CZ284476B6 - Use of 2,4-diaminopyrimidine-3-oxide or some of its salts for treating disorders of ripening and structure formation of collagen - Google Patents

Abstract

PCT No. PCT/FR95/01197 Sec. 371 Date Jun. 9, 1997 Sec. 102(e) Date Jun. 9, 1997 PCT Filed Sep. 19, 1995 PCT Pub. No. WO96/09048 PCT Pub. Date Mar. 28, 1996The Use of 2,4-diamino pyrimidine 3-oxide or a physiologically acceptable salt thereof as the active substance for the preparation of a therapeutical composition is disclosed. Said therapeutical composition is useful for treating collagen maturation and structuring disorders.

Description

(57)

Use of 2,4-diaminopyrimidine-3-oxide or a physiologically acceptable salt thereof as an active ingredient for the preparation of a therapeutic composition. Said therapeutic composition is suitable for the treatment of disorders of maturation and structuring of collagen.

CZ 284 476 B6

Use of 2,4-diaminopyrimidine-3-oxide or one of its salts for the treatment of collagen maturation and structuring disorders

Technical field

The invention relates to the use as an active ingredient of 2,4-diaminopyrimidine-3-oxide or one of its salts for the preparation of a therapeutic composition suitable for pharmaceutical or veterinary application and intended for the treatment of disorders of maturation and structuring of calogen.

BACKGROUND OF THE INVENTION

Obtaining native procollagen bundles requires the hydroxylation of a number of propyl and lysyl residues of the pre-procollagen in a wrinkled endoplasmic reticulum and then glycosylation of the hydroxy-lysyl residues in the Golgi apparatus. This maturation of collagen has been the subject of many studies.

Thus, Minoxidil, having the chemical name 2,4-diamino-6-piperidinopyrimidine-3-oxide and already described and used for the treatment of certain hypertension and for the treatment of androgenic alopecia, has been the subject of numerous studies as a specific inhibitor of lysyl hydroxylase. applied when maturing collagen.

In this regard, studies by Murad et al. published in Arch. Of Biochem. Biophys., Vol. 292, No. 1, pp. 234-238 (1992) and Vol. 308, No. 1, pp. 42-47 (1994) to demonstrate that the inhibitory ability of lysyl hydroxylase is conditional on the presence of a tertiary amine group located in the para position relative to the N-oxide function of the 2,4-diaminopyrimidine nucleus, and that it is preferably a piperino group such as Minoxidil.

WO-92/01437 discloses 2,4-diaminopyrimidine-3-oxide as an active ingredient for the cosmetic treatment of hair loss using topical application.

It has now surprisingly and quite unexpectedly been found that 2,4-diaminopyrimidine-3-oxide or

2,4-DPO, as will be abbreviated hereinafter, although it does not contain the tertiary amine function at the para position relative to the N-oxide function of the 2,4-diaminopyrimidine core, nevertheless specifically inhibits lysyl hydroxylase.

SUMMARY OF THE INVENTION

The object of the invention is therefore:

- the use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition, preferably in a form suitable for topical, transdermal or intradermal administration and intended for the treatment of collagen maturation and structuring disorders ,

the use of a physiologically acceptable acid addition salt of 2,4-diaminopyrimidine-3-oxide selected from the group consisting of sulfuric acid, hydrochloric acid, phosphoric acid, acetic acid, benzoic acid, salicylic acid, glycolic acid, acetic acid, succinic acid, acid nicotinic acid, tartaric acid, maleic acid, methanesulfonic acid, picric acid and lactic acid, for the preparation of a pharmaceutically or veterinarily useful therapeutic composition for treating disorders of the maturation and structuring of collagen,

-1 CZ 284476 B6

- the use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition containing from 0.0001 to 5% by weight of 2,4-diaminopyrimidine-3-oxide or its physiologically acceptable salts, based on the total weight of the composition, for the treatment of collagen maturation and structuring disorders,

- the use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition containing from 0.01 to 2% by weight of 2,4-diaminopyrimidine-3-oxide or its physiologically acceptable salts, based on the total weight of the composition, for treating collagen maturation and structuring disorders.

Compared to Minoxidil, 2,4-DPO has no antihypertensive effect and is sufficiently harmless, although it has an inhibitory activity that is equal to that of Minoxidil lysylhydroxylase or that of Minoxidil exceeds that of Minoxidil.

In the following, the term 2,4-DPO will mean not only the 2,4-DPO itself but also some of its salts as defined below.

In the context of the invention, collagen maturation disorder is to be understood as any undesirable collagen accumulation, and in particular a disorder of the collagen matrix structure of skin or conjunctival tissue. These disorders may be of spontaneous, traumatic or postoperative origin. These disorders include, but are not limited to, vitreoretinopathy, systemic scleroderma, skin compacting caused by ultraviolet light, and thick scars.

Thus, the use of the 2,4-DPO of the invention will in particular enable the improved aesthetic relationship of the patient to be treated.

While the invention may be curative treatment, it is nevertheless advantageous to employ a preventive treatment, i.e., during a period of time during which the collagen is structured and thus accumulated, particularly during cicatrization.

The 2,4-DPO product can be used to prepare a therapeutic composition in a form suitable for topical, transdermal and intradermal administration.

Physiologically acceptable salts within the scope of the invention are acid addition salts such as sulfuric acid, hydrochloric acid, phosphoric acid, acetic acid, benzoic acid, salicylic acid, glycolic acid, succinic acid, nicotinic acid, tartaric acid, maleic acid. , methanesulfonic acid, picric acid and lactic acid.

Where the therapeutic composition is in a form intended for topical administration, then the amount

The 2,4-DPO is generally 0.0001 to 5% by weight, and preferably 0.01 to 2% by weight, based on the total weight of the therapeutic composition.

The carrier used may have a very different nature, but a physiologically acceptable environment suitable for topical administration, which is of course compatible with the active ingredient, is preferred.

The 2,4-DPO product in such an environment may be either dissolved or dispersed, especially in micronized form.

Said physiologically acceptable medium may be comprised of water or a mixture of water and solvent or a mixture of solvents. Among the solvents which can be used, in particular, lower

C1-C4 alcohols such as ethanol, isopropanol, tert-butanol, alkylene glycols, alkylene glycol alkyl ethers and dialkyl glycols such as ethylene glycol monoethyl ether, propylene glycol monomethyl ether and diethylene glycol monoethyl ether. These compositions for topical administration may also contain at least one conventional excipient or active ingredient.

In particular, UV.A and UV.B filters, such as methoxycinnamates and benzophenone derivatives, antioxidants and / or free radical-binding agents, such as DMSO, alphatocopherol, BHA, BHT, superoxide dismutase, hydrating agents such as urea, glycerin, lactic acid, hydroxy acid, thiamorpholine and derivatives thereof and pyrrolidone carboxylic acid derivatives, in particular its sodium and potassium salts, steroidal and non-steroidal anti-inflammatory agents such as hydrocortisone, beta-methasone, dexamethasone, acetylsaicylic acid, indomethacin, isoprofen, vitamin D as well as antibacterial agents such as those belonging to the group of macrolides, pyranosides and tetracyclines such as erythromycin.

These compositions may also contain preservatives, stabilizers, pH regulating agents, osmotic pressure modifiers, and emulsifying agents.

Said compositions intended for topical administration and being based on 2,4-DPO may take various forms and may thus take the form of, for example, lotions, gels, foams, vesicular dispersions, sprays or aerosols.

These compositions may also take the form of gelled or compacted compositions. Of the gelled compositions, in particular, reference may be made to essentially no-comp. 3 gelled heterobiopolysaccharides, such as xanthan gum, sclerogens or cellulose derivatives and in particular cellulose ethers, or hydroalcoholic compositions of gelatinised polyhydroxyethyl acrylates or methacrylates. Among the aqueous compacted compositions, in particular, compositions obtained using crosslinked polyacrylic acid, which is crosslinked with a polyfunctional agent such as a number of commercially available products known as Carbopol ^R (Goodrich), may be used. However, it is possible to use as a compacting agent any of the conventional agents used in pharmacy or dermopharmacy.

For topical administration, 2,4-DPO is generally applied to the body parts to be treated in an amount of 0.0001 to 5 mg / kg per day, preferably in an amount of 0.001 to 1 mg / kg per day. Treatment is generally continued for as long as the collagen accumulation occurs and may optionally be continued for 90 days after the collagen accumulation has ended.

It is also within the scope of the invention to use 2,4-DPO for the preparation of therapeutic compositions intended for transdermal administration.

The amount of 2,4-DPO in this case is generally 0.001 to 5%, and preferably 0.01 to 2%, based on the total weight of the composition.

The excipients used in these compositions are generally selected from copolymers or vinyl copolymers to which a penetration promoter has optionally been added.

In particular, the compositions intended for transdermal administration can be administered by means of a self-adhesive system adhering to the skin and guaranteeing for at least 24 hours a controlled amount of the active ingredient through the skin into the bloodstream.

Among these systems, in particular, those described in French patent application FR88.11685 (2.653.979), as well as those commercialized by Tilderm.

-3GB 284476 B6

The 2,4-DPO product can also be used for the preparation of therapeutic compositions intended for intradermal administration.

The amount of 2,4-DPO in this case is between 0.0001 and 5% by weight and preferably between 0.01 and 1% by weight, based on the total weight of the composition.

In this case, 2,4-DPO is dissolved in a physiologically acceptable vehicle such as saline.

In addition, compositions intended for intradermal administration may contain various therapeutic agents, such as antibacterial agents, antioxidants, and steroidal or non-steroidal anti-inflammatory agents.

The 2,4-DPO product is generally administered when administered intradermally in an amount of less than or equal to 5 mg / kg per day and preferably in an amount ranging between 0.0001 and 1 mg / kg per day. Such treatment is generally carried out for as long as the collagen accumulation occurs or can be continued for 30 days after the collagen accumulation has ended.

Although references have been made in the foregoing to compositions intended for pharmaceutical use, it is understood that such compositions may be formulated in a form more suitable for veterinary use, particularly for the treatment of the equine family, for example, for the treatment of horses.

Whatever the mode of administration or use of the composition, these compositions are prepared by known methods.

In the following, the results of studies demonstrating the efficacy of the 2,4-DPO product as well as examples of therapeutic compositions will be illustrated by way of illustration.

I) Study of lamb expression of RNAm encoding lysyl hydroxylase (LH)

Fibroplasmas from the fibroblast culture derived from the outer connective sheath of the human hair are inoculated after 5 inoculations at 2.10 ⁵ fibroblasts in 60 mm diameter Petri dishes containing Dulbecco-modified Eagle culture medium supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U / ml penicillin G, 100 g / ml streptomycin S, 250 mg / ml amphoterin and 10% fetal calf serum commercialized by Gibco BRL.

After cultivation for 24 hours at 37 ° C in an oven with an atmosphere of 95% air and 5% carbon dioxide, the culture medium is replaced with an analogous culture medium which does not contain fetal calf serum. The cells are then incubated at 37 ° C for 3 hours (Figure IA) or 18 hours (Figure 1B) in the presence of 5 mM Minixidil, 5 mM 2,4-DPO or 5 mM Minoxidil sulfate.

Thereafter, the total RNA of each cell preparation is extracted by the method described in the Short Protocols in Molecular Biology, Harvard Medical School, J. Willey and Sons Publischer, 1992, and the total RNA is quantitated using ultraviolet spectroscopy at 280 nm.

In order to allow analysis of RNAm expression, it is amplified by a chain polymerization reaction (PCR).

-4GB 284476 B6

Using 2 µg of total RNA obtained as described above for each cell preparation, in vitro complementary DNA was synthesized using a reverse transcription kit commercialized under the name First strand C-DNA Synthesis kit by Pharmacia LKB Biotechnology AB. An aliquot of the complementary DNA obtained is then amplified by PCR in the presence of specific initiators of lysyl hydroxylase (LH) and prolyl hydroxylase (PH):

LH mediator initiator: 5'GAAATGGGCCATGTGAGAGCG3 'LH antisense initiator: 5'TGTGGATGACAATAGTCGGCACG3' PH initiator mediator: 5'GTGGATGGAACAAGCCCTAAGGC3 'antisense initiator PH: 5'CTCCGGACCGCCC3GCGGCCAGGCACCC3GCGGCCCGGCCCGCCCC3GCGCCCC3GCGCCCC3

μ of the mixture obtained for PCR is applied to an electrophoretic gel containing 2% agarose in the presence of 0,5 µg / ml ethidium bromide and Tris-acetate-EDTA (TAE) 1x electrophoretic buffer.

After a one-hour migration in a 100 V electric field, the intensity of the bands corresponding to the RNAn coding for lysyl hydroxylase and resp. prolyl hydroxylase using a content analyzer and software commercialized under the name Bioprofil ^R by Société Vilbert Lourmat.

Using the same procedure described above, the relative expression level of RNAm encoding lysyl hydroxylase and prolyl hydroxylate after 3 hours and 18 hours of fibroplast culture without any processing was also determined.

The results obtained are shown in Figures IA and IB.

In the above study, incubation of fibroblasts for 3 hours in the presence of Minoxidil or Minoxidil sulfate reduced the relative expression level of RNAm encoding lysyl hydroxylase at 0.75.

After three hours of incubation in the presence of 2,4-DPO, the rate of relative expression of the RNA encoding lysyl hydroxylase is 0.55.

Thus, 2,4-DPO inhibits the expression of RNAm encoding lysyl hydroxylase to a greater extent than Minoxidil or its sulfate analog.

The same results were observed after 18 hours cultivation in the presence of various inhibitors tested.

After cultivation for 3 hours in the presence of Minoxidil or Minoxidil sulfate, the relative expression level of the RNAm encoding prolyl hydroxylase is increased to 1.25 and 1.25, respectively. 1.85.

After a 3 hour incubation in the presence of 2,4-DPO, the relative expression level of the RNAm encoding prolyl hydroxylase is also higher, thus being about 1.3.

After cultivation for 18 hours in the presence of Minoxidil, Minoxidil sulfate or 2,4-DPO, the relative expression rates of RNAm encoding prolyl hydroxylase are 1.6, 1.3, respectively. 1.15.

Thus, no inhibition of the level of relative expression of RNAm encoding prolyl hydroxylase in response to these three compounds was observed.

Thus, the test compounds exhibit specific lysyl hydroxylase inhibitory activity.

-5GB 284476 B6

II) Study of the efficacy of 2,4-DPO on the collagen network present in the extracellular matrix of fibroplasts

10 μΜ of 2,4-DPO is added to the primary culture of human breast-derived dermal fibroplasts in DMEM culture medium supplemented with 10% fetal calf serum.

After three days, the cells are lysed by hyposmotic shock and the collagen deposit is fixed with a 5% glutaraldehyde solution.

Thereafter, the extracellular matrix of fibroplasts is observed by means of an electron microscope with a dot-wipe image.

The extracellular matrix of untreated fibroplasts is also observed by means of a spot-scanning electron microscope.

The photographs obtained in this observation are shown in Figures 2 and 3.

As can be seen from the photographs in Figures 2 and 3, the extracellular matrix of untreated fibroplasts has coarse bundles surrounding large areas that are completely free of collagen network, while the extra20 cellular matrix of 2,4-DPO treated fibroplasts exhibits a much more regular structural organization of the bundles , in which no coarse clustering is practically observed, and in which the collagen-free surfaces are much smaller.

Thus, application of the 2,4-DPO product to a fibroplastic culture causes a spatial reorganization of the 25 microth network of collagen fibers.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Dermal cream

A dermal cream is prepared by mixing the following ingredients:

2,4-DPO 0,5g

Ceteareth 30 7g

Glyceryl stearate 2g

Cetyl alcohol 1,5g

Polydimethylsiloxane 1.5g

Paraffin oil15 g

Glycerin, Pharmacopoeial purity20 g

Preservatives, sufficient

Demineralized water, make up to 100 g.

-6GB 284476 B6

Example 2

Dermal spray lotin

The dermal spray lotin is prepared by mixing the following ingredients:

2,4-DPO

Ethanol

Demineralized water, make up to

0.25 g g

100 g.

g g ·

Example 3

Injectable solution

An injectable solution for intradermal administration is prepared by mixing the following components:

2,4-DPO

Saline (9 g NaCl / H ₂ O make up to 100 ml)

Claims (4)

Use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition, preferably in a form useful for topical, transdermal or intradermal administration and intended for the treatment of collagen maturation and structuring disorders . Use of a physiologically acceptable acid addition salt of 2,4-diaminopyrimidine-3-oxide selected from the group consisting of sulfuric acid, hydrochloric acid, phosphoric acid, acetic acid, benzoic acid, salicylic acid, glycolic acid, acetic acid, succinic acid, nicotinic acid, tartaric acid, maleic acid, methanesulfonic acid, picric acid and lactic acid, for the preparation of a pharmaceutically or veterinarily useful therapeutic composition intended for the treatment of disorders of maturation and structuring of collagen. 3. Use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition containing from 0.0001 to 5% by weight of 2,4-diaminopyrimidine-3-oxide or its physiologically acceptable salts, based on the total weight of the composition, for the treatment of maturation and structuring of collagen. Use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily useful therapeutic composition containing from 0.01 to 2% by weight of 2,4-diaminopyrimidine-3-oxide or physiologically acceptable salts thereof acceptable salts, based on the total weight of the composition, for treating disorders of the maturation and structuring of collagen.