the remaining 1046 samples are <0.4, with over 90% of these samples <0, Show 1.
Die Ergebnisse der reaktiven Stichproben werden in Tabelle 5 aufgeführt. Wendet man einen Abschneidewert an, der den Standardabweichungen Mittelwert plus 5 entspricht, dann waren 10 Proben von 1056 (0,95%) anfangs reaktiv. Davon erwiesen sich fünf Proben (0,47%) wiederholt als reaktiv, als sie ein zweites Mal mit ELISA getestet wurden. Tabelle 5 zeigt auch den ALT- und den Anti-HBd-Status für jede der wiederholt reaktiven Proben. Von besonderem Interesse ist die Tatsache, daß alle fünf wiederholt reaktiven Proben in den beiden Surrogattests für NANBH negativ, im HCV-ELISA jedoch positiv waren.The results of the reactive samples are listed in Table 5. Using a truncation value corresponding to the standard deviations mean plus 5, then 10 samples of 1056 (0.95%) were initially reactive. Of these, five samples (0.47%) repeatedly proved to be reactive when tested a second time by ELISA. Table 5 also shows the ALT and anti-HBd status for each of the repeatedly reactive samples. Of particular interest is the fact that all five repeated reactive samples were negative for NANBH in the two surrogate assays, but positive in the HCV ELISA.
Ergebnisse an reaktiven StichprobenResults on reactive samples
SD = ±0,074SD = ± 0.074
Abschneidewert: χ + 5SD = 0,419(0,400 + negative Kontrolle)Cut off value: χ + 5SD = 0.419 (0.400 + negative control)
Probenanzeigen > 1,5 wurden nicht in die Berechnung des Mittelwertes und der statistischen Abweichung Sample readings> 1.5 were not included in the calculation of the mean and the statistical deviation
einbezogenincluded
' * ALT s 68 IU/L liegen über den normalen Grenzen* ALT s 68 IU / L are above normal limits
"' AnIiHBc S 0,535 (Konkurrenz-Assay) wird als positiv angesehen"AnIiHBc S 0.535 (competition assay) is considered positive
• ·' · WNL: innerhalb normaler Grenzen• · '· WNL: within normal limits
IV.1.2. Schimpansen-SerumprobenIV.1.2. Chimpanzee serum samples
Mittels HCV-dOO-3-ELISA wurden Serumproben aus 11 Schimpansen getestet. 4 dieser Schimpansen waren nach einem eingeführten Verfahren in Zusammenarbeit mit Dr. Daniel Bradley von Centers of Disease Control mit NANBH aus einer kontaminierten Charge Faktor VIII (wahrscheinlich Hutchinson-Stamm) infiziert. Als Kontrollen wurden 4 andere Schimpansen mit HAV und 3 mit HBV Infiziert. Die Serumproben wurden zu verschiedenen Zeiten nach der Infektion genommen. Die in Tabelle 6 zusammengefaßten Ergebnisse zeigen dokumentierte Antikörperserokonversion in allen mit dem Hutchinson-Stamm von NANBH infizierten Schimpansen. Nach der akuten Phase der Infektion (wie durch den signifikanten Anstieg und die anschließende Rückkehr zu normalen ALT-Werten bewiesen wurde) ließen sich die Antikörper gegen HCV-dOO-3 in den Seren der 4/4 NANBH-infizierten Schimpansen nachweisen. Diese Proben haben sich kürzlich wie in Abschnitt IV.B.3. diskutiert wurde, durch die Western-Analyse und ein Radioimmunoassay als positiv erwiesen. Im Gegensatz dazu zeigte keiner der Kontrollschimpansen, die mit HAV oder HBV Infiziert waren, bei ELISA ein Zeichen von Reaktivität.Serum samples from 11 chimpanzees were tested by HCV-dOO-3 ELISA. 4 of these chimpanzees were treated according to an established procedure in collaboration with Dr. med. Daniel Bradley of Centers of Disease Control Infected with NANBH from a Contaminated Charge Factor VIII (Probably Hutchinson's Strain). As controls, 4 other chimpanzees were infected with HAV and 3 with HBV. The serum samples were taken at different times after infection. The results summarized in Table 6 show documented antibody eroconversion in all chimpanzees infected with the Hutchinson strain of NANBH. After the acute phase of infection (as evidenced by the significant increase and subsequent return to normal ALT levels), antibodies to HCV-dOO-3 were detected in the sera of 4/4 NANBH infected chimpanzees. These samples have recently been analyzed as described in Section IV.B.3. was found to be positive by Western analysis and a radioimmunoassay. In contrast, none of the control chimpanzees infected with HAV or HBV showed any sign of reactivity in ELISA.
Tabelle 6 Schimpansen-SerumprobenTable 6 Chimpanzee serum samples
OD S/CO Inokulation Blut ALT TransOD S / CO Inoculation Blood ALT Trans
Datum Datum (IU/L) fusionDate Date (IU / L) fusion
Positivepositive
Kontrolle 1,504Control 1.504
Abschaltung 0,401Shutdown 0.401
Negativenegative
Kontrolle 0,001Control 0.001
Schimpanse 1 -0,007 0,00 24.05.84 24.05.84 9 NANBChimpanzee 1 -0,007 0,00 24.05.84 24.05.84 9 NANB
0,003 0,01 07.08.84 710,003 0,01 07.08.84 71
>3,000 >7,48 18.09.84 19> 3,000> 7,48 18.09.84 19
>3,000 >7,48 24.10.84> 3.000> 7.48 24.10.84
Schimpanse 2 - - 07.06.84 - - NANBChimpanzee 2 - - 07.06.84 - - NANB
-0,003 0,00 31.05.84 5-0.003 0.00 31.05.84 5
-0,005 0,00 28.06.84 52-0.005 0.00 28.06.84 52
0,945 2,36 20.08.84 130,945 2,36 20.08.84 13
>3,000 7,48 24.10.84> 3,000 7.48 24.10.84
Schimpanse 3 0,005 0,01 14.03.85 14.03.85 8 NANBChimpanzee 3 0,005 0,01 14.03.85 14.03.85 8 NANB
0,017 0,04 26.04.85 2050.017 0.04 26.04.85 205
0,006 0,01 06.05.85 140.006 0.01 06.05.85 14
1,0in 2,52 20.08.85 61,0in 2,52 20.08.85 6
Eine verschlüsselte Liste bestand aus 22 einmaligen Proben, jede als Duplikat, d.h. insgesamt 44 Proben. Die Proben stammten von nachgewiesen infektiösen Seren aus chronischen NANBH-Trägorn, infektiösen Seren von betroffenen Spendern und infektiösen Seren von NANBH-Patienten in der akuten Phase. Zusätzlich stammten die Proben von lange zurückverfolgten negativen Kontrollen und anderen Krankheitskontrollen. Diese Listo wurde von Dr. H. Alter von Department to Health and Human Services, National Institutes of Health, Bethesda, Maryland zur Verfugung gestellt. Die Liste wurde von Dr. Alter vor mehreren .Jahren aufgestellt und wurde seither von ihm als qualifizierende Liste für Tests auf vermutliche NANBH benutzt. (Siehe zitierte Bezugnahme auf Dr. Alters Artikel).An encrypted list consisted of 22 unique samples, each as a duplicate, i. a total of 44 samples. The samples were from proven infectious sera from chronic NANBH carrier, infectious sera from affected donors and infectious sera from NANBH patients in the acute phase. In addition, the samples came from long-tracked negative controls and other disease controls. This Listo was written by Dr. H. Age provided by Department of Health and Human Services, National Institutes of Health, Bethesda, Maryland. The list was written by dr. Age ago several years ago and has since been used by him as a qualifying list for tests on presumptive NANBH. (See cited reference to Dr. Alters article).
Die gesamte Liste wurde zweimal durch das ELISA-Verfahren getestet, und die Ergebnisse wurden zur Auswertung an Dr. Alter gesandt. Die Ergebnisse dieser Auswertung sind in Tabelle 7 gezeigt. Obwohl die Tabelle die Ergebnisse von nur einem Duplikatsatz enthält, wurden die gleichen Werte bei jedem der Duplikatproben erreicht.The entire list was tested twice by the ELISA method, and the results were reviewed for evaluation. Age sent. The results of this evaluation are shown in Table 7. Although the table contains the results of only one duplicate set, the same values were achieved on each of the duplicate samples.
Wie in Tabolle 7 gezeigt wird, waren 6 Seren, die in einem Schimpansenmodell erwiesen infektiös waren, stark positiv. Das siebente infektiöse Serum entsprach einer Probe in einem akuten NANBH-FaII und war bei dieser ELISA-Untersuchung nicht reaktiv. Eine Probe aus einem betroffenen Spender mit normalen ALT-Werten und zweideutigen Ergebnissen in den Schimpansenuntersuchungen war bei diesem Test nicht reaktiv. Drei andere Serienproben aus einem Individuum mit akuter NANBH waren ebenfalls nicht reaktiv. Alle Proben, die aus den lange zurückverfolgten negativen Kontrollen stammten, wurden von Spendern erhalten, die minde tens IOmal ohne Hepatitisimplikation Blut gespendet hatten, und waren in der ELISA-Untersuchung nicht reaktiv.As shown in Table 7, 6 sera that were proven infectious in a chimpanzee model were highly positive. The seventh infectious serum corresponded to a sample in an acute NANBH case and was unreactive in this ELISA. A sample from an affected donor with normal ALT values and ambiguous results in the chimpanzee studies was not reactive in this test. Three other serial samples from an individual with acute NANBH were also unreactive. All samples derived from the long traced negative controls were obtained from donors who had given blood at least 10 times without hepatitis, and were unreactive in the ELISA.
Schließlich wurden 4 der getesteten Proben zuvor in von anderen Wissenschaftlern entwickelten Tests auf vermutliche NANBH als positiv bewertet, diese Tests wurden aber nicht bestätigt.Finally, 4 of the tested samples were previously considered positive in presumptive NANBH tests developed by other scientists, but these tests were not confirmed.
Liste 1 von H.AlterList 1 by H.Alter
Liste I.Ergebnis 2. ErgebnisList I. Result 2. Result
1) Durch Schimpansen-Übertragung nachgewiesenermaßen infektiös1) Infectious by chimpanzee transmission
a. Chronische NANB; Post-Txa. Chronic NANB; Post-Tx
JF + +JF + +
EB + +EB + +
PG + +PG + +
b. Betroffene Spender mit erhöhter ALTb. Affected donors with increased ALT
BC + +BC + +
JJ + +JJ + +
BB + +BB + +
c. Akute NANB; Post-Tx WIIc. Acute NANB; Post-Tx WII
2) Durch Schimpansen-Übertragung nicht eindeutig infeitiös2) Not clearly infectious due to chimpanzee transmission
a. Betroffene Spender mit normaler ALTa. Affected donors with normal ALT
CC — —CC - -
3) Akute NANB; Post-TX JL I.Woche3) Acute NANB; Post-TX JL I.Woche
JL 2. Woche JL 3. WocheJL 2nd week JL 3rd week
4) Krankheitskontrollen Primary biliäre Leberzirrhose4) Disease checks Primary biliary cirrhosis
EK - -EK - -
b. Alkoholhepatitis in Rekonvaleszenzb. Alcohol Hepatitis in convalescence
HB - -HB - -
5) Negative Kontrollen mit Vorgeschichte5) Negative controls with history
DH - -DH - -
DC - -DC - -
LV - -LV - -
HL - -HL - -
All - -Alles - -
6) Potentielle NANB-.Antigene" JS-80-01T-O (ISHIDA) Asterix (TREPO)6) Potential NANB "Antigens" JS-80-01T-O (ISHIDA) Asterix (TREPO)
Zurtz (ARNOLD) Becassdine (TREPO)Zurtz (ARNOLD) Becassdine (TREPO)
IV.I.4. Liste 2: Spender/Empfinger-NANBHIV.I.4. List 2: Donor / recipient NANBH
Die verschlüsselte Liste bestand aus 10 unzweideutigen, mit Transfusionen im Zusammenhang stehenden Spender/Empfänger-NANBH-Fällen mit insgesamt 188 Proben. Jeder dieser Fälle bestand aus Proben von einigen oder allen Spendern an den Empfänger und aus Serienproben (die 3,6 und 12 Monate nach der Transfusion genommen wurden) aus dem Empfänger. Auch eine vor der Transfusion aus dem Empfänger entnommene Blutprobe gehörte dazu. Die verschlüsselte Liste wurde von Dr. H. Alter vom NIH aufgestellt, und die Ergebnisse wurden ihm zur Auswertung zugesandt.The encrypted list consisted of 10 unambiguous transfusion-related donor / recipient NANBH cases with a total of 188 samples. Each of these cases consisted of samples from some or all donors to the recipient and from serial samples (taken 3.6 and 12 months after transfusion) from the recipient. A blood sample taken from the recipient prior to transfusion was also included. The encrypted list was written by Dr. med. H. NIH and the results were sent to him for evaluation.
Die ii. Tabelle 8 zur ammengefaßten Ergebnisse zeigen, daß das ELISA-Verfahren Antikörpor-Serokonversion in 9 von 10 Fällen Von mit Transfusion in Zusammenhang stehender NANBH nachwies. Proben aus Fall 4 (wo keine Serokonversion nachgewiesen wurde) reagierten im ELISA beständig schlecht. 2 von den 10 Empfängerproben waren 3 Monate nach der Transfusion reaktiv.The ii. Table 8 for ammulated results shows that the ELISA method demonstrated antibody seroconversion in 9 out of 10 cases of transfusion-related NANBH. Samples from case 4 (where no seroconversion was detected) consistently reacted poorly in the ELISA. Two out of the ten recipient samples were reactive 3 months after transfusion.
Nach 6 Monaten waren 8 Empfängerproben reaktiv und nach 12 Monaten waren mit Ausnahme von Fall 4 alle Proben reaktiv.At 6 months, 8 recipient samples were reactive and at 12 months all samples except Case 4 were reactive.
Außerdem wurde mindestens 1 Antikörper-positiver Spender in 7 von 10 Fällen gefunden, wobei mit Fall 10 2 positive Spender vorliegen. In Fall 10 war die Vortransfusicns-Blutprobe des Empfängers ebenfalls positiv für HCV-Antikörper. Die Blutprobe dieses Empfängers nach einem Monat fiel unter die Grenzlinie der reaktiven Worte, während die Blutproben nach 4 und 10 Monaten auf positive Werte stiegen.In addition, at least 1 antibody-positive donor was found in 7 out of 10 cases, with case 10 having 2 positive donors. In case 10, the recipient's pre-transfusicns blood sample was also positive for HCV antibody. The blood sample of this recipient at one month fell below the limit of reactive words, while the blood samples rose to positive levels at 4 and 10 months.
Im allgemeinen wird ein S/CO von 0,4 als positiv angesehen. Dieser Fall kann somit eine frühere Infektion des Individuums mit HCV sein.In general, an S / CO of 0.4 is considered positive. This case may thus be an earlier infection of the individual with HCV.
Der ALT- und HBc-Status für alle reaktiven, d. h. positiven, Proben ist in Tabelle 9 zusammengefaßt. Wie in der Tabelle ersichtlich ist, waren die Vs Spenderproben für die Surrogatmarker nogativ und im HCV-Antikörper-ELISA-Verfahren reaktiv. Andererseits wiesen die Empfängerproben (12 Monate nach der Transfusion) entweder erhöhte ALT-Worte oder positive Anti-HBc-Werte oder beides auf.The ALT and HBc status for all reactive, i. H. positive, samples are summarized in Table 9. As can be seen in the table, the Vs donor samples were nogative for the surrogate markers and reactive in the HCV antibody ELISA procedure. On the other hand, the recipient samples (12 months after transfusion) had either elevated ALT words or positive anti-HBc values or both.
' ALT a 45IU/L liegt über dem normalen Grenzwert.'ALT a 45IU / L is above the normal limit.
' Anti-HBc a 50% (Konkurrenz-Assay) wird al· positiv angesehen.Anti-HBc a 50% (competition assay) is considered positive.
·*· Blutprobe vor der Trarnfution und 3 Monate danach waren HBc-negativ.· · · Blood sample before the Trarnfution and 3 months after that were HBc negative.
bestimmen. Diese Proben wurden von D. Gary Tegtmeier, Community Blood Bank, Kansas City, bereitgestellt. Die Ergebnissesind in Tabelle 10 zusammengefaßt.determine. These samples were provided by D. Gary Tegtmeier, Community Blood Bank, Kansas City. The results are summarized in Table 10.
erwiesen sich Proben von Individuen mit erhöhter ALT und Anti-HBc-positiv zu 51 % als reaktiv, ein Wert, der mit dem vonklinischen Daten und NANBH-Prävalenz in dieser Gruppe erwarteten Wert übereinstimmt. Das Vorkommen von Antikörpergegen HCV war auch höher bei Blutspendern mit erhöhter ALT allein, bei Blutspendern, die nur für Antikörper gegen Hepatitis-B-Samples from individuals with elevated ALT and anti-HBc positive were found to be 51% reactive, a value consistent with the expected clinical data and NANBH prevalence in this group. The presence of antibody to HCV was also higher in blood donors with elevated ALT alone, in blood donors who were only positive for antibodies to hepatitis B virus.
als zweitem Antikörper Im KCV-CI00-3-ELISAas Secondary Antibody In the KCV-CI00-3 ELISA
die erreicht wurde, wenn entweder ein Antl-lgM-monoclonales-Konjugat verwendet wird, oder wenn beide durch einpolyclonales Antiserum ersetzt werden, welches sowohl Schwer- als auch Leichtketten-spezifisch sein soll. Es wurd?n diofolgenden Untersuchungen durchgeführt.achieved when either an anti-IgM monoclonal conjugate is used, or when both are replaced by a polyclonal antiserum which is said to be both heavy and light chain specific. The following studies were carried out.
entweder das Anti-lgG-monoclonale-Antiserum allein oder in Kombination mit einem Antl-lgM-monoclonalen-Antiserumverwendet wurde, oder ein polyclonales Antiserum eingesetzt wurde. Die Proben wurden voo Dr.Cladd Stevens, N. Y. Bloodeither the anti-IgG monoclonal antiserum was used alone or in combination with an anti-IgM monoclonal antiserum, or a polyclonal antiserum was used. The samples were collected from Dr. Cladd Stevens, N. Y. Blood
zeigen, daß eine starke Reaktivität zu Anfang in den Proben 1-4,2-8 und 3-5 der Fälle 1,2 bzw. 3 nachgewiesen wurde.show that strong reactivity was initially detected in samples 1-4,2-8 and 3-5 of cases 1,2 and 3, respectively.
wurden, sind In Tabelle 13 aufgeführt. Es wurden 3 verschiedene Verhältnisse vor; Anti-lgG zu Anti-lgM getestet. Die Verdünnung1:10000 von Anti-lgG war während der gesamten Tests konstant.are listed in Table 13. There were 3 different conditions; Anti-IgG tested for anti-IgM. The dilution 1: 10,000 of anti-IgG was constant throughout the tests.
zeigon, daß in Übereinstimmung mit den Untersuchungen mit Anti-lgG allein die anfängliche starke Reaktivität in den Proben1-4,2-8 und 3-5 nachgewiesen wurde.zeigon, that in accordance with the studies with anti-IgG alone, the initial strong reactivity was detected in samples 1-4,2-8 and 3-5.
polyclonalem-Konjugat (Verdünnung 1:80000) oder mit Jackson-polyclonalem-Konjugat (Verdünnung 1:80000) gewonnenwurden, sind in Tabelle 14 aufgeführt. Die Daten zeigen, daß die anfängliche starke Reaktivität in den Proben 1-4,2-8 und 3-5 beiallen drei Konfigurationen nachgewiesen wurde. Die Tago-polyclonalen-Antikörper lieferten die ^!adrigsten Signale.polyclonal conjugate (1: 80000 dilution) or with Jackson polyclonal conjugate (1: 80000 dilution) are listed in Table 14. The data show that the initial high reactivity was detected in samples 1-4,2-8 and 3-5 in all three configurations. The tago-polyclonal antibodies gave the strongest signals.
daß die Sensivität des HCV-dOO-S-ELISA-Tests mittels Anti-lgG-monoclonalem-Enzymkonjugat g eich oder besser ist, alsdiejenige, die bei den anderen getesteten Konfigurationen des Enzymkonjugats erhalten wurde.that the sensitivity of the HCV dOO-S ELISA assay by anti-IgG monoclonal enzyme conjugate is equal to or better than that obtained in the other configurations of the enzyme conjugate tested.
Proben von Zufallsblutspendern (siehe Abschnitt IV.1.1.) wurden mittels HCV-ciOO-3-ELISA auf HCV-Infektion gescreent, wobei das Antikörper/Enzymkonjugat entweder ein Anti-lgG-monocIonales-Konjugat oder ein polyclonales Konjugat war. Die Gesamtanzahl der gescreenten Proben betrug 1077 bei polyclonalem Konjugat bzw. 1056 bei monoclonalem Konjugat. Eine Zusammenfassung der Screeningergebnisse erfolgt in Tabelle 15 und die Probenverteilungen werden im Histogramm in Figur 44 gezeigt.Samples from random blood donors (see section IV.1.1.) Were screened for HCV infection by HCV ciOO-3 ELISA, where the antibody / enzyme conjugate was either an anti-IgG monoclonal conjugate or a polyclonal conjugate. The total number of samples screened was 1077 for polyclonal conjugate and 1056 for monoclonal conjugate, respectively. A summary of the screening results is given in Table 15 and the sample distributions are shown in the histogram in FIG.
Die Berechnung der durchschnittlichen und der Standardabweichung erfolgte unter Ausschluß der Proben, die ein Signal über 1,5 ergaben, d. h. es wurden 1073 OD-Werte für die Berechnungen bei polyclonalem Konjugat und 1051 bei Anti-IgG-monoclonalem-Konjugat verwendet. Wie in Tabelle 15 zu erkennen ist, verschob sich der Durchschnittswert von 0,0439 auf 0,0931, und die Standardabweichung stieg von 0,074 auf 0,0933, wenn das polyclonale Konjugat verwendet wurde. Darüber hinaus zeigen die Ergebnisse auch, daß, wenn die Kriterien von χ +5SD angewandt werden, um den Assay-Abschneidowert zu definieren, die polyclonal/Enzymkonjugat-Konfiguration im ELISA-Test einen höheren Abschneidewert erfordert. Dies zeigt eine geringere Assay-Spezifität im Vergleich zum monoclonalen System an. Außerdem tritt, wie aus dem Histogramm in Figur 44 zu entnehmen ist, eine größere Trennung der Ergebnisse zwischen negativer und positiver Verteilung ein, wenn Zufallsblutspender in einem ELISA-Test unter Verwendung des Anti-lgG-monoclonalen-Konjugats im Vergleich zu einem Assay mittels einer herkömmlichen polyclonalen Markierung gescreent werden.The calculation of the mean and standard deviation was done excluding the samples which gave a signal above 1.5, ie. H. 1073 OD values were used for polyclonal conjugate calculations and 1051 for anti-IgG monoclonal conjugate. As can be seen in Table 15, the average value shifted from 0.0439 to 0.0931 and the standard deviation increased from 0.074 to 0.0933 when the polyclonal conjugate was used. In addition, the results also show that when the criteria of χ + 5SD are used to define the assay cutoff value, the polyclonal / enzyme conjugate configuration in the ELISA assay requires a higher cutoff value. This indicates a lower assay specificity compared to the monoclonal system. In addition, as can be seen from the histogram in Figure 44, a greater separation of the results between negative and positive distribution occurs when random blood donors in an ELISA using the anti-IgG monoclonal conjugate compared to an assay by means of a conventional polyclonal label.
IVJ. Nachwels der HCV-Serokonvarslon in NANBH-Patlonten aus vielen geographischen Gegenden Seren von Patienten, bei denen aufgrund erhöhter ALT-Werte NANBH vermutet wurde, bei denen HAV- und HBV-Tests negativ gewesen waren, wurden mittels Radioimmunassay im wesentlichen nach dem Abschnitt IV.D. beschriebenen Verfahren gescreent, wobei jedoch das HCV-C 100-3-Antigen als Screening-Antigen auf den Mikrotiterplatten verwendet wurde. Wie aus den in Tabelle 16 dargestellten Ergebnissen ersichtlich wird, wies das Radioimmunassay in einem hohen Prozentsatz der Fälle positive Proben nach.IV a. Detection of HCV Seroconvarslon in NANBH Patients from Many Geographic Areas Sera from patients suspected of having elevated ALT levels of NANBH in which HAV and HBV tests had been negative were analyzed by radioimmunoassay essentially according to Section IV. D. However, the HCV-C 100-3 antigen was used as a screening antigen on the microtiter plates. As can be seen from the results shown in Table 16, radioimmunoassay detected positive samples in a high percentage of cases.
IV.K. Nachwels der HCV-Serokonverslon In Patienten mit .In der Gemeinschaft erworbener" NANBH Von Dr. H.Alter vom Center of Disease Control und von Dr. J. Dienstag von der Harvard University wurden Seren zur Verfügung gestellt, die von 100 Patienten mit NANBH stammten, bei denen koin offensichtlicher Übertragungsweg zu erkennen war (d.h. keine Transfusionen, kein Benutzer intravenöser Drogen, keine Promiskuität usw. wurden als Risikofaktoren festgestellt). Diese Proben wurden mittels Radioimmunassay im wesentlichen nach dem im Abschnitt IV. D. beschriebenen Verfahren gescreent, mit der Ausnahme, daß das HCV-c100-3-Antigen als Screeningantigen auf den Mikrotiterplatten verwendet wurde. Die Ergebnisse zeigten, daß von den 100 Serumproben 55 Antikörper enthielten, die mit dem HCV-c100-3-Antigen immunologisch reagierten. Die oben beschriebenen Ergebnisse deuten darauf hin, daß die .in der Gemeinschaft erworbene" NANBH ebenfalls durch das HCV verursacht wird.IV.K. HCV seroconversion clones In NANBH-acquired community-acquired NANBH, Dr. H.Alter of the Center of Disease Control and Dr. J. Tuesday of Harvard University provided serums from 100 NANBH patients in which no apparent transmission pathway was detected (ie, no transfusions, no intravenous drug users, no promiscuity, etc. were identified as risk factors.) These samples were screened by radioimmunoassay in substantial accordance with the procedure described in Section IV.D. Except that the HCV c100-3 antigen was used as a screening antigen on the microtiter plates, the results showed that of the 100 serum samples, 55 contained antibodies that immunoreacted with the HCV c100- 3 antigen The results described above indicate that the 'NANBH acquired in the Community' is also caused by HCV.
Da hier außerdem gezeigt wurde, daß das HCV mit den Flaviyiren verwandt ist, von denen die meisten durch Arthropoden übertragen werden, läßt dies darauf schließen, daß die HCV-Übertragung der .in der Gemeinschaft erworbenen" Fälle ebenfalls durch Arthropoden erfolgte.Since it has also been shown here that HCV is related to the flaviruses, most of which are transmitted by arthropods, this suggests that HCV transmission of the 'community acquired' cases was also by arthropods.
IV.L. Vergleich des Auftretens von HCV-Antlkörpern und Surrogatmarkern bei Spendern, die von einer NANBH-Übertragung betroffen sindIV.L. Comparison of the occurrence of HCV antibodies and surrogate markers in donors affected by NANBH transmission
Es wurde eine prognostische Untersuchung durchgeführt, um festzustellen, ob bei Empfängern von Blut von vermutlich NANBH-positiven Spendern, bei denen sich eine NANBH entwickelt hatte, eine Serokonversion zu Anti-HCV-Antikörper-positiv stattgefunden hat. Die Blutspender wurden auf abnorme Surrogatmarker getestet, die jetzt als Marker bei NANBH-Infektion eingesetzt werden, d. h. erhöhte ALT-Werte und das Vorhandensein von Anti-Kern-Antikörpern. Außerdem wurden die Spender auch auf das Vorhandensein von Anti-HCV-Antikörpern getestet. Die Feststellung, ob Anti-HCV-Antikörper vorhanden sind, erfolgte mit Hilfe eines in Abschnitt IV.K. beschriebenen Radioimmunassays. Die Untersuchungsergebnisse sind in Tabelle 17 aufgeführt, die folgendes zeigt: die Patientennummer (Spalte 1); das Vorhandensein von Anti-HCV-Antikörpern im Patientenserum (Spalte 2); die Anzahl von Blutspenden, die der Patient erhalten hatte, wobei jede Spende von einem anderen Spender stammte (Spalte 3); das Vorhandensein von Anti-HCV-Antikörpern im Spenderserum (Spalte 4); und die Surrogatabnormalität des Spenders (Spalte 5). (NT oder - bedeutet nicht getestet). (ALT bedeutet erhöhte Transaminase und Anti-HBc bedeutet Anti-Kern-Antikörper).A prognostic study was conducted to determine whether seroconversion to anti-HCV antibody positive had occurred in recipients of blood from presumably NANBH-positive donors who had developed NANBH. Blood donors were tested for abnormal surrogate markers, which are now used as markers in NANBH infection, d. H. increased ALT levels and the presence of anti-nuclear antibodies. In addition, the donors were also tested for the presence of anti-HCV antibodies. The determination of whether anti-HCV antibodies are present was made by means of a procedure described in Section IV.K. described radioimmunoassays. The test results are listed in Table 17, which shows the patient number (column 1); the presence of anti-HCV antibodies in the patient serum (column 2); the number of blood donations the patient received, each donation from another donor (column 3); the presence of anti-HCV antibodies in the donor serum (column 4); and the surrogate abnormality of the donor (column 5). (NT or - does not mean tested). (ALT means increased transaminase and anti-HBc means anti-nuclear antibody).
Die Ergebnisse In Tabelle 17 zeigen, daß der HCV-Antikörpertest beim Auffinden von infizierten Blutspendern genauer ist als die Surrogatmarkertests. Neun von 10 Patienten, bei denen sich NANBH-Symptome entwickelten, waren im Test auf Anti-HCV-Antikörper-Serokonversion positiv. Von den 11 vermutlich infizierten Individuen (Patient 6 erhielt Spenden von zwei verschiedenen Spendern, die vermutlich NANBH-Träger sind) waren 9 bei Anti-HCV-Antikörpern positiv und 1 war knapp über der Grenzlinie positiv und deshalb nicht eindeutig (Spender von Patient 1).The Results Table 17 shows that the HCV antibody test is more accurate in finding infected blood donors than the surrogate marker tests. Nine out of 10 patients who developed NANBH symptoms were positive for anti-HCV antibody seroconversion. Of the 11 suspected infected individuals (patient 6 received donations from two different donors who are believed to be NANBH carriers) 9 were positive for anti-HCV antibodies and 1 was just above the borderline positive and therefore ambiguous (donor from patient 1) ,
Nutzt man dagegen den Test auf erhöhte ALT-Werte, so sind 6 von don 10 getesteten Spendern negativ und nutzt man den Antikern-Antikörper-Test, so sind 5 von den getesteten 10 Spendern negativ. Von größeren Auswirkungen ist jedoch die Tatsache, daß der ALT-Test und der Anti-HBc-Test in 3 Fällen (Spender für die Patienten 8,9 und 10) keine übereinstimmenden Ergebnisse brachteOn the other hand, if the test is used for elevated ALT values, then 6 out of 10 donors tested are negative and using the antibody antibody test, 5 out of the 10 donors tested are negative. Of greater impact, however, is the fact that the ALT test and the anti-HBc test did not yield consistent results in 3 cases (donors for patients 8,9 and 10)
'Derselbe Spender wie bei Anti-NANBH-positivThe same donor as anti-NANBH positive
IV.M. Amplilikatlon zum Clonleren von KCV-cDNA-Soquenzen mittels PCR und Primern, die aus konservierten Regionen von Flavivlrus-Genom-Sequenzen abgeleitet wurdenIV.M. Amplification to clone KCV cDNA sequences by PCR and primers derived from conserved regions of Flavivlrus genome sequences
Die im vorangegangenen dargestellten Ergebnisse, die darauf schließen lassen, daß das HCV ein Flavivirus oder ein flaviartiges Virus ist, erlauben eine Strategie zum Cionieren von uncharakteristischen HCV-cDNA-Sequenzen mittels der PCR-Technik und mit Primern, die aus den Regionen abgeleitet wurden, die für konservierte Aminosäuresequenzen in den Flaviviren codieren.The results presented above, suggesting that the HCV is a flavivirus or a flaviartic virus, allow a strategy for cionating uncharacteristic HCV cDNA sequences by the PCR technique and with primers derived from the regions, which code for conserved amino acid sequences in the flaviviruses.
Irr allgemeinen wird einer der Primer aus einer definierten HCV-Genomsequenz abgeleitet, und der andere Primer, der eine Region von nicht sequenziertem HCV-Polynucleotid flankiert, wird aus einer konservierten Region des Flavivirusgenoms abgeleitet. Die Flavivirungsgenome enthalten bekannterweise konservierte Sequenzen innerhalb der NS1 - und E-Polypeptide, die in der 5'-Region des Flavivirusgenoms codiert sind. Die für diese Regionen codierenden entsprechenden Sequenzen liegen „upstream" der HCV-cDNA-Sequenz, wie in Figur 26 gezeigt wird. Um somit die aus dieser Region des HCV-Genoms abgeleiteten cDNA-Sequenzen zu isolieren, werden „Upstream"-Primer entworfen, die von den konservierten Sequenzen innerhalb dir >er Flaviviruspolypeptide abgeleitet werden. Die „Downstream'-Primer werden aus einem „Upstream"-Ende des bekannten Teils der HCV-cDNA abgeleitet.Generally, one of the primers is derived from a defined HCV genomic sequence and the other primer flanking a region of non-sequenced HCV polynucleotide is derived from a conserved region of the flavivirus genome. The flavivirus genomes are known to contain conserved sequences within the NS1 and E polypeptides encoded in the 5 'region of the flavivirus genome. The corresponding sequences encoding these regions are "upstream" of the HCV cDNA sequence, as shown in Figure 26. Thus, to isolate the cDNA sequences derived from this region of the HCV genome, "upstream" primers are designed. which are derived from the conserved sequences within you> flavivirus polypeptides. The "downstream" primers are derived from an upstream end of the known part of the HCV cDNA.
Wegen der Degeneration des Codes ist es möglich, daß es zwischen den Flavivirussonden und der entsprechenden HCV-Genomsequenz zu Fehlanpassungen kommen wird. Deshalb wird eine Strategie angewandt, die ähnlich der von Lee (1988) beschriebenen ist. Das Leesche Verfahren nutzt gemischte Oligonucleotidprimer aus, die zu den Produkten der Reversen Translation einer Aminosäuresequenz komplementär sind; die Sequenzen in den gemischten Primern tragen jeder Codonclegeneration der konservierten Aminosäuresequenz Rechnung. Es wurden drei Sätze von Primärgemischen geschaffen, die auf den Aminosäurehomologien beruhen, die in mehreren Flaviviren, einschließlich Dengue-2,4 (D-2,4), Japan-Enzephalitis-Virus (JEV), Gelbfieber (YF) und West-Nile-Virus (WN), gefunden wurden. Die aus der am meisten .upstream" konservierten Sequenzen (5'-1) abgeleitete Primärmischung beruht auf der Aminosäuresequenz Gly-Trp-Gly, die ein Teil der konservierten Sequenz Asp-Arg-Gly-Trp-Tly-AspN ist, die sich im Ε-Protein von D-2, JEV, YF und WN befindet. Die nächste Primermischung (5'-2) beruht auf einer „downstream" konservierten Sequenz im Ε-Protein, Phe-Asp-Gly-Asp-Ser-Tyr-lleu-Phe-GIy-Asp-Ser-Tyr-Heu und ist abgeleitet von Phe-Gly-Asp; die konservierte Sequenz ist in D-2, JEV, YF und WN vorhanden. Die dritte Primermischung (5'-3) beruht auf der Aminosäuresequenz Arg-Ser-Cys, die Teil der konservierten Sequenz Cys-Cys-Arg-Ser-Cy s im NS1 -Protein von D-2, D-4, JEV, YF und WN ist. Die einzelnen Primer, die das Gemisch in 5'-3 bilden, sind in Figur 45 dargestellt.Because of the degeneracy of the code, it is possible that mismatches will occur between the flavivirus probes and the corresponding HCV genome sequence. Therefore, a strategy similar to that described by Lee (1988) is used. The Leesche method utilizes mixed oligonucleotide primers that are complementary to the products of the reverse translation of an amino acid sequence; the sequences in the mixed primers accommodate each codon generation of the conserved amino acid sequence. Three sets of primary blends based on the amino acid homologies present in several flaviviruses, including dengue 2,4 (D-2,4), Japan encephalitis virus (YEV), yellow fever (YF) and West Nile, have been created Virus (WN), were found. The primary mixture derived from the most .upstream "conserved sequences (5'-1) is based on the amino acid sequence Gly-Trp-Gly, which is part of the conserved sequence Asp-Arg-Gly-Trp-Tly-AspN, which is located in the The next primer mix (5'-2) is based on a downstream-conserved sequence in the Ε protein, Phe-Asp-Gly-Asp-Ser-Tyr-lleu -Phe-Gly-Asp-Ser-Tyr hay and is derived from Phe-Gly-Asp; the conserved sequence is present in D-2, JEV, YF and WN. The third primer mixture (5'-3) is based on the amino acid sequence Arg-Ser-Cys, which is part of the conserved sequence Cys-Cys-Arg-Ser-Cy in the NS1 protein of D-2, D-4, JEV, YF and WN is. The individual primers which form the mixture in 5'-3 are shown in FIG.
Zusätzlich zu den unterschiedlichen Sequsnzen, die von der konservierten Region abgeleitet werden, enthält jeder Primer in jeder Mischung auch eine konstante Region am 5'-Ende, die eine Sequenz enthält, die für Stellen für die Restriktionsenzyme, Hindlll, Mbol und EcoRI, codieren.In addition to the different sequences derived from the conserved region, each primer in each mixture also contains a constant region at the 5 'end which contains a sequence coding for sites for the restriction enzymes, HindIII, Mbol and EcoRI.
Der „downstream'-Primer, ssc5h20A, wird von einer Nucleotidsequenz in Clon 5h abgeleitet, die HCV-cDNA mit Sequenzen enthält, die sich mit Sequenzen in den Clonen 14i und 11 b überlappenThe "downstream" primer, ssc5h20A, is derived from a nucleotide sequence in clone 5h containing HCV cDNA with sequences that overlap sequences in clones 14i and 11b
Die Sequenz von ssc5 h 20 A ist The sequence of ssc5h is 20A
5' GTA ATA TGG TGA CAG AGT CA 3'.5 'GTA ATA TGG TGA CAG AGT CA 3'.
Es kann auch ein alternativer Primer, ssc5 h34 A, benutzt v/erden. Dieser Primer wird von einer Sequenz in Clon 5h abgeleitet und enthält zusätzlich Nucleotide am 5'-Ende, die eine Restriktionsenzymstelle bilden, so daß das Cionieren ermöglicht wird. Die Sequenz von ssc5h34A lautetAn alternative primer, ssc5 h34 A, can also be used. This primer is derived from a sequence in clone 5h and additionally contains nucleotides at the 5 'end which form a restriction enzyme site, thus enabling cionation. The sequence of ssc5h34A is
5' GAT CTC TAG AGA AAT CAA TAT GGT GAC AGA GTC A3'.5 'GAT CTC TAG AGA AAT CAA ACT GGT GAC AGA GTC A3'.
Die PCR-Reaktion, die erstmals von Saiki und Mitarbeitern (1986) beschrieben wurde, wird im wesentlichen wie von Lee und Mitarbeitern (1988) beschrieben durchgeführt, mit der Ausnahme, daß die Matrize für die cDNA RNA ist, die aus HCV-infizierter Schimpansenleber isoliert wurde, wie in Abschnitt IV.C.2. beschrieben wurde, oder aus viralen Partikeln stammt, die aus HCV-infiziertem Schimpansenserum isoliert wurde, wie in Abschnitt IV.A.1. beschrieben wurde. Außerdem sind die ,Annealing"-Bedingungen in der ersten Runde der Amplikation weniger streng (0,6M NaCI und 250C), da der Teil des Primers, der an die HCV-Sequenz hybridisiert (anneal) nur 9 Nucleotide beträgt und es zu Fehlanpassungen kommen könnte. Darüber hinaus, wenn ssc 5 h34 A verwendet wird, neigen die zusätzlichen Sequenzen, die nicht vom HCV-Genom abgeleitet sind, dazu, das Primer-Matrizen-Hybrid zu destabilisieren. Nach der ersten Runde der Amplifikation können die .Annealing"-Bedingungen strenger sein (0,066M NaCI und 32°C bis 370C), da amplifizierten Sequenzen jetzt Regionen enthalten, die komplementär zu den Primern oder deren Duplikate sind. Außerdem werden die ersten 10 Zyklen der Amplifikation mit dem Klenow-Enzym I unter den für dieses Enzym geeigneten PCR-Bedingungen durchgeführt. Nach Beendigung dieser Zyklen werdon die Proben extrahiert und entsprechend den Kit-Anweisungen wie von Cetus/Perkin-Elmer vorgesehen mit Taq-Polymerase behandelt. Nach der Amplifikation werden die amplifizierten HCV-cDNA-Sequenzen durch Hybridisierung mittels einer aus Clon 5 h 'abgeleiteten Sonde nachgewiesen. Diese Sonde wird aus Sequenzen abgeleitet, die .upstream" von denen liegen, von denen der Primer abgeleitet wurde, und überlappt nicht die Sequenzen der von Clon 5h abgeleiteten Primer. Die Sequenz der Sonde lautetThe PCR reaction, first described by Saiki and coworkers (1986), is performed essentially as described by Lee and coworkers (1988), except that the template for the cDNA is RNA derived from HCV-infected chimpanzee liver isolated as described in Section IV.C.2. or derived from viral particles isolated from HCV-infected chimpanzee serum as described in Section IV.A.1. has been described. In addition, the, annealing "conditions are in the first round of Amplikation less severe (0.6 M NaCl and 25 0 C), since the part of the primer which hybridizes to the HCV sequence is (anneal) only 9 nucleotides, and there to In addition, when ssc 5 h34 A is used, the extra sequences not derived from the HCV genome tend to destabilize the primer-template hybrid. After the first round of amplification, annealing Conditions be more stringent (0.066M NaCl and 32 ° C to 37 0 C), since amplified sequences now contain regions that are complementary to the primers or their duplicates. In addition, the first 10 cycles of amplification with the Klenow enzyme I are carried out under the PCR conditions suitable for this enzyme. After completion of these cycles, the samples are extracted and treated with Taq polymerase according to the kit instructions provided by Cetus / Perkin-Elmer. After amplification, the amplified HCV cDNA sequences are detected by hybridization using a probe derived from clone 5 h '. This probe is derived from sequences that are "upstream" from those from which the primer was derived, and does not overlap the sequences of clone 5h-derived primers
5' CCC AGC GGC GTA CGC GCT GGA CAC GGA GGT GGC CGC GTC GTG TGG CGG TGT TGT TCT CGT CGG GTT GAT GGC GC 3\5 'CCC AGC GGC GTA CGC CGC GGA CGC GGA GG CGC GTC GTG TGG CG TGT TGT TCT CGT CGG GTT GAT GGC GC 3
IV.N.1. Schaffung einer HCV-cDNA-Bibllothek aus der Leber eines Schimpansen mit Infektiöser NANBH Es wurde eine HCV-cDNA-Bibliothek aus der Leber des Schimpansen, von dem die HCV-cDNA-Bibliothek in Abschnitt IV.A.1. geschaffen worden war, erzeugt. Die Technik zur Schaffung der Bibliothek war ähnlich dor von Abschnitt IV.A.24., mit der Ausnahme, daß eine andere RNA-Quelle und daß ein Primer, der auf der Sequenz von HCV-cDNA in Clon 11b beruhte, benutzt wurde. Die Sequenz des Primers lautetIV.N.1. Creation of a chimpanzee liver HCV cDNA library with infectious NANBH A chimpanzee liver HCV cDNA library was prepared from the HCV cDNA library in Section IV.A.1. had been created. The technique for creating the library was similar to that of section IV.A.24 except that a different RNA source and a primer based on the sequence of HCV cDNA in clone 11b was used. The sequence of the primer is
5' CTG GC Γ TG A AGA ATC 3'.5 'CTG GC Γ TG A AGA ATC 3'.
IV.N.2. Isolierung und Nucleotidsequenz der überlappenden HCV-cDNA In Clon k9-1 bis cDNA In Clon 11b Clon k9-1 wurde aus der HCV-cDNA-Bibliothek isoliert, die aus der Leber eines NANBH-infizierten Schimpansen geschaffen worden war, wie in Abschnitt IV.A.25. beschrieben wurde. Die Bibliothek wurde nach Clonen gescreent, die die Sequenz in Clon 11b überlappen, indem ein Clon verwendet wurde, der Clon 11 b am 5'-Terminus überlappt, Clon 11 e. Die Sequenz von Clon 11b wird in Figur 23 gezeigt. Positive Clone wurden mit einer Häufigkeit von 1 in 500000 isoliert. Ein isolierter Clon, k£M, wurde weiteren Untersuchungen unterzogen. Die überlappende Art der HCV-cDNA in Clon k9-1 bis zum 5'-Ende der HCV-cDNA-Sequenz in Figur 26 wurde durch Sondieren des Clons mit Clon Alex46 bestätigt, dieser letztere Clon enthält eine HCV-cDNA· Sequenz von 30 Basdnpaaren, die den Basenpaaren am 5'-Terminus der HCV-cDNA in Clon 14 i entsprechen, wie im vorangegangenen beschrieben wurde.IV.N.2. Isolation and nucleotide sequence of overlapping HCV cDNA In clone k9-1 to cDNA In clone 11b clone k9-1 was isolated from the HCV cDNA library created from the liver of a NANBH-infected chimpanzee as described in Section IV. A.25. has been described. The library was screened for clones that overlap the sequence in clone 11b using a clone that overlaps clone 11b at the 5 'terminus, clone 11e. The sequence of clone 11b is shown in FIG. Positive clones were isolated at a frequency of 1 in 500,000. An isolated clone, k £ M, was subjected to further study. The overlapping nature of the HCV cDNA in clone k9-1 to the 5 'end of the HCV cDNA sequence in Figure 26 was confirmed by probing the clone with clone Alex46, this latter clone containing a HCV cDNA sequence of 30 basepair pairs corresponding to the base pairs at the 5 'terminus of the HCV cDNA in clone 14 i as described above.
Die Nucleotidsequenz der HCV-cDNA, die aus Clon k9-i isoliert wurde, wurde mit den im vorangegangenen beschriebenen Techniken bestimmt. Die Sequenzen der HCV-cDNA in Clon k£M, die Überlappung mit der HCV-cDNA in Figur 26 und die darin codierten Aminosäuren werden in Figur 46 gezeigt.The nucleotide sequence of the HCV cDNA isolated from clone k9-i was determined by the techniques described above. The sequences of the HCV cDNA in clone k £ M, the overlap with the HCV cDNA in Figure 26 and the amino acids encoded therein are shown in Figure 46.
Die HCV-cDNA-Sequenz in Clon k9—1 wurde mit denen der im Abschnitt IV.A.19. beschriebenen Clone ausgerichtet (aligned), um eine zusammengesotzte HCV-cDNA-Sequenz zu schafften, wobei die k9-1-Sequenz „upstream" von der in Figur 32 gezeigten Sequenz plaziert wu rde. Die zusammengesetzten HCV-cDNA, die die k9-1 -Sequenz enthält, sowie die darin codierten Aminosäuren, wird in Figur 47 gezeigt.The HCV cDNA sequence in clone k9-1 was compared with those described in Section IV.A.19. clones aligned to create a nested HCV cDNA sequence, where the k9-1 sequence was placed "upstream" of the sequence shown in Figure 32. The assembled HCV cDNA encoding the k9-1 And the amino acids encoded therein is shown in FIG.
Die Sequenz der Aminosäuren, die in der 5'-Region der in Figur 47 gezeigten HCV-cDNA codiert sind, wurde mit der entsprechenden Region in einem der Stämme des Dengue-Virus, oben beschrieben, in bezug auf das Profil der Regionen für Hydrophobie und Hydrophilie verglichen. Dieser Vergleich zeigte, daß die in dieser Region codierten Polypeptide aus HCV und Dengue-Virus, wobei diese Region der Region entspricht, die für NS1 (oder einem Teil davon) codiert, ein ähnliches hydrophobes/hydrophiles Profil haben.The sequence of the amino acids encoded in the 5 'region of the HCV cDNA shown in Figure 47 was compared with the corresponding region in one of the dengue virus strains described above with respect to the profile of the regions for hydrophobicity and Hydrophilicity compared. This comparison showed that the polypeptides encoded in this region from HCV and dengue virus, this region corresponding to the region encoding NS1 (or a part thereof), have a similar hydrophobic / hydrophilic profile.
Die im folgenden zur Verfügung gestellte Information erlaubt die Identifikation von HCV-Stämmen. Die Isolierung und Charakterisierung linderer HCV-Stämme kann durch Isolierung der Nucleinsäuren aus Körperkomponenten, die virale Partikel enthalten, durch Schaffung von cDNA-Bibliotheken mittels Polynucleotidsonden, die auf der Grundlage der im folgenden beschriebenen HCV-cDNA-Sonden beruhen, durch Screenen der Bibliotheken nach Clonen, die die unten beschriebenen HCV-cDNA-Sequenzen nnthalten, und durch Vergleichen dnr HCV-cDNAs aus den neuen Isolaten mit den im folgenden beschriebenen cDNAs, erfolgen. Die darin oder im Virusgenom codierten Polypeptide können durch Ausnutzung der im vorangegangenen beschriebenen Polypeptide und Antikörper auf immunologische Kreuz-Reaktivität überwacht werden. Stämme, die den im Abschnitt Definitionen im vorangegangenen beschriebenen Parametern des HCV entsprechen, sind leicht identifizierbar. Weitere Verfahren zur Identifizierung von HCV-Stämmen werden den Fachleuten auf diesem Gebiet auf der Grundlage der hier bereitgestellten Informationen klar sein.The information provided below allows the identification of HCV strains. The isolation and characterization of lesser HCV strains can be accomplished by isolating the nucleic acids from body components containing viral particles by creating cDNA libraries using polynucleotide probes based on the HCV cDNA probes described below, by screening the libraries Clones holding the HCV cDNA sequences described below and comparing dnr HCV cDNAs from the new isolates with the cDNAs described below. The polypeptides encoded therein or in the viral genome can be monitored for immunological cross-reactivity by utilizing the polypeptides and antibodies described above. Strains that meet the parameters of HCV described in the Definitions section above are easily identifiable. Other methods of identifying HCV strains will be apparent to those skilled in the art based on the information provided herein.
Figur 46 zeigt die HCV-cDNA-Sequenz in Clon k9-1, das Segment, das die cDNA in Figur 26 überlappt sowie die darin codierten Aminosäuren. Fig Jr 47 zeigt die Sequenz in einer zusammengesetzten cDNA, die durch Ausrichten der Clone k9—1 bis 15e in der 5' bis 3'-Richtung abgeleitet wurde; sie zeigt auch die im kontinuierlichen ORF codierten Aminosäuren.Figure 46 shows the HCV cDNA sequence in clone k9-1, the segment that overlaps the cDNA in Figure 26 and the amino acids encoded therein. Fig. 47 shows the sequence in a composite cDNA derived by aligning clones k9-1 to 15e in the 5 'to 3' direction; it also shows the amino acids encoded in the continuous ORF.
Die hier in vielfältigen Offenbarung' η vorgelegte Erfindung hat viele industrielle Anwendungen, von denen einige im folgenden vorgestellt werden. Die HCV-cDNAs können für den Entwurf von Sonden zum Nachweis von HCV-Nucleinsäuren in Proben verwendet werden. Die aus den cDNAs abgeleiteten Sonden können zum Nachweis von HCV-Nucleinsäuren zum Beispiel in chemischen Synt iesereaktionen eingesetzt werden. Sie können auch in Screening-Programmen nach Anti-Virus-Agenzien, zur Bestimmung der Wirkung von Mitteln zur Hemmung viraler Replikation in Zellkultursystemen und in Tiermodellsystemen verwendet werden. Die HCV-Polynucleotidsonden sind auch beim Nachweis von Virus-Nucleinsäuren im Menschen nützlich und können somit als eine Grundlage bei der Diagnose von HCV-Infektionen im Menschen dienen.The invention presented herein in various disclosure 'η has many industrial applications, some of which are presented below. The HCV cDNAs can be used to design probes for detection of HCV nucleic acids in samples. The probes derived from the cDNAs can be used for the detection of HCV nucleic acids, for example in chemical syn iesereaktionen. They may also be used in anti-viral agent screening programs, to determine the effect of viral replication inhibition agents in cell culture systems and in animal model systems. The HCV polynucleotide probes are also useful in the detection of viral nucleic acids in humans and thus may serve as a basis for the diagnosis of HCV infections in humans.
Zusätzlich zu dem oben Gesagten liefern die hier zur Verfügung gestellten cDNAs Informationen und stellen ein Mittel der zur Synthetisierung von Polypeptiden, die Epitope des HCV enthalten Diese Polypeptide sind beim Nachweis von Antikörpern gegen HCV-Antig ene nützlich. Es wird hier eine Serie von Immunoassays bei HCV-Infektionen auf der Grundlage von rekombinanten Polypeptiden, die HCV-Epitope enthalten, beschrieben, die kommerzielle Anwendung bei der Diagnose von HCV-induzierter NANBH, beim Screenen von Blutspendern nach HCV-verursachter infektiöser Hepatitis und auch beim Nachweis von kontaminiertem Blut von infektiösen Blutspendern ,Inden werden. Die viralon Antigene werden auch in der Überwachung der Wirksamkeit von Anti-Virusagenzien in Tiermodellen nützlich sein. Außerdem werden die von den hier offenbarten HCV-cDNAs abgeleiteten Polypeptide als Vakzine für die Behandlung von HCV-Infektionen nützlich sein.In addition to the above, the cDNAs provided herein provide information and provide a means of synthesizing polypeptides containing HCV epitopes. These polypeptides are useful in the detection of antibodies to HCV antigens. Described herein is a series of immunoassays in HCV infections based on recombinant polypeptides containing HCV epitopes, commercial application in the diagnosis of HCV-induced NANBH, screening of blood donors for HCV-induced infectious hepatitis, and also when detecting contaminated blood from infectious blood donors, indenes. The viral antigens will also be useful in monitoring the efficacy of anti-viral agents in animal models. In addition, the polypeptides derived from the HCV cDNAs disclosed herein will be useful as vaccines for the treatment of HCV infections.
Die von den HCV-cDNAs abgeleiteten Polypeptide sind außer den oben genannten Verwendungszwecken auch zum Entwickeln von Anti-HCV-Antikörpern nützlich. Sie können deshalb in Anti-HCV-Vakzinen verwendet werden. Die infolge der Immunisierung mit den HCV-Po!ypeptiden erzeugten Antikörper sind auch beim Nachweis auf Vorhandensein von viralem Antigen in Proben nützlich. Sie können somit dazu verwendet werden, die Produktion von HCV-Polypeptiden in chemischen Systemen zu testen. Die Anti-HCV-Antikörper können auch zur Überwachung der Wirksamkeit anti-viraler Agenzien in Screeniny-Programmen, in denen dieso Agenzien in Gewebekultursystemen getestet v/erden, dienen. Weiterhin können sie auch zur passiven Immuntherapie und zur Diagnose von HCV-verursachter NANBH genutzt werden, indem das (die) Virus-Antigen(e) sowohl im Blutspender als auch im -empfänger nachgewiesen werden können. Eine weitere wichtige Verwendung von Anti-HCV-Antikörpern liegt in der Affinitätschromatographie für die Reinigung von Virus- und viralen Polypeptiden. Die gereinigten Virus- und viralen Polypeptidpräparate können in Vakzinen verwendet werden. Außerdem kann das gereinigte Virus auch bei der Entwicklung von Zellkultursystemen, in denen das HCV repliziert, nützlich sein.The polypeptides derived from the HCV cDNAs are also useful for developing anti-HCV antibodies, besides the uses mentioned above. They can therefore be used in anti-HCV vaccines. The antibodies generated as a result of immunization with the HCV polypeptides are also useful in detecting the presence of viral antigen in samples. They can thus be used to test the production of HCV polypeptides in chemical systems. The anti-HCV antibodies may also be used to monitor the efficacy of anti-viral agents in screening programs in which these agents are tested in tissue culture systems. Furthermore, they can also be used for passive immunotherapy and for the diagnosis of HCV-induced NANBH by detecting the virus antigen (s) both in the blood donor and in the recipient. Another important use of anti-HCV antibodies is in affinity chromatography for the purification of virus and viral polypeptides. The purified virus and viral polypeptide preparations can be used in vaccines. In addition, the purified virus may also be useful in the development of cell culture systems in which HCV replicates.
der Aufhellung der Molekularbiologie des Virus nützlich sein und zur Entwicklung von anti-viralen Agenzien führen. Diebe useful in elucidating the molecular biology of the virus and leading to the development of anti-viral agents. The
werden.become.
infiziertem Gcvebe eines Individuums abgeleitet wird, in einem Expressionsvektor, und in der Selektionierung von Clonen, diedie Expressionsprodukte erzeugen, die immunologisch mit Antikörpern in Antikörper enthaltenden Körperkomponenten ausanderen infizierten Individuen, nicht aber mit denen von nicht infizierten Individuen reagieren, besteht, kann auch angewandtwerden bei der Isolierung von cDNAs, die abgeleitet wurden aus anderen, hier im vorangegangenen nicht charakterisiertenderived from an infected individual, in an expression vector, and in the selection of clones that produce the expression products that immunologically react with antibody-containing body components of other infected individuals, but not those of uninfected individuals, may also be used isolation of cDNAs derived from others not characterized hereinbefore
für diese anderen krankheitsbegleiteten Agenzien führen.for these other disease-related agents.
Claims (7)
Sondenantikörper enthält, nachgewiesen wird.An immunoassay for the detection of an HCU antigen, characterized in that (a) a sample suspected of containing an HCU antigen is incubated with a probe antibody directed against the HCU antigen to be detected under conditions which inhibit the formation of an HCU antigen allow an antigen-antibody complex; and (b) an antigen-antibody complex containing the
Probe antibody is detected.
Sonderpolypeptid, das ein HCU-Apitop enthält, unter Bedingungen inkubiert wird, die die Bildung eines Antikörper-Antigen-Komplexes gestatten; und (b) der Antikörper-Antigen-Komplex, der das Sondenanf /en enthält, nachgewiesen wird.2. Immunoassay for the detection of antibodies directed against an HCU antigen, characterized in that (a) a sample, which presumably contains anti-HCU antibodies, with a
A special polypeptide containing an HCU apitope is incubated under conditions permitting the formation of an antibody-antigen complex; and (b) detecting the antibody-antigen complex containing the probe's antigens.
HCU-Epitop umfaßt, das in der HCU-cDNA-Sequenz gemäß Figur 47 kodiert ist.4. Immunoassay according to claim 2, characterized in that the probe polypeptide a
HCU epitope encoded in the HCU cDNA sequence of FIG. 47.
HCU-Epitop umfaßt, das in einer HCU-cDNA-Sequenz in ATCC-Nr. 40394, ATCC-Nr.40388,
ATCC-Nr. 40389, ATCC-Nr. 40390, ATCC-Nr. 40391, ATCC-Nr. 40514, ATCC-Nr. 40511,
ATCC-Nr^OS^oderATCC-Nr.^OölS kodiert ist.5. Immunoassay according to claim 2, characterized in that the probe polypeptide
HCU epitope included in an HCU cDNA sequence in ATCC no. 40394, ATCC No. 40388,
ATCC-No. 40389, ATCC no. 40390, ATCC no. 40391, ATCC no. 40514, ATCC no. 40511,
ATCC No. ^ OS ^ or ATCC No. ^ O oil.
C100-3umfiißt.6. Immunoassiiy according to claim 2, characterized in that the polypeptide is an epitope of
C100-3umfiißt.
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12271487A | 1987-11-18 | 1987-11-18 |
Publications (1)
Publication Number | Publication Date |
---|---|
DD287104A5 true DD287104A5 (en) | 1991-02-14 |
Family
ID=22404317
Family Applications (5)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DD34440488A DD298527A5 (en) | 1987-11-18 | 1988-11-18 | PROCESS FOR PREPARING HCV-EPITOPE-CONTAINING POLYPEPTIDES AND HCV-FREE BLOOD SUPPLEMENTS |
DD34440388A DD298526A5 (en) | 1987-11-18 | 1988-11-18 | METHOD FOR DETECTING HCV NUCLEINE ACIDS |
DD34440288A DD298525A5 (en) | 1987-11-18 | 1988-11-18 | METHOD FOR PRODUCING AN HCV VACCINE |
DD88321971A DD287104A5 (en) | 1987-11-18 | 1988-11-18 | IMMUNOASSEY FOR DETECTION OF AN HCU ANTIGEN AND ANTICO PERPERS PROVIDED AGAINST A HCU ANTIGEN |
DD34440188A DD298524A5 (en) | 1987-11-18 | 1988-11-18 | ANALYSIS KIT FOR HCV POLYNUCLEOTIDES, HCV ANTIGENES AND ANTIBODIES TAKEN AGAINST HCV ANTIGENS |
Family Applications Before (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DD34440488A DD298527A5 (en) | 1987-11-18 | 1988-11-18 | PROCESS FOR PREPARING HCV-EPITOPE-CONTAINING POLYPEPTIDES AND HCV-FREE BLOOD SUPPLEMENTS |
DD34440388A DD298526A5 (en) | 1987-11-18 | 1988-11-18 | METHOD FOR DETECTING HCV NUCLEINE ACIDS |
DD34440288A DD298525A5 (en) | 1987-11-18 | 1988-11-18 | METHOD FOR PRODUCING AN HCV VACCINE |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DD34440188A DD298524A5 (en) | 1987-11-18 | 1988-11-18 | ANALYSIS KIT FOR HCV POLYNUCLEOTIDES, HCV ANTIGENES AND ANTIBODIES TAKEN AGAINST HCV ANTIGENS |
Country Status (2)
Country | Link |
---|---|
DD (5) | DD298527A5 (en) |
ZA (1) | ZA888669B (en) |
-
1988
- 1988-11-18 ZA ZA888669A patent/ZA888669B/en unknown
- 1988-11-18 DD DD34440488A patent/DD298527A5/en active Search and Examination
- 1988-11-18 DD DD34440388A patent/DD298526A5/en unknown
- 1988-11-18 DD DD34440288A patent/DD298525A5/en unknown
- 1988-11-18 DD DD88321971A patent/DD287104A5/en active Search and Examination
- 1988-11-18 DD DD34440188A patent/DD298524A5/en active Search and Examination
Also Published As
Publication number | Publication date |
---|---|
DD298524A5 (en) | 1992-02-27 |
ZA888669B (en) | 1989-08-30 |
DD298525A5 (en) | 1992-02-27 |
DD298526A5 (en) | 1992-02-27 |
DD298527A5 (en) | 1992-02-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DE3886363T3 (en) | NANBV diagnostics | |
US5350671A (en) | HCV immunoassays employing C domain antigens | |
US5698390A (en) | Hepatitis C immunoassays | |
DE69034182T2 (en) | NANBV diagnostics and vaccines | |
DE69033425T3 (en) | HCV isolate J-1 | |
US6027729A (en) | NANBV Diagnostics and vaccines | |
US6171782B1 (en) | Antibody compositions to HCV and uses thereof | |
GB2212511A (en) | Hepatitis C virus | |
AU624105B2 (en) | Nanbv diagnostics and vaccines | |
DD287104A5 (en) | IMMUNOASSEY FOR DETECTION OF AN HCU ANTIGEN AND ANTICO PERPERS PROVIDED AGAINST A HCU ANTIGEN | |
AU640920C (en) | Nanbv diagnostics and vaccines | |
DD297446A5 (en) | NANBV DIAGNOSTICS AND VACCINE | |
PT89041B (en) | METHOD OF PREPARATION OF NANBV DIAGNOSTICS AND VACCINES |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
RPV | Change in the person, the name or the address of the representative (searches according to art. 11 and 12 extension act) | ||
UP | Ineffectiveness of examination requests | ||
IF04 | In force in the year 2004 |
Expiry date: 20081119 |