CZ32308U1 - A reaction mixture for normalization of RNA quantification in wheat and barley virus analysis - Google Patents

Description

Reaction mixture for normalization of RNA quantification in viral analysis in wheat and barley

Field of technology

The solution relates to a reaction mixture and a procedure for the simultaneous detection and quantification of RNA of three reference genes of barley and wheat in order to normalize the quantification of RNA for virome analysis using molecular detection and quantification of mRNA.

Prior art

Cereals are grown on an area of almost 1,600,000 hectares, which represents more than 60% of the total arable land area of the Czech Republic. Due to extensive cultivation and simple sowing procedures, cereals are attacked by many pathogens. Cereal virosis is one of the major diseases that can cause large yield losses. There is currently no effective protection against plant viral diseases. The most important cereal viruses in the Czech Republic include the Barley yellow dwarf virus (BYDV), the Wheat dwarf virus (WDV), the Wheat streak mosaic virus (WSMV).

Current diagnostic methods for plant viruses are based either on the detection of viral proteins by serological methods or on the molecular detection of viral nucleic acid. With erotic tests (ELISA test) it is possible to achieve semi-quantitative analysis, where the sample is diluted with an arithmetic series (1: 2, 1: 4, 1: 8, 1:16, etc.). However, this method is only able to compare the virus titer and not to determine it absolutely. Sensitivity limits are relatively limited with this method. Using this method, only one pathogen can be identified in each assay.

Nucleic acids of pathogens are most often determined by RT-PCR, in which RNA viruses are first transcribed into cDNA and then thawed using species-specific primers. With appropriate design of different lengths of PCR end products, several different pathogens can be detected simultaneously (Multiplex PCR), but usually the sensitivity of detection is reduced.

The TaqMan RT-qPCR method, based on the detection of viral nucleic acids using specific primers and probes in real time, is one of the most reliable quantification methods currently available. In RT-qPCR, the product is detected and measured after each cycle, allowing the product to be detected while quantifying the initial amount of template. TaqMan probes are double-stained hydrolysis probes carrying a reporter fluoroform at the 5 'end and a quencher molecule at the 3' end. There are several fluoro forums of different wavelengths that can be combined in one assay to effectively detect and quantify multiple pathogens simultaneously. For accurate quantification, it is necessary to normalize the obtained data using the so-called host reference genes (ie wheat and barley in this case).

Primers and probes have been developed for BYDV, WDV and WSMV to allow their simultaneous detection using TaqMan RT-qPCR. However, no method has been developed to normalize quantification using reference genes of wheat and barley in one reaction at a time.

The essence of the technical solution

The technical solution provides a reaction mixture for the detection and quantification of three reference genes of barley (α-tubulin gene - TUBA; β-tubulin gene - TUBB; glyceraldehyde-3-phosphate dehydrogenaseGAPDH;) and wheat (TUBA; TUBB; eukaryotic initiation factor 4a - EIF4A ) using RT-qPCR. The essence of the technical solution lies in the fact that at the same time, under the same conditions, three amplifications of the reaction will take place simultaneously, enabling the detection of all three viruses.

- 1 CZ 32308 Ul at once.

The reaction mixture contains 4 μΐ of test cDNA sample, TaqMan® RT-PCR mix, distilled water and specific primers and probes for detection of barley yellow dwarf virus. All primers and probes are at a final concentration of 0.16 μΜ. Specifically, these are the following primers and probes:

TUBB-R GTCGTTCATGTTGCTCTC

TUBB-F CCTTCTTGCACTGGTACA

TUBB-Taq FAM-CGGTGAACTCCATCTCGTCCA-BHQ1

TUBA-R GGC ACGCTTGGCGTACAT

TUBA-F CCAGCGTCGTCGAGGTCTTCTC

TUBA-Taq Cy5-CGCATCGACCACAAGTTTGACCT-BHQ2

Eif4a-R GGGAGGTCATAGTTGATG

Eif4a-F GGAGTTCAGATCAGGTTC

Eif4a-Taq HEX-CATCA AT ACC ACGAGC A AGC AGG-BHQ1

GapB-R CTGCTGTCACCAACGAAG

GapB-F TTGTTGATCTCACTGTTAGAACC

GapB-Taq HEX-ACATCAAGAAGGCTATCAAGGCTGCTTCC-BHQ1 cDNA is prepared from isolated plant RNA using random hexamers and reverse transcriptase according to the transcriptase manufacturer's protocol.

RT-PCR mixtures according to the technical solution are prepared in microtubes, capillaries or on a Real-time PCR plate, and each contains 4 μΐ cDNA of the test sample, TaqMan® PCR Master Mix, containing 0.25 μΐ DNA polymerase at a concentration of 5U / pl, 5 μΐ of a 2.5 mM mixture of oligonucleotides, 5 μΐ of a buffer containing MgCl 2 to a final concentration of 5.5 mM; distilled water, to which each reaction mixture is made up to a final volume of 25 μΐ and 0.4 μΐ of individual specific primers and probes for the detection and quantification of mRNA reference genes of wheat and barley with an initial concentration of 10 μΜ (specifically primers TUBA-R, TUBA-F, TUBB-R, TUBB-F, GapB-R and GapB-F and TUBA-Taq, TUBB-Taq and GapB-Taq probes for barley, and primers TUBA-R, TUBA-F, TUBB-R, TUBB-F, Eif4a -R and Eif4a-F and TUBA-Taq, TUBB-Taq and Eif4a-Taq probes for wheat).

TUBB mRNA amplification produces a 143 bp signal-producing product at 494-515 nm. GAPDH and EIF4a mRNA amplification produces 148 bp and 102 bp signal-producing products at 535 to 555 nm. Amplification of TUBA mRNA produces a 65 bp signal-producing product at 651 to 674 nm. All signals can be detected in one response at a time.

The actual qPCR takes place in a real-time thermocycler for the first 15 minutes at 95 ° C. This is followed by 40 cycles, each containing two steps: 15 seconds at 95 ° C and 1 minute at 60 ° C.

This technical solution enables the precise simultaneous normalization of the quantification of cereal viruses, in only one reaction. This method can achieve high savings in time and money. Such convincing results have not yet been achieved.

The following examples merely illustrate the reaction mixture according to the technical solution, without limiting it in any way.

Examples of technical solution

Evaluation of wheat responses to mixed BYDV, WDV and WSMV infections.

An experiment has been established at the research institution to investigate possible synergistic / antagonistic reactions between three commonly occurring cereal viruses. Experimental wheat plants are inoculated with all three

-2GB 32308 UI viruses at once. Leaf samples are taken from each plant at certain time intervals. Total RNA is isolated from the samples in the laboratory. From the total RNA is synthesized using reverse transcriptase and random hexamers cDNA.

Each sample is pipetted in triplicate twice - ie one triplicate for virus detection and quantification in one reaction (BYDV, WDV, WSMV) and one triplicate for wheat mRNA reference gene detection and quantification (TUBA, TUBB, EIF4a) - see scheme.

1 2 3 4 5 6 7 8 9 10 11 12 AND He took the virus Vz2 virus Vz3 virus Vz4 virus Vz5 vir Vz6 vir Vz7 virus Vz8 virus Vz9 vir VzlO vir Pos. Contr. Vortex Neg. Contr. Vortex B He took the virus Vz2 virus Vz3 virus Vz4 virus Vz5 vir Vz6 vir Vz7 virus Vz8 virus Vz9 vir VzlO vir Pos. Contr. Vortex Neg. Contr. Vortex C He took the virus Vz2 virus Vz3 virus Vz4 virus Vz5 vir Vz6 vir Vz7 virus Vz8 virus Vz9 vir VzlO vir Pos. Contr. Vortex Neg. Contr. Vortex D Vzl ref gen Vz2 ref gen Vz3 ref gen Vz4 ref gen Vz5 ref gen Vz6 ref gen Vz7 ref gen Vz8 ref gen Vz9 ref gen VzlO ref gen Pos. Contr. Ref gen Neg. Contr. Ref gen E Vzl ref gen Vz2 ref gen Vz3 ref gen Vz4 ref gen Vz5 ref gen Vz6 ref gen Vz7 ref gen Vz8 ref gen Vz9 ref gen VzlO ref gen Pos. Contr. Ref gen Neg. Contr. Ref gen F Vzl ref gen Vz2 ref gen Vz3 ref gen Vz4 ref gen Vz5 ref gen Vz6 ref gen Vz7 ref gen Vz8 ref gen Vz9 ref gen VzlO ref gen Pos. Contr. Ref gen Neg. Contr. Ref gen G H

Scheme of sample distribution on a 96-well Real-time PCR plate μΐ cDNAs are pipetted into a sterile Real-time PCR plate according to the sketch. Next, TaqMan® PCR Master Mix containing 0.25 μΐ of DNA polymerase at a concentration of 5U / μl, 5 μΐ of a mixture of oligonucleotides at a concentration of 2.5 mM, 5 μΐ of buffer containing MgCl 2 at a final concentration of 5.5 mM is added; 0.4 μΐ of individual primers and probes with a concentration of 10 μΜ. The volume of each reaction is made up to 25 μΐ with distilled water.

The actual RT-PCR takes place in the Real-time thermal cycler Lightcycler480 (Roche). The first part of the reaction proceeds for 10 minutes at 95 ° C. This was followed by 40 cycles, each comprising two steps: 15 seconds at 95 ° C and 1 minute at 60 ° C.

The resulting C _t values of the individual viruses in the samples were compared against the average C _t values of the mRNA values of the reference wheat genes. The titer of individual viruses was compared in individual groups.

-3GB 32308 UI

In this way, the material can be tested both at breeding stations and plants from field samples or laboratory isolates. As viral infection cannot be treated, the only protection against viral diseases in cereals is the use of resistant varieties or preventive measures to prevent the further spread of viruses, including early detection.

Industrial applicability

Reaction mixtures for the simultaneous detection and quantification of normalization genes for wheat and barley can be supplied to plant pathogen protection laboratories as a ready-to-use detection and quantification kit. The user then only needs to add his sample of the tested cDNA and perform the reaction according to precisely defined conditions.

Claims (1)

CLAIMS FOR PROTECTION A reaction mixture for the simultaneous detection and quantification of RNA of three reference barley and wheat genes by real-time polymerase chain reaction, characterized in that the reaction mixture contains 4 μΐ of a sample of the tested cDNA; TaqMan PCR Master Mix containing 0.25 μΐ 5 U / μΙ DNA polymerase, 5 μΐ 2.5 mM oligonucleotide mixture, 5 μΐ buffer containing 5.5 mM MgCl 2; 2.4 pL of specific primers with an initial concentration of 10μΜ for the detection of TUBA, TUBB and GAPDH for barley and TUBA, TUBB and EIF4a for wheat, namely 0.4 μΐ of TUBA-R primers with the sequence 5’-GGCACGCTTGGCGTACAT-3 ’, 0.4 μΐ of TUBA-F primers with sequence 5’-CCAGCGTCGTCGAGGTCTTCTC-3 ‘, 0.4 μΐ of TUBB-R primers with sequence 5’- GTCGTTCATGTTGCTCTC-3 ‘, 0.4 μΐ of TUBB-F primers with sequence 5’-CCTTCTTGCACTGGTACA-3 ’, 0.4 μΐ of GapB-R primers with the sequence 5’-CTGCTGTCACCAACGAAG-3 ’, 0.4 μΐ of GapB-F primers with the sequence 5’-TTGTTGATCTCACTGTTAGAACC-3 ’, 0.4 μΐ of EIF4a-R primers with sequence 5’-GGGAGGTCATAGTTGATG-3 ’, 0.4 μΐ of EIF4a-F primers with sequence 5’-GGAGTTCAGATCAGGTTC-3 ’; 1.2 μΐ of specific probes with an initial concentration of 10μΜ for the detection of TUBA, TUBB and GAPDH for barley and TUBA, TUBB and EIF4a for wheat, namely 0.4 μΐ of the TUBB-Taq probe with the sequence 5’-FAM-CGGTGAACTCCATCTCGTCCA-BHQ1-3 ’, 0.4 μΐ EIF4a-Taq probe with sequence 5’-HEX-CATCAATACCACGAGCAAGCAGG-BHQ1-3 ’, 0.4 μΐ GapB-Taq probe with sequence 5’-HEX-ACATCAAGAAGGCTATCAAGGCTGCTTCC-BHQ1-3’, 0.4 μΐ of the TUBA-Taq probe with the sequence 5’-Cy5-CGCATCGACCACAAGTTTGACCT-BHQ2-3 ’; and distilled water making up the reaction mixture to a final volume of 25 μΐ.