DD287104A5 - IMMUNOASSEY FOR DETECTION OF AN HCU ANTIGEN AND ANTICO PERPERS PROVIDED AGAINST A HCU ANTIGEN - Google Patents

Abstract

The invention relates to immunoassay for the detection of an HCU antigen and of antibodies directed against an HCU antigen. According to the invention, for example, an immunoassay for detecting an HCU antigen is provided, characterized in that (a) a sample suspected of containing an HCU antigen is probed with a probe antibody directed against the HCU antigen to be detected under conditions is incubated, which shape the formation of an antigen-antibody complex; and (b) detecting an antigen-antibody complex containing the probe antibody. {Immunoassay; HCU antigen; Antibody Probe Antibodies; Antigen-antibody complex}

Description

For this 63 pages drawings

Field of application of the invention

The invention relates to an immunoassay for detecting an HCU antigen and antibodies directed against an HCU antigen for controlling the spread of infection by the non-A non-B hepatitis viruo (NANBU),

In the application cited literature Barr and coworkers (1986), Biotechniquos 4: 428

 Botstein (1979), Gene 8:17.

Brinton, M.A. (1986) in: The Viruses: The Togaviradae and Flaviviridae, (Series edited by Fraenkel-Conra! And Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press), p.327-374.

Broach (1981) in: Molecular Biology of the Yeast Saccharomyces, Vol. 1, p.445, Cold Spring Harbor Press.

Broach and Autorenkollektiv (1983), Meth. Enz. 101: 307

 Chang and author collective (1977), Nature 198: 1056

 Chirgwin and author collective (1979), Biochemistry 18, 5294

 Chomczynski and Sacchi (1987), Analytical Biochemistry 162: 156

 Clewell and Author Collective (1969), Proc. Natl. Acad. Be. USA 62: 1159

 Clewell (1972) J. Bacteriol. 110: 667

 Cohen (1972), Proc. Natl. Acad. Be. USA 69: 2110

 Cousens and author collective (1987), Gene 61: 265

 De Boer and Author Collective (1983), Proc. Natl. Acad. Be. USA 292: 128

 Dreesman and Autorenkollektiv (1985), J. Infect. Disease 151: 761

 Feinstone, S.M. and Hoofnagle, J.H. (1984), New England, J. Med. 311: 185.

Fields and Knipe (1986), Fundamental Virology (Foundations of Virology), (Raven Press, New York)

 Fiers and Author Collective (1978), Nature 273: 113.

Gferety, R.J., and author collective, Viral Hepatitis and Liver Disease (Vyas, B.N., Tuesday, J.L., and Hoofnagle, J.H., edited by Grüne and Stratton, Inc., 198, p.23-47

 Goeddel u. Autorenkollaktiv (1980), Nucleic Acids Res. 8: 4057

 Graham and Van der Eb (1978), Virology 52: 546

 Grunstein and Hogness (1975), Proc. Natl. Acad. Be USA 73: 3961

 Grych u. Author Collective (1985), Nature 316: 74

 Gubler and Hoffman (1983) Gene, 25, 263.

Hammerling and author collective (1981), Monoclonal Antibodies and T-CeII Hybridomas (monodonal antibodies and T cell hybridomas) Hess et al. Author collective (1968), J. Adv. Enzyme Reg. 7: 149.

Hin u. Author Collective (1978), Proc. Natl. Acad. Be. 75: 1929th Hitzeman u. Author collective (1980), J. Biol. Chem. 255: 2073. Holland u. Author collective (1978), Biochemistry 17: 4900. Holland (1981) J. Biol. Chem. 256: 1385. Houghton u. Authors collective (1981), Nucleic Acids Res. 9: 247.

Hunyh, T.V. u. Author collective (1985) in: DNA Cloning Techniques; A Practical Approach (Edited by D. Glover, IRL Press, Oxford, UK), pp. 49-78. Immune. Rev. (1982) 62: 185. Iwarson (1987), British Medical J. 295, 94P.

Kennett u. Author collective (1980), Mono-Lonal Antibodies. (Monoclonal Antibodies) Laemmli (1970), Nature 227, 680. Lee u. Author collective (1988), Science 239: 1288.

Maniatis, T. u. Author Collective (1982), Molecular Cloning; A Laboratory Manual (Molecular Cloning, Laboratory Manual) (Cold Spring Harbor Press, Cold Spring Harbor, New York). Maye and Walker, Eds. (1987), Immunochemical Methods in Cell and Molecular Biology (Academic Press, London). Mdxam u. Authors collective (1980), Methods in Enzymology 65: 499. MacNamara U.Autor collective (1984), Science 226: 1325. Brass u. Authors collective (1981), Nucleic Acids Res. 9: 309. Messing (1983), Methods in Enzymology 101: 20-37. Methods in Enzymology (Academic Press).

Michelle u. Author Collective, International Symposium on Viral Hepatitis.

Monath (1926) in: The Viruses: The Togaviradae and Flaviviridae (Series edited by Fraenkel-Conrat and Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press), pp. 375-440. Nagahuma u. Author collective (1984), Anal. Biochem. 141: 74th Neurath u. Author Collective (1984), Science 224: 392.

Nisonoff u. Author collective (1981), Clin. Immunol., Immunopathol. 21: 397-406. Overby, L.R. (1985), Curr. Hepatol. 5:49. Overby, L.R. (1986), Curr. Hepatol. 6: Overby, L.R. (1987), Curr. Hepatol. 7: Peleg (1969), Nature 221, 193.

Pfefferkorn and Shepirs (1974), in: Comprehensive Virology, Vol. 2 (edited by Fraenkel-Conrat & Wagner, Plenum Press, New York) p. 171-230. Piince, A.M. (1983) Annu. Rev. Microbiol. 37: 217.

Rice u. Author collective (1986) in: The Viruses: Togaviradae and Flaviviridae (series edited by Fraenkel-Conrat and Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press), pp. 213-328.

Roehrig (1986) in: The Viruses: The Togaviridae and Flaviviridae (series edited by Fraenkel-Conrat and Wagner, volume edited by Schlesinger and Schlesinger, Plenum Press). Sadler u. Author collective (1980), Gene 8,279. Saiki u. Author collective (1986), Nature 324: 163. Sanger u. Autoron Collective (1977), Proc. Natl. Acad. Be. USA 74: 5463. Schlesinger u. Author collective (1986), J. Virol. 60: 1,153th

Schreier, M. u. Author collective (1980), Hybridoma Techniques. (Hybridoma) techniques

Scopes (1984), Protein Purification, Principles and Practice, Second Edition (Protein, Purification, Principles and Practice, 2nd Edition) (Springer-Verlag, New York). Shimatake u. Author Collective (1981), Nature 292: 128. Steimer u. Author collective (1986), J. Virol. 58:

Stoller (1980) in: The Togaviruses (Editor: R.W. Schlesinger, Academic Press, New York) pp. 584-622. Taylor u. Author collective (1976), Biochem. Biophys. Acta 442: 324. Towbin u. Author collective (1979), Proc. Natl. Acad. Be. USA 76: 4350.

Tsu and Herzenberg (1980), in: Selected Methods in Cellular Immunology (W.H. Freeman & Co.) pp. 373-391.

Vytdehaag u. Authors collective (1985), J. Immunol. 134: 1225th Valenzuela, P. u. Author collective (1982), Nature 298: 344.

Valenzuela, P. u. Author collective (1984), in: Hepatitis B (Millman, I. and author collective, publisher: Plenum Press) p.225-236. Warner (1984), DNA 3: 401.

Wu and Grossman (1987), Methods in Enzymology, Vol. 154, Recombinant DNA, Part E. Wu (1987), Methods in Enzymology, Vol. 155, Recombinant DNA, Part F. Zoller (1982), Nucleic Acids Res. 10 : 6487.

Cited patent no. US Patent Nr.4,341,761 US Patent Nr.4,399,121 US Patent Nr.4,427,783 US Patent Nr.4,444,887 US Patent Nr.4,466,917 US Patent Nr.4,472,500 US Patent Nr.4,491,632 US Patent Nr.4,493,890 Characteristic of the known state of the art

Non-A-non-B hepatitis (NANBH) is a transmissible disease or family of diseases believed to be induced by a virus other than those of other forms of virus-associated liver disease, including those caused by the virus known hepatitis viruses, ie Hepatitis A virus (HAV), hepatitis B virus (HBV) and delta hepatitis virus (HDV), as well as those caused by cytomegalovirus (CMV) or Epstein-Barr virus (EBV ) differentiates hepatitis. NANBH was first identified in people with blood transfusions. Transmission from humans to chimpanzees and serial passages in chimpanzees has provided evidence that NANBH is due to transmissible infectious agent (s). However, the NANBH transmission agent is still unidentified and the number of pathogens causing this disease is unknown. The epidemiological evidence suggests that there may be three types of NANBH; the epidemic type transmitted by water, the type of blood or needle, and the sporadically occurring type (acquired in the community). However, the number of NANBH-causing pathogens is unknown.

The clinical diagnosis and detection of NANBH has so far mainly been done by excluding other viral markers. Methods used to detect putative NANBV antigens or antibodies include agar gel diifusion, over-migration electrophoresis, immunofluorescence microscopy, immunoelectron microscopy, radioimmunoassay and enzyme immunoassay. However, none of these assays has been found to be sufficiently sensitive, specific and reproducible to be useful as a diagnostic test for NANBH.

So far, there is no clarity or consistency in the identity or specificity of the antigen-antibody systems related to the NANBH pathogens. This is due, at least in part, to previous or concurrent HBV infection in individuals with NANBV and to the known complexity of soluble and finely divided antigens associated with HBV, as well as to integration of HBV DNA into the genome of liver cells. Furthermore, there is the possibility that NANBH is caused by more than one infectious agent and there could also be a misdiagnosis of NANBH. It is also unclear what serological assays in the serum of patients with NANBH detect. It has been postulated that agar gel diffusion and the migration electrophoresis assay detect autoimmune reactions or nonspecific protein interactions that sometimes occur between serum samples, and that they do not represent specific NANBV antigen-antibody reactions. Immunofluorescence, enzyme immunoassay and radioimmunoassay appear to detect low levels of rheumatoid factor-like material commonly found in serum from patients with NANBH and also from patients with other hepatitis and non-hepatitis. Part of the observed reactivity may be an antibody to host-determined cytoplasmic antigens. There are a number of NANBV candidates. See, for example, the summaries of Prince (1983), Feinstone and Hoofnagle (1984), Overby (1985, 1986, 1987), and the articles by Iwarson (1987). However, there is no evidence that any of these candidates is the etiological agent of NANBH.

The demand for sensitive, specific screening and detection methods for NANBV carriers and for NANBV-contaminated blood or blood products is of great importance. Posttransfusion hepatitis (PTH) occurs in almost 10% of transfusion patients, with NANBH responsible for up to 90% of these cases. The main problem with this disease is the frequent aggravation to chronic liver damage (25-55%).

Patient treatment, as well as the prevention of NANBH transmission through blood and blood products or close personal contacts, require reliable diagnostic and prognostic means to detect nucleic acids, antigens, and antibodies associated with NANBV. In addition, there is an urgent need for effective vaccines and immunotherapeutic agents for the prevention and / or treatment of the disease.

Object of the invention

The aim of the invention is the improvement for controlling the spread of infection by the non-A-non-B hepatitis virus (NANBV).

Explanation of the essence of the invention

The invention has for its object to provide novel diagnostic DNA fragments, diagnostic proteins, diagnostic antibodies and protective antigens and antibodies to the pathogen of hepatitis C virus available. The invention relates to the isolation and characterization of a newly discovered etiological agent of NANBH, the hepatitis C virus (HCV). More specifically, the invention provides a family of cDNA copies of portions of the HCV genome. These cDNA copies were isolated by a technique comprising: a novel step of screening expressior production from cDNA libraries created from a finely distributed pathogen in infected tissue with sera from patients with NANBH to obtain newly synthesized antigens; which were derived from the genome of the hitherto unisolated and uncharacterized virus pathogen, and the selection of clones producing products which reacted immunologically only with sera from infected individuals as compared to uninfected individuals. Studies of the nature of the HCV genome using probes developed from the HCV cDNA as well as the sequence information contained in the HCV cDNA indicate that the HCV is a flavirus or a flaviartic virus.

Portions of the cDNA sequences derived from the HCV are useful as probes to detect the presence of the virus in samples and to isolate naturally occurring variants of the virus. These cDNAs also provide polypeptide sequences of HCV antigens encoded in the HCV genome (s) and permit the production of polypeptides useful as standards or as reagents in diagnostic assays and / or as components of vaccines are. Antibodies, both polyclonal and monoclonal, directed against the HCV epitopes contained in these polypeptide sequences are also useful for diagnostic assays and therapeutic agents for

u3s Sr-. "Ring of antiviral MiHeIn and for the isolation of the NANBV pathogen from which these cDNAs are derived useful. In addition, by using probes derived from these cDNAs, it becomes possible to isolate and sequence other portions of the HCV genome to yield additional probes and polypeptides useful for the diagnosis and / or prophylactic therapeutic search for NANBH.

Accordingly, with respect to the polynucleotides, some aspects of the invention relate to: a purified HCV polynucleotide; a recombinant HCV polynucleotide; a recombinant polynucleotide containing a sequence derived from an HCV genome or HCV cDNA; a recombinant polynucleotide encoding an epitope of HCV; a recombinant vector containing any of the above recombinant polynucleotides, and a host cell transformed with any of these vectors. Other aspects of the invention are: a rekombinar.:es Exp ^r essionssystem comprising an open reading frame (ORF) derived from an HCV genome or from HCV cDNA DNA, wherein the ORF is operably linked to a control sequence (English text difficult. readably operably linked? d., Ü) compatible with a desired host; a cell transformed with the recombinant expression system; and a polypeptide produced by the transformed cell.

Further aspects of the invention are: purified HCV, a preparation of polypeptides from the purified HCV; a purified HCV polypeptide; a purified polypeptide containing an epitope that is immunologically identifiable with an epitope contained in HCV.

The aspects of the invention include: recombinant HCV polypeptide; a recombinant polypeptide consisting of a sequence derived from an HCV genome or HCV cDNA; a recombinant polypeptide consisting of an HCV epitope; and a fusion polypeptide consisting of an HCV polypeptide. The invention also includes: a monoclonal antibody directed against an HCV epitope; and a purified preparation of polyclonal antibodies directed against an HCV epitope. Another aspect of the invention is a particle that is immunogenic against HCV infection and contains a non-HCV polypeptide that has an amino acid sequence that can form a particle when that sequence is generated in a eukaryotic host and an HCV epitope ,

Another aspect of the invention is a polynucleotide probe for HCV. Aspects of the invention pertaining to analysis kits are those for: analyzing samples for the presence of polynucleotides derived from the HCV by means of a polynucleotide probe containing a nucleotide sequence from the HCV of about 8 or more nucleotides in a suitable one Container (English container); Analysis of samples for the presence of an HCV antigen by means of an antibody directed against the HCV antigen to be detected in a suitable container; Analysis of samples for the presence of an antibody directed against an HCV antigen by means of a polypeptide containing an HCV epitope present in the HCV antigen in a suitable container.

Other aspects of the invention are: a polypeptide consisting of an HCV epitope linked to a solid substrate; and an antibody to an HCV epitope linked to a solid substrate.

Further aspects of the invention are: a method of producing a polypeptide containing an HCV epitope by incubating host cell ion transformed with an expression vector, the vector containing a sequence encoding a HCV epitope-containing polypeptide, under conditions which: allow expression of the polypeptide; and a polypeptide containing an HCV epitope generated by this method.

The invention also encompasses a method of detecting HCV nucleic acids in a sample, wherein the nucleic acids of the sample react with a probe for an HCV polynucleotide under conditions which permit the formation of a polynucleotide duplex between the probe and the HCV nucleic acid from the sample allow; and for detecting a polynucleotide duplex containing the probe.

Immunoassays are also included in the invention. These include an immunoassay to detect an HCV antigen wherein a sample suspected of containing an HCV antigen is incubated with a probe antibody directed against the HCV antigen to be detected under conditions that prevent the formation of an antigen-antibody. Allow complex; and for detecting an antigen-antibody complex containing the probe antibody. An immunoassay for detecting antibodies directed to an HCV antigen, wherein a sample suspected of containing anti-HCV antibodies is incubated with a probe polypeptide containing an epitope of the HCV under conditions which prevent its formation allow an antibody-antigen complex; and for detection of the antibody-antigen complex containing the probe antigen.

Also included in the invention are vaccines for the treatment of HCV infection which comprise an immunogenic peptide containing an HCV epitope or an inactivated HCV preparation or an attenuated HCV preparation. Another aspect of the invention is a tissue culture infected with HCV.

A still further aspect of the invention is a method of generating antibodies to HCV by administering to an individual an isolated immunogenic polypeptide containing an HCV epitope in an amount sufficient to elicit an immune response.

A still further aspect of the invention is a method of isolating cDNA derived from the genome of an unidentified infectious agent by providing (a) host cells transformed with expression vectors containing a cDNA library prepared from nucleic acids isolated from dom-infected tissues and allowing these host cells to grow under conditions permitting the expression of polypeptide (s) encoded in the cDNA; (b) there is an interaction of the expression products of the cDNA with an antibody-containing body component of an individual infected with the infectious agent under conditions which permit an immune reaction and the antibody-antigen complexes formed as a result of the interaction are detected; (c) culturing host cells that express polypeptides that form antibody-antigen complexes according to step (b) under conditions that allow their growth as individual chlones and that these clones are isolated; (d) growing cells from the clones according to (c) under conditions which allow the expression of polypeptide (s) encoded in the cDNA, and the expression products with antibody-containing body components from individuals other than those mentioned in step (a) infected with the infectious agent and interacting with control individuals not infected with the agent and detecting the antibody-antigen complexes formed as a result of said interaction; (e) culturing host cells expressing polypeptides having antibody-antagonists

Complex antibody-containing body components of infected individuals and of individuals suspected of being infected, rather than the components of control individuals, under conditions that allow their growth as individual clones, and these clones are isolated; and (f) isolating the cDNA from the host cell clones of step (e).

Short description of the drawings

Figure 1 shows the double-stranded nucleotide sequence of the HCV cDNA insert in clone 5-1-1 and the putative amino acid sequence of the polypeptide encoded therein.

Figure 2 shows the homologies of the overlapping HCV cDNA sequences in clones 5-1-1,81,1-2 and 91.

Figure 3 shows a composite sequence of HCV cDNA derived from overlapping clones 81, 1-2 and 91 and the amino acid sequence encoded therein.

Figure 4 shows the double-stranded nucleotide sequence of the HCV cDNA insert in clone 81 and the putative amino acid sequence of the polypeptide encoded therein.

Fig. 5 shows the HCV cDNA sequence in clone 36, the segment which overlaps the NANBV cDNA clone 81 before ι and encoded in clone 36 polypeptide sequence.

Figure 6 shows the combined open reading frames (ORF) of HCV cDNAs in clones 36 and 81 and the polypeptide encoded therein.

Figure 7 shows the HCV cDNA sequence in clone 32, the segment that overlaps clone 81, and the polypeptide encoded therein.

Figure 8 shows the HCV cDNA sequence in clone 35, the segment that overlaps C! On 36, and the polypeptide encoded therein.

Figure 9 shows the combined open reading frames (ORF) of HCV cDNAs in clones 35, 36, 81 and 32 and the polypeptide encoded therein.

Figure 10 shows the HCV cDNA sequence in clone 37b, the segment that overlaps clone 35, and the polypeptide encoded therein.

Figure 11 shows the HCV cDNA sequence in clone 33b, the segmant overlapping clone 32, and the polypeptide encoded therein.

Figure 12 shows the HCV cDNA sequence in clone 40b, the segment that overlaps clone 37b, and the polypeptide encoded therein.

Figure 13 shows the HCV cDNA sequence in clone 25c, the segment that overlaps clone 33b, and the polypeptide encoded therein.

Figure 14 shows the nucleotide sequence and the open reading frame (ORF) polypeptide encoded therein extended by the HCV cDNAs in clones 40b, 37b, 35, 36, 81, 32, 33b and 25c.

Figure 15 shows the HCV cDNA sequence in clone 33c, the segment that overlaps clones 40b and 33c, and the amino acids encoded therein.

Figure 16 shows the HCV cDNA sequence in clone 8h, the segment that overlaps clone 33c and the amino acids encoded therein.

Fig. 17 shows the HCV cDNA sequence in clone 7e, since ^r ment, overlaps clone 8h, and the amino acids encoded therein.

Figure 18 shows the HCV cDNA sequence in clone 14c, not overlapping clone 25c and the amino acids encoded therein.

Figure 19 shows the HCV cDNA sequence in clone 8f, the ..yment overlapping the clone Vt and the amino acids encoded therein.

Figure 20 shows the HCV cDNA sequence in clone 33f, the segment that overlaps clone 8f and the amino acids encoded therein.

Figure 21 shows the HCV cDNA sequence in clone 33g, the segment that overlaps clone 33f, and the amino acids encoded therein.

Figure 22 shows the HCV cDNA sequence in clone 7f, the segment that overlaps the sequence in clone 7e, and the amino acids encoded therein.

Figure 23 shows the HCV cDNA sequence in clone 11b, the segment that overlaps the sequence in clone 7f and the amino acids encoded therein.

Figure 24 shows the HCV cDNA sequence in clone 14i, the segment that overlaps the sequence in clone 11b, and the amino acids encoded therein.

Figure 25 shows the HCV cDNA sequence in clone 39c, the segment that overlaps the sequence in clone 33g and the amino acids encoded therein.

Figure 26 shows the composite HCV cDNA sequence obtained from aligned cDNAs in clones 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35,36,81 , 32,33b, 25c, 14c, 8 f, 33 fund 33g were derived; Further, the amino acid sequence of the polypeptide encoded in the extended ORF in the deduced sequence is shown.

Figure 27 shows the sequence of the HCV cDNA in clone 1 (?) F, the segment that overlaps clone 14i (?), And the amino acids encoded therein. (English text illegible, d.U.)

Figure 28 shows the sequence of the HCV cDNA in clone 35f, the segment that overlaps clone 39c and the amino acids encoded therein.

Figure 29 shows the sequence of the HCV cDNA in clone 19g, the segment that overlaps clone 35f and the amino acids encoded therein.

Fig. 31A is a photograph of a Coomassie blue-stained polyacrylamide gel that identifies C100-3 expressed in yeast.

Fig. 31B shows a western blot of C10Ü-3 with serum from a human infected with NANBV.

Fig. 32 shows an autoradiogram of a Northern blot of RNA isolated from the liver of a RB-NANBV infected chimpanzee and probed with clone 81 BB-NANBV cDNA.

Figure 33 shows an autoradiogram of NANBV nucleic acid treated with RNase A or DNase I and probed with BB-NANBV cDNA from clone 81 var.

Fig. 34 shows an autoradiogram of nucleic acids extracted from NANBV particles captured from infected plasma with AnIi-NANB ₆ .,., And probed with ³² P-labeled NANBV cDNA from clone 81 were.

Figure 30 shows the sequence of clone 26g, the segment that overlaps clone 19g, and the amino acids encoded therein.

Figure 31 shows the sequence of clone 15 (?), The segment that overlaps clone 26g, and the amino acids encoded therein.

Fig. 32 shows the sequence in a composite cDNA derived by aligning clones 12 f to 15 (?) In the 5'-3 'direction and those in continuous ORF coded amino acids.

Figure 33 shows a photograph of Western blots of a fusion protein, SOD-NAND ₅ , with chimpanzee serum from BQ-NANB, HAV and HBV infected chimpanzees.

Fig. 34 shows a photograph of Western blots of a fusion protein, SOD-NANB _6. ]. Ι, with serum from humans infected with NANBV, HAV and HBV and from control individuals.

Fig. 35 shows in a map the significant features of the vector pAB 24.

Fig. 36 shows the putative amino acid sequence of the carboxy terminus of the fusion polypeptide C100-3 and the nucleotide sequence coding therefor.

Figure 37A is a photograph of a Coomissiblau-stained polyacrylamide gel that identifies C100-3 expressed in yeast. Figure 37B shows a Western blot of C100-3 with serum from an NANBV infected human. Fig. 38 shows an autocradiogram of a Northern blot of RNA from the liver of BB-NANBV infected chimpanzees

and probed with BB-NANBV cDNA from clone (11).

Fig. 39 shows an autoradiogram of NANBV nucleic acid treated with RNase A or DNase I and with BB-NANBV cDNA

had been probed by clone 81.

Fig. 40 shows an autoradiogram of nucleic acids extracted from NANBV particles which elutes with anti-NANB ^ .i

were probed and probed with ³² P-labeled NANBV cDNA from clone 81.

Figure 41 shows autoradiograms of filters containing isolated NANBV nucleic acids labeled with ³² P-labeled plus and minus

minus-stranded DNA probes derived from NANBV cDNA in clone 81 were probed.

Fig. 42 shows the homologies between a polypeptide encoded in HCV cDNA and a dengue NS protein. Flavivirus. FIG. 43 shows a histogram of the distribution of HCV infection in samples after determination by an ELISA.

Screening.

Fig. 44 shows a histogram of the distribution of HCV infection in samples by means of two configurations of Immunoglobulin-enzyme conjugate in an ELISA assay. Figure 45 shows the sequences in a starter mixture derived from a conserved sequence in NSI of flaviviruses

had been.

embodiments The invention is explained in more detail below with reference to some examples I. Definitions

The term hepatitis C virus was reserved by scientists working in this field for a previously unknown pathogen of NANBH. Accordingly, the term "hepatitis C virus" (HCV), as used herein, refers to a pathogen causing NANBH, formerly known as NANBV and / or BB-NANBV, the terms HCV, NANBV and BB-NANBV As an extension of this terminology, the disease caused by HCV, formerly known as NANB hepatitis (NANBH), is now called hepatitis C. The terms NANBH and hepatitis C can be used interchangeably herein.

As used herein, the term "HCV" refers to a virus species that causes NANBH, as well as debilitated strains or defective interfering particles derived therefrom. "As will be shown below, the HCV genome is HNA that RNA-containing viruses relatively high spontaneous mutation rates, which are intended to be in the range of 10 ^-3 to 10 ^-4 per nucleotide (Fields & Knipe [1986]), have. There is therefore a variety of strains within the ranges described in the following HCV The compositions and methods described herein allow propagation, identification, detection, and isolation of the various related strains, as well as allowing for the diagnosis and production of vaccines for the various strains, and for screening for antiviral agents for pharmacological purposes useful in inhibiting the replication of HCV. Available here Although information obtained from an HCV strain, hereinafter referred to as CDC / HCVI, is sufficient for a virus taxonomist to identify other strains belonging to these species. As described herein, we have discovered that the HCV is an avivirus or flavivirus. Morphology and composition of flaviviral particles are known and discussed in Brinton (1936). In terms of morphology, the flaviviruses generally contain a nucleocapsid in the middle, which is surrounded by a lipid-containing bilayer. The virions are spherical and have a diameter of about 40nm-50nm. Their nuclei have a diameter of about 25 nm-30 nm. On the outer surface of the virion shell are projections with a length of about 5 nm-10 nm with knobs of about 2 nm in diameter.

The HCV encodes an epitope that is immunologically identifiable with an epitope in the HCV genome from which the cDNAs described herein were derived, the epitope is preferably encoded in a cDNA described herein. Compared to other known flaviviruses, the epitope is unique to HCV. This uniqueness of the epitope can be determined by its immunological reactivity with the HCV and its lack of immunological reactivity with other species of flavivirus. Method for determining immunological reactivity si> d known in the art, for example by radioimmunoassay, by ELISA, by hemagglutination, several examples of suitable techniques for assays being presented here.

In addition to the above, the following parameters, either alone or in combination, are applicable to the identification of a strain as HCV. Since HCV strains are evolutionarily related, it is expected that the total homology of genomes at nucleotide level will be at least about 40%, preferably about 60% or more, and more preferably about 80% or more. In addition, the corresponding contiguous sequences are expected to be at least about 13 nucleotides in length. The correspondence between the putative genomic sequence of the HCV strain and the CDC / CH1 HCV cDNA sequence can be determined by techniques known in the art. For example, they can be determined by a direct comparison of the sequence information of the polynucleotide from the putative HCV and the HCV cDNA sequence (s) described herein. For example, they may also be determined by hybridization of the polynucleotides under conditions in which stable duplexes are formed between homologous regions (for example, those that would be used prior to SpDigestion), then digestion with single-stranded (specific) ( en) Nuclease (s) and then sizing the digested fragments.

Because of the evolutionary relatedness of the HCV strains, the putative HCV strains are identifiable by their homology at the polypeptide level. Generally speaking, over 40%, preferably over about 60%, and more preferably over about 80% of the HCV strains are homologous at the polypeptide level. The techniques for determining amino acid sequence homology are known in the art. The amino acid sequence can for example be determined directly and compared with the sequences presented here. For example, the nucleotide sequence of the genome of the putative HCV may also be determined

(usually through a cDNA intermediate); the amino acid sequence encoded therein can be determined and the corresponding regions can be compared.

As used herein, a polynucleotide, which is derived from "a designated sequence, refers to Example of the HCV cDNA, in particular those shown in FIGS. 1-32, or of an HCV genome, on a * Polynucleotide sequence consisting of a sequence of at least about 6 nucleotides, preferably at least about

8 nucleotides, and more preferably at least about 10-12 nucleotides, and most preferably at least about 15-20 nucleotides, corresponding to a region of the designated nucleotide sequence, i. homologous or complementary to her.

Preferably, the sequence of the region from which the polynucleotide is derived is a Seq: .onz to a HCV genome

unique, homologous or complementary. Whether a sequence to the HCV genome is unique or not, can be determined by the

Determine techniques known to those skilled in the art. For example, the sequence with sequences in databases,

z. Genebank, to see if it is present in the uninfected host or in other organisms.

The sequence may also be linked to known sequences of other viral agents, including those known in the art Induce hepatitis, such as As HAV, HBV and HDV ₁ and compared with other members of Flaviviridae. The Matching or non-matching of the deduced sequence with other sequences can also be accomplished by Hybridization under appropriate severe conditions. Hybridization techniques for the determination of Complementarity of the nucleic acid sequences are known in the art and will be discussed below. Please refer

for example, Maniatis and co-workers (1982). Furthermore, malformations of

Duplex polynucleotides by known techniques, such as digestion with a nuclease such as S1, specifically

single-stranded regions digested in duplex polynucleotides. Regions from which typical DNA sequences can be derived include, but are not limited to, for example, rations specific for

Epitope encode, as well as non-transcribed and / or untranslated regions. The derived polynucleotide is not necessarily physically derived from the nucleotide sequence shown, but can

in different ways, including z. As chemical synthesis or DNA replication or reverse transcription or

Transcription derived from the base sequence in the region (s) from which the I-oligonucleotide is derived,

given information can be generated.

Furthermore, combinations of regions corresponding to those of the designated sequence may be known in the art Be modified so that they correspond to the intended purpose. Likewise, a polypeptide or amino acid sequence "derived from" refers to one designated Nucleic acid sequence, e.g. The sequences shown in Figures 1-32, or from an HCV genome, to a polypeptide having a An amino acid sequence which is identical to that of a polypeptide which is encoded in. The sequence or to a part

of which the part consists of at least 3 to 5 amino acids, preferably of at least 8 to 10 amino acids and more preferably at least 11 to 15 amino acids, or which is immunologically identifiable with a peptide encoded in the sequence

A recombinant or derived polypeptide is not necessarily of a designated nucleic acid sequence, for example

The sequence shown in Figures 1-32, or translated from an HCV genome, can be generated in a variety of ways, including e.g. chemical synthesis or expression of a recombinant expression system, or isolation mutant ICV.

The concept. recombinant polynucleotide "as used herein denotes a polynucleotide of genomic,

cDNA, semisynthetic or synthetic origin which, by virtue of its origin or manipulation (1), is not linked to all or part of the polynucleotide to which it is linked in nature or in the form of a library; and / or (2) is associated with a different polynucleotide than would be naturally associated.

The term "polynucleotide" as used herein refers to a polymeric form of nucleotides of any one Length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the Molecule. This term thus includes both double and single stranded DNA as well as double and single stranded RNA. He

also includes, for example, by methylation and / or "capping" modified and unmodified forms of

Polynucleotides. As used herein, the term "HCV, which contains a sequence corresponding to a cDNA" means the HCV ene Polynucleotide sequence homologous or complementary to a sequence in the designated DNA; the degree of

Homology or complementarity to the cDNA will be about 50% or more, preferably about at least 70%, and more preferably about at least 90%. The corresponding sequences will be at least about 70 nucleotides in length, preferably at least about 80 nucleotides in length, and more preferably at least about 90 nucleotides in length. The correspondence between the HCV sequence and the cDNA can be determined by techniques known in the art, such as by direct comparison of the sequenced material with the described cDNAs or by hybridization and

Digestion with single-stranded nucleases and subsequent determination of the digested fragments. The term "purified from viral nucleotide" refers to a HCV genome or fragment thereof that is substantially free of,

d. H. it contains less than about 50%, preferably less than about 70%, and more preferably less than about 90%

Polypeptides to which the viral polynucleotide is naturally linked. The techniques for cleaning the Viral polynucleotides of the viral particles are known in the art and include, for example, disruption

(disruption) of the particles with a chaotropic agent and separation of the polynucleotide (s) and polypeptide (s) by ion exchange chromatography, affinity chromatography and sedimentation by density.

The term "purified virus polypeptide" refers to an HCV polypeptide or fragment thereof that is substantially free

from D. H. it contains less than 50%, preferably less than about 70%, and more preferably less than about 90% of cellular

Components to which the virus polypeptide is naturally linked. The techniques for cleaning the Virus polypeptides are known in the art and examples of these techniques are discussed below.

"Recombinantoic host cells", "host cells", "cells", "cell lines", "cell cultures" and other such terms that refer to microorganisms or higher eukaryotic cell lines that have been cultured as unicellular units refer to cells identified as "cells." Recipients of a recombinant vector may be or have been used for a different transfer DNA, and also include the progeny of the Criginalzelui that has been transfected. It is understood that the progeny of a single parent cell are not necessarily of morphology or genome or totality. The parent cell progeny, which has similarities to the parent cell and is characterized by relevant characteristics, such as the presence of a nucleotide sequence encoding a desired peptide, may be identical to the DNA complement due to a random or intended mutation is in dor d Progeny explained by this definition are included and covered by the above terms. A "replicon" is any genetic element, ie, a plasmid, a chromosome, a virus that behaves as an autonomous unit of polynucleotide repellency within a cell, ie that it is capable of replication under its own control. A "vector" is a replicon to which another polynucleotide segment is linked so as to effect the replication and / or expression of the attached segment.

"Control sequence" refers to polynucleotide sequences necessary to effect expression of the coding sequences to which they are ligated. The nature of these control sequences differs depending on the host organism; in prokaryotes, these control sequences are generally promoters. Ribosome sites and terminators; in eukaryotes, these control sequences are promoters, terminators, and in some cases enhancers. The term "regulatory sequences" is intended to include at least all components whose presence is necessary for expression, and may also include additional components whose presence is advantageous, such as leader sequences. "Operably linked" refers to a juxtaposition, in the components thus described are in a relationship with one another which allows their function in the intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions that are compatible with the control sequences.

An "open reading frame" (ORF) is a region of a polynucleotide sequence that encodes a polypeptide, which region may be part of a coding sequence or a complete coding sequence.

"Ier · ηβ" coding sequence "is a polynucleotide sequence that is transcribed into mRNA and / or translated into a polypeptide when under the control of appropriate regulatory sequences The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and by a A coding sequence may include, but is not limited to, mRNA, cDNA, and recombinant polynucleotide sequences.

"Immunologically identifiable with / as" refers to the presence of an epitope (epitope) and polypeptide (polypeptide) present in and unique to the designated polypeptide (s), usually HCV proteins. Immunological identity can be determined by antibody binding and / or binding competition, and these techniques are well known to those skilled in the art, and are also illustrated below The uniqueness of an epitope may also be determined by computer research in known databases, eg Gen ° bank, for the polynucleotide sequences As used herein, "epitope" refers to an antigenic determinant of an epitope, an epitope could comprise 3 amino acids in a spatial arrangement common to the epitope is unique, generally an epitope consists of at least 5 such amino acids and more generally it consists of at least 8-10 such amino acids. The methods for determining the spatial arrangement of the amino acids are known in the art and include, for example, X-ray crystallography and two-dimensional magnetization.

A polypeptide is "immunologically reactive" with an antibody when it binds to an antibody due to the fact that the antibody recognizes a specific epitope contained in the polypeptide.The immunological reactivity can be determined by antibody binding, especially by kinetics antibody binding, and / or by binding competition, by using a known polypeptide or known polypeptide (s) containing an epitope against which the antibody is directed, as a competitor (s); whether a polypeptide is immunologically reactive with an antibody is known in the art.

As used herein, the term "an HCV-containing immunogenic polypeptide" includes naturally occurring HCV polypeptides or fragments thereof as well as polypeptides produced by other means, such as chemical synthesis, or expression of the polypeptide in a recombinant organism The term "polypeptide" refers to a molecular chain of amino acids rather than a specific length of the product such that peptides, oligopeptides and proteins are included in the definition of the polypeptide. The term also does not refer to the modifications of the polypeptide upon expression such as glycosylations, acetylations, phosphorylations and the like.

"Transformation" as used herein refers to the insertion of an exogenous polynucleotide into a host cell regardless of the method used for the insertion, such as direct uptake, transduction or f-mating. The exogenous polynucleotide may be retained as a nonintegrated vector, e.g. a plasmid, or may be integrated into the host genome in some other way.

"Treatment" in the sense used here refers to prophylaxis and / or therapy.

An "individual" as used herein refers to vertebrates, particularly members of mammalian species, and includes, but is not limited to, pets, sports animals, primates, and humans As used herein, the "plus strand" of a nucleic acid includes the sequence that encodes the polypeptide. The "minus strand" contains a sequence that is complementary to that of the "plus strand".

As used herein, a "positive-stranded genome" is a virus in which the genome, whether RNA or DNA, is single-stranded and encodes a viral polypeptide / virus polypeptide.Examples of positive-stranded RNA viruses are Togaviridae, Coronaviridae, Retroviridae, Also included are the Flaviviridae, formerly classified as Togaviridae, see Fields & Knipe (1986).

As used herein, "antibody-containing body component" refers to a component of the body of an individual that is a source of the antibodies of interest. Antibody-containing body components are known in the art and include, for example, plasma, serum, cerebrospinal fluid, lymph, external to sections of the respiratory, digestive and urogenital tracts, tears, saliva, milk, white blood cells and myeloma. As used herein, "purified HCV preparation" refers to an HCV preparation derived from the cellular Ingredients with which the virus is normally associated and isolated from other virus species that may be present in the infected tissue. The techniques for isolating the viruses are known to those skilled in the art and include, for example, centrifugation and affinity chromatography; A process for producing purified HVC will be explained below.

II. Description of the invention

Unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology and immunology, which are conventional in the art, are given for carrying out the present invention. These techniques are explained in detail in the literature. See, e.g. Maniatis, Fitsch & Sambrook, MOLECULAR CLONING; /. LABORATORY MANUAL (Molecular Cloning, A Laboratory Manual) (1982); DNA CLONING, VOLUMES I AND II (DNA Cloning, Volumes I and II) (Editor D.N. Glover, 1985); OLIGONUCLEOTIDE SYNTHESIS (Oligonucleotide Synthesis) (Editor MJfiait, 1984) NUCLEIC ACID HYBRIDIZATION (Published by BD Harnes & SJ Higgins, 1984) TRANSCRIPTION AND TRANSLATION (Editor BD Hames & S.J.Higgins, 1984) ANIMAL CELL CULTURE (published by RIFrishney, 1986), IMMOBILIZED CELLS AND ENZYMES (Immobilized Cells and Enzymes) (IRL Press, 1986), B. Perbai, A PRACTICAL GUIDE TO MOLECULAR CLONING (A Practical Guide to Molecular Cloning (1984); Series: METHODS IN ENZYMOLOGY (Methods of Enzymology) (Academic Press, Inc.); GENE TRANSFER VECTORS FOR MAMALIAN CELLS (Gene Transfer Vectors for Mammalian Cells) (Editor JH Miller and MP Calos, 1987, Cold Spring Harbor Laboratory) , Methods in Enzymology Vol. 154 and Vol. 155 (Methods of Enzymology, Volume 154 and Volume 155) (Editors Wu and Grossmsn and Wu, eds. Mayer and Walker (1987), IMMUNOCHEMICALMET HODSIN CELLAND MOLECULAR BIOLOGY (Academic Press, London), Scopes (1987) PROTEIN PURIFICATION: PRINCIPLES AND PRACTICE (Protein Purification: Principles and Practice), second edition, (Springer-Verlag, NY) and HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, VOLUMES NV (Handbook of Experimental Immunology, Volume HV), (publisher DMWeir and CC. Blackwell, 1986).

All patents, patent applications and publications mentioned hereinbefore and hereinafter are incorporated herein by reference.

The useful materials and processes of the present invention are made possible by the provision of a family of closely homologous nucleotide sequences isolated from a cDNA library derived from nucleic acid sequences present in the plasma of an HCV-infected chimpanzee. This family of nucleotide sequences does not originate in either humans or chimpanzees because it does not hybridize to human or chimpanzee genomic DNA from uninfected individuals and nucleotides of this family of sequences exist only in the liver and plasma of chimpanzees with HCV infection occur and because the sequence is not present on the Genebank. In addition, this family of sequences shows no significant homology to sequences contained in the HBV genome.

The sequence of a member of the family contained in clone 5-1-1 has a continuous open reading frame (ORF) coding for a polypeptide of about 50 amino acids. The sera from HCV-infected humans contain antibodies that bind to this polypeptide, while the sera from uninfected humans do not contain antibodies that bind to this polypeptide. Finally, while the sera from uninfected chimpanzees do not contain antibodies that bind to this polypeptide, the antibodies in chimpanzees are induced after acute NANBH infection. In addition, antibodies that bind to this polypeptide are not detected in chimpanzees and humans infected with HAV and HBV. According to these criteria, the sequence is a cDNA against a viral sequence, which virus causes or is linked to NANBH; This cDNA sequence is gezöigt in Fig. 1. As will be discussed below, the cDNA sequence in clone 5-1-1 differs from that of the other isolated cDNAs in that it contains 28 extra base pairs. A composition of other identified members of the cDNA family isolated by using a synthetic sequence corresponding to a fragment of the cDNA in clone 5-1-1 is shown in FIG. A member of the cDNA family which was isolated by using a synthetic sequence derived from the cDNA in clone 81 is shown in Fig. 5, and a composition of this sequence with that of clone 81 is shown in Fig. 6. Other members of the cDNA family, including those in the clones 17f, 14i, 11 ^ 7ί, 7β, 8 ^ 33o, 40 ^ 37 ^ 35,36,81,32,33 ^ 25ο, 14c, 8f33f, 35f, 19g , 26g, 15c, 33g and 39c are described in Section IV. A. A composition of the cDNAs in these clones is described in Section IV. A. 9. and tilted in Figure 39. The composite cDNA shows that it contains a continuous open reading frame and thus encodes a polyprotein. These data are consistent with the presumption discussed below that HCV is a flavivirus or flavivirus.

The availability of this family of cDNAs shown in Figures 1-32 permits the construction of DNA probes and polypeptides useful for the diagnosis of NANBH infection of HCV infection and for screening examination in blood donors as well as donated blood and blood products for infection are useful. For example, it is possible to synthesize from the sequences DNA oligomer of about 8-10 nucleotides or more which are useful as hybridizing probes to detect the presence of the viral genome in, for example, sera of individuals who may harbor the virus, or the like useful for screening donated blood for the presence of the virus. The family of cDNA sequences also allow the design and generation of HCV-specific polypeptides useful as diagnostic agents for the presence of antibodies raised during NANBH. Antibodies to purified polypeptides derived from the cDNAs can also be used to detect viral antigens in infected individuals and in blood.

Knowledge of these cDNA sequences also permits the design and production of polypeptides useful as vaccines against HCV and also for the production of antibodies which, in turn, can be used to protect against this disease and / or for therapy with HCV infected individuals can be used.

In addition, the family of cDNA sequences allows further characterization of the HCV genome. The polynucleotide probes derived from these sequences can be used to screen cDNA libraries for additional overlapping cDNA sequences, which in turn can be used to obtain even more overlapping sequences. Unless the genome is segmented and the segments lack common sequences, this technique can be used to obtain the sequence of the entire genome. However, when the genome is segmented, other segments of the genome can be obtained by repeating the Hes-Lambda-gt11 serological screening procedure to isolate the cDNA clones described herein or, alternatively, isolating the genome from purified HCV particles.

The family of cDNA sequences and the polypeptides derived from these sequences as well as the antibodies directed against these polypeptides are useful in the isolation and identification of the BB-NANBV pathogen (s). For example, antibodies directed against HCV epitopes) contained in polypeptides derived from the cDNAs can be used in processes that rely on affinity chromatography to isolate the virus. Alternatively, the antibodies can be used to identify virus particles isolated by other techniques. The viral antigens and the genomic material within the isolated virus particles can then be further characterized. Information derived from the further sequencing of the HCV genome (s), as well as from further characterization of the HCV antigens and genome characterization, allows the design and synthesis of additional probes and polypeptides and antibodies useful for diagnosis, prevention and therapy of HCV-induced NANBH and for the screening of infected blood and blood-like products. The availability of probes for HCV, including antigens and antibodies, as well as polynucleotides derived from the genome from which the family of cDNAs was derived, also allow the development of tissue culture systems which are of great benefit for brightening the biology of HCV become. This, in turn, may lead to the development of new treatments based on antiviral components that preferentially inhibit the replication of or infection by the HCV.

The method used to identify and isolate the agent of NANBH is novel and can be used in the identification and / or isolation of previously uncharacterised pathogens containing a genome and those with a variety of diseases, including those caused by viruses, Viroids, bacteria, fungi and parasites are induced. In this method, a cDNA library was created from the nucleic acids present in the infected tissue from an infected individual. The library was created in a vector that allowed expression of the polypeptides encoded in the cDNA. Clones from host cells containing the vector expressing an immunologically reactive fragment of a polypeptide of the pathogen were selected by immunological screening of the library's expression products with an antibody-containing body component from another individual previously infected with the putative pathogen. The steps of the immunological screening procedure included the interaction of the expression products of the cDNA-containing vectors with the antibody-containing body component of a second infected individual and the detection of the formation of antibody-antigen complexes between the expressing product (s) and antibodies of the second infected one Individual. The isolated clones are further subjected to immunological screening procedures by interacting their expression products with the antibody-containing body components of the other suspected virus-infected individuals and with control individuals uninfected with the putative agent and the formation of antigen-antibody Complexes with antibodies from the infected individuals was detected; and the cDNA-containing vectors encoding polypeptides which are immunologically isolated from antibodies to infected individuals and from individuals suspected of being infected with the agent, but not with control individuals. The infected individuals used for construction of the cDNA library and for immunological screening need not be of the same species. The cDNAs isolated as a result of this method and their expression products and the antibodies directed against the expression products are useful for the characterization and / or trapping of the etiological agent. As described in more detail below, this method has been used successfully to isolate a family of cDNAs derived from the HCV genome.

HA. Preparation of the cDNA sequence

Sera collected from a chimpanzee with chronic HCV infection containing high levels of virus, i.e., at least one 10 'chimpanzee infectious dose / ml (CID / ml), has been used to isolate viral particles; the nucleic acids isolated from these particles were used as templates in the construction of a cDNA library to the viral genome. The procedures for isolating putative HVC particles and for constructing the cDNA library in lambda gt 11 are discussed in Section IV. A. 1.. Lambda gt 11 is a vector designed specifically to express inserted cDNAs as beta-galactosidase fusion polypeptides and to produce a large number of recombinant phage with specific antisera to a particular antigen. The lambda gt 11 library, prepared from a cDNA library containing approximately 200-base cDNA size cDNA, was screened for coded epitopes containing spe; could bind sera derived from previously NANB hepatitis patients. Huynh, T.V., et. al. (1985). It was screened approximately 10 'phage and five positive phage were identified, purified and then tested for specificity of binding to sera from various humans and chimpanzees previously infected with HCV agent. One of the phages, 5-1-1, had bound 5 of the 8 human sera tested. This binding appeared to be selective for sera from patients previously exposed to NANB hepatitis infection since 7 normal blood donor sera did not exhibit such binding.

The sequence of the cDNA in the recombinant phage 5-1-1 was determined and shown in FIG. The polypeptide encoded by this cloned cDNA, which is in the same translational pattern as the N-terminal beta-galactosidase component of the fusion polypeptide, is shown above the nucleotide sequence. Therefore, this translational open reading frame encodes an epitope or epitopes that are specifically recognized by the sera of patients with NANB hepatitis infections.

The availability of the cDNA in recombinant phage 5-1-1 allowed the isolation of other clones, the additional segments

and / or alternative segments of the cDNA for the viral genome. The lambda gt 11 cDNA described above

Bibliothuek was prepared using a synthetic polynucleotide derived from the sequence of the cloned 5-1-1 cDNA

screened. This screening argab three other clones that were identified as 81,1-2 and 91; the cDNAs contained in these clones were sequenced, as described in Section IV. A.3. and IV.A.4. The homologies between the four independent clones are shown in Figure 2, where the homologies are indicated by vertical lines. Nucleotide sequences are present exclusively in clones 5-1-1,81 and 91 and are indicated by small letters.

The cloned cDNAs present in the recombinant phage in clones 5-1-Ί, 81, 1-2 are extremely homoge- and

differ only in two reginnen. First, nucleotide number 67 in clone 1-2 is one thymidine, while the other three

Clones in this position contain a cytidine residue. However, this substitution does not alter the nature of the encoded one Amino acid. The second difference between the clones is that clone 5-1-1 contains 28 base pairs at its 5 'terminus, which in

other clonans are not present. This additional sequence may be a 5'-terminal cloned artifact; Extermine-cloned artifacts are observed in the majority of cDNA products.

Synthetic sequences derived from the 5 'region and 3' region of the HCV cDNA in Cton 81 were used for screening and Isolating cDNAs from the lambda gt H-NANBV cDNA library using the clone 81 cDNA (Section IV.A.5.).

overlap. The sequences of the resulting cDNAs present in clone 36 and clone 32, respectively, are shown in FIG. 5 and FIG.

A synthetic polynucleotide based on the 5'-Reg: on of clone 36 was also used to screen and isolate

cDNAs from the lambda gt 11 NANBV cDNA library are used, or the clone 36 cDNA (Section IV.A.8.) overlap.

A purified clone of recombinant phage-containing cDNA that hybridized to the synthetic polynucleotide probe,

was designated as clone 35 and the NANBV cDNA queni contained in this clone is shown in FIG.

By using the method for isolation of opender cDNA sequences one obtained additional upstream and

downstream HCV cDNA sequences. The isolation of clones will later be described in Section IV.A. described.

Did analysis of nucleotide sequences from within the isolated clones encode HCV-c.DNAs show that the

composite cDNA contains a long continuous open reading frame. Figure 26 shows the sequence of the composite DNA from these Cones together with the. coded in it putative HCV polypeptide.

The description of the method for obtaining the cDNA sequences is mostly of historical interest. The

resulting sequences (and their complements) are provided herein, and the sequences, or any part thereof, may be synthesized using synthetic methods or by a combination of the synthetic methods

Restore partial sequences using similar methods to those described herein

become.

Lambda gt 11 strains replicated pus of the HCV cDNA library and from clones 5-1-1,81,1-2 and 91

according to the provisions of the Budapest Treaty at the American Type Culture Collection (ATCC), 12301 Parklawn

Dr., Rockville, Maryland 20852 and identified with the following accession numbers.

Lcrnbda gt11 ATCC-No. Klr.terlegungsdatum HCV cDNA library 40394 Dec. 1, 1987 Clone 81 40388 Nov. 17, 1987 Clone 91 40389 Nov. 17, 1987 Chlon1-2 40390 Nov. 17, 1987 Clone 5-1-1 40391 1β. Nov. 1987

Upon granting and issuing this United States patent application, all restrictions on the availability of such deposits will be irrevocably canceled; Access to the designated deposits will be made possible during the pendency of the above application to the one designated by the patent agent authorized to do so under 37CFR 1.14 and 35 USC 1.22. In addition, the designated deposits will be held for a period of thirty (30) years from the date of deposit, or for five (5) years after the last filing request; or the life of the US patent, whichever is longer. These deposits and other deposited material as referred to herein are intended for convenience only and are not required to practice the present invention as the description proceeds. The HCV cDMA grade in all of the deposited materials are incorporated herein by reference.

The above specification, au with the, walking "a genome by isolating overlapping cDNA sequences" of the HCV lambda gt 11 -Bib ^': concerned othek represents r <in procedures are available,''the cDNAs rch according dom However, it will be appreciated by those skilled in the art that the information provided herein enables other methods of isolating these CDNAs, some of which are described in Section IV.A., infra, below.

 I.B. Production of viral polypeptides and fragments

The availability of cDNA sequences, either those isolated by use of the cDNA sequences shown in Figures 1 to 26, as set forth below, as well as the cDNA sequences .eta. Η of these figures, permits the construction of the expression vectors The antigenic regions may be derived from the overmold or envelope antigens or from core antigens including, for example, polynucleotide binding proteins, polynucleotide polymerase (s), and other viral proteins required for the replication and / or assembly of the virus particles. The fragments encoding the desired polypeptides are derived from cDNA clones using conventional restriction digestion or synthetic methods and ligated into vectors containing, for example, portions of fusion sequences such as beta-galactosidase or superoxide dismutase (SOD), preferably SOD.

Methods and vectors useful for the production of polypeptides containing synthetic sequences of SOD are described in EPO Publication No. 0196056, published Oct. 10, 1999. 1986, described. Vectors encoding fusion polypeptides of SOD · and HCV polypeptides, ie, NANB ₅ .,!, NANB ₈ , and C100-3 encoded in a composition of HCV cDNAs are described in Sections IV.B.1, IV.B.2 or IV.8.4 described. Any desired portion of the HCV cDNA containing an open reading frame in each of the two encoded strands may be recovered as a recombinant polypeptide, for example as a mature or fusion protein; alternatively, a polypeptide encoded in the cDNA can be prepared by chemical synthesis.

The cDNA encoding the desired polypeptide, whether in fused or mature form, and whether or not a signal sequence that allows secretion, may or may not be ligated into expression vectors suitable for any host. Both eukaryotic and prokaryotic host systems are currently used in the production of recombinant polypeptides, and a summary of some of the common control systems and host cell lines is described in Section III.A. see below, given. The polypeptide is then isolated from lysed cells or from the culture medium and purified to the extent necessary for the intended use. The purification may be carried out by methods known in the art, for example, salt fractionation, chromatography on ion exchange resins, affinity chromatography, centrifugation and so on. For the variety of methods for purifying proteins, see, for example, "Method in Enzymology." Such polypeptides may be used as diagnoses, or those that cause neutralization of antibodies may be formulated in vaccines Also, as discussed later in Section IU, antibodies to these polypeptides are useful for isolating and identifying the HCV particles, as well as being useful as diagnoses or for passive immunotherapy.

The HCV arthotenes can also be isolated from HCV virions. The virions can be grown in HCV-infected cells in tissue culture or in an infected host.

II.C. Preparation of ancillary polypeptides and conjugation with carriers

An antigenic region is generally relatively small, typically from 8 to 10 amino acids or a shorter length. Fragments of only 5 amino acids can characterize an antigenic region. These segments can characterize regions. These segments may correspond to regions of the HCV antigen. Thus, using the cDNAs of HCV as a base, DNAs encoding short segments of HCV polypeptides can be recombinantly expressed either as fusion proteins or as isolated polypeptides. In addition, short amino acid sequences can be conveniently obtained by chemical synthesis. For example, in the case where the synthesized polypeptide is correctly configured to provide the correct epitope but is too small to be immunogenic, it can be bound to a suitable carrier.

A number of techniques for obtaining such compound (s) are known to those skilled in the art, including the formation of disulfide compounds using N-succinimidyl-3- (2-pyridylthio) propionate (SPDP) and succinimidyl-4- (N-maleimidomethyl) cyclohexane. 1-carboxylate (SMCC) purchased from the Pierce Company, Rockford, Illinois. (If the peptide does not have a sulfhydryl group, this can be provided by addition of a cysteine residue.) These reagents cause a disulfide bond between them and the peptide cysteine residues on a protein as well as an amide bond through the epsilon amino to a lysine, or anoer free Amino groups in others. The variety of such disulfide / amide-forming agents is known, see, for example, Immun. Rev. (1982) 62: 185.

Other bifunctional coupling agents form a thioether rather than a disulfide compound. Many of these thioether forming agents are commercially available and include effective esters of 6-maleimidocaproic acid, 2-bromoacetic acid, 2-iodoacetic acid, 4- (N-maleimidomethyl) -cyclohexane-1-carboxylic acid, and the like. The carboxyl groups may be activated by combination with succinimide or 1-hydroxyl-2-nitro-4-sulfonic acid sodium salt. The list above is not exhaustive and modifications of said compounds may of course be used.

Any vehicle can be used that does not induce the generation of host-damaging antibodies. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins; Polysaccharides such as latex-functionalized sepharose, agarose, cellulose, cellulose beads and the like; polymeric amino acids such as polyglutamic acid, polylysine and the like; amino acid copolymers; and inactive virus particles, see, for example, Section II.D. Particularly useful protein substrates are serum albumins, keyhole limpet hemocyrin, immunoglobulin molecules, thyroglobulin, egg albumin, tetanus toxoid, and other proteins well known to those skilled in the art.

II.D. Preparation of HCV Epltope Containing Hybrid Particle Immunogens

The immunogenicity of the epitopes of HCV may also be enhanced by producing them in mammalian or yeast systems that fuse and assemble with particle-forming proteins, such as those associated with hepatitis B surface antigen. The constructs in which the NANBV epitope is directly linked to particle-forming protein coding sequences produce hybrids that are immunogenic with respect to the HCV epitope. In addition, all of the vectors produced contain HBV specific epitopes with different degrees of immunogenicity, such as the pre-S peptide. Thus particles constructed from particle-forming protein which include HCV sequences are immunogenic with respect to HCV and HBV. The hepatitis surface antigen (HBSAg) was formed and assembled in S. cerevlslae (Valenzuela et al., 1982), as well as in mammalian tents (Valenzuela, P. et al., 1984) The formation of such particles revealed that the immunogenicity of the monomer subunit The constructs may also contain the immunodominant epitope of HBSAg comprising 55 amino acids of the presurface (pre-S) region, Neurath et al., (1985). Constructs of the pre-S-HBSAg particles that are capable of being expressed in yeast. are disclosed in EPO 174444, published March 19, 1986. Hybrids including heterologous viral sequences for yeast expression are disclosed in EPO 175261, published March 26, 1966. Both applications are hereby assigned to and are incorporated herein by reference These constructs may also be used in mammalian cells, such as Chinese hamster ovary (CHO) cells, using a s SV40 dihydrofolate reductase vector (Michelle et al. [1984]).

In addition, portions of the particle-forming protein coding sequence may be exchanged for codons encoding HCV editop. In this replacement, regions that are not required to mediate aggregation of the moieties to form immunizing particles in yeast or mammals can be eradicated, thus eliminating additional HBV antigenic sites competing with the HCV epitope.

U.E. Production of vaccines

Vaccines may be prepared from one or more immunogenic polypeptides derived from an HCV cDNA as well as from the cDNA sequences shown in Figures 1 to 32 or from the HCV genome to which they correspond. The homology observed between HCV and flaviviruses provides information concerning the polypeptides which are most likely to be most effective as vaccines as well as the regions of the genome in which they are encoded. The general structure of the flavivirus genome is described in Rice et al. (1986). It is believed that the flavivirus genomic RNA is the only virus-specific mRNA species and is translated into three viral structural proteins, i. H. C, M, and E as well as two large non-structural proteins, NV4 and NV5, and a complex group of minor non-structural proteins. It is known that the major neutralization epitopes for flaviviruses are in the E (envelope) protein (Roehring (1986).) The region encoding the corresponding HCV E gene and polypeptide can be predicted from homology to the flavivirus These polypeptides may be expressed in bacterial, yeast or mammalian cells, or may be isolated in isolation from viral preparations. It is also believed that the other structural proteins also contain epitopes Thus, HCV vaccines may also utilize polypeptides that contain E, C, and M, either individually or in combination of the epitopes.

In addition to the above, it has been shown that immunization with NS1 (non-structural protein 1) results in protection against yellow fever (Schlesinger et al., 1986) .This is true, although immunization did not cause the formation of neutralizing antibodies is likely, especially since this protein appears to be highly conserved among the flaviviruses, which also protects HCV-NS1 against HCV infection In addition, it is also known that non-structural proteins provide protection against viral pathogenicity, even if they do not inhibit the production of neutralizing Cause antibodies.

In view of the above, multi-valent vaccines against HCV may include one or more structural proteins, and / or one or more non-structural proteins. These vaccines may contain, for example, recombinant HCV polypeptides and / or polypeptides isolated from virions. In addition, it is possible to use inactivated HCV in vaccines; inactivation may be by the production of viral lysates or by other means known to those skilled in the art which will cause the inactivation of the flaviviruses, for example by treatment with organic solvents or detergents, or by treatment with formalin. In addition, vaccines can also be produced from attenuated HCV strains. The production of the attenuated HCV strains will be described later.

It is known that some of the proteins present in flaviviruses contain highly conserved regions, so that some immunological cross-Rsactivity must be assumed between HCV and other flaviviruses. It is possible that epitopes shared between the flaviviruses and HCV produce protective antibodies against one or more diseases caused by these pathogenic agents. Therefore, it may be possible to develop multivariate vaccines based on this knowledge.

The preparation of vaccines containing an immunizing polypeptide (s) as an active ingredient is known to those skilled in the art. Typical is the production of such vaccines as injectables, either as liquid solutions or suspensions; Solid forms suitable for solution or suspension in a liquid prior to injection may also be prepared. The preparation may also be emulsified, or the protein may be encapsulated in liposomes. The immunizing agents are often mixed with pharmaceutically acceptable and drug-compatible excipients. Suitable carriers include, for example, water, physiological saline, dextrose, glycerol, ethanol, etc., and combinations thereof. If desired, the vaccines may contain small amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and / or adjuvants that enhance the effectiveness of the vaccine. For example, effective adjuvants include, but are not limited to, aluminum hydroxide, N-acetylmuramyl-L-threonyl-D-isoglutamine (thr-MPD), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine ^ -d'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) ethyl-amine (CGP 19835A, designated as MTP-PE) and RIBI containing three components extracted from bacteria, monophosphoryl lipid A.Trehalosedimycclat and cell wall skeleton fMPL + TDM + CWS) in 2% squalene / Tween-80 emulsion. The efficacy of an adjuvant can be determined by measuring the amount of antibody directed against an immunizing polypeptide containing an HCV antigenic sequence resulting from the administration of this polypeptide to vaccine. results, which also consist of different adjuvants:

The vaccines are usually administered parenterally, by injection, for example, subcutaneously or intramuscularly. Other formulations suitable for other forms of administration include suppositories and, in some cases, oral formulations. Suppositories may include traditional binders and carriers, for example, polyalkylene glycols or triglycerides; Such suppositories may be formed from mixtures containing an active ingredient content in the range of 0.5% to 10%, preferably 1% to 2%. Oral formulations include such normally used excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like. These compositions may take the form of solutions, suspensions, tablets, pills, capsules, long-acting formulations or powders and contain from 10% to 95% of the active ingredient, preferably from 25% to 70%.

The proteins can be formulated into the vaccine in neutral or saline form. Pharmaceutically acceptable salts include acid addition salts (formed with free amino groups of the peptide) formed with inorganic acids, for example hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, maleic acid, etc. The salts formed with the free carboxyl groups may also be derived from inorganic bases, for example, sodium, potassium, ammonium, calcium or ferric D-hydroxides, or such organic bases as isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine and the like become.

II.F. Dosage and administration of vaccines

The vaccines are administered in a manner compatible with the dosage formulation and in an amount which is prophylactically and / or therapeutically effective. The amount to be administered will generally range from 5 micrograms to 250 micrograms of antigen per dose and will depend on the subject being treated, the ability of the immune system to person to synthesize antibodies, and the degree of protection desired. Exact amounts of the required drug to be administered will depend on the judgment of the physician and may be different for each individual.

The vaccine may be administered as a single dose or, preferably, as a multiple dose. A multi-dose regimen means that a main course of vaccination may consist of 1 to 10 individual doses followed by other doses required for subsequent intervals of time required to maintain or re-boost the immune response, for example, in 1 to 4 months (s ) a second dose and, if necessary, after several months another dose or multiple doses. The dosage regimen will also, i. H. at least in part, based on the needs of the individual and depends on the assessment of the physician.

In addition, the vaccine containing the immunizing HCV antigen (s) may be administered in conjunction with other immunoregulatory agents, for example immuno-globulins.

II.G. Production of Antibodies to HCV Epitopes

The immunogenic polypeptides prepared as described above are used to produce antibodies, both polyclonal and monoclonal. When polyclonal antibodies are desired, a selected mammal (for example, a mouse, goat, rabbit, horse, etc.) is immunized with an immunity-producing polypeptide carrying one or more HCV b'pitope (s). The serum of the immunized animal is collected and treated according to known procedures. When the polyclonal antibody to HCV epitope-containing serum contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for the generation and processing of polyclonal antisera are known in the art, see, for example, Mayer and Walker (1987).

Alternatively, polyclonal antibodies can be isolated from a mammal that has previously been infected with HCV. An example of a method of purifying antibodies to HCV epitopes from serum from an infected individual based on affinity chromatography using a fusion polypeptide of SOD and a polypeptide encoded within cDNA clone 5-1-1 is described in Section V.E. shown.

Monoclonal antibodies directed against HCV epitopes can also be readily prepared by one skilled in the art. The general procedure for the production of monoclonal antibodies by hybridomas is well known.

Immortal antibody-producing cell lines can be generated by cell fusion and also by other techniques, such as direct transformation of B lymphocytes with engrafting DNA or transfection with Epstein-Barr virus. See, for example, M. Schreier et al., (1980); Hammerling and others. (1981); Kennott et al., (1980); see also US patent no. 4,341,761; 4,399,121; 4,427,738; 4,444,887; 4,466,917; 4,472,500; 4,491,632 and 4,493,890. Monoclonal antibodies produced against HCV epitode can be analyzed for their different properties, i. H. Isotypes, epitope affinity, etc. are screened by means of lists.

Antibodies, both monoclonal and polyclonal, directed against HCV epitopes are particularly useful in diagnosis, and those that have a neutralizing effect are useful in passive immunotherapy. Monoclonal antibodies can be used specifically to develop anti-idiotypic antibodies.

Anti-idiotypic antibodies are immunoglobulins which carry an "inner" image of the antigen of the infectious agent against which protection is desired See, for example, Nisonoff, A., et al., (1981) and Dreesman et al., (1985).

Techniques for the production of anti-idiotypic antibodies are well known in the art. See, for example, Grzych (1985), MacNamara et al. (1984) and Uytdehaag et al. (1985). These anti-idiotypic antibodies may also be useful for the treatment of NANBH as well as for the lightening of the immunizing regions of the HCV antigen.

H. H. Diagnostic oligonucleotide probes and kits

Using the disclosed portions of the isolated HCV cDNAs as a base, including those in Figures 1 through 32, oligomers of approximately 8 nucleotides or more, either excisional or synthetic, can be prepared which hybridize to and hybridize with the HCV genome the identification of the virus agent or viral agents, as well as in the characterization of viral genomes as well as the detection of viruses in diseased people is useful. The probes for HCV polynucleotides (natural or derived) are of a length that allow the detection of unique viral sequences by hybridization. While 6 to 8 nucleotides represent a workable length, sequences of 10 to 12 nucleotides are preferred, and about 20 nucleotides appear to be of optimal length. These sequences are preferably derived from regions that lack heterogeneity. These probes can be made using routine methods, including automated oligonucleotide synthesis methods. Among the useful probes are, for example, clone 5-1-1 and the additional clones disclosed herein, as well as the various oligomers used in probing

cDNA libraries, which will be further discussed, are useful. A compliment to any unique part of the HCV genome will be enough. For use as Sondr. η, full complementarity is desirable, although this may be unnecessary as the length of the fragment increases. For use of such probes as diagnostic agents, the biological sample to be analyzed, such as blood or serum, is treated, if desired, to extract the nucleic acids contained therein. The nucleic acid resulting from the sample may be subjected to gel electrophoresis or other size separation methods; otherwise, the nucleic acid samples may be spotted without size separation. Subsequently, the samples are marked. Suitable labels and methods for labeling the samples are known in the art and include, for example, nick-translational or kinase, biotin, fluorescent probes, and chemiluminescent probes inserted radioactive tags. The nucleic acids extracted from the sample are then treated with the labeled probe under hybridization conditions subjected to appropriate controls.

The probes can be made completely complementary to the HCV genome. Therefore, usually very strict control conditions are desirable to prevent false-positive results. However, the stringent control conditions should only be used if the probes are complementary to regions of the viral genome lacking heterogeneity.

The stringent control of hybridization is determined by a number of factors during hybridization and during the washing process, including temperature, ionic strength, time duration, and formamide concentration. These factors are outlined, for example, by Maniatis, T. (1982).

In general, it is believed that the HCV genome sequences are present in the serum of infected individuals at relatively low levels, ie, from about 10 ² to 10 ³ sequences per ml. This magnitude may require that amplification techniques be used in the hybridization assays. Such techniques are known in the art. For example, the "Bio-Bridge" system provided by Enzo Biochemical Corporation uses terminal deoxynucleotide transferase to add unmodified 3'-poly-dT tails to a DNA probe The poly-dT tailed probe is hybridized to the target nucleotide sequence and subsequently to a biotin-modified poly A. PCT Application 84/03520 and EPA 124221 describe a DNA hybridization assay by: (i) analyte hybridizing to a single-stranded DNA probe that is complementary to an enzyme-labeled oligonucleotide and (2) the resulting tailed duplex is hybridized to an enzyme-labeled oligonucleotide. EPA 204510 describes a DNA hybridization assay in which analyte DNA is contacted with a probe having a tail, such as a poly-dT tail, an amplifier strand having a sequence attached to the tail of the probe, like a poly A sequence, hybridizes and is capable of binding a variety of labeled strands. A particularly desirable technique may first involve amplification of the target HCV sequences in sera to approximately lOOOOfache, ie to approximately 10 ml sequences ^e /. This can be achieved, for example, by the technique of Saiki et al. (1986). The amplified sequence (s) may then be determined using a hybridization assay as described in co-pending U.S. Application, Attorney Docket No. 2300-0171 filed October 15, 1987 and assigned to the assignee hereof has been assigned and is hereby incorporated by reference. This hybridization assay, which should detect sequences at a level of 10 ⁶ / ml, uses Nucle ^! acid multimers that bind to the single-stranded analyte nucleic acid and also to a plurality of single-stranded labeled oligonucleotides. A suitable solution phase sandwich assay wherein labeled nucleotide London can be used and methods for preparing probes are described in EPO 225307 (7), published June 16, 1987, Application Serial No. 807,624, which is incorporated herein by reference assigned to the assignee herein and incorporated herein by reference.

The probes can be packaged in diagnostic kits.

Diagnostic kits include the probe DNA, which may be labeled; otherwise, the probe DNA may not be labeled and the label additives may be included in the kit. The kit may also contain other suitable packaged reagents and materials needed for the particular hybridization protocol, such as standards and also requirements for performing the assay.

II.I. Immunoassay and diagnostic kits

Both polypeptides that react immunologically with HCV antibody-containing serum, for example, those derived from or encoded by the clones and described in Section IV.A. and the compositions thereof (see Section IV.A.) and the antibodies raised against the HCV-specific epitope in these polypeptides, see, for example, Section IV.E, are detectable for presence in immunoassays of HCV antibodies, or the presence of the virus and / or viral antigens in biological samples, including, for example, blood or serum samples. The design of immunoassays is frequently altered and a variety of them are known in the art. The immunoassay may, for example, utilize a viral antigen, for example a polypeptide derived from any of the HCV cDNA-containing clones, see Section IV.A., or from the composite cDNAs derived from the cDNAs in these clones, or from the HCV genome from which the cDMA was derived in these clones; otherwise, the immunoassay may use a combination of viral antigens derived from these sources. For example, a monoclonal antibody directed against a virus epitope (s), a combination of monoclonal antibodies directed against a viral antigen, monoclonal antibodies directed against different viral antigens, polyclonal antibodies raised against the virus antigen are directed to the same viral antigen, or polyclonal 'antibodies directed against different viral antigens. For example, the protocols may be based on competitive, direct reaction or sandwich assays. For example, the protocols may also use solid support or may be by immunoprecipitation. Most assays involve the use of a labeled antibody or polypeptide; the labels can be made, for example, by fluorescent, chemiluminescent, radioactive or color molecules. Assays that amplify the signals from the probe are also known; Examples include assays that use biotin and avidin as well as enzyme-labeled and indirect immunoassays such as the ELISA assays. The flavivirus model for HCV allows predictions regarding the likely location of diagnostic epitopes for virion structural proteins. The C, pre-M, M, and Ε domains likely contain all epitopes of significant potential for. Detection of virus antigens and especially for diagnoses. Likewise, it is believed that the domains of the non-structural proteins contain important diagnostic epitopes (for example, NS5 encoding a putative polymerase and NS1 encoding a suspected complement-binding antigen). Recombinant polypeptides, or viral polypeptides, that include epitopes from these specific domains may be useful for the detection of virus antibodies in infected blood donors and infected patients.

In addition, antibodies directed against B and / or M proteins can be used in immunoassays for the detection of viral antigens in patients with HCV-induced NANBH and in infected blood donors. In addition, these antibodies may be particularly useful in detecting donors and patients in the acute phase.

Kits suitable for immunodiagnosis and containing the corresponding labeled reagents are co-packaged with appropriate containers by packaging the appropriate materials, including the polypeptides of the invention, which have HCV epitopes or antibodies directed against HCV epitopes the remaining reagents and materials required to perform the assay, as well as a suitable set of assay protocols.

IU. Further fragmentation of the HCV genome, virions and viral antigens using probes derived from the viral genome cDNA

The HCV cDNA sequence information in the clones described in Section IV.A. and described in Figures 1 to 32 are directed against HCV epitopes which would be useful in the diagnosis and / or treatment of fiCV-induced NANBH.

The cDNA sequence informatic η in the aforementioned clones is useful for the design of probes for the isolation of additional cDNA sequences derived from hitherto undefined regions of the HCV genome or genomes, of which those described in Section IV.A. described cDNAs were obtained in clones. For example, the labeled probes containing a sequence of about 8 or more nucleotides and preferably 20 or more nucleotides derived from regions near the 5 'termini or 3' termini of the family of HCV cDNA sequences and Figures 1,3,6,9,14 and 32 are used to isolate overlapping cDNA sequences from HCV cDNA libraries. These sequences, which overlap the cDNAs in the aforementioned clones but which also contain sequences derived from the regions of the genome from which the cDNAs are not derived in the aforementioned clones, can then be used to synthesize probes for identification the other overlapping fragments, which do not necessarily contain the cDNAs in Section IV.A. overlap described clones used. If the HCV genome is segmented and the segments do not share common sequences, it is possible to derive all or the entire viral genome (s) using the technique of isolating overlapping cDNAs derived from the virus genome (s) are to be sequenced. Although unlikely, if the genome is a segmented genome that does not share common sequences, the sequence of the genome can be determined by serological screening of the Lambdagt11 HCV cDNA libraries, as in the isolation of clone 5-1-1, by sequencing cDNA isolates and using the isolated cDNAs to isolate overlapping fragments, using the methods described for the isolation and sequencing of the clones in Section IV.A. described technique has been applied. In the other case, the characterization of the genome segments could be derived from the virus genome (s) isolated from the purified HCV pesticides. Methods for purifying the HCV particles and for detecting them during the purification process are described hereinbelow. Methods for the isolation of polynucleotide genomes from virus particles are known in the art, and an applicable method is described in Example IV.A.1. shown. The isolated genome segments could then be cloned and sequenced. Thus, with the information provided therein, it is possible to clone and sequence the entire HCV genome (s) regardless of its nature.

Methods for the construction of cDNA libraries are known in the art and are discussed above and below; a method for the construction of HCV cDNA libraries in lambda gt11 is discussed in Section IV.A. discussed further below. The cDNA libraries useful for screening with nucleic acid probes can also be constructed in other vectors known in the art, for example lambda gtiO (Huynh et al. [1985]). The HCV-derived cDNA detected by probes derived from the cDNAs in Figs. 1 to 32 and probes synthesized from the polynucleotides derived from these cDNAs can be prepared from the clone by digesting the isolated polynucleotide with the appropriate restriction enzyme (s) ) and sequenced. See, for example, Section IV.A.3. and IV.A.4. regarding the techniques used for the isolation and sequencing of the HCV cDNA overlapping the HCV cDNA in clone 5-1-1; Sections IV.A.5. to IV.A.7. for the isolation and sequencing of HCV cDNA overlapping those in clone 81 and Section IV.A.8. and IV.A.9. regarding the isolation and sequencing of a clone that overlaps another clone (clone 36) that overlaps clone 81.

The sequence information derived from these overlapping HCV cDNAs is useful for the determination of homology and heterogeneity regions within the virus genome (s), which in turn could indicate the presence of different genome strains, and / or populations of defective particles. They are also useful for the design of the hybridization probes to detect HCV or HCV antigens or HCV nucleic acids in biological samples, and during the isolation of HCV (discussed below) those described in Section II.G. to use the techniques described. In addition, the overlapping cDNAs can be used to generate expression vectors for polypeptides derived from the HCV genome (s), including those in clones 5-1-1, 36, 81, 91 and 1-2 and in the others in Section IV.A. encode encoded polypeptides. These techniques for the generation of these HCV epitope-containing polypeptides and for antibodies directed against the HCV epitopes they contain as well as their uses are described analogously to those for polypeptides derived from NANBV cDNA sequences and Clones 5-1-1, 32,35,36,1, -2,81 and 91 are included and discussed in the preceding and following text.

Encoded in the family of cDNA sequences, in the cions 5-1-1,32,35,36,81,91,1-2 and in the others in Section IV.A. beongton clonon is antigen or contains antigens that have epitopes that appear unique to HCV, that is, antibodies directed against these antigens are absent in the individuals infected with HAV or HBV and in non-HCV infected individuals (see serological data listed in section IV.B.). Moreover, comparison of the sequence information of these cDNAs with the sequences of HAV, HBV, HDV and genomic sequences in the library shows that there is minimal homology between these cDNAs and the polynucleotide sequences of these sources. Thus, antibodies directed against antigens encoded within the cDNAs of these clones can be used to identify BB-NANBV particles isolated from infected individuals. In addition, they are also useful for the isolation of NANBH active agent (s).

HCV particles may be obtained from the sera of BB-NANBV-infected individuals or from cell cultures by methods known in the art, including, for example, techniques based on size discrimination, such as sedimentation or exclusion methods or density-based techniques such as ultracentrifugation in density gradients, or precipitation with Agents such as polyethylene glycol or chromatography on a variety of materials such as anionic or cationic Austausr.hmaterialien, and materials that bind due to hydrophobicity, as well as affinity columns are isolated. During the isolation procedure, the presence of HCV can be determined by hybridization analysis of the extracted genome using probes derived from the HCV cDNAs described above or by immunoassay (see section DI), using as probes against HCV antigens Antibodies encoded within the family of cDNA sequences shown in Figures 1 to 32 and also directed against HCV antigens encoded within the overlapping HCV cDNA sequences discussed above. The antibodies may be monoclonal or polyclonal, and it may be desirable to purify the antibodies prior to use in the immunoassay. A purification procedure for polyclonal antibodies directed against antigen (s) encoded within clone 5-1-1 is described in Section IV.E. described; Analogous purification methods can be used for antibodies directed against other HCV antigens.

Antibodies directed against HCV antigens encoded within the family of cDNAs shown in Figures 1 to 32, as well as those encoding within overlapping HCV cDNAs and attached to solid supports are for the isolation of HCV useful by immunoaffinity chromatography. Techniques for immunoaffinity chromatography are known in the art, including techniques for attaching antibodies to solid supports so that they retain their immunoselective activity; the techniques may consist of those in which the antibodies are adsorbed to the support (see, for example, Kurstak in "Enzyme Immunodiagnosis," pages 31-37) as well as those in which the antibodies are covalently bound to the support The techniques are similar to those used for the covalent attachment of antigens to a solid support and are generally described in Section II.C., However, spacer groups can be included in the bifunctional coupling agents so that the antigen binding site of the antibody remains accessible ,

During the purification procedure, the presence of HCV can be detected and / or verified by nucleic acid hybridization using polynucleotides derived as probes from the family of HCV cDNA sequences shown in Figures 1 to 32 as well as those derived from overlapping HCV cDNA sequences were derived and described in the text above. In this case, the fractions would be treated under conditions causing disruption of the virus particles, for example with detergents in the presence of chelators and in the presence of viral nucleic acids prepared by the methods described in section H.H. described hybridization techniques were determined. Further confirmation that the isolated particles are the drugs that induce HCV can be gained by infecting chimpanzees with the isolated virus particles, then determining whether the NANBH symptoms result from the infection.

Viral particles from the purified preparations can then be further characterized. The genomic nucleic acid was purified. Based on their sensitivity to RNase, rather than DNase I, it looks like the virus is composed of an RNA genome. See Example IV.C.2., Below. Stringency and circularity or non-circularity may be detected by techniques known in the art, including, for example, their visualization by electron microscopy, their migration in the density gradients, and their sedimentation characteristics. Based on the hybridization of the captured HCV genome to the negative strands of HCV cDNAs, it appears that the HCV consists of a positive-stranded RNA genome (see Section IV. H. 1.). Techniques such as these are described, for example, in "Methods in Enzymology." In addition, the purified nucleic acid can be cloned and sequenced by known techniques, including reverse transcriptase, since the genomic material is RNA. See, for example, Maniatis (1982) and Glover (1985). By using the nucleic acid derived from the viral particles, it is possible to sequence the entire genome, depending on whether it is unsegmented or not.The study of the homology of within the continuous open reading frame of combined clones 141 to 390 (see Figure 26) shows that the HCV polypeptide contains regions of homology to the corresponding proteins in the conserved regions of the flaviviruses, an example of which is described in Section IV.H.3.-This finding has many important aspects this evidence in conjunction with the findings that the HCV is a positive-stranded Genome, the size of which is about 10,000 nucleotides, in line with the presumption that the HCV is a flavivirus or a flaviarttges virus. In general, flavivirus virions and their genomes have a relatively consistent structure and organization that are known. See Rice et al. (1988) and Brinton, M.A. (1988). Thus, the structural genes encoding polypeptides C, pre-M / M and E can be located in the 5 'terminus of the genome upstream of clone 14i. In addition, predictions regarding the exact location of the sequences encoding these proteins can be made, including comparison with other flaviviruses.

Isolation of the sequences upstream of those in clone 141 can be accomplished in a variety of ways, and the information provided herein will be apparent to one skilled in the art. For example, the genomic "walking" technique can be used to isolate other frames that are 5 'to those in Cton 14 i, but which overlap that clone; this leads again to the isolation of additional sequences. This technique is detailed in Section IV. A., below. For example, it is known that the flaviviruses have conserved epitopes and regions of conserved nucleic acid sequences. Polynucleotides containing the conserved sequences can be used as probes that bind the HCV genome, thus allowing its isolation. In addition, these conserved sequences, in conjunction with those derived from the HCV cDNAs, see Figure 22, can be used to design starters for use in systems that amplify genome sequences upstream of those in clone 14 i using polymerase chain reaction technology. An example of this will be described below.

The structure of HCV can also be determined and its components isolated. The morphology and size can be determined, for example, by electron microscopy. The identification and localization of specific viral polypeptide antigens such as coat or envelope antigens, or internal antigens such as nucleic acid binding proteins, core antigens and polynucleotide polymerase (s) can also be determined by, for example, determining whether the antigens are present as the largest or smallest virus components, as well as by Use of antibodies directed against the specific antigens encoded within isolated cDNAs as cDNA probes This information is useful for the design of vaccines, for example, it may be beneficial to include an external antigen in a vaccine preparation for example, a polypeptide derived from the genome encoding a structural protein, for example E, as well as a polypeptide from another part of the genome, for example, a polypeptide (text location unreadable, i.e., trans.).

II. K. Cell culture systems and animal model systems for HCV replication

The assumption that HCV is a flavivirus or a flavivirus also provides information on methods for growing HCV. The term "flavi-like" means that the virus has a significant proportion of homology to the known conserved regions of the flavivirus and that the major part of the genome is a single open reading frame Methods for the production of flaviviruses are known to those skilled in the art (see, for example the reviews of Brinton [1986] Slollar, V. [1980]). In general, suitable cells or cell lines for the growth of HCV may include those known to support flavivirus replication, for example the following: monkey kidney Cell lines (e.g., HK ₃ , VERQ); porcine kidney cell lines (e.g., PS); baby hamster kidney cell lines (e.g., 6HK); mouse macrophage cell lines (eg, P388D1, MK1, MmI); Human macrophage cell lines (eg U-937); peripheral human blood leucocytes, adherent human monocytes; hepatocytes or hepatocyte cell lines (e.g., HUH 7, HEPC2); embryonic or embryonic cells (e.g., chicken embryo fibroblasts or cell lines, e.g. e of invertebrates), preferably insects (eg Drosophila cell lines), or more preferably arthropods, for example mosquito cell lines (e.g. Albopictus, Aedes aegypti, Cutex tritaeniorhynchus) or tick cell lines (eg, RML-14, Dermacentor parumaportus).

It is possible that primary hepatocytes can be cultured and subsequently infected with HCV; or otherwise, the hepatocyte cultures could be recovered from the livers of the infected individuals (e.g., humans or chimpanzees). In the latter case, an example is that of a cell that is infected in vivo and transferred in vitro. In addition, various immortalization methods can be used to recover cell lines derived from hepatocyte cultures. For example, primary liver cultures (before and after accumulation of the hepatocyte population) may fuse with a number of cells to maintain their stability. For example, cultures may also be infected with transforming viruses or transferred with transforming genes to produce permanent or semi-permanent cell lines. In addition, for example, cells in liver cultures can be fused to established cell lines (eg, HepG 2). Methods for cell fusion are known in the art and include, for example, the use of fusion agents such as polyethylene glycol, Sendai virus and Epstein-Barr virus. As already discussed, HCV is a flavivirus or a flavivirus. Therefore, it is likely that HCV infection of cell lines can be performed by techniques known in the art for infecting cells with flaviviruses. These include, for example, incubating the cells with virus preparations under conditions that allow virus entry into the cell. In addition, it is possible to achieve virus production by transferring the cells to isolated viral polynucleotides. It is known that togavirus and flavivirus RNAs are transmissible in a number of vertebrate cell lines (Pfefferkorn and Shapiro [1974]) and in a mosquito cell line (Peleg [1969]).

Methods for transfecting tissue culture cells with RNA duplexes, positive-stranded RNAs and DNAs (including cDNAs) are known in the art and include, for example, techniques such as electroporation and precipitation with DEAE-dextran or calcium phosphate. A rich source of HCV RNA can be obtained by performing the in vitro transcription of a full-genome HCV cDNA. Transfection with this material or with cloned HCV cDNA would have to result in viral replication and in virus propagation of the virus. In addition to the cultured cells, animal model systems for viral replication can be used; animal systems in which flaviviruses occur are known to those skilled in the art (see, for example, "Review" by Monath [1986]). Thus, HCV replication can occur not only in chimpanzees, but also in marmosets and suckling mice, for example.

ILL. Screening antiviral agents for HCV

The availability of cell cultures and animal model systems for HCV also allows screening for antiviral agents that inhibit HCV replication, and particularly for those agents that preferentially allow cell growth and multiplication while inhibiting viral replication. These screening methods are known to those skilled in the art. In general, the antiviral agents become effective in a number of concentrations in their effect of preventing viral replication in cell culture systems that support viral replication and then inhibiting infectivity or viral pathogenicity (and a low level of toxicity) in an animal model system tested.

The methods and compositions provided herein for the detection of HCV antigens and HCV polynucleotides are useful for the screening of antiviral agents in that they provide an alternative and perhaps a more sensitive means of detecting the effect of the agent on viral replication the cell plaque assay or IDso assay. The HCV polynucleotide probes described herein can be used, for example, to quantify the amount of viral nucleic acids produced in a cell culture. This could be done, for example, by hybridization or "competition" hybridization of the infected cell nucleic acids with a labeled HCV polynucleotide probe Anti-HCV antibodies may also be used, for example, to identify and quantify HCV antigen (s) in cell cultures Since it may also be desirable to quantify HCV antigens in the infected cell cultures by a competition assay,

For example, the polypeptides encoded in the cDNAs described herein are useful in these "competition" assays. In general, a recombinant HCV polypeptide derived from the HCV cDNA would be labeled and inhibition of binding of this labeled polypeptide to an HCV polypeptide due to the antigan produced in the cell culture system would be monitored. In addition, the techniques are particularly useful in cases where the HCV may be able to replicate in a cell line without causing cell death.

AROUND. Preparation of attenuated HCV votes

In addition to the above and using the tissue culture systems and / or model animal systems, it may be possible to isolate attenuated HCV strains. These strains would be suitable for vaccines or for isolating viral antigens. Attenuated strains are isolatable after multiple passages in cell cultures and / or an animal model. Detection of an attenuated parent in an infected calf or individual is accomplished by techniques known in the art and could include, for example, the use of antibodies to one or more epitopes encoded in HCV as a probe for the use of a polynucleotide having an HCV sequence of at least about ... (incomplete ds) nucleotide as a probe. Alternatively, or in addition, an attenuated strain may be constructed using the genomic information provided herein of HCV and using recombinant techniques. In general, one would try to eradicate a region of the genome that, for example, encodes polypeptide-related pathogenicity but allows viral replication. In addition, genome construction would allow the expression of an epitope that causes neutralization of antibodies to HCV. The altered genome could then be used to transform cells that permit HCV replication, and the cells grown under these conditions allow for viral replication.

The attenuated strains of HCV are useful not only for vaccine purposes but also as sources of commercial production of viral antigen, since processing these viruses would require less stringent protection measures for the coworkers involved in viral production and / or production of viral products .... (Text connection is missing ds.)

... whether the antigens are present as largest or smallest viral components, as well as by the use of antibodies directed against the specific antigens encoded in the isolated cDNAs as probes. This information is useful in the design of vaccines, for example, it may prove beneficial to include an external antigen in a vaccine preparation. For example, multivalent vaccines may comprise a polypeptide derived from a genome encoding a structural protein, for example E, as well as a polypeptide from another part of the genome, for example a non-structural or structural polypeptide.

III. General methods

The general techniques used to extract the genome from a virus, for preparing and probing a cDNA library, sequencing the clones, constructing expression vectors, transforming the cells, performing immunological assays such as radioimmunoassays and ElisA Assays, for culturing cells in cultures and the like are well known in the art, and there are handbooks describing these techniques. The following text provides a general guide to some of the readily available sources of such procedures and methods Materials that are useful in the execution of the same shows.

III. A. hosts and expression control sequences

Both prokaryotic and eukaryotic host cells may be used for the expression of the desired coding sequences if appropriate control sequestrants compatible with the labeled host are used. Among prokaryotic hosts E. coil is the most commonly used. Prokaryote expression control sequences include promoters optionally containing operator portions and ribosome binding sites. Transfer vectors that are compatible with the prokeryotic hosts are commonly derived from, for example, pBR 322, an operon-containing plasmid conferring ampicillin and tetracycline resistance, and various puC vectors, which also contain sequences that confer antibiotic resistance markers. These markers can be used to obtain successful transformants by selection. The commonly used prokaryotic control sequences include beta-lactamase (penicillinase) and lactose promoter systems (Chang, et al., 11977)), tryptophan (trp) promoter system (Goeddel et al. (198O)), and the lambda-derived PL promoter and N-type promoter. Gene ribosome binding site (Shimatake et al., 1981) and the hybrid tac promoter (De Boer et al., 1983) derived from the sequences of the trp and lac UV5 promoters The above systems are particularly compatible with E. coli, if desired, other prokaryotic hosts such as Bacillus or Pseudomonas clades can be used with the appropriate control sequences.

Eukaryotic hosts contain yeast and mammalian cells in the culture systems. Saccharomyces * cerevlslae and Saccharomyces carlsbergensfs are the most widely used yeast hosts and are also favorable fungal values. Yeast-compatible vectors carry markers that allow the selection of successful transformants by conferring prototropy on auxotrophic mutants or resistance to heavy metals on wild strains. Yeast-compatible vectors can use the

2 micron origin of replication (Broach et al., 1983), the combination of CDN3 and ARS1, or other means for ensuring replication, as well as sequences resulting in the incorporation of a suitable fragment into the host cell genome Control sequences for yeast vectors are well known in the art and include promoters for the synthesis of glycolytic enzymes (Hess et al. (1968); Holland et al. (1978)), including the promoter for

3 phosphoglycerate kinases (Hitzeman [198O)]. Terminators may also be included, such as those derived from the enolase gene (Holland (1981)). Particularly useful are control systems, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter or alcohol dehydrogenase (ADH) -regulatable promoter, also GAPDH-derived terminators, and, if secretion is desired, yeast alpha-alpha sequence. In addition, the transcriptional regulatory region and the transcriptional initiation region that are operably linked to each other may be of the nature that they are not naturally associated in the wild-type organism

are described in detail in EPO 120551, published October 3, 1984; EP0116201, published August 22, 1984, and EPO 164446, published December 18, 1985, all of which are assigned to the assignee hereof and are hereby incorporated by reference.

Mammalian cell lines available as hosts for expression are known in the art and include many immortalized cell lines provided by the American Type Culture Collection (ATCC) including HeLa cells, China hamster ovary ICHOI cells , Baby Hamster Kidney (BHK) cells and a number of other cell lines. Suitable promoters for mammalian cells are known in the art and include viral promoters such as simian virus 40 (SV 40) (Fiers [1978]), rous sarcoma virus (RSV), adenovirus (ADV), and bovine papilloma virus ( BPV). Mammalian cells may also require terminator sequences and poly (A) addition sequences; Enhancer sequences that increase expression may also be included, as well as sequences that effect the amplification of the genes may also be desirable. These sequences are known in the art. Vectors suitable for replication in mammalian cells may contain viral replicons or sequences that guarantee the integration of appropriate sequences encoding NANBV epitope into the host genome.

III. B. Transformations

Transformation may be by any known method for introducing polynucleotides into a host cell, including, for example, packaging the polynucleotides into a virus and transducing a host cell with the virus, and by directly uptake of the polynucleotides. The applied transformation procedure depends on the host to be transformed. Transformation of E. coli host cells with lambda gt 11 containing BB-NANBV sequences as discussed, for example, in the later section below "Examples." Bacterial transformation by direct uptake generally involves treatment with calcium or rubidium chloride (Cohen (1972)); Maniatis [1982]). Yeast transformation by direct uptake can be performed using the method of Hinnen et al., (1978). Mammalian cell transformation by direct uptake can be performed using the calcium phosphate precipitation method of Graham and Van der Eb (1978) or the various known modifications thereof.

III.C. vector construction

The vector construction is accomplished by techniques known in the art. Sequence-specific cleavage is performed by treatment with appropriate restriction enzymes under conditions generally specified by the manufacturer of these commercially available enzymes. In general, about 1 microgram of plasmid or DNA sequence is cut by 1 unit of enzyme in about 20 microliters of buffer solution by incubation for 1 to 2 hours at 37 ° C. After incubation with the restriction enzyme, the protein is removed by phenol / chloroform extraction and the PNA recovered by precipitation with ethanol. The cut fragments can be separated using polyacrylamide or agarose gel electrophoresis techniques according to the general procedures outlined in "Methods in Enzymology" (1980) 65: 499-560.

Cut fragments with cohesive ends may have blunt ends when using E. coli DNA polymerase I (Klenow) in the presence of appropriate deoxynucleotide triphosphates (dNTPs) present in the mixture. Treatment with S1 nuclease resulting in the hydrolysis of any single-stranded DNA segments can also be performed. Ligations are performed using standard buffers and temperature conditions using T4 DNA ligase and ATP; Ligation of cohesive ends requires less Αϊ γ and less ligase than blunt end ligations. When vector fragments are used as part of a ligation mixture, the vector fragment is often treated with bacterial alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase to remove the 5'-phosphate and thus prevent re-ligiation of the vector; otherwise, restriction enzyme digestion of unwanted fragments can be used to prevent ligation. Ligation mixtures are transformed into suitable cloning hosts such as E. coli, and successful transformants are selected, for example, by antibiotic resistance and screened for correct construction.

III.D. Construction of desired DNA sequences

Synthetic oligonucleotides can be made using automated oligonucleotide synthesizers as described by Warner (1984). If desired, the synthetic strands can be labeled with ^3J p by treatment with polynucleotide kinase in the presence of "p-ATP, using standard conditions for the reaction.

DNA sequences, including those isolated from the cDNA libraries, can be modified by known techniques, including, for example, directed mutagenesis as described by Zoller (1982). In short, the DNA to be modified is packaged into a phage as a single-stranded sequence and converted to a double-stranded DNA with DNA polymerase, using as a starter a synthetic oligonucleotide that is complementary to the portion of the DNA that is to be modified , and which contains the desired modification in its own sequence. The resulting double-stranded DNA is transformed into a phage that supports the host bacterium. The cultures of transformed bacteria containing replications of each strand of phage are plated in agar to obtain plaques. Theoretically, 50% of the new plaques contain phage with mutated sequence. The remaining 50% have the original sequence. Replicas of the plaques are hybridized to the labeled synthetic probe at temperatures and conditions that permit hybridization with the correct strand, but not with the unaltered sequence. The sequences identified by hybridization are recovered and cloned.

III.E. Hybridization with probes

DNA libraries can be probed using the method of Grundstein and Hogness (1975). Briefly, in this method, the DNA to be probed is immobilized on nitrocellulose fibrils, denatured and pre-hybridized with a buffer containing 0 to 50% formamide, 0.75M NaCl, 75 mM Na citrate, 0.02% (M / V) of bovine serum albumin,

Polyvinylpyrollidone and Ficoll, 50 mM Na-phosphate (pH = 6.5), 0.1% SDS and 100 micrograms / ml carricr-denatured DNA. The percent formamide in the buffer as well as the time and temperature conditions of the pre- Hybridization and subsequent hybridization steps are dependent upon the requisite stringency Oligomeric probes requiring less stringent conditions are generally employed at lower percentages of formamide, lower temperatures, and longer hybridization times Probes greater than 30 to 40 nucleotides such as those of cDNA or cDNA generally derived from genomic sequences generally require higher temperatures, for example, about 40 ° C. to 42 ° C., and a high formamide content, for example 50%. Subsequent to pre-hybridization, the 5'- ³² p-labeled oligonucleotide probe becomes the Buffer is added and the filters are incubated under Habridisierungsbedingungen in this After washing, the b subjected filters to autoradiography to show the location of the hybridized probe; the DNA in appropriate locations on the original agar plates is used as the source of the desired DNA.

III. F. Verification of Construction and Sequencing

For routine vector designs, ligation mixtures are transformed into E. coli strain HB 101 or other appropriate value, and successful transformants are selected for antibiotic resistance or other markers. Plasmids from the transformants are then purified according to the method of Clewell et al. (1969), usually prepared by following the chloramphenicol amplification (Clewell (1972)) The DNA is isolated and analyzed on the basis of restriction enzyme analysis and / or sequencing The sequencing can be carried out by the dideoxy method of Sanger et al (1977) Further described by Messing et al. (1981) or by the method of Maxam et al. (1980) Problems with band compression sometimes observed in the GC-rich regions were identified by the use of T-deazoguanosine according to Barr et al (1986).

III.G. Enzyme-linked Immunoiorbont Assay

The enzyme-linked immunological assay (ELISA) can be used to measure either antigen or antibody levels. This method depends on the conjugation of an enzyme to either an antigen or antibody, and uses the bound enzyme activity as a quanitative label. To measure the antibody, the known antigen is fixed to a solid phase . A microplate or plastic crucible), incubated with test serum dilutions, washed, incubated with anti-immunoglobulin labeled with an enzyme, and washed again. Suitable enzymes for labeling are known in the art and include, for example, horseradish peroxidase. The enzyme activity bound to the solid phase is measured by the addition of the specific substrate, and the determination of product formation or substrate utilization is colorimetric. The bound enzyme activity is a direct function of the amount of bound antibody.

To measure the antigen, a known specific antibody is fixed to the solid phase, the antigen-containing test material is added, washed after incubation of the solid phase, and a second enzyme-labeled antibody is added. After washing, the substrate is added and the enzyme activity is colorimetrically evaluated and related to antigen concentration.

IV. Examples

In the following, examples according to the invention are described which are given by way of illustration only and do not limit the scope of the present invention. In view of the present invention, numerous embodiments within the scope of the claims are apparent to those skilled in the art. However, the procedures outlined, for example, in Section IV. A. may, if desired, need not be repeated, as techniques for constructing the desired nucleotide sequences are available based on the information provided by the invention. Expression is illustrated in E. coli, but other systems are available, which are described in more detail in Section III A. In addition, epitopes derived from the genomic structure may also be produced and used to generate antibodies as described below.

IV.A. Preparation, isolation and sequencing of HCV cDNA IV.A.1. Preparation of HCV cDNA

The source of the NANB agent was a plasma pool derived from a chimpanzee with chronic NANBH. The chimpanzee was experimentally infected with blood from another chimpanzee with chronic NANBH, which in turn resulted from infection with HCV in a contaminated concentration level with factor 8 derived from pooled human serum. The chimpanzee plasma pool was prepared by combining many individual plasma samples that had a high degree of alanine aminotransferase activity, this activity resulting from hepatic injury due to HCV infection. Since 1 ml of a 10 ^"6 dilution of this collected and intravenous serum iit other chimpanzees NAN-BH caused, its CID (Zytomegaliesyndrom) was at least ', 10 / ml that is, it had a höh in infectious virus titer.

A cDNA library from the high titer plasma pool was generated as follows. First, viral particles were isolated from the plasma; A 90 ml aliquot was diluted with 310 ml of a 50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.1 mM NaCl-containing solution. Residues were removed by centrifugation at 15,000 g for 20 min at 20 ^° C. Vire o particles in the resulting supernatant were then pelleted by centrifugation in a Beetman SW28 rotor at 28,000 rpm for 5 hours at 20 ° C. To release the viral genome, the particles du suspending ch du pellets were resuspended in 15 ml solution containing 1% sodium dodecyl sulfate (SDS), 1OmM EDTA, 1OmM Tris-HCl, pH 7.5, as well as 2 mg / nr.l proteinase k broken and then incubated at 45 ⁰ C for 90 min. The nucleic acids were isolated by the addition of 0.8 micrograms of MS 2 bacteriophage RNA as a carrier, and the mixture was washed four times with a 1: 1 mixture

of phenol: chloroform (phenol saturated with 0.5M Tris-HCl, pH 7.5.0.1% (v / v) beta-mercoaptoethanol, 0.1% (w / v) hydroxyquinoline extracted, and then twice with chloroform extracted. the aqueous phase was concentrated prior to precipitation with 2.5 volumes of absolute ethanol and allowed to stand overnight at -20T with 1-butanol. the nucleic acid was collected by centrifugation in a SW41-Bsckman -rotor at 40000U / min over 90min at 4 ⁰ C and dissolved in water, which was treated with 0.05% (v / v) diethylpyrocarbonate and autoclaved The nucleic acid (<2 micrograms) recovered by the above procedure was denatured with 17.5 mM CH ₃ HgOH; was synthesized using this denatured nucleic acid as a template and cloned into the EcoRI site of phage lambda-gt 11 using methods described by Huynh (1985), except that the random starters oligo (dT) -12-18 were synthesized during synthesis of the first cDNA-S tranges replaced by reverse transcriptase (Taylor et al., 1976]). The resulting double-stranded cDNAs were fractionated according to size on a Sepharose CL-4 B column; Approximately 400,300,200 and 100 base pair eluted material were pooled in cDNA pools 1,2, 3 and 4, respectively. The lambda gt 11 cDNA library was generated from the cDNA in pool 3.

The lambda gt 11 cDNA library generated from pool 3 was screened for epitopes that can specifically bind serum derived from a patient previously on NANBH. Using the methods of Huynh et al. (1i85), approximately 10 * phages were screened with patient sera except that bound human antibodies could be detected with sheep Ar.ti human Ig antisera labeled ¹²⁵ I readiolactively. Five positive phages were identified and purified. The five positive phage were then tested for specificity of binding to sera from 8 different humans previously infected with the NANBH agent using the same method. Four of the phage encoded a polypeptide that was immunologically reactive with only one human serum, ie, the one used for primary screening of the phage library. The fifth phage (5-1-1) encoded a polypeptide that immunologically reacted with 5 of the 8 sera tested. In addition, this polypeptide did not react immunologically with sera from 7 normal blood donors. Therefore, it appears that clone 5-1-1 encodes a polypeptide which is recognized immunologically specifically by sera from NAND patients.

IV.A.2. Sequences of the HCV cDNA in Recombinant Phage 5-1-1 and the Polypeptide Encoded Within the Sequence The cDNA in recombinant phage 5-1-1 was analyzed by a method of Sanger et al. (1977). The cDNA was excised substantially with EcoRI and isolated by gel fractionation using gel electrophoresis. The EcoRI restriction fragments were subcloned into the M13 vectors mp18 and mp19 (Messing [1983]) and using the dideoxy chain termination method of Sanger et al. (1977). The sequence obtained is shown in FIG. The polypeptide encoded in Figure 1, encoded in the HCV cDNA, is in the same translational framework as the N-terminal beta-galactosidase component to which it is fused. As shown in Section IV. A., the translational open reading frame (ORF) of 5-1-1 encodes an epitope or epitopes specifically recognized by sera from NANBH infection-confronting patients and chimpanzees.

IV. A.3. Isolation of HCV cDNAs that overlaps the cDNA in CU η 5-1-1

HCV cDNA overlapping the cDNA in clone B-1-1 was screened by screening the same lambda gt 11 library as described in Section IV. A. 1. with one from the sequence of the HCV cDNA in FIGS Clones 5-1 -1, as shown in Figure 1, derived derived synthetic polynucleotide. The sequence of the polynucleotide used for the screening was:

5'-TCC CTT GCT CGA T3T ACG GTA AGT GCT GAG AGC

ACT CTT CCA TCT CAT CGA ACT CTC GGT AGA GGA CTT CCC TGT

GAG GT-3 '.

The lambda gt 11 library was probed with this probe using the method described by Huynh (1985)

screened. About 1 in 50,000 clones hybridized to this probe. Three clones containing cDNA hybridized to the synthetic probe numbered 81.1-2 and 91.

IV. A.4. Nucleotide Sequences of Overlapping HCV cDNAs to cDNA In Clor. 5-1-1

The nucleotide sequences of the three cDNAs in clones 81, 1-2 and 91 were essentially as described in Section IV. A.

described determined. The sequences of these clones relative to the HCV rDNA sequence in phage 5-1-1 are shown in Figure 2, which shows the strand encoding the HCV epitope detected and where the homologies in the nucleotide sequences are by vertical lines be indicated between the sequences.

The sequencers of the cloned HCV cDNAs are extremely homologous in the overlapping regions (see Figure 2). In zwni Regions best), but differences. Nucleotide 67 in clone 1 -2 is a thymidine, whereas the other three clones are one Cytidine residue contained at this point. However, it should be noted that the same amino acid is encoded when either C

or T occupy this position.

The second difference is that clone 5-1-1 contains 28 base pairs that are not present in the other three clones

are. These base pairs occur at the start of the cDNA sequence in 5-1-1 and are indicated by small letters. On the

The basis of the radioimmunoassay data set forth in Section IV.D. it is possible that a HCV epitope can be encoded in this 28 bp region. The presence of the 28 base pairs of 5-1-1 from clones 81, 1-2 and 91 may indicate that the cDNA in these clones is

defective HCV genome was derived; alternatively, the 28 bp region could be a terminal artifact in clone 5-1-1.

The small lettered sequences above in the nucleotide sequence of clones 81 and 91 simply indicated

that these sequences were not found in other cDNAs since cDNAs overlapping these regions have not yet been isolated.

A composite HCV cDNA sequence deduced from the overlapping cDNAs in clones 5-1-1,81,1-2 and 91 becomes

shown in FIG. In this figure, however, the unique 28 base pairs of clone 5-1-1 have been omitted. The figure also shows the sequence of the polypeptide encoded in the ORF of the composite HCV cDNA.

IV.A.5. Isolation of HCV cDNAs that overlap the cDNA in clone 81

The isolation of the HCV cDNA sequences upstream of and overlapping those in clone 81 cDNA was performed as follows. The lambda gtH cDNA library described in Section IV.A.1. was screened by hybridization with a synthetic polynucleotide probe homologous to a 5'-terminal sequence of clone 81. The sequence of clone 81 is shown in FIG. The sequence of the synthetic polynucleotides used for the screening was:

5 'CTG TCA GGT ATG ATT GCC GGC TTC CCG GAC 3'.

The methods were essentially those described by Huynh (1985), except that the library filters were subjected to two washes under stringent conditions, i.e., the washes were performed in 5x SSC, 0.1% SDS at 55 ° C, and each for 30 min. About 1 in 50,000 clones hybridized with the probe. A positive rekom. iant phage containing cDNA that hybridized to the sequence was isolated and purified

 This phage was numbered 36.

Downstram cDNA sequences overlapping the carboxy terminus sequences in clone 81 cDNA were isolated except that a method similar to that for isolation of upstream cDNA sequences was used except that a synthetic oligonucleotide probe, which is homologous to a 3'-terminal sequence of clone 81. The sequence of the synthetic polynucleotides used for the screening was:

5 'TTT GGC TAG TGG TTA GTG GGC TGG TGA CAG 3'

A positive recombinant phage containing cDNA that hybridized to this last sequence was isolated and purified and numbered with clone 32.

IV.A.6. Nucleotide sequence of HCV cDNA in clone 36 The nucleotide sequence of the cDNA in clone 36 was prepared essentially as described in Section IV.A.2. described determined. The

double-stranded sequence of this cDNA, its overlap region with the HCV cDNA in clone 81 and that encoded by the ORF

Polypeptide are shown in FIG. The ORF in clone 36 is located in the same translational frame as the HCV antigen encoded in clone 81. Thus

In combination, the ORFs in clones 36 and 81 encode a polypeptide representing part of a large HCV antigen. The sequence of this putative HCV polypeptide and the double-stranded DNA sequence encoding it derived from the combined ORFs of the HCV cDNAs of clones 36 and 81 are shown in FIG.

IV.A.7. Nucleotide sequences of HCV cDNA in clone 32 The nucleotide sequence of the cDNA in clone 32 was determined essentially as described in Section IV.A.2. described example for the Sequence of clone 5-1-1 determined. The sequence data showed that the cDNA in clone 32 recombinant phage consists of two

was derived from different sources. One fragment of the cDNA contained 418 nucleotides derived from the HCV genome, the other fragment comprised 172 l.'ucleotides derived from the Bactenophage MS2 genome, which was used as a carrier during the preparation of the Lambdagtl 1 plasma cDNA library.

The sequence of the cDNA in clone 32 corresponding to the HCV genome is shown in FIG. The h igion the sequences of the Clone 81 exerts jppt, and the polypeptide co-membered by the ORF is also shown in this figure. This sequence

contains a continuous ORF that is in the same translational frame as that encoded by clone 81

HCV antigen. IV.A.8. Isolation of HCV cDMA, which overlaps the cDNA in clone 36 The isolation of HCV cDNA sequences upstream from MP.d overlapping those in clone 36 cDNA was performed as described in U.S. Pat Section IV.A.5. for those overlapping clone 81 cDNA, except that the synthetic Pjlynuc jotid

based on the 5 region of clone 36. The sequence of the synthetic polynucleotides W8 "used for the screening.

5 'AAG CCA CCG TGT GCG CTA GGG CTC AAG CCC 3'

About 1 in 50,000 clones hybridized to the probe. The isolated, purified clone of the recombinant phage containing cDNA attached to d ^! Seezusnz hybridized, clone 35 was named.

IV.A.9. Nucleotide sequence of HCV cDNA in clone 35

The nucleotide sequence of the cDNA in clone 35 was essentially as described in Section IV.A.2. described determined. The sequence, its region of overlap with that of the cDNA in clone 36, and the putative polypeptide encoded therein are shown in FIG. Clone 35 apparently contains a single continuous ORF encoding a polypeptide peptide encoded by clone 36, clone 81 and clone 32 in the same translational Γ '. Figure 9 shows the sequence of the long continuous ORF which extends through clones 35, 36, 81 and 32 and is coded with the putative HCV polypeptide therein. This combined sequence has been confirmed using other independent cDNA clones derived from the same lambda gt11 cDNA library.

IV.A.10. Isolation of HCV cDNA overlapping the cDNA in clone 35

The isolation of HCV cDNA sequences upstream from and overlapping those in clone 35 cDNA was performed as described in Section IV.A.8. described for those overlapping clone 36 cDNA, except that the synthetic polynucleotide was based on the 5 'region of clone 35. The sequence of the synthetic polynucleotides used for the screening was:

-24- 287 1 (K

5 'CAG GAT GCT GTG TCC CGC ACT CAA CGT 3'

About 1 in 50,000 clones hybridized to the probe. The isolated, purified clone of recombinant phage containing cDNA that hybridized to this sequence was named clone 37b.

I V.A.11. NucleoUd sequence of HCV in clone 37b

The nucleotide sequence of the cDNA in clone 37b was prepared essentially as described in Section IV.A.2. described determined. The St 'onz, its overlap region with the cDNA in clone 35, and the putative polypeptide encoded therein are shown in Figure o.

The 5'-terminal nucleotide of clone 35 is a T, whereas the corresponding nucleotide in clone 37b is A. The cDNAs from three other independent clones isolated during the procedure, in clone 37b, as described in Section IV.A.10. was isolated were also sequenced. The cDNAs from these clones also contain an A in this position. Thus, the 5'-terminal T in clone 35 can be an artifact of the cloning procedure. It is known that artifacts often occur at the 5 'termini of cDNA molecules.

Clone 37b apparently contains a continuous open reading frame (ORF) encoding a polypeptide which is a continuation of the polypeptide encoded in the open reading frame extending through the overlapping clones, 36, 36, 81 and 32.

IV.A.12. Isolation of HCV cDNA Overlap the cDNA in clone 32

The isolation of HCV cDNA sequeizon "downstream" from clone 32 was performed as follows: First, clone was isolated using a synthetic hybridization probe based on the nucleotide sequence of the HCV cDNA sequence in clone 32. The method was equivalent essentially that described in Section IV.A.5., except that the sequence of the synthetic probe looked like this:

5 AGT GCA GTG GAT GAA CCG GCT GAT AGC CTT 3 '.

Using the nucleotide sequence of clone da, another synthetic nucleotide was synthesized which had the following sequence:

5 'TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'.

Screening of the lambda gt11 library using the clon da-derived sequence as a probe gave approximately 1 in 50,000 positive colonies. An isolated purified clone that hybridized with this probe was named clone 33b.

IV.A.13. Nucieotid sequence of HCV cDNA in clone 33b

The nucleotide sequence of the cDNA in clone 33b was prepared essentially as described in Section IV.A.2. described determined. The sequence, its region of overlap with that of the cDNA in clone 32, and the putative polypeptide encoded therein are shown in FIG. Clone 33b evidently contains a continuous open reading frame which is an extension of the open reading frames π to the overlapping clones, 37b, 35, 36, 81, and 32. The polypeptide encoded in clone 33b is in the same translational framework as in the extended open reading frame of these overlapping clones. te.

IV.A.14. Isolation of HCV cDNAs Overlapping the cDNA in Clone 37b and cDNA in Clone 33b

To isolate HCV cDNAs overlapping the cDNAs in clone 37b and in clone 33b, the following synthetic oligonucleotide probes derived from the cDNAs in those clones were used to scree / lambda the lambda gt11 library essentially using the method described in Section IV.A.3.

5 'CAG GAT GCT GTC TCC CGC ACT CA / CCT C 3'

5 'TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'

were used to find colonies containing HCV cDNA sequences that overlap those in clones 37b and 3b, respectively. About 1 in 50,000 colonies were detected with each probe. A clone containing cDNA "upstream" from and overlapping the cDNA in clone 37b was named clone 40b, a clone containing cDNA "downstream" from cDNA in clone 33b and overlapping it Clone was named 25c.

IV.A.15. Nucleotide sequences of HCV cDNA In clone 40b and in clone 25c The nucleotide sequences of the cDNAs in clone 40b and in clone 25c were prepared essentially as described in Section IV.A.2. described

certainly. The sequences of 40b and 25c, their overlap regions with the oDNAs in clones 37b and 33b, and the darincodinated putative polypeptides are shown in Figure 12 (clone 40b) and in Figure 13 (Cl ^ i 25c).

The 5'-terminal nucleotide of clone 40b is a G. However, the cDNAs were not. five other independent clones, the

during the procedure in which Cion 40b was isolated, described in Section IV.A.14., also sequenced.

The cDNAs of these clones also contain a T in this position. Thus, the G can represent a cloning artifact (see Discussion in Section IV.A.11.). The 5 "end of clone 25c is ACT, but the sequence of this region in clone da (sequence not shown) ur d in clone 33b is TCA. This difference may also represent a cloning artifact such as the 28 extra δ 'terminal nucleotides in "lon 5-1" -1.

Clones 40b and 25c evidently each contain an open reading frame (ORF) which is an extension of the continuous open reading frame in the previously sequenced clones. The nucleotide sequence of the open reading frame passing through clones 40b, 37b, 35, 36, 81, 32, 33b and 25c and the amino acid sequence of the putative polypeptides encoded therein are shown in FIG. In the figure, the potential artifacts have been omitted from the sequence, and instead the corresponding sequences are shown in non-5'-terminal regions of multiple overlap clones.

IV.A.16. Preparation of a Composite HCV cDNA from the cDNAs in Clones 36, 81 and 32 The composite HCV cDNA, C100, was constructed as follows. First, the cDNAs from clones 36, 31 and 32 were excised with EcoRI. The EcoRI fragment of the cDNA from each clone was individually cloned into the EcoRI site of the vector pGEM3-blue (Promega Biotec). The resulting recombinant vectors containing cDNAs of clones 36, 81 and 32 were named pGEM3-blue / 36, pGEM3-blue / 81 and pGEM3-blue / 3, respectively. The appropriately oriented pGEM3 blue / 81 recombinant was digested with Nael and NarI, and the large (~ 2850bp) fragment was purified and ligated to the small (~ 570bp) Nael / NarI-truncated restriction fragment of pGEM3-blu9 / 36. This composition of the cDNAs of clones 36 and 81 was used to generate another pGEM3 blue vector containing the continuous HCV ORF contained in the overlap cDNA within these clones. This new plasmid was then digested with PVuII and EcoRI to release a fragment of about 680bp, which was then ligated to the small (580 bp) Pvull / EcoRI fragment isolated from the appropriately oriented pGEM3-blue / 32 plasmid : and the composite cDNA from clones 36, 81 and 32 was ligated into the Eco RI-linearized vector pSODcf 1 described in Section IV.B.1. and was used to express clone 5-1-1 in bacteria. Recombinants containing the ~ 1270bp EcoRI fragment of composite HCV cDNA (C100) were selected and the cDNA from the plasmids was excised with EcoRI and purified.

IV.A.17. Isolation and Nucleotide Sequences of HCV cDNAs In clones 14I, 11b, 7f, 7e, 8h, 33c, 14c, 8f, 33f, 33g and 39cc, the HCV cDNAs clone Ki, 11b, 7f, 7e ₍ 8h, 33c, 14c, 8f, 33f, 33g and 39c were isolated by the technique of ligating overlapping cDNA fragments from the Iambda gt11 library of HCV cDNAs described in Section IV.A.1 .. The technique used was essentially as described in Section IV.A.3., Except that the probes used were designed from the nucleotide sequence of the last isolated clones of the 5 'and the 3' end of the combined HCV sequences The frequency of the clones that hybridized with the probes described below was about 1 in every 50,000.

The nucleotide sequences of the HCV cDNAs in clones 14i, 7f, 7e, 8h, 33c, 14c, 8f, 33f, 33g, and 39c were prepared essentially as described in Section IV.A.2. except that the cDNA excised from these phages was substituted for the cDNA isolated from clone 5-1-1.

Clone 33c was isolated using a hybridization probe based on the sequence of nucleotides in clone 40b. The nucleotide sequence of clone 40b is shown in FIG. The nucleotide sequence of the probe used to isolate 33c was:

5 'ATC AGG ACC GGG GTG AGA ACA ATT ACC ACT 3'

The sequence of the HCV cDNA in clone 33c and the overlap with that in clone 40b are shown in FIG

coded amino acids shows.

Clone 8h was isolated with a probe based on the sequence of nucleotides in clone 33c. The nucleotide sequence of the probe

5 'AGA GAC AAC CAT GAG GTC CCC GGT GTT C 3'.

The sequence of the HCV cDNA in C! On 8h and the overlap with that in clone 33c and the amino acids encoded therein are shown in FIG.

Clone 7e was isolated using a probe based on the sequence of nucleotides in clone 8 h. The nucleotide sequence of the probe was

5 'TCG GAC CTT TAC CTG GTC ACG AGG CAC 3'.

The sequence of the HCV cDNA in clone 7 e, the overlap with clone 8h and the amino acids encoded therein are shown in FIG. 17

shown.

Clone 14c was isolated with a probe based on the sequence of nucleotides in clone 25c. The sequence of clone 25c is in FIG. 13. The probe had ». in the isolation of clone 14c the sequence

5 'ACC TTC CCC ATT AAT GCC TAC ACC ACG GGC 3'.

The sequence of the HCV cDNA in clone 14c, its overlap with that in clone 25c and the amino acids encoded therein are shown in FIG.

Clone 8f was isolated using a probe based on the sequence of nucleotides in clone 14c. The nucleotide sequence of the probe was

5 'TCC ATC TCT CAA GGC AAC TTG CAC CGC TAA 3'.

The sequence of HCV-CDNA in clone 8f, their overlap with that in clone 14c and the amino acids encoded therein are shown in FIG.

Clone 33f was isolated using a probe based on the nucleotide sequence present in clone 8f. The nucleotide sequence of the probe was

5 'TCC ATG GCT GTC CGC TTC CAC CTG CAA AGT 3'.

The sequence of HCV cDNA in clone 33f, its overlap with that in clone 8f and the amino acids encoded therein are shown in FIG.

Clone 33g was isolated using a probe based on the sequence of nucleotides in clone 33f. The nucleotide sequence of the probe was

5 'GCG ACAATA CGA CAA CAT CCT CTG AGC CCG 3'.

The sequence of HCV cDNA in clone 33g, its overlap with that in clone 33f and the amino acids encoded therein are shown in FIG.

Clone 7f was isolated using a probe based on the sequence of nucleotides in clone 7e. The nucleotide sequence of the probe was

5'AGCAGACAAGGGGCCTCCTAGGGTGCATAATs'.

The sequence of HCV cDNA in clone 7f, its overlap with clone 73, and the amino acids encoded therein are shown in FIG.

Clone 11b was isolated using a probe based on the sequence of clone 7f. The nucleoide sequence was

5 'CAC CTA TGT TTA TAA CCA TGT CAC TCC TCT 3'.

The sequence of the HCV cDNA in clone 11b, its overlap with clone 7f, and the amino acids encoded therein are shown in FIG.

Clone 14 i was isolated using a probe based on the sequence of nucleotides in clone 11b. The nucleotide sequence of the probe was

5 'CTC TGT CAC CAT ATT ACA AGC GCT ATA TCA 3'.

The sequence of the HCV cDNA in clone 14 i, its overlap with 11 b and the amino acids encoded therein are shown in FIG.

Clone 39c was isolated using a probe based on the sequence of nucleotides in clone 33g. The nucleotide sequence of the probe was

5 'CTC GTT GCTACG TCA CCA CAA TTT GGT GTA 3'.

The sequence of HCV cDNA in clone 39c, its overlap with clone 33g, and the amino acids encoded therein are shown in FIG.

IV.A.18. The Composite HCV cDNA Sequence Derived from Isolated, HCV cDNA-containing Clones The HCV cDNA sequences in the isolated clones described above were requested in a line to create a composite HCV cDNA sequence. The isolated clones arranged in the 5'-3 'direction are: 14i, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f , 33g and 39c. A composite HCV cDNA sequence deduced from the isolated clones and the amino acids encoded therein are shown in FIG.

In creating the composite sequence, the following sequence heterogeneities were considered. Clone 33c contains the 800 base pair HCV cDNA that overlaps the cDNAs in clones 40b and 37c. In clone 33c, as well as in 5 'other overlapping clones, nucleotide 789 is a G. In clone 37b (see Section IV.A.11.), However, the corresponding nucleotide is an A. This sequence difference creates apparent heterogeneity in the amino acids encoded therein. CYS or TYR for G and A, respectively. This heterogeneity may have important ramifications in protein folding.

Nucleotide residue 2 in clone 8h HCV cDNA is T. However, as shown below, the corresponding residue in clone 7 e is an A. In addition, an A in this position is also found in 3 other isolated overlapping clones. Thus, the T residue in clone 8h may represent a cloning artifact. Therefore, the remainder in this position is designated as an A in FIG.

The 3 'terminal nucleotide in clone 8f HCV cDNA is oin G. The corresponding residue in clone 33f and in two other overlapping clones, however, is T. Therefore, the remainder in this position in Figure 26 is designated as T.

The 3 'terminal sequence in clone 33f HCV cDNA is TTGC. However, the corresponding sequence in clone 33g and in two other overlapping clones is ATTC. Therefore, in Fig. 26, the corresponding region is shown as ATTC.

Nucleotide residue 4 in clone 33g HCV cDNA is a T. In clone 33f and in two other overlapping clones, however, the corresponding residue is an A. Therefore, the corresponding residue in Figure 26 is designated A.

The 3 'end of clone 14i is AA, while the corresponding dinucleotide in clone is 11b and in three other clones TA. Therefore, the TA remainder is shown in FIG.

The resolution of the other sequence heterogeneities is discussed above.

Examination of the composite HCV cDNA reveals that it contains a large open reading frame. This suggests that the viral genome is translated into a large polypeptide which is processed simultaneously with or subsequent to translation.

IV.A.19. Isolation and Nucleotide Sequences of HCV cDNAs in Clones 12f, 35f, 19g, 26g, and 15e The HCV cDNAs in clones 12f, 35f, 19g, 26g, and 15e were prepared essentially as described in Section IVA17. technique except that the probes were as indicated below. The frequency of clones that hybridized with the probes was in each case about 1 in 50,000. The nucleotide sequences of the HCV cDNAs in these clones were essentially as described in Section IV.A.2. except that the cDNA from the indicated clones was used in place of the cDNA isolated from clone 5-1-1.

Isolation of clone 12f containing cDNA "upstream" from the HCV cDNA in Figure 26 was performed using a hybridization probe based on the sequence of nucleotides in clone 14i. The nucleotide sequence of the probe was

5 'TQC TTG TGG ATG ATG CTA CTC ATA TCC CTA 3'.

The HCV cDNA sequence of clone 12f, its overlap with clone 14i, and the amino acids encoded therein are shown in FIG.

The isolation of clone 35f (poorly legible) containing cDNA "downstream" from the HCV cDNA in Figure 26 was carried out using a hybridization probe based on the sequence of nucleotides in clone 39c The nucleotide sequence of the probe was

5'AGCAGCGGCGTCAAAAGTGAAGGCTAACTTs'.

The sequence of clone 35f, its overlap with the sequence in clone 39c, and the amino acids encoded therein are shown in FIG.

Clone 19g was isolated using an eir-ar hybridization probe based on the 3 'sequence of clone 35f. The nucleotide sequence of the probe was

5 'TTC TCG TAT GAT ACC CGC TGC TTT GAC TCC 3'.

The HCV cDNA sequence of clone 19g, its overlap with the sequence in clone 35f, and the amino acids encoded therein are shown in FIG.

Isolation of clone 26g was done using a hybridization probe based on the 3 'sequence of clone 19g. The nucleotide sequence of the probe was

5 'TGT GTG GCG ACG ACT TAG TCG TTA TCT GTG 3'.

The HCV cDNA sequence of clone 26g, its overlap with the sequence in clone 19g, and the amino acids encoded therein are shown in FIG.

Clone 15e was isolated using a hybridization probe based on the 3 'sequence of clone 26g. The nucleotide sequence of the probe was

5 'CAC ACT CCA GTC AAT TCC TGG CTA GGC AAC 3'.

The HCV cDNA sequence of clone 15e, its overlap with the sequence in clone 26g, and the amino acids encoded therein are shown in FIG.

The clones described in this section were prepared under the conditions described in section H.A. deposited with the ATCC and received the following access nomenclatures:

Lambda-gt11 ATCC-No. deposit date

Clon 12 f 40514 10th Novermer 1988

Clone 35 f 40511 November 10, 1988

Clon15e 40513 November 10, 1988

Clone K 9-1 40512 November 10, 1988

The HCV cDNA sequences in the isolated clones described above were aligned to create the composite HCV cDNA sequence. The isolated clones arranged in the 5'-3 'direction are:

12f, 14i, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g and 15e.

A composite HCV cDNA sequence deduced from the isolated clones and the amino acids encoded therein are shown in FIG.

IV.A.20. Alternative Method of Isolation of cDNA Sequences .upstream "from the HCV cDNA Sequence In clone 12f. Based on the largest 3 'HCV sequence in Figure 32 derived from the HCV cDNA in clone 12f, small ones become synthetic oligonucleotide primers synthesized from reverse transcriptase and used to bind to the corresponding sequence in HCV genomic RNA to initiate reverse transcription of the upstream sequences. The primer sequences are proximal to the known 5'-terminal sequence of clone 12f, but sufficiently "downstream" to allow the design of probe sequences "upstream" from the primer sequences. Known standard startup and execution methods are used. The resulting cDNA libraries are screened with sequences "upstream" from the priming sites (as derived from the illustrated sequence at clone 12 f). HCV genomic RNA is either extracted from plasma or liver samples from chimpanzees with NANBH or from analog samples obtained from humans using NANBH.

IV.A.21. Alternative method using "parts" to isolate sequences from the 5'-terminal region of the HCV genome

To isolate the extreme 5'-terminal sequences of the HCV RNA genome, the cDNA product of the first round of reverse transcription duplexed with the template RNA is oligo-C-tailed The second round of cDNA synthesis, which provides the complement of the first cDNA strand, is performed using Oligo-G as the primer for the reverse transcriptase reaction Genomic HCV RNA is described in Section IV.A.20 .. The methods for tailing with ... (illegible site) are as described in Maniatis et al. (1982). The oDNA products are then cloned, screened and sequenced.

IV.A.22. Alternative method using "parts" for insulation

This method is based on previously used methods for cloning cDNAs of flavivirus RNA. In this method, the RNA is subjected to denaturing conditions to remove secondary structures at the 3 'end, and is then tailed using rATP as a substrate with poly A polymerase. The reverse transcription of the poly A tailed "RNA is catalyzed by reverse transcriptase using oligo-dT as a primer. The second cDNA strands are synthesized, the cDNA products are cloned, screened and sequenced.

IV.A.23. Creation of Lambda gtH HCV cDNA libraries containing larger cDNA inserts. The method used to create and screen the lambda gt11 library is essentially as described in Section IV.A.1., Except that the library is generated from a pool of larger cDNAs eluted from the Sepharose CL-AB column (7 illegible).

IV.A.24. Creation of HCV cDNA Blotlibraries Using Synthetic Ollgomers as Primers. New HCV cDNA libraries were prepared from RNA derived from that described in Section IV.A.1. obtained from the infectious chimpanzee plasma pool and from the poly-A ⁺ fraction recovered from the liver of this infected animal. The cDNA was constructed essentially as described by Gubler and Hoffman (1983), except that the primers for the synthesis of the first cDNA strand were two synthetic oligomers based on the sequence of the HCV genome described above. Primers based on the sequence of clones 11b and 7e were

5 'CTG GCT TGA AGA ATC 3' h? W

 AGT TAG GCT GGT GAT TAT GC 3 '.

The resulting DNAs were cloned into lambda bacteriophage vectors and screened with various other synthetic oligomers whose sequence was based on the HCV sequence, Figure 32.

IV.B. Expression of polypeptides encoded in HCV cDNAs and identification of the expressed products as HCV inducers

antigens

IV.B.1. Expression of the polypeptides encoded in clone 5-1-1 The HCV polypeptide encoded in clone 5-1-1 (see Section IV.A.2., Supra) was used as a fusion polypeptide Superoxide dismutase (SOD) expressed. This was done by subcloning the clone-ö-i-i cDNA insert into the expression vector

pSODcf 1 (Steimer et al. (1986)) in the following manner.

First, DNA isolated from pSODcf 1 was treated with BamH 1 and EcoRI, and the following linker was inserted into the linear DNA

ligated created by the restriction enzymes:

5 'GAT CCT GGA ATT CTG ATA A 3' 3 'GA CCT TAA GAC TAT TTT AA 5'

After cloning, the plasmid containing the insert was isolated.

The plasmid containing the insert was restricted with EcoRI. The HCV cDNA insert in clone 5-1-1 was excised with EcoRI and ligated into this EcoRI-linearized plasmid DNA. The DNA mixture was used to transform E. coli strain D1210 (Sadler et al., 198O) Recombinants with the 5-1-1 cDNA in the correct orientation for expression of the ORF, see Figure 1 were identified by restriction mapping and nucleotide sequencing Recombinant bacteria from a clone were induced by culturing the bacteria in the presence of IPTG for expression of the SOD-NANB ₆ , ·, - polypeptides.

IV.B.2. Expression of the polypeptides encoded in clone 81

The HCV cDNA contained in clone 81 was expressed as a SOD-NANB ₈ , fusion polypeptide. The method for preparing the vector encoding this fusion polypeptide was analogous to the method used to create the SOD-NANB ₆ .,., Vector, except that the source of the HCV cDNA was clone 81, which was prepared according to the description in Section IV.A.3. and for which the DNA sequence described in Section IV.A.4. was determined. The nucleotide sequence of the HCV cDNA in clone 81 and the putative amino acid sequence of the polypeptide encoded therein are shown in FIG.

The HCV cDNA insert in clone 81 was excised with EcoRI and ligated into pSODcf 1 containing the linker (see IV.B.1.) And linearized by treatment with EcoRI. The DNA mixture was used to transform E. coli strain D1210. Recombinants with the clone 81 HCV cDNA in the correct orientation for the expression of the ORF (open reading frame) shown in Figure 4 were identified by restriction mapping and nucleotide sequencing. Recombinant bacteria from a clone were obtained by culturing the bacteria in the presence of IPTG for expression of the. ^c iOD-NANB _B1 polypeptide induced.

IV.B.3. Identification of the Polypeptides Encoded in Clone 5-1-1 as an HCV and NANBH Associated Antigen The polypeptide encoded in the HCV cDNA of clone 5-1-1 was identified as a NANBH-associated antigen by demonstrating that sera of NANBH -infected chimpanzees and humans immunologically reacted with the fusion polypeptide, SOD-NANB ₆ , 10, which is composed of superoxide dismutase at its N-terminus and the in-frame 5-1-1 antigen at its C This was done by Western blotting (Towbin et al., 1979) in the following manner.

A recombinant bacterial strain transformed with an expression vector encoding the SOD-NANB _5. , I polypeptide, as described in Section IV.BI, was induced by growth in the presence of IPTG to express the fusion polypeptide. All bacterial lysate was electrophoresed through polyacrylamide gels in the presence of SDS according to Laemmli (1970). The separated polypeptides were transferred to nitrocellulose filters (Towbin et al., 1979). The filters were then cut into thin strips and the strips were individually incubated with the different chimpanzee and human sera. Bound antibodies were detected by further incubation with ''! -Labeled sheep anti-human Ig as described in Section IV.A.1.

The characterization of the chimpanzee sera used for Western blots and the results presented in the photograph of the autoradiographic strips are shown in Figure 33. Polypeptide-containing nitrocellulose strips were incubated with sera obtained from chimpanzees at different times during the acute NANBH (Hutchinson strain) infections (lane 1-16), hepatitis A infections (lanes 17-24 and 26-33), and hepatitis B infections (lanes 34-44) and Figure 45 shows positive controls in which the immunoblots were incubated with serum from the patient used to identify the recombinant clone 5-1-1 in the original screening of the lambda gt11 cDNA library (see Section IV.A.1.). The band visible in control lanes 25 and 45 in Figure 23 reflects the binding of antibodies to the NANB ₆ ,., component of the SOD fusion polypeptide Binding to SOD, since this was also included as a negative control in these samples, would have appeared as a band migrating significantly faster than the SOD-NANB ₆ .,., Fusion polypeptide.

Lanes 1-16 of Figure 33 show antibody binding in serum samples from 4 chimpanzees. The samples were obtained immediately before infection with NANBH and then during the acute infection. The figure provides as follows: While in serum samples obtained prior to administration of the infective HCV inoculum and during the early acute phase of infection. Antibodies immunoreactive with the SOD-NANB ₅ ,., Polypeptide were absent, eventually inducing all 4 animals during the final part of the acute phase, or antibodies to this polypeptide thereafter. Additional bands observed on chimpanzees Nos. 3 and 4 on the immunoblots were due to background binding to host bacterial proteins. In contrast to the results obtained with sera from NANBH-infected chimpanzees, the development of antibodies against the NANBe-ti component of the fusion polypeptide has been in 4 chimpanzees infected with HAV and 3 chimpanzees infected with HBV, respectively were not observed. The only binding in these cases was background binding to host bacterial proteins, which also occurred in the HCV-infected samples. The characterization of the human sera used for the Western blots and the results shown in the photograph of the autoradiographically picked strips are shown in Figure 34. Polypeptide-containing nitrocellulose strips were incubated with sera from humans at different time points during infection NANBH (lane 1-21), HAV (lane 33-40), and HBV (lane 41-49). Lanes 25 and 50 show positive controls in which the immunoblots were incubated with patient serum which was used in the initial screening of the patient Lanes 22-24 and 26-32 show "uninfected" conidia in which the sera were derived from "normal" blood donors.

As can be seen in Figure 34, the sera from nine NANBH patients, including the serum used to screen the L mbdagti 1 library, contained antibodies to the NANB ₆ ,., Component of the fusion polypeptide. The sera, three patients with NANBH did not contain these antibodies. It is possible that the anti-NANBs.,.., - develop antibodies in these patients at a later date. It is also possible that this lack of response resulted from a different NANBV agent that was causative for the disease in the individuals from whom the unresponsive serum was taken.

Figure 34 also shows that sera from many patients infected with HAV and HBV did not contain AmI-NANB ₅ .,... Antibodies, and that these antibodies were not present in the sera of "normal" controls, although an HAV patient (Lane 36) evidently anti-NANB ^.,., - antibodies, it is possible that this patient was previously infected with HCV, since the incidence of NANBH is very high and because it is often subclinical.

These serological studies show that the cDNA in clone 5-1-1 encodes epitopes specifically recognized by sera from BB-NANBV infected patients and animals. In addition, the cDNA apparently is not derived from the primate genome. A hybridization probe made by clone 5-1-1 or clone 81 did not hybridize to Southern blots of control human and chimpanzee genomic DNA under conditions where unique, single-copy genes were detectable These probes also did not hybridize to Southern blots of control bovine genomic DNA.

IV.B.4. Expression de ti * a composition of the HCV-DNAs in clone 36,81 and 32 The HCV polypeptide encoded PoIypeptid which is encoded in the open reading frame which extends by clone 36,81 and 32 was expressed as a fusion polypeptide with SOD , This was done by inserting the composite cDNA, C100, into an exposition cassette containing the human superoxide dismutase gene. Inserting the expression cassette into a yeast expression vector and expressing the polypeptide in yeast.

An expression cassette containing the C "100" cDNA derived from clones 36, 81 and 32 was constructed by inserting the "_{ecow.Frigm.nt" into the "} EcoRI" Stello of the vector pS3-5G (also called pS356), the plasmid pS3-56 _c10 o was obtained. The construction of C100 is in Section IV.A.16 above. described.

Vector pS3-56, which is a pBR322 derivative, contains an expression cassette composed of the ADH2 / GAPDH hybrid yeast promoter "upstream" of the human superoxide dismutase gene and a "downstream" GAPDH transcription terminator. A similar cassette containing these control elements and the superoxide dismutase gene is described in Cousens et al. (1987) and co-pending application GPO 196056, published October 1, 1986, which is the common property of the assignee of this application. The cassette in pS3-56, however, differs from that in Cousens et al. (1987), where the heterologous proinsulin gene and the immunoglobulin hinge are deleted, and where an adapter sequence containing an Eco RI site joins gln _{M of} the superoxide dismutase The sequence of the adapter is:

5'-AAT TTG GGA ATT CCA TAA TGA G -3 '

ACCCTTAAGGTATTACTCAGCT

The EcoRI site allows the insertion of heterologous sequences which, when expressed by a vector containing the cassette, yield polypeptides having an amino acid sequence:

Asn-leu-gly-ile-ar-

containing oligopeptide linker are fused to superoxide dismutase.

A sample of pS 356 was deposited on April 29, 1988 under the terms of the Budapest Treaty b li of the American Type Culture Collection (ATCC), 12301 Parklawn Dr., Rockville, Maryland 20853, and was given accession number 67683. Conditions regarding availability and access to the deposited material and regarding the preservation of the deposited material correspond to those in section HA specified for strains containing NANBV cDNAs. This deposit is intended to provide relief, but not the practical implementation of the invention in terms of PajI the description given here. The deposited material is incorporated herein by reference.

After isolation of recombinants containing the C 100 cDNA insert in the correct orientation, the expression cassette containing the C 100 cDNA was excised from pS3-56cioo with BamMI and a ~ 3400 bp fragment containing the cassette was isolated and purified , This fragment was then inserted into the BamHI site of yeast vector ρ AB24.

Plasmid pAB24, the significant features of which are shown in Figure 35, is a yeast "shuttle" vector containing the complete 2-micron sequence for replication (Broach [1981]) and pBR322 sequences, and also contains that of plasmid YEp24 (Botstein et al., 1979)) derived yeast URA3 gene and the yeast LEU ^2d gene derived from plasmid pC1 / 1 EPO Publication No. 116,201 Plasmid ρ AB 24 has been described in US Application Serial No. 138,894. The plasmid pAB24 was constructed by digesting YEp24 with EcoRI and religating the vector to remove the 2 micron partial sequence The resulting plasmid, YEP24de1taRI, was linearized by digestion with ClaI and ligated to the plasmid pAB24 The resulting plasmid, pCBou, was then digested with SbaI and the 8605 bp vector fragment was gel isolated This isolated XbaI fragment was m to a 4460bp SbaI fragment containing the pCI / 1-isolated LEU ^M gene. The orientation of the LEU ^M gene is in the same direction as the URA3 gene. Insertion of the expression was at the unique EcoRI site of the pBR322 sequence (illegible site), disrupting the gene for bacterial resistance to tetracycline.

The recombinant plasmid containing the SOD-C 100 expression cassette, pAB24100-3, was inserted into the yeast strain JSC308. and transformed into other yeast strains. The cells were prepared as described by Hinnen et al. (1978) and plated on ura-selective plates. Individual colonies were inoculated into leuselective media and grown to saturation. The culture was induced by growth in YEP containing 1% glucose for expression of the SOD polypeptide (called C100-3). Strain ISC308 is of the genotype MAT, leu2, ura3 (del) DM15 (GAP / ADR1) integrated at the ADR1 locus. In JSC308, overexpression of the positive activator gene product ADR1 results in hyperderepression (relative to an ADR1 wild-type control) and significantly higher yields of expressed heterologous proteins when such proteins are synthesized via an ADH 2 UAS regulatory system. The construction of yeast strain JSC308 is disclosed in co-pending application U.S. Attorney Docket No. (Attorney Docket No. 2300-0229), filed concurrently herewith and incorporated herein by reference A sample of JSC308 was made on May 5 Deposited with the ATCC under the terms of the Budapest Treaty in 1988 and received accession number 20879. The terms of availability and access to the deposited material and conservation of deposit are the same as those specified in section UA for strains containing HCV cuNAs.

The complete CIOO-3 fusion polypeptide encoded in pAB24C100-3 should contain 154 amino acids of human SOD at the amino terminus, 5 from the EcoRI site-containing synthetic adapter-derived amino acid residues, 363 C100 cDNA-derived amino acid residues, and 5 carboxy-terminal amino acids derived from the MS 2 nucleotide sequence adjacent to the HCV cDNA sequence in clone 32. (See Section IV.A.7.) The putative amino acid sequence of the carboxy terminus of this polypeptide starting at the penultimate Ala residue of SOD is shown in FIG. Also shown is the nucleotide sequence encoding this portion of the polypeptide.

IV.B.5. Identification of In C100 Encoded Polypeptides a NANBH-Asociated * Antigen The CIOO-3 fusion polypeptide expressed from plasmid pAB24C 100-3 in yeast strain JSC308 was characterized for size, and the polypeptide encoded in C100 was identified as having Sorum immunoreactivity identified a human with chromatic NANBH as a NANBH-associated antigen.

The C100-3 polypeptide prepared as described in Section IV.B.4. was expressed as follows. Yeast JSC-308 cells were transformed with ρ AB 24 or with pAB24C100-3 and were induced to express the heterologous plasmid-encoded polypeptides. The induced yeast cells in 1 ml of culture (OD _6M "ni-20) were pelleted by centrifugation at 10,000 rpm for 1 minute and were lysed by vigorous (10x 1 min) with 2 volumes of solution and 1 volume of glass beads (0.2 nanometers) Diameter) were swirled. The solution contained 50 mM Tris-HCl, pH 8.0.1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 microgram / ml pepstatin. Insoluble material in the lysate containing the CIOO-3 polypeptide was collected by centrifugation (10,000 rpm for 5 minutes) and dissolved in Laemmli SDS sample buffer for 5 minutes. (See Laemmli [197O]). A polypeptide amount equivalent to that in 0.3 ml of the induced yeast culture was subjected to electrophoresis through 10% polyacrylamide gels in the presence of SDS according to Laemmli (1970). Protein standards were co-electrophoresed on the gels. The gels containing expressed polypeptides were either stained with Coomassie Brilliant Blue or subjected to Western blotting as described in section IV.B.2., Taking serum from a patient with chronic NANBH to assess the immunological responsiveness of pAB 24 and pAB 24 The results are shown in Figure 37. In Figure 37A, the polypeptides were stained with Coomassie Brilliant Blue The insoluble polypeptides of JSC308 transformed with ρ AB 24 and of two further colonies of pAB24C100-3 are in lanes 1 (pAB24) and 2 and 3. A comparison of Lanes 2 and 3 with lane 1 shows the induced expression of a ~ 54,000 dalton molecular weight polypeptide from JSC 308 transformed with pAB24C100-3 which was not is induced in JSC308 transformed with pAB 24. This polypeptide was indicated by the arrow Figure 37B shows the results of. Western blots of the insoluble polypeptides expressed in yeast strain JSC308 transformed with pAB24 (lane 1) or with pAB24C100-3 (lane 2). The polypeptides expressed from pAB24 were not immunologically reactive with human serum with NANBH. However, as indicated by the arrow, JSC 308 transformed with pAB24C100-3 expressed a ~ 54,000 dalton molecular weight polypeptide that reacted with the human NANBH serum. The other immunologically reactive polypeptides in lane 2 may be degradation and / or aggregation products of this ~54,000 dalton polypeptide.

IV.B.6. Cleaning of Fuslonpolypeptld C100-3 The fusion polypeptide composed of SOD at the N-terminus and Jn-frame "C100 HCV polypeptide at the C-terminus C100-3 was obtained by differential extraction of the insoluble fraction of the extracted host yeast cells containing the polypeptide

was purified.

The fusion polypeptide C100-3 was purified as described in Section IV.B.4. described in yeast strain transformed with pAB24C 100-3 JSC308 expressed. The yeast cells were then lysed by homogenization, the insoluble material in the lysate was added

pH 12.0 was extracted and C100-3 in the remaining insoluble fraction was solubilized in SDS-containing buffer.

The yeast lysate was prepared essentially according to Nagahuma et al. (1984). A yeast cell suspension was prepared. It consisted of 33% cells (v / v) suspended in a solution (Buffer A) containing 2 mM Tris-HCl, pH 8.0, 1 mM Dithiotreitol and 1 mM phenylmethylsulfonyl fluoride (PMSF). An aliquot of the suspension (15ml) was added

an equal volume of glass beads (0.45 to 0.50 mm in diameter) and the mixture was added

Maximum speed swirled for 8 minutes in a Super Mixer (Lab Line Intrumonts, Inc.). Homogenate and glass beads

were separated and the glass beads were washed three times with the same volume of Buffer A as that initially used

Cells washed. After combining washings and homogenate, the insoluble material in the lysate became

by centrifuging the homogenate at 4 ^° C. for 15 minutes, resuspending the pellets in twice the volume of buffer A as the cells initially used, and pelletizing the material by centrifuging at 7,000 ° C. for 15 minutes. This washing was repeated three times.

The insoluble material from the lysate was extracted at pH 12.0 as follows. The pellet was dissolved in buffer containing 0.5 M NaCl, 1 mM EDTA containing the suspending volume of 1.8 times that of the cells initially employed. The

pH of the suspension was adjusted by adding 0.2 volume of 0.4 M Na phosphate buffer, pH 12.0. After mixing, the suspension was centrifuged at 4 ° C for 15 minutes at 7000 g and the supernatant was removed

Extraction was repeated twice. The extracted pellets were washed by placing them in 0.5 M NaCl, 1 mM EDTA,

were suspended, using a suspension volume that was twice that of the cells initially used. This was followed by 15 minutes centrifugation at 4 ⁰ C at 7000 g.

The C100-3 polypeptide in the extracted pellet was solubilized by treatment with SDS. The pellets were in one Buffer A amount corresponding to 0.9 volume of the volume of cells initially charged, and 0.1 volume

2% SDS was added. After mixing the suspension, it was centrifuged at 4 ° C for 15 minutes at 7000 g.

The resulting pellet was extracted a further 3 times with SDS. The resulting supernatants containing C100-3 were

collected.

This procedure purifies C100-3 more than 10-fold from the insoluble fraction of the yeast homogenate, and the Recovery of the polypeptide is more than 50%. The purified fusion polypeptide preparation was analyzed by polyacrylamide joint electrophoresis according to Laemmli (1970). Based on this analysis, the polypeptide was more than 80% pure and had an apparent molecular weight of

~ 54,000 daltons.

IV.C. Identification of RNA Hybridizing to HCV cDNA in Infected Individuals

IV.C.1. Identification of RNA hybridizing to HCV cDNA in a chimpanzee liver with NANBH It was demonstrated that chimpanzee liver liver having NANBH contained an RNA species that hybridized to HCV cDNA containing clone 81 by .Northern blotting * in the following way.

RNA was isolated from chimpanzee liver biopsy material from which the high titer plasma (see Section IV.A.1.) Was recovered using techniques described in Maniatis et al. (1982) for the isolation of total RNA from mammalian cells and for their separation into poly A ⁺ and poly A "fractions These RNA fractions were electrophoresed on a formaldehyde / agarose gel (1% mass / vol Maniatis et al., 1982.) The nitrocellulose filters were hybridized with radiolabelled HCV cDNA from clone 81 (see Figure 4 for the nucleotide sequence of the insert) radioactively labeled the HCV cDNA insert isolated from clone 81 by "nick" translation using DNA polymerase I (Maniatis et al., 1982) Hybridization was carried out at 42 ^° C. for 18 hours in a solution containing 10 % (W / v) dextran sulfate, 50% (mass / volume) deionized formamide, 75 mM NaCl, 75 mM Na citrate, 20 mM Na ₂ HPO ₄ , pH 6.5, 0.1% SDS, 0.02% (mass / Vol.) Bovine serum albumin (BSA), 0.02% (mass AvOI) Ficoll-400.0.02% (w / v) Polyv inylpyrrolidone, 100 micrograms / ml salmon sperm DNA sheared and denatured by sonication containing 10 ^e CPM / ml of the nick-translated cDNA probe.

An autoradiographic image of the separate filter is shown in FIG. Lane 1 contains "p-labeled restriction fragment markers. Lanes 2-4 contain chimpanzee liver RNA as follows: lane 2 contains 30 micrograms of total RNA, lane 3 contains 30 micrograms of poly A ^- RNA, and lane 4 contains 20 micrograms of poly-A ⁺ RNA. As shown in Figure 32, the liver of the chimpanzee with NANBH contains a heterogeneous population of related poly a + RNA molecules which hybridizes to the HCV-DNA probe and the apparently about 5000 to about 11000 nucleotides This RNA, which hybridizes to the HCV cDNA, could be viral genomes and / or specific transcripts of the virus genome.

The following in section IV.C.2. described experiment confirms the assumption that HCV contains an RNA genome.

IV.C.2. Identification of HCV Derived RNA in the Serum of Infected Individuals Nucleic acids were isolated from particles which, as described in Section IV.A.1. isolated from high titer chimpanzee NANBH plasma. Aliquots (equivalent to 1 m of original plasma) of the isolated nucleic acids were resuspended in 20 microliters of 50 mM Hepes, pH7.5, 1 mM EDTA, and 16 micrograms / ml yeast-soluble RNA. The samples were denatured by boiling for 5 minutes with subsequent immediate freezing and RNase A (5 microliters containing 0.1 mg / ml RNase A in 25 mM EDTA, 40 mM Hepes, pH 7.5) or DNAse I (5 microliters containing 1 unit DNase I in 10 mM MgCl ₂ , 25 mM Hepes, pH 7.5). Control samples were incubated without enzyme. After incubation, 230 microliters of ice-cold 2XSSC containing 2 micrograms / ml of yeast soluble RNA was added and the samples were filtered on a nitrocellulose filter. The filters were hybridized with a cDNA probe of clone 81 which had been 32p-labeled by nick translation. Fig. 39 shows an autoradiographic image of the filter. Hybridization signals were detected in the DNase-treated and control samples (lanes 2 and 1, respectively) but not in the RNase-treated sample (lane 3). Thus, because RNase-A treatment destroyed the nucleic acids isolated from the particles and DNase treatment had no effect, it can be assumed that the HCV genome consists of RNA.

IV.C.3. Detection of HCV nucleic acid sequences In liver and plasma samples from chimpanzees, NANBH derived amplified nucleic acid sequences

In the liver and plasma of chimpanzees with NANBH and in control chimpanzees existing HCV nucleic acids were essentially using the Saiki et al. (1986) PCR technique (PCR = polymorase chain reachon) amplified. The primer oligonucleotides were derived from the HCV cDNA sequences in clone 81 or clones 36 and 37. The amplified sequences were detected by gel electrophoresis and Southern blotting using as probes the appropriate cDNA oligomer having a sequence from the region between, but not including, the two primers.

Samples of RNA with HCV sequences to be examined by the amplification system were isolated from liver biopsy material from three chimpanzees with NANBH and from two control phalanxes. The isolation of the RNA fraction was performed by the methods described in Section IV.C.1. Guanidiniumthiocyan itprozedur described.

RNA samples to be tested by the amplification system were also isolated from the plasma of two chimpanzees with NANBH and a control chimpanzee, as well as a pool of control chimpanzee plasmas. One infected chimpanzee had a CID / ml equal to or greater than 10 ', and the other infected chimpanzee had a CID / ml equal to or greater than 10 ^seconds .

The nucleic acids were extracted from the plasma as follows. Either 0.1 ml or 0.01 ml of plasma was diluted to a final volume of 1.0 ml with a TENB / Proteinase K / SDS solution (0.05M Tris-HCl, pH 8.0, 0.01 M EDTA, 0 , 1 M NaCl, 1 mg / ml proteinase K and 0.5% SDS) containing 10 micrograms / ml polydenylic acid, and incubated at 37X for 60 minutes. After this proteinase K digestion, the resulting plasma fractions were deproteinized by extraction with TE-10, OmM Tris-HCl, pH 8.0.1 mM EDTA) -saturated phenol. The phenol phase was separated by centrifugation and reextracted with TENB containing 0.1% SDS. The resulting aqueous phases from each extraction were puffed and extracted twice with an equal volume of phenol / chloroform / isoamyl alcohol (1: 1 [99: 2]) and then twice with an equal volume of a 99: 1 mixture of chloroform / isoamyl alcohol. After phase separation by centrifugation, the aqueous phase was brought to a final concentration of 0.2 M Na-acetate and the nucleic acids were precipitated by the addition of two volumes of ethanol. The precipitated nucleic acids were recovered by ultracentrifugation in a SW-41 rotor at 38K for 60 minutes at 4 ⁰ C.

In addition, the high titer chimpanzee plasma and the collected control plasma were alternately extracted by the method of Chomcyzaki and Sacchi (1987) with 50 micrograms of poly A carrier. Using this procedure, acid guanidinium thiocyanate extraction is used. RNA was recovered by centrifugation for 10 minutes at 10000U / min at 4 ⁰ C in an Eppendorf microfuge.

In two cases, prior to the synthesis of cONA in the PCR reaction, the nucleic acids extracted from the plasma by the proteinase K / SDS / phenol method were further purified by binding to and from S and S-Elutip R columns be oluiert them. The procedure was carried out according to the manufacturer's guidelines.

The cDNA used as template for the PCR reaction was derived from the nucleic acids prepared as described above (either total nucleic acids or RNA). Following ethanol precipitation, the precipitated nucleic acid was dried and resuspended in DEPC-treated distilled water. Secondary structures in the nucleic acids were separated by lOminütiges holding at 65 ⁰ C, and the samples were immediately cooled on ice. cDNA was synthesized using 1 to 3 micrograms of total chimpanzee RNA from the liver or nucleic acids (or RNA) extracted from 10 to 100 microliters of plasma. In the synthesis, Reverse Tr. nskriptase and was carried out in a 25 microliter reaction vessel according to the protocol specified by the manufacturer, BRL. The primers for cDNA synthesis were those also used in the PCR reaction described below. All reaction mixtures for cDNA synthesis contained 23 units of the RNAase inhibitor RNASIN ¹ "(Fisher / Promega) Following cDNA synthesis, the reaction mixtures were boiled with W. server diluted, 10 minutes and rapidly cooled on ice.

The PCR reactions were carried out essentially according to the manufacturer's guidelines (Cetus-Perkin-Elmer), with the exception of the addition of 1 microgram of RNase A. The PCR technique was carried out in 35 cycles with a temperature regime of 37 ⁰ C, 72 ° C and 94 ° 0. The primers for cDNA synthesis and for the PCR reactions were derived from the HCV cDNA sequences in (lon 81, clone 36 or clone 37b. (The HCV cDNA sequences of clones 81, 36 and 37 are b shown in Figures 4,5 and 10, respectively). The sequences of the two 16-mer primers derived from clone 81 were:

5'CAA TCA TAC CTG ACA G 3 'and 5' GAT AAC CTC TGC CTG A 3 '.

The sequence of the primer of clone 36 was: 5 'GCA TGT CAT GAT GTA T 3'

 The sequence of the clone 37 b primer was: 5 'ACA ATA CGT GTG TCA C 3'.

For the PRC reactions, the primer pairs consisted of either the two clon 81 derived 16-mer from clone 36 and the 16-mer from clone 37b.

The products of the PCR reaction were prepared by labeling the products by alkali gel electrophoresis followed by Southern blotting and detection of the amplified HCV cDNA sequences with a p-labeled internal oligonucleotide probe derived from a non-primer overlapping region of the HCV cDNA. cDNA was derived. The PCR reaction mixtures were extracted with phenol / chloroform and the nucleic acids were precipitated from the aqueous phase with salt and ethanol. The precipitated nucleic acids were collected by centrifugation and dissolved in distilled water. Aliquots of the samples were electrophoresed on 1.8% alkaline agarose gels. Single-stranded DNAs of 60.108 and 161 nucleotides in length were co-electrophoresed on gels as "molecular weight markers." After electrophoresis, the DNAs in the gel were transferred to Biorad-Zet & probes ^TH paper, prehybridization and hybridization, and washing conditions complied with the manufacturer's specification (Biorad).

The probes used for hybridization / detection of the amplified HCV cDNA sequences were as follows. When the PCR primer pair was recovered from clone 81, the probe was a 108 mer with a sequence corresponding to that in the region between the sequences of the two primers. When the PCR primer pair was derived from clone 36 and clone 37b, the probe was the clone 35-derived nick-translated HCV cDNA insert. The primers are derived from nucleotides 155-170 of the clone 37 b insert and nucleotides 206-268 of the clone 36 site. The 3 'end of the HCV cDNA insert in clone 35 overlaps nucleotides 1-186 of the insert in clone 36; and the 5 'end of the clone 35 insert overlaps nucleotides 207-269 of the insert in clone 37b. (Compare Figures 5, 8 and 10). Thus, the cDNA insert in clone 35 spans a portion of the region between the sequences of clones derived from clone 36 and clone 37b and is useful as a probe for the amplified sequences that include these primers.

Analysis of the RNA from the liver samples was done according to the above procedure using both primer and probe groups. RNA from the liver of the three chimpanzees with NANBH provided positive hybridization results for amplification sequences of the expected size (161 and 586 nucleotides for 81 and 36 and 37b, respectively) while the control chimpanzees gave negative hybridization results. The same results were obtained when the experiment was repeated three times.

The analysis of the nucleic acids and RNA from the plasma was also carried out according to the above procedure using the primary and probe of clone 81. The plasmas were from two chimpanzees with NANBH, a control chimpanzee and pooled plasma of control chimpanzees. Both NANBH plasmas contained nucleic acids / RNA, which gave positive results in the PCR-amplified assay, while both control plasmas gave negative results. These results were obtained several times in retest tests.

IV.D. Radiolum immunoassay for the detection of HCV antibodies in the serum of infected individuals. Solid phase radioimmunoassays for the detection of antibodies to HCV antigens were developed on the basis of TSU and Herzenberg (1980). Microtiter plates (Immulon 2, Removawell Strei) are coated with purified polypeptides containing HCV epitopes. The coated plates are incubated with human serum samples suspected of containing antibodies to the HCV epitopes, or with appropriate controls. During the

Incubation, the antibody, if any, is immunologically linked to the Fes'phase antigen. After removal of the unbound material and washing of the M'crotiter plates, complexes of human antibody NANBV antigen are detected by incubation with l-labeled sheep anti-human immunoglobulin Unbound labeled antibody is removed by aspiration and the plates are harvested The radioactivity in individual wells is determined and the amount of bound human anti-HCV antibodies is proportional to the radioactivity in the well.

IV.D.1. Purification of Fuslonpolypeptld SOD-NANB ₆ .,.

The fusion polypeptide SOD-NANB ₆ .,... 'Expresses in recombinant bacteria as described in Section IV.B.1. was purified from the recombinant E. coli by differential extraction of the cell extract with urea and subsequent chromatography on anion and cation exchange columns as follows.

Thawed 1 liter culture cells were resuspended in 10 mM 20% (mass / volume) sucrose containing 0.01 M Tris-HCl, pH 8.0, and 0.4 ml 0.5 M EDTA. ? · Ά 8, Ov urdei. added. After 5 minutes at 0 ⁰ C, the mixture was centrifuged for 10 minutes at 4000 xg. The resulting pellet was suspended in 10mL of 25% (mass / volume) sucrose containing 0.05N Tris-HCl pH 8.0.1mM phenylmethylsulfonyl fluoride (PMSF) and 1 microgram / ml Pepstatin A followed by followed by the addition of 0.5 ml lysozyme (10 mg / ml) incubation at ⁰ ° C over a period of 10 minutes. After the addition of 10% (v / v) Triton X-100 in 0.05 M Tris HCl, pH 8.0, 1 mM EDTA, the mixture was further incubated at 0 ° C for 10 minutes with occasional shaking. The resulting viscous solution was homogenized by passing 6 times through a 20 gauge sterile hypodermic needle and centrifuging at 13,000 g for 25 minutes. The pelleted material was suspended in 5 ml of 0.01 M Tris-HCl, pH 8.0, and the suspension was centrifuged at 4000 g for 10 minutes. The pellet containing SOD-NANBs.,., - fusion protein was dissolved in 5 ml of 6M urea in 0.02M Tris-HCl, pH 8.0.1mM dithiothreitol (buffer A), and placed on a buffer A balanced column given by Q-Sepharose Fast Flow. Polypeptides were eluted with a linear gradient of 0.0 to 0.3 M NaCl in Buffer A. After elution, the fractions were analyzed by polyacrylamide gel electrophoresis in the presence of SDS to determine their content of SOD-NANB ₅ .,. Fractions containing this polypeptide were collected and dialysed against 6M urea in 0.02M sodium phosphate buffer, pH 6.0.1 mM dithiothreitol (Buffer B). The dialyzed sample was loaded onto a buffer 8 equilibrated column of S-Sepharose Fast Flow, and polypeptides were eluted with a linear gradient of 0.0 to 0.3 M NaCl in buffer B. The fractions were analyzed for the presence of SOD-NAP 3s-m by polyacrylamide gel electrophoresis and the appropriate fractions were pooled.

The final SOD-NANB ₆ .: -, polypeptide preparation was examined by electrophoresis on polyacrylamide gels in the presence of SDS. Based on this analysis, the preparation was more than 80% pure.

IV.D.2. Cleaning of Fuslonpolypeptld SOD-NANBi ₁ The fusion polypeptide SOD-NANB ,, expressed in recombinant bacteria as described in Section IV.B.2. described, was out

recombinant E. coli by differential extraction of the cell extracts with urea, followed by chromatography

Anion and cation exchange columns using those for the isolation of fusion polypeptide SOD-NANB ₆ .,.

described procedure (see Section IV.D.1.).

The final SOD-NANB ₈ polypeptide preparation was prepared by electrophoresis on polyacrylamide gels in the presence of SDS

examined. Based on this analysis, the preparation was more than 50% pure.

IV.D.3. Detection of Antibodies Against HCV Epitopes by Solid-Phase Radiolum Immunoassay Serum samples from 32 patients diagnosed with ΝΛΝΒΗ were analyzed by radioimmunoassay (RIA) to determine whether antibodies to fusion polypeptides SOD-NANB ₆ , ι, and SOD -NANB ₁ I existing HCV epitopes were detectable.

Microtiter plates were coated with SOD-NANB ₆ .,., Or SOD-NANB ,, which was prepared according to Sections IV.D.1. or IV.D.2. had been partially cleaned. The assays were performed as follows. 100 milliliter aliquots containing 0.1 to 0.5 micrograms SODNANB ₆ .,., Or SOD-NANBj, in 0.125 M Na borate buffer, pH 8.3, 0.07 5, M NaCl (BBS). were added to each well of a microtiter plate (Dynatech Immulon 2 Rmovawell strips). The plate was incubated overnight at 4 ^° C. in a humid chamber, after which the protein solution was removed and the wells were bled three times with BBS containing 0.02% Triton X-100 (BBST). To prevent nonspecific binding, the wells were coated with bovine serum albumin (BSA) with the addition of 100 μL of a 5 mg / ml solution of BSA in BBS, followed by room temperature incubation over a period of one hour. After this incubation, the BSA solution was removed. The polypeptides in the coated wells were reacted with serum by adding 100 microliter of serum samples diluted 1: 100 in 0.01 M Na phosphate buffer, pH 7.2, 0, 15 M NaCl (PES) containing 10 mg / ml BSA were added and the wells were incubated with the serum for 1 hour at 37 ⁰ C. After incubation, the serum samples were removed by aspiration and the wells were washed 5 times with BBST. AnIi-NANB ₆ .,., And anti-NANB ₍ , was bound to the fusion polypeptides by the binding of '' L-tagged F '(ab) _r sheep anti-human IgG to the coated wells amounts of 100 Mikroiitern the labeled probe (specific activity 5-20 microcuries / microgram) were added to each well, and the plates were incubated for one hour at 37 ⁰ C, followed by joined removal of excess probe by aspiration and 5 washes with BBST The amount of radioactivity bound in each well was determined by counting in a counter that detects gamma radiation

The results of detection of AnIi-NANB ₆ .,., And anti-NANBg in individuals with NANBH are given in Table 1.

Table 1 Detection of Antl-5-1-1 and Antl-81 in sera from NANB, HAV and HBV hepatitis patients

patient- Diagnosü Anti-5-1-1 S / N Anti-81 ready-for Chronic NANB, IVD " 0.77 4.20 niimmer Chronic NANB, IVD 1.14 5.14 1.28 ' Chronic NANB, IVD 2.11 4.05 AVH ", NANB, sporadically 1.09 1.05 Chronically, NANB 33.89 11.39 2.29 ' Chronically, NANB 36.22 13.67 AVH, NANB, IVD 1.90 1.54 Chronic NANB, IVD 34.17 30.28 3.30 ' Chronic NANB, IVD 32,45 30.84 Chronic NANB, PT ⁴¹ 16.09 8.05 Late AVH NANB, IVD 0.69 0.94 4.31 Late AVH NANB, IVD 0.73 0.68 5:32 ' AVH, NANB, IVD 1.66 1.96 AVH, NANB, IVD 1.53 0.56 « 6:33 ' Chronic NANB, PT 34.40 7.56 Chronic NANB, PT 45.55 13.11 7:34 ' Chronic NANB, PT 41.58 13,45 Chronic NANB, PT 44,20 Ί0.48 AVHNANBJVD 31.92 3, 95 "Healed news 6.87 4.45 8:35 ' NANB ₁ AVH Late AVH NANBPT 11.84 5.79 AVHNANB.IVD 6.52 1.33 9:36 Late AVH NANB, PT 39.44 39.18 10:37 Chronic NANB, PT 42.22 37.54 11:38 AVH ₁ NANB ₁ PT 1.35 1.17 12:39 Chronic NANB, PT 0.35 0.28 13:40 AVH, NANB, IVD 6.25 2.34 14:41 Chronic NANB, PT 0.74 0.61 15:42 AVH, NANB, PT 5.40 1.83 16:43 Chronic NANB, PT 0.52 0.32 17:44 AVH, NANB 23.35 4.15 18:45 AVH, type A. 1.60 1.35 19:46 AVH, type A. 1.30 0.66 20:47 AVH, type A. 1.44 0.74 21:48 Resolved 0.48 0.56 22:49 Recent AVH, Type A 23:50 AVH, type A. 0.68 0.64 Dissolved AVH, type A. 0.80 0.65 24.51 Solved recent AVH, 1.38 1.0 " Type A 25.52 Solved recent AVH, 0.80 0.65 Type A AVH, type A. 1.85 1.16 Solved recent AVH, 1.02 0.88 26.53 Type A AVH, type A. 1.35 0.74 Late AVH, HBV 0.58 0.55 27.54 Chronically, HBV 0.84 1.06 28.55 Late AVH, HBV 3.20 1.60 29.56 Chronically, HBV 0.47 0.46 30.57 AVH, HBV 0.73 0.60 31.58 Healed AVH, HBV 0.43 0.44 32.59 ' AVH, HBV 1.06 0.92 Healed AVH, HBV 0.70 0.68 33.60 ¹ AVH, HBV 1.66 0.61 Healed AVH, HBV 0.63 0.36 34.61 ' AVH ₁ HBV 1.02 0,7.3 Healed AVH, HBV 0.41 0.42 35.62 ¹

Patient reference number

S / N

diagnosis

Anti-5-1-1 Anti-I 1.24 1.31 1.55 0.45 0.82 0.79 0.53 0.37 0.95 0.92 0.95 0.92 0.70 0.50 1.03 0.68 1.71 1.39

36.63 ' AVH, HBV Healed AVH, HBV 37.64 ' AVH, HBV Healed AVH, HBV 38.65 ' AVH, HBV Healed AVH, HBV Healed AVH, HBV 39.66 ' AVH, HBV Healed AVH, HBV

1 Of these patients, sequential serum samples are available.

2 IVD = intravenous drug user.

3 AVH - acute viral hepatitis.

4 PT = post-transfusion (after transfusion).

As can be seen in Table 1, 19 out of 32 sera from patients diagnosed with NANBH had antibodies to antibodies against 'HCV epitopes present in SOD-NANB ₆ .,., And SOD-NANB ₈₁ '. were positive. However, the positive serum samples were not equally immunologically reactive with S0D-NANB6.M and SOD-NANB ₈₁ . Patient No. 1 serum samples were positive for SOD-NAN ₈₁ but not SOD-NANB ₅ .,.,. Serum samples from patients # 10, 15 and 17 were positive for SOD-NANB ₅ -M, but not for SOD-NANB ₈₁ . Serum samples from patients Nos. 3, 8, 11 and 12 reacted equally with both fusion polypeptides, while serum samples from patients Nos. 2, 4, 7 and 9 compared to SOD-NANB ₆ .!., Had a 2 to 3 times greater response as compared to SOD-NANB ₈ ). These results suggest that NANB _6. ).) And NANB ₈ may contain at least three different epitopes, ie, it is possible that each polypeptide contains at least one unique epitope and that the two polypeptides share at least one epitope.

IV.D.4. Specificity of the solid phase RIA with respect to NANBH

The specificity of solid phase radioimmunoassays for NANBH was tested by performing the assay on the basis of serum from HAV or HBV infected patients and sera from control individuals. Assays using partially purified SOD-NANB ₆ ,., And SOD-NANB ₈ were made essentially as described in Section IV.D.3. except that the sires were from patients previously diagnosed with HAV or HBV, or from individuals who were blood donors. The results for sera from HAV and HBV infected patients are shown in Table 1. The radioimmunoassay was tested using 11 serum pumps of HAV-infected patients and 20 serum samples of HBV-infected patients.

As shown in Table 1, coins of these sera showed a positive immunological reaction with the fusion polypeptide containing BB-NANBV epitopes.

The RIA using the NANBt.,., Antigen was used to determine the immunological responsiveness of serum from control individuals. Of 230 serum samples from normal blood donors, only two showed positive responses in RIA (data not shown). It is possible that the blood donors from which these serum samples originated were once exposed to HCV.

IV.D.5. Reactivity of NANB ₄₁ , during NANBH infection

The presence of AnIi-NANB ₆ .,... Antibodies in the course of NANBH infection of two patients and four chimpanzees was assessed with RIA as described in Section IV.D.3. tracked. Also, the radioimmunoassay was used to determine the A nwosenheit or absence of anti-NANBuo antibodies in the course of HAV and HBV infection in chimpanzees infected applied.

The results presented in Table 2 show that in chimpanzees and in humans, AnU-NANB ₆ .,... Antibodies were detected after onset of the acute phase of NANBH infection. No AnU-NANB ₆ .,., - antibodies were detected in sera samples from HAV- or HBV-infected chimpanzees. Thus, the AnIi-NANB ₆ .,., - antibody as an indicator (marker) for the ECV exposure of an individual.

Table 2

Seroconversion in sequential serum samples from hepatitis patients and cirrhotics, rumen using 5-1-1 antigen

Patient/ Sample date (day) hepatitis Anti-5-1-1 OLD chimp Io " vaccination day) virus (S / N) (Mu / mL) Patient 29 , T · NANB 1.09 1180 T + 180 53.89 425 T + 208 36.22 _ Patient 30 T NANB 1.90 1830 τ +. ·>:, 34.17 290 1 + 799 32,45 276 SchiiTip 1 0 NANB 1.87 9 76 0,5.3 71 118 23.67 19 154 32.41 -

Patient/ Sample date (day) hepatitis Anti-5-1-1 OLD chimp (o - vaccination day) virus (S / N) (Mu / mL) Schimp2 0 NANB 1.00 5 21 1.08 52 73 4.64 13 138 23,01 - Schimp3 0 NANB 1.08 8th 43 1.44 205 53 1.82 14 159 11.87 6 Schimp4 -3 NANB 1.12 11 55 1.25 132 83 6.60 - 140 17.51 - Schimp5 0 HAV 1.50 4 25 2.39 147 40 1.92 18 268 1.53 5 Schimp6 -8th HAV 0.85 - 15 - 106 41 0.81 10 129 1.33 - Schimp7 0 HAV 1.17 7 22 1.60 83 115 1.55 5 139 1.60 _ Schimp8 0 HAV 0.77 15 26 1.98 130 74 1.77 8th 205 1.27 5 Schimp9 -290 HBV 1.74 _ 379 3.29 9 435 2.77 6 SchimpiO 0 HBV 2.35 8th 111-118 2.74 96-155 (Pool) (Pool) 205 2.05 9 240 1.78 13 SchimpU 0 HBV 1.82 11 28-56 1.26 8-100 (Pool) (Pool) 169 1.00 9 223 0.52 10

'T = day of initial sampling

IV.E. Purification of polyclonalan serum antibodies against NANB ₆ .,.

Based on the specific immunological reactivity of the SOD-NaNB ₅ .!. Polypeptides with the antibodies in patient 3n serum samples with NANBH, a procedure was developed for the purification of serum antibodies immunogenic with the epitope (s) in NANB _6th ,.! react, developed.

In this method, the affinity chromatography is exploited. Purified SOD-NANB ₆ .!. I polypeptide (see Section IV.DI) was attached to an insoluble support, with the immobilized polypeptide retaining its affinity for the antibody to NANB ₅ .,. The antibody in Sorum samples is absorbed on the matrix-bound polypeptide. After washing to remove the non-specifically bound materials and unbound materials, the bound antibody is released from the bound SOD-HCV polypeptide by changing the pH and / or chaotropic reagents, such as urea.

Nitrocellulose membranes containing bound SOD-NANB _6. , Were prepared as follows. A nitrocellulose membrane, 2.1 cm Sartorius with a pore size of 0.2 μm, was washed three times with BBS for 3 minutes. SOD-NANB _5. ! Ι was bound to the membrane by incubation of the purified preparation in BBS at room temperature for 2 hours; in an alternative manner, incubation was carried out at 4 ^° C. overnight. The solution containing the bound antigen was removed and the filter was washed three times with BBS for three minutes each. The remaining active sites on the membrane were blocked by incubation with a 5 mg / ml BSA solution for 30 minutes. Excess BSA was removed by washing the membrane five times with BBS and washing three times with distilled water. The membrane containing the viral antigen and BSA was then treated with 0.05M glycine hydrochloride, pH 2.5.0.1 OMN aCl (Gly HCl) for 15 minutes followed by three 3-minute washes with PBS '. aiterbehandelt. The polyclonal anti-NANB ^.,... Antibodies were isolated by incubating the fusion polypeptide-containing membranes with serum from one subject with NANBH for two hours. After incubation, the filters were washed five times with BBS and twice with distilled water. The bound antibodies were dsmn by 5 elutions of GIyHCl, where

each elution took 3 minutes, removed from each filter. The pH of the eluates was adjusted to 8.0 by collecting each eluent in a test tube containing 2.0M Tris HCl at pH 8.0. The recovery of the anti-NANBe-M antibody after affinity chromatography was about 50%.

The dos bound virus antigen-containing Nitrocellulosemombranen can repeatedly without significant loss en: used binding capacity. For reuse, after the antibodies have eluted, the membranes are washed 3 times with BBS 3 times each for 3 minutes. Then they are stored at 4 ⁰ C in BBS.

IV.F. The capture of HCV particles from infected plasma by purified human polyclonal anti-HCV antibodies; Hybridization of Nuclofenic Acid In Captured Particles to HCV cDNA

IV.F.1. The trapping of HCV particles from infected plasma using human polyclonal anti-HCV antibody Protein nucleic acid complexes present in the infectious plasma of a chimpanzee with NANBH were analyzed by

purified human polyclonal anti-HCV antibody bound to polystyrene beads.

Polyclonal anti-NANB ^ .t antibodies were purified from human serum with NANBH by cloning 5-1-1

coded polypeptide SOD-HCV was used. For purification, the procedure described in Section IV.E. described method applied.

The purified anti-NANB ^ .i antibodies were immobilized on polystyrene beads ( ¹ inch diameter, mirror-smooth surface, Precision Plastic Ball Co., Chicago, Ill.) Bound by placing each bead overnight at room temperature with 1 ml of antibody

(1 microgram / ml in borate-buffered saline, pH 8.5). After overnight incubation, the beads were washed once with TBST (50 mM IrisHCl, pH 8.0, 15 mM, NaCl, 0.05% [V / V] Tween 20) and then with phosphate buffer

Saline (PBS) containing 10 mg / ml BSA. Control beads were prepared in a similar manner except that the purified AnU-NANB ^ ₁ , antibodies

were replaced by total human immunoglobulin.

The capture of HCV from chimpanzee plasma infected with NANBH by means of the anti-NANB ^,.! The antibody was as follows: The plasma used from a chimpanzee with NANBH is described in Section IV.A.1. described. A

aliquot (1ml) of the with NANBV infected chimpanzee plasma was coated for 3 hours at 37 ⁰ C with 5 beads, dieentweder with anti-NANB ^ M-antibodies or with Kontrollimmunoglubulinen incubated. The perlon was washed three times with TBST.

IV.F.2. Hybridization of Nuclofenic Acid In the Captured Particles to NANBV cDNA

The nucleic acid component released from the particles captured with AnU-NANB ₅ .,... Antibodies was analyzed for hybridization to HCV cDNA derived from clone 81.

HCV particles were prepared from NANBH-infected chimpanzee plasma as described in Section IV.F.1. captured captured. To release the nucleic acids from the particles, the washed beads were incubated for 60 minutes at 37 ⁰ C with 0.2 ml per bead solution, wherein the solution of proteinase K (1 mg / ml), 1OmM Tris HCl, pH 7.5 1OmM EDTA, 0 , 25% (M / V) SDS, contained 10 micrograms / ml of soluble yeast RNA, the supernatant was removed. The supernatant was extracted with phenol and chloroform, and the nucleic acids were precipitated overnight at -20 ° C. The nucleic acid precipitate was collected by centrifugation, dried and dissolved in 50 mM Hepes, pH 7.5. Exactly equal amounts of the soluble nucleic acids from the samples derived from the anti-NANBj.,., Antibody-coated beads and the control beads containing the total human immunoglobulin were filtered on the nitrocellulose filters. The filters were hybridized with a ³² P-labeled "nick" -translated probe prepared from the purified HCV cDNA fragment in clone 81. The procedures for probe preparation and hybridization are described in Section IV.C. Fig. 34. Autoradiograms of a probed filter containing the nucleic acids from particles captured by the beads containing anti-NANB ₆ .,..., Antibodies are shown in Figure 34. Using the AnU-NANB ₅ .,., - Antibody (Ai, A ₂ ) obtained extract in relation to the control antibody extract (A ₃ , A ₄ ) and the control yeast RNA 'B ₁ , B ₂ ) clear hybridization signals pg, 5pg, and 10pg of the purified cDNA fragment of Cion 81 are shown in C1-3.

These results indicate that the particles captured from NANBH plasma by Anii-NANB ^,..., - antibodies contain nucleic acids that hybridize to HCV cDNA in clone 81, thus providing further evidence that the cDNAs in these clones are pus etiological agents were derived from NANBH.

IV.G. Immunological Reactivity of C100-3 with Purified AnU-NANBn ₁ Antibodies The immunological reactivity of the C 100-3 fusion polypeptide with AnU-NANB ₅ .,... Antibodies was determined by radioimmunoassay using the solid phase-bound antigens with purified AnU-NANB ₅ .,., - antibodies and the antigen-antibody complex was detected with ''! labeled sheep anti-human antibodies of SOD-NANB ₅ .,., - Antigen The fusion polypeptide C100-3 was synthesized and purified as described in Section IV.B.5 and Section IV.B.6, respectively The fusion polypeptide SOD-NANB ₅ . , was synthesized and purified as described in Section IV.B.1 and Section IV.D.1, respectively. The purified AnIi-NANB ₅ .,., - antibodies were purified as described in Section IV.E. Aliquots of 100 microliters containing varying amounts of purified C 100-3 antigen i n 0.125M Na borate buffer, pH 8.3.0.075M NaCl (BBS) was added to each well of a microtiter plate (Dynatech Immolon 2 Removawell Strips). The plate was incubated overnight in a humid chamber at 4 ⁰ C, after which the Protainlösung was removed and the wells were washed three times with BBS containing 0.02% Triton X-100 (B3ST). To avoid nonspecific binding, the wells were coated with BSA by adding 100 microliters of a 5 mg / ml solution of BSA in BBS and then incubating for 1 hour at room temperature, after which the excess BSA solution was removed. The polypeptides in the coated wells were reacted with purified AnU-NANB ₅ .,., Antibodies by adding 1 microgram of antibody / well, and the samples were incubated for 1 hour at 37 ° C. After incubation, the excess solution was removed by aspiration and the wells were washed five times with BBST

washed. AnU-NANB ₆ .,., Bound to the fusion polypeptides, was detected by binding of '' labeled F '(ab) ₂ sheep anti-human IgG to the coated wells, aliquots of 100 microliters of labeled probe (specific activity 5-20 micro Curies / microgram) were added to each well, the plates were incubated for 1 hour at 37 ⁰ C, and then the excess probe was removed by aspiration and washed five times with BBST. the bound in each well radioactivity was Table 3 shows the results of the immunological reactivity of C100 with purified AnU-NANB ₆ .,., Compared to that of NANB ₅ .,.) With the purified antibodies.

Table 3 Immunological reactivity of C100-3 compared to NANBs.,., Detected by radioimmunoassay (R / A)

AG (ng) RIA (count per minute / assay) 400 320 240 6732 6985 4954 5920 160 60 0 NANBs.,., C100-3 7332 7450 4050 5593 3051 4096 57 67

The results in Table 3 show that AnIi-NANB ₆ .,., Recognizes an epitope (or epitopes) in the CIOO component of the C100-3 polypeptide. Thus, NANB ₆ ,., And C100 share a common epitope (epitope). The results indicate that the cDNA sequence encoding this NANBV epitope (s) is present in both clone 5-1-1 and clone 81.

IV.H. Characterization of HCV IV.H.1. Characterization of the Strength of the HCV Genome

The HCV genome was characterized for strandability by isolating nucleic acid irrigation from the particles captured on the polystyrene beads coated with anti-NANB6.,., Antibody and determining whether the isolated nucleic acid was positive and / or minus strands of the HCV cDNA hybridized.

As in Section IV.F.1. described particles from the HCV-infected chimpanzee plasma were captured using immunopurified AmI-NANB _5. , -, Antibody coated polystyrene beads. The nucleic acid component of the particles was analyzed by means of the procedure described in Section IV.F.2. released process described. Aliquots of isolated genomic nucleic acid corresponding to 3 ml of the high titer plasma were transferred to nitrocellulose filters. As controls, aliquots of denatured HCV cDNA from clone 81 (2 picograms) were also transferred to the same filters. The filters were probed with a ³² P-labeled mixture of plus or a mixture of minus strands of single-stranded DNA from the HCV cDNAs; the cDNAs were excised from clones 40b, 81 and 25c. The single-stranded London were obtained by excising the HCV cDNAs by EcoRI from clones 81, 40b and 25c, and cloning the cDNA fragments into M13 vectors, mp 18 and mp 19 (Messing (1983).) The MIS clones were sequenced The sequencing was done with the dideoxy chain termination method of Sanger and co-workers (1977). From a set of duplicate filters containing aliquots of the HCV genome derived from the HCV genomes Each filter was hybridized with either plus or minus strand probes derived from the HCV cDNAs Figure 41 shows the autoradiographs obtained on probing of the NANBV genome, with the probe mixture of was derived from clones 81, 40b and 25c, and was used to increase the sensitivity of the hybridization assay Strand-probe mixture hybridized. The samples in List II were hybridized by hybridization to the minus strand-probe mixture. The composition of the samples in the lists t, ¹ S immunoblots is shown in Table 4.

Table 4

1 HCV genome ^>

2 ·

3 · CDNA81

4 - CDNA81

* is an unspecified sample

As can be seen from the results in Figure 41, only the minus strand DNA probe hybridizes to the isolated HCV genome. This result, coupled with the finding that the genome is sensitive to RNase and not to DNase (see Section IV.C.2.), Suggests that the genome of NANBV is a positive-stranded RNA. These data, as well as the data from the other laboratories regarding the physicochemical properties of a probable NANBV, are consistent with the possibility that the HCV belongs to don Flaviviridae. However, the possibility that the HCV represents a new class of viral agent is not disabled.

IV.H.2. Detection of Sequences In Captured Particles that hybridize upon amplification by PCR to clone 81-derived HCV cDNA

The RNA in trapped particles was purified as described in Section IV.H.1. described, won. Analysis for sequences that hybridize to the clone 81-derived HCV cDNA was performed using the PCR amplification method as described in Section IV.C.3. with the exception that the hybridization probe was a kinase oligonucleotide derived from the cDNA sequence of clone 81. The results showed that the amplified sequences hybridized with the clone 81-derived HCV cDNA probe.

IV.H.3. Homology between dengue flavivirus non-structural protein (MNWWVD 1) and the HCV polypeptides encoded by the combined ORF of clones 141 to 39c

As shown in Figure 26, the combined HCV cONAs of clones 14i to 39c contain a continuous ORF. The polypeptide encoded therein was analyzed for sequence homology with the region of the non-structural or non-structural dengue flavivirus peptides (MNWVD 1). For the analysis performed on the computer, the Dayhoff protein database was used. The results are shown in Figure 47, in which the symbol (:) indicates exact homology and the symbol (.) Indicates a conservative replacement in the sequence; the dashes indicate spaces that have been inserted into the sequence to achieve the greatest homology. As can be seen from the figure, there is significant homology between the sequence encoded in the HCV cDNA and dengue virus non-structural polypeptide (s). In addition to the homology shown in Figure 42, analysis of the polypeptide segment encoded in one region towards the 3 'end of the cDNA also contained sequences homologous to sequences in dengue polymerase. Also of consequence is the discovery that the regulatory Gly-Asp-Asp (GDD) sequence believed to be important for RNA-dependent RNA polymerases is contained in the polypeptide encoded in HCV cDNA, and although in a place that is consistent with the Dengue-2 virus. (This data is not shown.)

IV.H.4. HCV DNA is not detectable in NANBH-infected tissue

Two types of studies provide results suggesting that HCV DNA is undetectable in tissue from an individual with NANBH. These results, together with those in Sections IV.C. and IV.H.2. evidence that the HCV is not a DNA-containing virus and that its replication proceeds without cDNA involvement.

IV.H.4.a. Southern blotting Verfahrcn

To determine whether NANBH-infected chimpanzee liver contains detectable HCV DNA (or HCV cDNA), restriction enzyme fragments of DNA were isolated from this source by Southern blotting and the "blots" were probed with ³² P-labeled HCV cDNA. The results showed that the labeled HCV cDNA did not hybridize to the DNA transferred from the infected chimpanzee liver. It also did not hybridize to the DNA transferred for control from normal chimpanzee liver. On the contrary, in a positive control, a labeled probe of the beta interferon gene hybridized strongly to Southern blot of restriction enzyme-digested human placental DNA These systems were designed to detect a single copy of the gene labeled with the labeled probe DNAs were isolated from the liver of two chimpanzees with NANBH Control DNAs were isolated from uninfected chimpanzee liver and from human placentas The DNA extraction procedure was performed essentially according to Maniatis and coworkers (1988), and the samples Both DNA samples were treated with either EcoRI, Mbol or HincII (12 micrograms) according to the manufacturer's instructions The digested DNAs were then further analyzed by electrophoresis on 1% neutral agarose gels, by Southern blotting treated on nitrocellulose, and the transferred material hybridized with the corresponding "nick" -translated probe cDNA (3x10 'counts per minute / ml of hybridization mixture). The DNA from infected chimpanzee liver and normal liver was hybridized with ³² P-labeled HCV cDNA from clones 36 plus 81; the human placenta DNA was hybridized with ³² P-labeled DNA from the beta interferon gene. After hybridization, the "blots" were washed under stringent conditions, ie with a solution containing 0.1% SSC, 0.1% SDS and at a temperature of 69 ^° C. The beta interferon gene DNA was as described by Houghton and coworkers (1981).

IV.HAb. Amplification by the PCR Technlk

To determine whether the HCV DNA in chimpanzee liver was to be detected with NANBH, DNA was isolated from the tissue and PCR amplification detection method using primers and probe polynucleotides derived from clone 81 HCV cDNA , subjected. As negative controls, DNA samples isolated from uninfected HepG 2 tissue culture cells and from suspected uninfected Hu. Tianplacenta were used. As positive controls, probes, the negative control DNAs to which a known relatively small amount (250 molecules) of the HCV cDNA insert from clone 81 had been added, appeared. In addition, to confirm that DNA fractions (RNA fractions which are difficult to read copy) isolated from the same liver of chimpanzees with NANBH contained sequences complementary to the HCV cDNA probe, PCR amplification detection system also applied to the isolated RNA samples.

In these studies, the DNAs were amplified by the procedure described in Section IV.H.4.a. were isolated and the RNAs were extracted essentially as described by Chirgwin and coworkers (1981).

DNA samples were isolated from 2 infected chimpanzee livers, from uninfected HepG 2 cells and from human placenta. One microgram of each DNA was digested with HindIII according to the manufacturer's instructions. The digested samples were amplified by PCR and the detection of the amplified HCV cDNA was performed essentially as described in Section IV.C.3., Except that the reverse transcriptase step was omitted. The PCR primers and probe were recovered from HCV cDNA clone 81 and are described in Section IV.C.3. described. Prior to amplification, a 1 microgram sample of each DNA was "spiked" for positive controls by the addition of 250 molecules of HCV cDNA insert isolated from clone 81. For the determination of whether HCV sequences in RNA derived from the livers of When chimpanzees were isolated with NANSH, samples containing 0.4 micrograms of total RNA were subjected to an amplification process essentially as described in Section IV.C.3, but with some samples as a negative control, the reverse The PCR primer and probe were recovered from HCV cDNA clone 81 as described previously.

The results showed that the amplified sequences complementary to the HCV cDNA probe were detectable neither in the infected chimpanzee liver DNAs nor in the negative controls. On the contrary, if the samples, including the DNA from infected chimpanzee liver, were "spiked" with the HCV cDNA prior to amplification, the sequences from clone 81 were detected in all positive control samples and amplified HCV cDNAs were also amplified in the RNA assays. Clone 81 sequences were detected only when reverse transcriptase was used, strongly suggesting that the results were not due to DNA contamination.

These results indicate that hepatocytes from chimpanzees with NANBH contain no or undetectable levels of HCV DNA. Based on the "spiking" study, it can be said that if HCV DNA is present then it accounts for well below 0.06 copies per hepatocyte, on the contrary, the HCV sequences in the total RNA from the same liver samples could easily be detected with the PCR technique.

IV.I. ELISA tests for HCV infection with HCV-c 100-3 old test antigen

All samples were tested by ELISA using HCV-C100-3. This assay uses the HCV c 100-3 antigen (synthesized and purified as described in Section IV.B.5.) And a horseradish peroxidase (HRP) conjugate of mouse monoclonal anti-human IgG.

The plates coated with the HCV c 100-3 antigen were prepared as follows. A solution of coating buffer (50 mM Na-borate, pH 9.0), 21 ml / plate, BSA (25 micrograms / ml), c100-3 (2.50 micrograms / ml) was added to the Removeawell Immulon immediately before addition. I plates (Dynatech Corp.). After mixing for 5 minutes, 0.2 ml / well of the solution was added to the plates, they were covered and incubated at 37 ^° C. for 2 hours, after which the solution was removed by suction. The wells were washed once with 400 microliters of wash buffer (10 mM sodium phosphate, pH 7.4.14 mM sodium chloride, 0.1% M / V casein, 1% (M / V) Triton X-100.0.01% [M / V]. V) thimerosal). After removal of the wash solution, 200 microliters / well of postcoat solution (10 mM sodium phosphate, pH 7.2, 15 mM sodium chloride, 0.1% (w / v) casein, and 2 mM phenylmethylsulfonyl fluoride (PMSF) were added, the plates were loosely capped to give a And allowed to stand for 30 minutes at room temperature, then the wells were aspirated to remove the solution, and lyophilized dry overnight without heating.The prepared plates can be stored at 2-8 ° C in sealed aluminum containers ELISA assays were performed in a well containing 20 microliters of serum sample or control sample containing 200 microliters of sample diluent (10 mM sodium phosphate, pH 7.4, 50 mM sodium chloride, 1 mM EDTA, 0.1% (M / V) casein, 0.015% [M]. V] Therosal, 1% [w / v] Triton X-100,100 micrograms / ml yeast extract) was prepared. the plates were sealed and incubated for two hours at 37 ⁰ C, after which the solution by suction, was removed. The wells were washed with 400 microliters of wash buffer (phosphate buffered saline [PBS] containing 0.05% Tween 20). The washed wells were washed with 200 microliters of mouse anti-Hurrvn IgG HRP conjugate dissolved in a solution of orthoconjugate diluent (10 mM sodium phosphate, pH 7.2, 125 mM sodium chloride, 50% (v / v) fetal bovine serum, 1% (v / v) of heat-treated horse serum containing 1 mM K ₃ Fe (CN) ₈ , 0.05% (M / V | Tween 20.0.02% [M / V] thimerosal) took 1 hour at 37 ⁰ C, after which the solution was removed by aspiration and the wells were washed with Waschpuffar, which was also removed by aspiration. to determine the amount of bound enzyme conjugate, 200 microliters of substrate solution (10 mg O-phenylenediamine dihydrochloride per 5 ml The Developer solution contains 5 mM sodium citrate adjusted to pH 5.1 with phosphoric acid and 0.6 microliters / ml of 30% H] O]. The plates with the substrate solution were allowed to stand in the dark for 30 minutes incubated at room temperature, the reactions were monitored by addition e of 50 microliters / ml of 4N sulfuric acid stopped and absorbance values (OD) were determined.

The examples presented below demonstrate that the microtiter plate screening ELISA using HCV C100-3 antigen has a high degree of specificity, as evidenced by the initial rate of reactivity of about 1% with a repeat-response rate of about 0.5% random donors becomes. The assay is capable of detecting the immune response both during the post-acute phase of the infection and during the chronic disease phase. In addition, this test can be used for detection on some samples that have been negatively evaluated in the surrogate tests for NANBH. These samples are from individuals with a NANBH history or from donors implicated in NANBH transmission (donors implicated in NANBH transmission). In the examples below, the following abbreviations are used:

OLD Alanine aminotransferase Anti-HBc Antibody to HBc Anti-HBsAg Antibody to HBsAg HBc Hepatitis B core antigen ABsAg Hepatitis B surface antigen IgG immunoglobulins IgM ImmunoglobulinM IU / L International units / liter N / A is not available NT was not tested N sample size Neg negative OD extinction Pos positive S / CO Signal / cutoff value SD standard deviation X Average or average WNL within normal limits

IV.1.1. HCV Infection In a population of random blood donors

A panel of 1056 samples (fresh sera) from randomly selected blood donors was obtained from Irwin Memorial Blood Bank, San Francisco, California. The test results from these samples are summarized in a histogram showing the distribution of extinction values (Figure 37). As can be seen from FIG. 37, 4 samples are> 3, one sample between 1 and 3.5 samples between 0.4 and 1 and the remaining 1046 samples are <0.4, with over 90% of these samples <0, Show 1.

The results of the reactive samples are listed in Table 5. Using a truncation value corresponding to the standard deviations mean plus 5, then 10 samples of 1056 (0.95%) were initially reactive. Of these, five samples (0.47%) repeatedly proved to be reactive when tested a second time by ELISA. Table 5 also shows the ALT and anti-HBd status for each of the repeatedly reactive samples. Of particular interest is the fact that all five repeated reactive samples were negative for NANBH in the two surrogate assays, but positive in the HCV ELISA.

Table 5

Results on reactive samples

SD = ± 0.074

Cut off value: χ + 5SD = 0.419 (0.400 + negative control)

rehearse OD the beginning OD repeated OLD" Anti-Hbc "" reactive samples reactive samples (IU / L) (OD) 4227 0.462 0.084 N / A N / A 6292 0.569 0.294 N / A N / A 6188 0.699 0.326 N / A N / A 6157 0.735 0,187 N / A N / A 6277 0.883 0,152 N / A N / A 6397 1,567 1,392 30.14 1,433 6019 > 3,000 > 3,000 46.48 1,057 6651 > 3,000 > 3,000 48.53 1,343 6669 > 3,000 > 3,0C0 60.53 1,165 4003 > 3,000 3,000 WNL "" negative 10/1056 = 0.95% 5/1056 = 0.47%

  Sample readings> 1.5 were not included in the calculation of the mean and the statistical deviation

included

* ALT s 68 IU / L are above normal limits

"AnIiHBc S 0.535 (competition assay) is considered positive

• · '· WNL: within normal limits

IV.1.2. Chimpanzee serum samples

Serum samples from 11 chimpanzees were tested by HCV-dOO-3 ELISA. 4 of these chimpanzees were treated according to an established procedure in collaboration with Dr. med. Daniel Bradley of Centers of Disease Control Infected with NANBH from a Contaminated Charge Factor VIII (Probably Hutchinson's Strain). As controls, 4 other chimpanzees were infected with HAV and 3 with HBV. The serum samples were taken at different times after infection. The results summarized in Table 6 show documented antibody eroconversion in all chimpanzees infected with the Hutchinson strain of NANBH. After the acute phase of infection (as evidenced by the significant increase and subsequent return to normal ALT levels), antibodies to HCV-dOO-3 were detected in the sera of 4/4 NANBH infected chimpanzees. These samples have recently been analyzed as described in Section IV.B.3. was found to be positive by Western analysis and a radioimmunoassay. In contrast, none of the control chimpanzees infected with HAV or HBV showed any sign of reactivity in ELISA.

Table 6 Chimpanzee serum samples

OD S / CO Inoculation Blood ALT Trans

Date Date (IU / L) fusion

positive

Control 1.504

Shutdown 0.401

negative

Control 0.001

Chimpanzee 1 -0,007 0,00 24.05.84 24.05.84 9 NANB

0,003 0,01 07.08.84 71

> 3,000> 7,48 18.09.84 19

> 3.000> 7.48 24.10.84

Chimpanzee 2 - - 07.06.84 - - NANB

-0.003 0.00 31.05.84 5

-0.005 0.00 28.06.84 52

0,945 2,36 20.08.84 13

> 3,000 7.48 24.10.84

Chimpanzee 3 0,005 0,01 14.03.85 14.03.85 8 NANB

0.017 0.04 26.04.85 205

0.006 0.01 06.05.85 14

1,0in 2,52 20.08.85 6

Continuation of Table β

OD S / CO inoculation blood OLD trans date date (IU / L) fusion Schlmpanse4 0,006 0.00 11/3/85 11/3/85 11 NANB 0,003 0.01 09/05/85 132 0.523 1.31 06/06/85 - 1.574 3.93 08/01/85 - Chimpanzee 5 0,006 0.00 21/11/70 21/11/80 4 HAV 0.001 0.00 16/12/80 147 0,003 0.01 30/12/80 18 o.ooe 0.01 29.07.-08.21.81 5 Chimpanzee 6 - - P5.05.82 - - HAV 0,00b 0.00 17/5/82 - 0.001 0.00 10/6/82 106 0,004 0.00 07/06/82 10 0,290 0.72 10/1/82 - Schfmpar.se 7 0,008 0.00 25/5/82 25/5/82 7 HAV 0,004 0.00 17/6/82 83 0,006 0.00 16/9/82 5 0.005 0.01 10/9/82 - Chimpanzee 8 0,007 0.00 21/11/80 21/11/80 15 HAV 0,000 0.00 16/12/80 130 0,004 0.01 03/02/81 8th 0,000 0 00 03.06.-06.10.81 4 Sch! Mpanse9 - - 24/7/80 - - HBV 0.019 0.05 22.0B.-10/10/79 - - - 11/3/81 57 0,015 0.04 01.07.-05.08.81 9 0,008 0.02 10/1/81 6 Chimpanzee 10 - - 12/5/82 - - HBV 0.011 0.03 21.04.-05.12.82 9 0,015 0.04 01.09.-08.09.82 126 0,008 0.02 12/2/82 9 0,010 0.02 06/01/83 13 chimpanzees - - 12/5/82 - - HBV 0,000 0.00 06.01.-05.12.82 11 - - 23/6/82 100 0,003 0.00 09.06.-O7.07.82 - 0,003 0.00 28/10/82 9 0,003 0.00 20/12/82 10

IV.1.3. Listo 1: Detected Infectious sera from human carriers chronic NANBH

An encrypted list consisted of 22 unique samples, each as a duplicate, i. a total of 44 samples. The samples were from proven infectious sera from chronic NANBH carrier, infectious sera from affected donors and infectious sera from NANBH patients in the acute phase. In addition, the samples came from long-tracked negative controls and other disease controls. This Listo was written by Dr. H. Age provided by Department of Health and Human Services, National Institutes of Health, Bethesda, Maryland. The list was written by dr. Age ago several years ago and has since been used by him as a qualifying list for tests on presumptive NANBH. (See cited reference to Dr. Alters article).

The entire list was tested twice by the ELISA method, and the results were reviewed for evaluation. Age sent. The results of this evaluation are shown in Table 7. Although the table contains the results of only one duplicate set, the same values were achieved on each of the duplicate samples.

As shown in Table 7, 6 sera that were proven infectious in a chimpanzee model were highly positive. The seventh infectious serum corresponded to a sample in an acute NANBH case and was unreactive in this ELISA. A sample from an affected donor with normal ALT values and ambiguous results in the chimpanzee studies was not reactive in this test. Three other serial samples from an individual with acute NANBH were also unreactive. All samples derived from the long traced negative controls were obtained from donors who had given blood at least 10 times without hepatitis, and were unreactive in the ELISA.

Finally, 4 of the tested samples were previously considered positive in presumptive NANBH tests developed by other scientists, but these tests were not confirmed.

Table 7

List 1 by H.Alter

List I. Result 2. Result

1) Infectious by chimpanzee transmission

a. Chronic NANB; Post-Tx

JF + +

EB + +

PG + +

b. Affected donors with increased ALT

BC + +

JJ + +

BB + +

c. Acute NANB; Post-Tx WII

2) Not clearly infectious due to chimpanzee transmission

a. Affected donors with normal ALT

CC - -

3) Acute NANB; Post-TX JL I.Woche

JL 2nd week JL 3rd week

4) Disease checks Primary biliary cirrhosis

EK - -

b. Alcohol Hepatitis in convalescence

HB - -

5) Negative controls with history

DH - -

DC - -

LV - -

HL - -

Alles - -

6) Potential NANB "Antigens" JS-80-01T-O (ISHIDA) Asterix (TREPO)

Zurtz (ARNOLD) Becassdine (TREPO)

IV.I.4. List 2: Donor / recipient NANBH

The encrypted list consisted of 10 unambiguous transfusion-related donor / recipient NANBH cases with a total of 188 samples. Each of these cases consisted of samples from some or all donors to the recipient and from serial samples (taken 3.6 and 12 months after transfusion) from the recipient. A blood sample taken from the recipient prior to transfusion was also included. The encrypted list was written by Dr. med. H. NIH and the results were sent to him for evaluation.

The ii. Table 8 for ammulated results shows that the ELISA method demonstrated antibody seroconversion in 9 out of 10 cases of transfusion-related NANBH. Samples from case 4 (where no seroconversion was detected) consistently reacted poorly in the ELISA. Two out of the ten recipient samples were reactive 3 months after transfusion.

At 6 months, 8 recipient samples were reactive and at 12 months all samples except Case 4 were reactive.

In addition, at least 1 antibody-positive donor was found in 7 out of 10 cases, with case 10 having 2 positive donors. In case 10, the recipient's pre-transfusicns blood sample was also positive for HCV antibody. The blood sample of this recipient at one month fell below the limit of reactive words, while the blood samples rose to positive levels at 4 and 10 months.

In general, an S / CO of 0.4 is considered positive. This case may thus be an earlier infection of the individual with HCV.

The ALT and HBc status for all reactive, i. H. positive, samples are summarized in Table 9. As can be seen in the table, the Vs donor samples were nogative for the surrogate markers and reactive in the HCV antibody ELISA procedure. On the other hand, the recipient samples (12 months after transfusion) had either elevated ALT words or positive anti-HBc values or both.

Table 8 List of donor / recipient NANB after H.Alter

Case dispenser 1. S / CO Recipient 3 months S / CO OD 6Mon. Anti-Alt · Post-TX S / CO 12 months S / CO Second - Blood sample 0.07 0.112 elevated 6 months > 6.96 > 6.96 3. 0,403 - transfusion 0.14 0.050 6Mon. normal 3.90 > 6.96 OD 4th 0.94 OD 0.11 0.057 elevated elevated S / CO OD > 6.96 OD > 6.96 5.> 3,000 - 0.032 0.15 0.073 6Mon. elevated 0.26> 3,000 0.16 > 3,000 0.50 6.> 3,000 > 6.96 0.059 0.08 0.096 elevated not available 0.12 to 1,681 > 6.96 > 3,000 > 6.96 7.> 3,000 > 6.96 0,049 0.13 1.475 6Mon. normal 0, 3> 3,000 > 6.96 > 3,000 > 6.96 8.> 3,000 > 6.96 0,065 0.08 0.056 elevated elevated 0.1? 0.067 > 6.96 0.217 > 6.96 9.> 3,000 > 6.96 0.034 0.14 0.078 3mon. normal 0, i! 2> 3,000 5.28 > 3,000 > 6.96 10.> 3,000 > 6.96 0.056 0.19 0.127 elevated normal 3,44> 3, C00 0.13 > 3,000 > 6.96 > 3,000 > 6.96 0.034 > 6,96 0,317 " elevated 0.13> 3,000 > 6.96 > 3,000 > 6.96 > 6.96 0,061 6Mon. elevated 0.18 2.262 > 3,000 0.08 elevated not tested 0.30 0.055 > 3,000 -> 3,000 6Mon. elevated 0,74> 3,000 " > 3.000 ··· Old and HBc status for reactive samples in List 1 by H.Alter elevated not tested • -1 month; ·· -4 months; ··· -10 months rehearse 12Mon. normal Table 9 donor 4Mon not tested··· Case 3 elevated elevated Case 5 not tested HBc " Cases elevated Case 7 negative negative Fall8 not tested positive Case 9 elevated positive Case 10 negative negative FaIMO normal positive receiver not tested not available case 1 elevated positive 12 Mc. elevated positive Case 2 not tested 12Mon. positive Case 3 12Mon. negative Case 5 12Mon. not tested··· Case β 6Mon. not tested 12Mon. Case 7 negative 12Mon. Case 8 12Mon. negative Case 9 Case 10 positive 10Mon. not tested not tested

'ALT a 45IU / L is above the normal limit.

Anti-HBc a 50% (competition assay) is considered positive.

· · · Blood sample before the Trarnfution and 3 months after that were HBc negative.

IV.I.5. Determination of HCV infection in samples of high-risk groups High risk group samples were monitored by ELISA to increase reactivity to HCV ciOO-3 antigen

determine. These samples were provided by D. Gary Tegtmeier, Community Blood Bank, Kansas City. The results are summarized in Table 10.

As can be seen from the table, the samples with the highest reactivity are obtained from hemophiles (76%). Continue

Samples from individuals with elevated ALT and anti-HBc positive were found to be 51% reactive, a value consistent with the expected clinical data and NANBH prevalence in this group. The presence of antibody to HCV was also higher in blood donors with elevated ALT alone, in blood donors who were only positive for antibodies to hepatitis B virus.

Core positive and in blood donors, for reasons other than high ALT or anti-nuclear antibodies in the Compared to random voluntary blood donors were rejected. Table 10 Samples from NANBH risky groups

group N 35 distribution OD % reactive 1 0.728 N 3,000 11.4% Increased ALT 24 3 33 5 3,000 20.8% Anti-HBc 1 2,768 5 3,000 51.5% ErhöhteALT, anti-HBc 1 2,324 12 1 0.939 1 0.951 1 0,906 25 150 3,000 20.0% Rejected donors 1 0.837 5 3,000 14.7% Donor with hepatitis I 0.714 19 prehistory I 0.469 50 I 2,568 3,000 76.0% hemophilic I 2,483 31 I 2,000 I 1,979 i 1,495 I 1,209 I 0.809

IV.I.6. Comparative studies using anti-IgG or anti-IgM monoclonal antibody or polyclonal antibody

as Secondary Antibody In the KCV-CI00-3 ELISA

The sensitivity of the ELISA measurement using anti-IgG monoclonal conjugate was compared to that of

achieved when either an anti-IgM monoclonal conjugate is used, or when both are replaced by a polyclonal antiserum which is said to be both heavy and light chain specific. The following studies were carried out.

IV.I.e.a. Serial samples from seroconverters Serial Probonon from Three Files NANB seroconverters were tested in the HCV-c1 OO ELISA assay using the Enzyme Conjugate

either the anti-IgG monoclonal antiserum was used alone or in combination with an anti-IgM monoclonal antiserum, or a polyclonal antiserum was used. The samples were collected from Dr. Cladd Stevens, N. Y. Blood

Center, N.Y. C, N.Y. provided. The sample histories are listed in Table 11. The results obtained with an anti-IgG monoclonal antibody / enzyme conjugate are shown in Table 12. The data

show that strong reactivity was initially detected in samples 1-4,2-8 and 3-5 of cases 1,2 and 3, respectively.

The results obtained by a combination of an anti-IgG monoclonal Korijugats and an anti-IgM conjugate

are listed in Table 13. There were 3 different conditions; Anti-IgG tested for anti-IgM. The dilution 1: 10,000 of anti-IgG was constant throughout the tests.

The dilutions tested in the anti-IgM monoclonal conjugate were 1: 30000.1: 60,000 and 1: 120000. The data

zeigon, that in accordance with the studies with anti-IgG alone, the initial strong reactivity was detected in samples 1-4,2-8 and 3-5.

The results obtained with the ELISA test with anti-IgG monoclonal conjugate (dilution 1: 100000), or with Tago-

polyclonal conjugate (1: 80000 dilution) or with Jackson polyclonal conjugate (1: 80000 dilution) are listed in Table 14. The data show that the initial high reactivity was detected in samples 1-4,2-8 and 3-5 in all three configurations. The tago-polyclonal antibodies gave the strongest signals.

The results presented above show that all three configurations have reactive samples at the same time after the acute Demonstrate disease phase (as indicated by the increase in ALT levels). In addition, the results show

that the sensitivity of the HCV dOO-S ELISA assay by anti-IgG monoclonal enzyme conjugate is equal to or better than that obtained in the other configurations of the enzyme conjugate tested.

tables Description of the samples according to the list of Cladd Stevem

date HBsAg Anti-HBs Anti-HBc OLD bilirubin FAIM 1-1 08/05/81 1.0 91.7 12.9 40.0 -1.0 1-2 09/02/81 1.0 121.0 15.1 274.0 1.4 1-3 10/7/81 1.0 64.0 23.8 261.0 0.9 1-4 19/11/81 1.0 67.3 33.8 75.0 0.9 1-5 15.12.81 1.0 50.5 27.6 71.0 1.0

Continuation of Table 11

Date I -4BsAG Anti-HBs Anti-HBc OLD Bill Rubin Case 2 2-1 19.10.81 1 , 0 1.0 116.2 17.0 -1.0 2-2 17/11/81 , 0 0.8 89.5 46.0 1.1 2-3 12/2/81 .0 1.2 78.3 63.0 1.4 2-4 14/12/81 , 0 0.9 90.6 152.0 1.4 2-5 23/12/81 1.0 0.8 93.6 624.0 1.7 2-6 20/1/82 1.0 0.8 92.9 66.0 1.5 2-7 15/2/82 , 0 0.8 86.7 70.0 1.3 2-8 17/3/82 1.0 0.9 69.8 24.0 -1.0 2-9 21/4/82 1.0 0.9 67.1 53.0 1.5 2-10 19/5/82 1.0 0.5 74.8 95.0 1.6 2-11 14/6/82 1.0 0.8 82.9 37.0 - '' 0 Case 3 3-1 07/04/81 1.0 1.2 88.4 13.0 -1.0 3-2 12/5/81 .0 1.1 162.2 236.0 0.4 3-3 30.05. E1 , 0 0.7 99.9 471.0 0.2 3-4 09/06/81 .0 1.2 110.8 315.0 0.4 3-5 07/06/81 .0 1.1 89.9 273.0 0.4 3-6 10/8/81 , 0 1.0 118.2 158.0 0.4 3-7 09/08/81 , 0 1.0 112.3 84.0 0.3 3-8 14/10/81 , 0 0.9 102.5 180.0 0.5 3-9 11/11/81 .0 1.0 84.6 154.0 0.3

Table 12 ELISA test results obtained using anti-IgG monoclonal conjugate

sample date Old OD S / CO Neg.Kontrolle 0,076 cut-off value 0,476 PC {1: 128) 1,390 FAIM 1-1 05.08.8 ' 40.0 0,178 0.37 1-2 09/02/81 274.0 0.154 0.32 1-3 10/7/81 261.0 0,129 0.27 1-4 19/11/81 75.0 0.937 1.97 1-5 15.12.81 71.0 3,000 6.30 Case 2 2-1 19/10/81 17.0 0.058 0.12 2-2 17/11/81 46.0 0,050 0.11 2-3 12/2/81 63.0 0.047 12:10 2-4 14/12/81 152.0 0.059 0.12 2-5 23/12/81 62Λ.0 0,070 0.13 2-6 20/1/82 66.0 0,051 0.11 2-7 15/2/82 70.0 0,139 0.20 2-8 17/3/82 24.0 1,867 3.92 .2-9 21/4/82 53.0 3,000 6.30 2-10 19/5/82 95.0 3,000 6.30 2-11 14/6/82 37.0 3,000 30.6 Case 3 3-1 07/04/81 13.0 0,090 0.19 3-2 12/5/81 236.0 0.064 0.13 3-3 30/5/81 471.0 0.079 0.17 3-4 09/06/81 315.0 0.211 0.44 3-5 07/06/81 273.0 1,707 3.59 3-6 10/8/81 158.0 3,000 6.30 3-7 09/08/81 84.0 3,000 6.30 3-8 14/10/81 180.0 3,000 6.30 3-9 11/11/81 154.0 3,000 6.30

Table 13 ELISA test results obtained using anti-IgG and anti-IgM monoclonal conjugate

date OLD ELISA TestsanNANB monoclonal monoclonal monoclonal IgG1: 10K lßG1: 10K IgG1: 10K IgM 1:60 K lgM1: 120K lgM1: 30K OD S / CO OD S / CO Frobe OD S / CO 0,080 0.079 Nag. control 08/05/81 40 0,100 cut-off value 09/02/81 274 1,328 1,197 PC (1: 128) 10/7/81 261 1,083 FAIM 19/11/81 75 0.162 0,070 1-1 15.12.81 71 0.173 0.141 0.079 1-2 0.194 0,129 0.063 1-3 19/10/81 17 0.162 0.85 0.709 1-4 17/11/81 46 0.812 > 3.00 > 3.00 1-5 12/2/81 63 > 3.00 Case 2 14/12/81 152 0,045 0.085 2-1 12.23. fl1 624 0,442 0,029 0,030 2-2 20/1/82 66 0,102 0,036 0.027 2-3 15/2/82 70 0.059 0,041 0,025 2-4 17/3/82 24 0,065 0.033 0.032 2-5 21/4/82 53 0.082 0,042 0.027 2-6 19/5/82 95 0,102 0,068 0.096 2-7 14 06 82 37 0.188 1,668 1,541 2-8 1,728 2,443 > 3.00 2-9 07/04/81 13 > 3.00 > 3.00 > 3.00 2-10 12/5/81 236 > 3.00 > 3.00 > 3.00 2-11 30/5/81 471 > 3.00 Case 3 09/06/81 315 0,076 0,049 3-1 07/06/81 273 0,193 0,051 0,038 3-2 10/8/81 158 0.201 0.067 0,052 3-3 09/08/81 84 0.132 0,155 0.140 3-4 14/10/81 180 0,175 1,238 1,260 3-5 11/11/81 154 1,335 > 3.00 > 3.00 3-6 > 3.00 > 3.00 > 3.00 3-7 > 3.00 > 3.00 > 3.00 3-8 > 3.00 > 3.00 > 3.00 3-9 > 3.00

Table 14 ELISA test results obtained using polyclonal conjugates

date OLD ELISA TestsanNANB S / CO TAGO S / CO Jackson S / CO monoclonal 0,045 1: 80K 1: 80K 1: 10K OD OD sample OD 0.154 Neg. control 0,076 0.545 0,654 cut-off value 08/05/81 40 0,476 0.37 0.727 0.12 2,154 0.23 PC (1:28) 09/02/81 274 1,390 0.32 0.18 0.34 FAIM 10/7/81 261 0.27 0.067 0.05 0.153 0.26 1-1 19/11/81 75 0,178 1.97 0.097 0.60 0.225 1.21 1-2 15.12.81 71 0.154 6.30 0.026 3.27 0.167 4.59 1-3 0,129 0,324 0.793 1-4 0.937 1.778 > 3.00 1-5 > 3.00

date OLD EUSA-TestsanNANB S / CO TAGO S / CO -49- 287 104 monoclonal 1: 80K Table 14 (continued) 19/10/81 17 1: 10K 0.12 OD 0.04 17/11/81 46 OD 0.11 0.03 Jackson 12/2/81 63 0.10 0.023 0.04 1:80 K 14/12/81 152 0.058 0.12 0,018 0.05 OD S / CO sample 23/12/81 624 0,050 0.15 0,020 0.05 Case 2 20/1/82 66 0.047 0.11 0,025 0.03 0,052 0.08 2-1 15/2/82 70 0.059 0.29 0.026 0.07 0.058 0.09 2-2 17/3/82 24 0,070 3.92 0,018 0.65 0,060 0.09 2-3 21/4/82 53 0,051 > 0.30 0.037 1.37 0.054 0.08 2-4 19/5/82 95 0,139 > 6.30 0.355 1.88 0.074 0.11 2-5 14/6/82 37 1,867 > 6.30 0,748 1.68 0.058 0.09 2-6 > 3.00 1.025 0.146 0.22 2-7 07/04/81 13 > 3.00 0.19 0.917 0.09 1,429 2.19 2-8 12/5/81 236 > 3.00 0.13 0.07 > 3.00 > 4.59 2-9 30/5/81 471 0.17 0,049 0.08 > 3.00 > 4.59 2-10 09/06/81 315 0,090 0.44 0,040 0.16 > 3.00 > 4.59 2-11 07/06/81 273 0.064 3.59 0,045 0.50 Case 3 10/8/81 158 (, 079 > 6.30 0.085 2.47 0.138 0.21 3-1 09/08/81 84 0211 > 6.30 0.272 4.21 0.094 0.14 3-2 14/10/81 180 1,707 > 6.30 1,347 > 5.50 0.144 0.22 3-3 11/11/81 154 > 3.00 > 6.30 2,294 > 5.50 0,275 0.42 3-4 > 3.00 > 3.00 1,773 2.71 3-5 > 3.00 > 3.00 > 3.00 > 4.59 3-6 > 3.00 > 3.00 > 4.59 3-7 > 3.00 > 4.59 3-8 > 3.00 > 4.59 3-9

IV.I.ß.b. Samples of random blood donors

Samples from random blood donors (see section IV.1.1.) Were screened for HCV infection by HCV ciOO-3 ELISA, where the antibody / enzyme conjugate was either an anti-IgG monoclonal conjugate or a polyclonal conjugate. The total number of samples screened was 1077 for polyclonal conjugate and 1056 for monoclonal conjugate, respectively. A summary of the screening results is given in Table 15 and the sample distributions are shown in the histogram in FIG.

The calculation of the mean and standard deviation was done excluding the samples which gave a signal above 1.5, ie. H. 1073 OD values were used for polyclonal conjugate calculations and 1051 for anti-IgG monoclonal conjugate. As can be seen in Table 15, the average value shifted from 0.0439 to 0.0931 and the standard deviation increased from 0.074 to 0.0933 when the polyclonal conjugate was used. In addition, the results also show that when the criteria of χ + 5SD are used to define the assay cutoff value, the polyclonal / enzyme conjugate configuration in the ELISA assay requires a higher cutoff value. This indicates a lower assay specificity compared to the monoclonal system. In addition, as can be seen from the histogram in Figure 44, a greater separation of the results between negative and positive distribution occurs when random blood donors in an ELISA using the anti-IgG monoclonal conjugate compared to an assay by means of a conventional polyclonal label.

Table 15 Comparison of two ELISA configurations in test samples from random blood donors

conjugate Polyclonal Anti-IgG mono- (Jackson) clonally Number of samples 1073 1051 Average (x) 0.0931 0.04926 Standard deviation (SD) 0.0933 0.07427 5SD .4666 .3714 cut-off value (5SD + x) .5596 .4206

IV a. Detection of HCV Seroconvarslon in NANBH Patients from Many Geographic Areas Sera from patients suspected of having elevated ALT levels of NANBH in which HAV and HBV tests had been negative were analyzed by radioimmunoassay essentially according to Section IV. D. However, the HCV-C 100-3 antigen was used as a screening antigen on the microtiter plates. As can be seen from the results shown in Table 16, radioimmunoassay detected positive samples in a high percentage of cases.

Table 16 Frequency of seroconversion in anti-dOO-3 among NANBH patients from different countries

country Netherlands Italy Japan Number of examined cases 5 36 26 Positive number 3 29 19 % positive 60 SO 73

IV.K. HCV seroconversion clones In NANBH-acquired community-acquired NANBH, Dr. H.Alter of the Center of Disease Control and Dr. J. Tuesday of Harvard University provided serums from 100 NANBH patients in which no apparent transmission pathway was detected (ie, no transfusions, no intravenous drug users, no promiscuity, etc. were identified as risk factors.) These samples were screened by radioimmunoassay in substantial accordance with the procedure described in Section IV.D. Except that the HCV c100-3 antigen was used as a screening antigen on the microtiter plates, the results showed that of the 100 serum samples, 55 contained antibodies that immunoreacted with the HCV c100- 3 antigen The results described above indicate that the 'NANBH acquired in the Community' is also caused by HCV.

Since it has also been shown here that HCV is related to the flaviruses, most of which are transmitted by arthropods, this suggests that HCV transmission of the 'community acquired' cases was also by arthropods.

IV.L. Comparison of the occurrence of HCV antibodies and surrogate markers in donors affected by NANBH transmission

A prognostic study was conducted to determine whether seroconversion to anti-HCV antibody positive had occurred in recipients of blood from presumably NANBH-positive donors who had developed NANBH. Blood donors were tested for abnormal surrogate markers, which are now used as markers in NANBH infection, d. H. increased ALT levels and the presence of anti-nuclear antibodies. In addition, the donors were also tested for the presence of anti-HCV antibodies. The determination of whether anti-HCV antibodies are present was made by means of a procedure described in Section IV.K. described radioimmunoassays. The test results are listed in Table 17, which shows the patient number (column 1); the presence of anti-HCV antibodies in the patient serum (column 2); the number of blood donations the patient received, each donation from another donor (column 3); the presence of anti-HCV antibodies in the donor serum (column 4); and the surrogate abnormality of the donor (column 5). (NT or - does not mean tested). (ALT means increased transaminase and anti-HBc means anti-nuclear antibody).

The Results Table 17 shows that the HCV antibody test is more accurate in finding infected blood donors than the surrogate marker tests. Nine out of 10 patients who developed NANBH symptoms were positive for anti-HCV antibody seroconversion. Of the 11 suspected infected individuals (patient 6 received donations from two different donors who are believed to be NANBH carriers) 9 were positive for anti-HCV antibodies and 1 was just above the borderline positive and therefore ambiguous (donor from patient 1) ,

On the other hand, if the test is used for elevated ALT values, then 6 out of 10 donors tested are negative and using the antibody antibody test, 5 out of the 10 donors tested are negative. Of greater impact, however, is the fact that the ALT test and the anti-HBc test did not yield consistent results in 3 cases (donors for patients 8,9 and 10)

Table 17 Development of anti-HCV antibodies in patients receiving blood from donors who are believed to be NANBH carriers

patient Anti-HCV Serokon- Number of donations / Anti-HCV positive Surrogatabnormalität Anti-HB version in patients donor donor OLD No 1 Yes 18 ambiguous No Yes 2 Yes 18 Yes . NT No 3 Yes 13 Yes No - 4 No 18 No - Yes 5 Yes 16 Yes Yes No 6 Yes 11 Yes 2) No Yes Yes No 7 Yes 15 Yes NT Yes 8th Yes 20 Yes No No 9 Yes 5 Yes Yes Yes 10 Yes 15 Yes No

The same donor as anti-NANBH positive

IV.M. Amplification to clone KCV cDNA sequences by PCR and primers derived from conserved regions of Flavivlrus genome sequences

The results presented above, suggesting that the HCV is a flavivirus or a flaviartic virus, allow a strategy for cionating uncharacteristic HCV cDNA sequences by the PCR technique and with primers derived from the regions, which code for conserved amino acid sequences in the flaviviruses.

Generally, one of the primers is derived from a defined HCV genomic sequence and the other primer flanking a region of non-sequenced HCV polynucleotide is derived from a conserved region of the flavivirus genome. The flavivirus genomes are known to contain conserved sequences within the NS1 and E polypeptides encoded in the 5 'region of the flavivirus genome. The corresponding sequences encoding these regions are "upstream" of the HCV cDNA sequence, as shown in Figure 26. Thus, to isolate the cDNA sequences derived from this region of the HCV genome, "upstream" primers are designed. which are derived from the conserved sequences within you> flavivirus polypeptides. The "downstream" primers are derived from an upstream end of the known part of the HCV cDNA.

Because of the degeneracy of the code, it is possible that mismatches will occur between the flavivirus probes and the corresponding HCV genome sequence. Therefore, a strategy similar to that described by Lee (1988) is used. The Leesche method utilizes mixed oligonucleotide primers that are complementary to the products of the reverse translation of an amino acid sequence; the sequences in the mixed primers accommodate each codon generation of the conserved amino acid sequence. Three sets of primary blends based on the amino acid homologies present in several flaviviruses, including dengue 2,4 (D-2,4), Japan encephalitis virus (YEV), yellow fever (YF) and West Nile, have been created Virus (WN), were found. The primary mixture derived from the most .upstream "conserved sequences (5'-1) is based on the amino acid sequence Gly-Trp-Gly, which is part of the conserved sequence Asp-Arg-Gly-Trp-Tly-AspN, which is located in the The next primer mix (5'-2) is based on a downstream-conserved sequence in the Ε protein, Phe-Asp-Gly-Asp-Ser-Tyr-lleu -Phe-Gly-Asp-Ser-Tyr hay and is derived from Phe-Gly-Asp; the conserved sequence is present in D-2, JEV, YF and WN. The third primer mixture (5'-3) is based on the amino acid sequence Arg-Ser-Cys, which is part of the conserved sequence Cys-Cys-Arg-Ser-Cy in the NS1 protein of D-2, D-4, JEV, YF and WN is. The individual primers which form the mixture in 5'-3 are shown in FIG.

In addition to the different sequences derived from the conserved region, each primer in each mixture also contains a constant region at the 5 'end which contains a sequence coding for sites for the restriction enzymes, HindIII, Mbol and EcoRI.

The "downstream" primer, ssc5h20A, is derived from a nucleotide sequence in clone 5h containing HCV cDNA with sequences that overlap sequences in clones 14i and 11b

 The sequence of ssc5h is 20A

5 'GTA ATA TGG TGA CAG AGT CA 3'.

An alternative primer, ssc5 h34 A, can also be used. This primer is derived from a sequence in clone 5h and additionally contains nucleotides at the 5 'end which form a restriction enzyme site, thus enabling cionation. The sequence of ssc5h34A is

5 'GAT CTC TAG AGA AAT CAA ACT GGT GAC AGA GTC A3'.

The PCR reaction, first described by Saiki and coworkers (1986), is performed essentially as described by Lee and coworkers (1988), except that the template for the cDNA is RNA derived from HCV-infected chimpanzee liver isolated as described in Section IV.C.2. or derived from viral particles isolated from HCV-infected chimpanzee serum as described in Section IV.A.1. has been described. In addition, the, annealing "conditions are in the first round of Amplikation less severe (0.6 M NaCl and 25 ⁰ C), since the part of the primer which hybridizes to the HCV sequence is (anneal) only 9 nucleotides, and there to In addition, when ssc 5 h34 A is used, the extra sequences not derived from the HCV genome tend to destabilize the primer-template hybrid. After the first round of amplification, annealing Conditions be more stringent (0.066M NaCl and 32 ° C to 37 ⁰ C), since amplified sequences now contain regions that are complementary to the primers or their duplicates. In addition, the first 10 cycles of amplification with the Klenow enzyme I are carried out under the PCR conditions suitable for this enzyme. After completion of these cycles, the samples are extracted and treated with Taq polymerase according to the kit instructions provided by Cetus / Perkin-Elmer. After amplification, the amplified HCV cDNA sequences are detected by hybridization using a probe derived from clone 5 h '. This probe is derived from sequences that are "upstream" from those from which the primer was derived, and does not overlap the sequences of clone 5h-derived primers

5 'CCC AGC GGC GTA CGC CGC GGA CGC GGA GG CGC GTC GTG TGG CG TGT TGT TCT CGT CGG GTT GAT GGC GC 3

IV.N.1. Creation of a chimpanzee liver HCV cDNA library with infectious NANBH A chimpanzee liver HCV cDNA library was prepared from the HCV cDNA library in Section IV.A.1. had been created. The technique for creating the library was similar to that of section IV.A.24 except that a different RNA source and a primer based on the sequence of HCV cDNA in clone 11b was used. The sequence of the primer is

5 'CTG GC Γ TG A AGA ATC 3'.

IV.N.2. Isolation and nucleotide sequence of overlapping HCV cDNA In clone k9-1 to cDNA In clone 11b clone k9-1 was isolated from the HCV cDNA library created from the liver of a NANBH-infected chimpanzee as described in Section IV. A.25. has been described. The library was screened for clones that overlap the sequence in clone 11b using a clone that overlaps clone 11b at the 5 'terminus, clone 11e. The sequence of clone 11b is shown in FIG. Positive clones were isolated at a frequency of 1 in 500,000. An isolated clone, k £ M, was subjected to further study. The overlapping nature of the HCV cDNA in clone k9-1 to the 5 'end of the HCV cDNA sequence in Figure 26 was confirmed by probing the clone with clone Alex46, this latter clone containing a HCV cDNA sequence of 30 basepair pairs corresponding to the base pairs at the 5 'terminus of the HCV cDNA in clone 14 i as described above.

The nucleotide sequence of the HCV cDNA isolated from clone k9-i was determined by the techniques described above. The sequences of the HCV cDNA in clone k £ M, the overlap with the HCV cDNA in Figure 26 and the amino acids encoded therein are shown in Figure 46.

The HCV cDNA sequence in clone k9-1 was compared with those described in Section IV.A.19. clones aligned to create a nested HCV cDNA sequence, where the k9-1 sequence was placed "upstream" of the sequence shown in Figure 32. The assembled HCV cDNA encoding the k9-1 And the amino acids encoded therein is shown in FIG.

The sequence of the amino acids encoded in the 5 'region of the HCV cDNA shown in Figure 47 was compared with the corresponding region in one of the dengue virus strains described above with respect to the profile of the regions for hydrophobicity and Hydrophilicity compared. This comparison showed that the polypeptides encoded in this region from HCV and dengue virus, this region corresponding to the region encoding NS1 (or a part thereof), have a similar hydrophobic / hydrophilic profile.

The information provided below allows the identification of HCV strains. The isolation and characterization of lesser HCV strains can be accomplished by isolating the nucleic acids from body components containing viral particles by creating cDNA libraries using polynucleotide probes based on the HCV cDNA probes described below, by screening the libraries Clones holding the HCV cDNA sequences described below and comparing dnr HCV cDNAs from the new isolates with the cDNAs described below. The polypeptides encoded therein or in the viral genome can be monitored for immunological cross-reactivity by utilizing the polypeptides and antibodies described above. Strains that meet the parameters of HCV described in the Definitions section above are easily identifiable. Other methods of identifying HCV strains will be apparent to those skilled in the art based on the information provided herein.

Continuation of the description of the figures

Figure 46 shows the HCV cDNA sequence in clone k9-1, the segment that overlaps the cDNA in Figure 26 and the amino acids encoded therein. Fig. 47 shows the sequence in a composite cDNA derived by aligning clones k9-1 to 15e in the 5 'to 3' direction; it also shows the amino acids encoded in the continuous ORF.

Industrial application market

The invention presented herein in various disclosure 'η has many industrial applications, some of which are presented below. The HCV cDNAs can be used to design probes for detection of HCV nucleic acids in samples. The probes derived from the cDNAs can be used for the detection of HCV nucleic acids, for example in chemical syn iesereaktionen. They may also be used in anti-viral agent screening programs, to determine the effect of viral replication inhibition agents in cell culture systems and in animal model systems. The HCV polynucleotide probes are also useful in the detection of viral nucleic acids in humans and thus may serve as a basis for the diagnosis of HCV infections in humans.

In addition to the above, the cDNAs provided herein provide information and provide a means of synthesizing polypeptides containing HCV epitopes. These polypeptides are useful in the detection of antibodies to HCV antigens. Described herein is a series of immunoassays in HCV infections based on recombinant polypeptides containing HCV epitopes, commercial application in the diagnosis of HCV-induced NANBH, screening of blood donors for HCV-induced infectious hepatitis, and also when detecting contaminated blood from infectious blood donors, indenes. The viral antigens will also be useful in monitoring the efficacy of anti-viral agents in animal models. In addition, the polypeptides derived from the HCV cDNAs disclosed herein will be useful as vaccines for the treatment of HCV infections.

The polypeptides derived from the HCV cDNAs are also useful for developing anti-HCV antibodies, besides the uses mentioned above. They can therefore be used in anti-HCV vaccines. The antibodies generated as a result of immunization with the HCV polypeptides are also useful in detecting the presence of viral antigen in samples. They can thus be used to test the production of HCV polypeptides in chemical systems. The anti-HCV antibodies may also be used to monitor the efficacy of anti-viral agents in screening programs in which these agents are tested in tissue culture systems. Furthermore, they can also be used for passive immunotherapy and for the diagnosis of HCV-induced NANBH by detecting the virus antigen (s) both in the blood donor and in the recipient. Another important use of anti-HCV antibodies is in affinity chromatography for the purification of virus and viral polypeptides. The purified virus and viral polypeptide preparations can be used in vaccines. In addition, the purified virus may also be useful in the development of cell culture systems in which HCV replicates.

Cell culture systems containing HCV-infected cells can be used in a variety of ways. You can for a production of HCV, which is usually a low-titer virus, can be used on a relatively large scale. These systems are also included

be useful in elucidating the molecular biology of the virus and leading to the development of anti-viral agents. The

Cell culture systems will also be useful in screening for the efficacy of the antiviral agents. Besides, they are HCV-permissive cell culture systems are useful in the production of attenuated HCV strains. Conveniently, the anti-HCV antibodies and the HCV polypeptides, whether natural or recombinant, can be packaged in kits

become.

The method used to isolate HCV cDNA and the preparation of a cDNA library derived from the

derived from an infected individual, in an expression vector, and in the selection of clones that produce the expression products that immunologically react with antibody-containing body components of other infected individuals, but not those of uninfected individuals, may also be used isolation of cDNAs derived from others not characterized hereinbefore

Disease-accompanying agents consisting of a genomic component. This in turn could be used to isolate and characterize these agents as well as diagnostic reagents and vaccines

for these other disease-related agents.

Claims (7)

An immunoassay for the detection of an HCU antigen, characterized in that (a) a sample suspected of containing an HCU antigen is incubated with a probe antibody directed against the HCU antigen to be detected under conditions which inhibit the formation of an HCU antigen allow an antigen-antibody complex; and (b) an antigen-antibody complex containing the
Probe antibody is detected. 2. Immunoassay for the detection of antibodies directed against an HCU antigen, characterized in that (a) a sample, which presumably contains anti-HCU antibodies, with a
A special polypeptide containing an HCU apitope is incubated under conditions permitting the formation of an antibody-antigen complex; and (b) detecting the antibody-antigen complex containing the probe's antigens. 3. Immunoassay according to claim 2, characterized in that the probe polypeptide is attached to a solid substrate. 4. Immunoassay according to claim 2, characterized in that the probe polypeptide a
HCU epitope encoded in the HCU cDNA sequence of FIG. 47. 5. Immunoassay according to claim 2, characterized in that the probe polypeptide
HCU epitope included in an HCU cDNA sequence in ATCC no. 40394, ATCC No. 40388,
ATCC-No. 40389, ATCC no. 40390, ATCC no. 40391, ATCC no. 40514, ATCC no. 40511,
ATCC No. ^ OS ^ or ATCC No. ^ O oil. 6. Immunoassiiy according to claim 2, characterized in that the polypeptide is an epitope of
C100-3umfiißt. 7. Immunoassay according to claim 2, characterized in that the polypeptide comprises C100-3.