CZ284476B6 - Use of 2,4-diaminopyrimidine-3-oxide or some of its salts for treating disorders of ripening and structure formation of collagen - Google Patents
Use of 2,4-diaminopyrimidine-3-oxide or some of its salts for treating disorders of ripening and structure formation of collagen Download PDFInfo
- Publication number
- CZ284476B6 CZ284476B6 CZ97842A CZ84297A CZ284476B6 CZ 284476 B6 CZ284476 B6 CZ 284476B6 CZ 97842 A CZ97842 A CZ 97842A CZ 84297 A CZ84297 A CZ 84297A CZ 284476 B6 CZ284476 B6 CZ 284476B6
- Authority
- CZ
- Czechia
- Prior art keywords
- acid
- oxide
- diaminopyrimidine
- collagen
- physiologically acceptable
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/14—Drugs for dermatological disorders for baldness or alopecia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
Landscapes
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Dermatology (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Materials For Medical Uses (AREA)
- Cosmetics (AREA)
- Peptides Or Proteins (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
Description
(57) Anotace:(57)
Použití 2,4-diaminopyrimidin-3-oxidu nebo jeho fyziologicky přijatelné soli Jako účinné látky pro přípravu terapeutické kompozice. Uvedená terapeutická kompozice je vhodná pro léčení poruch zrání a strukturace kolagenu.Use of 2,4-diaminopyrimidine-3-oxide or a physiologically acceptable salt thereof as an active ingredient for the preparation of a therapeutic composition. Said therapeutic composition is suitable for the treatment of disorders of maturation and structuring of collagen.
CZ 284 476 B6CZ 284 476 B6
Použití 2,4-diaminopyrimidin-3-oxidu nebo některé z jeho solí pro léčení poruch zrání a strukturace kolagenuUse of 2,4-diaminopyrimidine-3-oxide or one of its salts for the treatment of collagen maturation and structuring disorders
Oblast technikyTechnical field
Vynález se týká použití ve funkci účinné látky 2,4-diaminopyrimidin-3-oxidu nebo některé z jeho solí pro přípravu terapeutické kompozice vhodné pro farmaceutickou nebo veterinární aplikaci a určené pro léčení poruch zrání a strukturace kalogenu.The invention relates to the use as an active ingredient of 2,4-diaminopyrimidine-3-oxide or one of its salts for the preparation of a therapeutic composition suitable for pharmaceutical or veterinary application and intended for the treatment of disorders of maturation and structuring of calogen.
Dosavadní stav technikyBACKGROUND OF THE INVENTION
Získání svazků nativního prokolagenu vyžaduje hydroxylaci určitého počtu prolylových a lysylových zbytků préprokolagenu ve vrásčitém endoplasmickém retikulu a potom glykosylaci hydroxy-lysylových zbytků v Golgiho aparatuře. Toto zrání kolagenu bylo předmětem mnoha studií.Obtaining native procollagen bundles requires the hydroxylation of a number of propyl and lysyl residues of the pre-procollagen in a wrinkled endoplasmic reticulum and then glycosylation of the hydroxy-lysyl residues in the Golgi apparatus. This maturation of collagen has been the subject of many studies.
Takto byl produkt Minoxidil, mající chemický název 2,4-diamino-6-piperidinopyrimidin-3oxid a již popsaný a použitý pro léčení některých hypertenzí a pro léčení androgenní alopecie, předmětem četných studií jako specifický inhibitor lysyl-hydroxylázy, což je enzym, který se uplatňuje při zrání kolagenu.Thus, Minoxidil, having the chemical name 2,4-diamino-6-piperidinopyrimidine-3-oxide and already described and used for the treatment of certain hypertension and for the treatment of androgenic alopecia, has been the subject of numerous studies as a specific inhibitor of lysyl hydroxylase. applied when maturing collagen.
V tomto ohledu umožnily studie Murad-a a kol. publikované v Arch. Of Biochem. Biophys., sv. 292, č. 1, str. 234-238 (1992) a sv. 308, č. 1, str. 42-47 (1994) prokázat, že inhibiční schopnost lysyl-hydroxylázy je podmíněna přítomnosti terciární aminové skupiny nacházející se v poloze para vzhledem kN-oxidové funkci 2,4-diaminopyrimidinového jádra, a že výhodně je touto skupinou piperinová skupina, jako je tomu v případě produktu Minoxidil.In this regard, studies by Murad et al. published in Arch. Of Biochem. Biophys., Vol. 292, No. 1, pp. 234-238 (1992) and Vol. 308, No. 1, pp. 42-47 (1994) to demonstrate that the inhibitory ability of lysyl hydroxylase is conditional on the presence of a tertiary amine group located in the para position relative to the N-oxide function of the 2,4-diaminopyrimidine nucleus, and that it is preferably a piperino group such as Minoxidil.
Z dokumentu WO-92/01437 je znám 2,4-diaminopyrimidin-3-oxid jako účinná látka určená pro kosmetické léčení vypadávání vlasů za použití topické aplikace.WO-92/01437 discloses 2,4-diaminopyrimidine-3-oxide as an active ingredient for the cosmetic treatment of hair loss using topical application.
Nyní bylo s překvapením a zcela neočekávaně zjištěno, že 2,4-diaminopyrimidin-3-oxid neboIt has now surprisingly and quite unexpectedly been found that 2,4-diaminopyrimidine-3-oxide or
2,4-DPO, jak bude dále zkráceně nazýván, ačkoliv neobsahuje terciární aminovou funkci v poloze para vzhledem k N-oxidové funkci 2,4-diaminopyrimidinového jádra, přesto specificky inhibuje lysyl-hydroxylázu.2,4-DPO, as will be abbreviated hereinafter, although it does not contain the tertiary amine function at the para position relative to the N-oxide function of the 2,4-diaminopyrimidine core, nevertheless specifically inhibits lysyl hydroxylase.
Podstata vynálezuSUMMARY OF THE INVENTION
Předmětem vynálezu je proto:The object of the invention is therefore:
- použití 2,4-diaminopyrimidin-3-oxidu nebo některé z jeho fyziologicky přijatelných solí jako účinné látky pro přípravu farmaceuticky nebo veterinárně použitelné terapeutické kompozice, mající výhodně formu použitelnou pro topické, transdermální nebo intradermální podání a určené pro léčení poruch zrání a strukturace kolagenu,- the use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition, preferably in a form suitable for topical, transdermal or intradermal administration and intended for the treatment of collagen maturation and structuring disorders ,
- použití fyziologicky přijatelné adiční soli 2,4-diaminopyrimidin-3-oxidu s kyselinou zvolenou z množiny, zahrnující kyselinu sírovou, kyselinu chlorovodíkovou, kyselinu fosforečnou, kyselinu octovou, kyselinu benzoovou, kyselinu salicylovou, kyselinu glykolovou, kyselinu aceturovou, kyselinu jantarovou, kyselinu nikotinovou, kyselinu vinnou, kyselinu maleinovou, kyselinu methansulfonovou, kyselinu pikrovou a kyselinu mléčnou, pro přípravu farmaceuticky nebo veterinárně použitelné terapeutické kompozice určené pro léčení poruch zrání a strukturace kolagenu,the use of a physiologically acceptable acid addition salt of 2,4-diaminopyrimidine-3-oxide selected from the group consisting of sulfuric acid, hydrochloric acid, phosphoric acid, acetic acid, benzoic acid, salicylic acid, glycolic acid, acetic acid, succinic acid, acid nicotinic acid, tartaric acid, maleic acid, methanesulfonic acid, picric acid and lactic acid, for the preparation of a pharmaceutically or veterinarily useful therapeutic composition for treating disorders of the maturation and structuring of collagen,
-1 CZ 284476 B6-1 CZ 284476 B6
- použití 2,4-diaminopyrimidin-3-oxidu nebo některé z jeho fyziologicky přijatelných solí jako účinné látky pro přípravu farmaceuticky nebo veterinárně použitelné terapeutické kompozice, obsahující 0,0001 až 5 hmotnostních % 2,4-diaminopyrimidin-3-oxidu nebo jeho fyziologicky přijatelné soli, vztaženo na celkovou hmotnost kompozice, a určené pro léčení poruch zrání a strukturace kolagenu,- the use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition containing from 0.0001 to 5% by weight of 2,4-diaminopyrimidine-3-oxide or its physiologically acceptable salts, based on the total weight of the composition, for the treatment of collagen maturation and structuring disorders,
- použití 2,4-diaminopyrimidin-3-oxidu nebo některé z jeho fyziologicky přijatelných solí jako účinné látky pro přípravu farmaceuticky nebo veterinárně použitelné terapeutické kompozice, obsahující 0,01 až 2 hmotnostní % 2,4-diaminopyrimidin-3-oxidu nebo jeho fyziologicky přijatelné soli, vztaženo na celkovou hmotnost kompozice, a určené pro léčení poruch zrání a strukturace kolagenu.- the use of 2,4-diaminopyrimidine-3-oxide or one of its physiologically acceptable salts as an active ingredient for the preparation of a pharmaceutically or veterinarily usable therapeutic composition containing from 0.01 to 2% by weight of 2,4-diaminopyrimidine-3-oxide or its physiologically acceptable salts, based on the total weight of the composition, for treating collagen maturation and structuring disorders.
Oproti produktu Minoxidil nevykazuje 2,4-DPO žádný antihypertenzní účinek a je dostatečně neškodný, i když má inhibiční účinnost, která se vyrovná inhibiční účinnosti vůči lysylhydroxyláze produktu Minoxidil nebo inhibiční účinnost Minoxidilu ještě předčí.Compared to Minoxidil, 2,4-DPO has no antihypertensive effect and is sufficiently harmless, although it has an inhibitory activity that is equal to that of Minoxidil lysylhydroxylase or that of Minoxidil exceeds that of Minoxidil.
V následujícím textu výraz 2,4-DPO bude znamenat nejen samotný 2,4-DPO ale také některé z jeho dále definovaných solí.In the following, the term 2,4-DPO will mean not only the 2,4-DPO itself but also some of its salts as defined below.
Poruchou zrání kolagenu je třeba v rámci vynálezu rozumět jakoukoliv nežádoucí akumulaci kolagenu a zejména poruchy struktury kolagenní matrice kožní tkáně nebo tkáně oční spojivky. Tyto poruchy mohou být spontánního, úrazového nebo pooperačního původu. Z těchto poruch lze zejména uvést vitreoretinopatie, systemické sklerodermie, zhutnění kůže způsobené ultrafialovým světlem a zbytnělé jizvy.In the context of the invention, collagen maturation disorder is to be understood as any undesirable collagen accumulation, and in particular a disorder of the collagen matrix structure of skin or conjunctival tissue. These disorders may be of spontaneous, traumatic or postoperative origin. These disorders include, but are not limited to, vitreoretinopathy, systemic scleroderma, skin compacting caused by ultraviolet light, and thick scars.
Použití 2,4-DPO podle vynálezu tedy zejména umožní dosažení zlepšeného estetického vztahu léčeného pacienta.Thus, the use of the 2,4-DPO of the invention will in particular enable the improved aesthetic relationship of the patient to be treated.
I když se podle vynálezu může jednat o kurativní léčení, je nicméně výhodné využít preventivního způsobu léčby, tj. v průběhu časové periody, během které dochází ke strukturaci a tudíž akumulaci kolagenu, k čemuž dochází zejména v průběhu cikatrizace.While the invention may be curative treatment, it is nevertheless advantageous to employ a preventive treatment, i.e., during a period of time during which the collagen is structured and thus accumulated, particularly during cicatrization.
Produkt 2,4-DPO může být použit pro přípravu terapeutické kompozice, která má formu vhodnou pro topické, transdermální a intradermální podání.The 2,4-DPO product can be used to prepare a therapeutic composition in a form suitable for topical, transdermal and intradermal administration.
Pod pojmem fyziologicky přijatelné soli je třeba v rámci vynálezu rozumět adiční soli s kyselinami, jakými jsou kyselina sírová, kyselina chlorovodíková, kyselina fosforečná, kyselina octová, kyselina benzoová, kyselina salicylová, kyselina glykolová, kyselina jantarová, kyselina nikotinová, kyselina vinná, kyselina maleinová, kyselina methansulfonová, kyselina pikrová a kyselina mléčná.Physiologically acceptable salts within the scope of the invention are acid addition salts such as sulfuric acid, hydrochloric acid, phosphoric acid, acetic acid, benzoic acid, salicylic acid, glycolic acid, succinic acid, nicotinic acid, tartaric acid, maleic acid. , methanesulfonic acid, picric acid and lactic acid.
V případě, že terapeutická kompozice má formu určenou pro topické podání, potom množstvíWhere the therapeutic composition is in a form intended for topical administration, then the amount
2,4-DPO činí obecně 0,0001 až 5 % hmotnosti a výhodně 0,01 až 2 % hmotnosti, vztaženo na celkovou hmotnost terapeutické kompozice.The 2,4-DPO is generally 0.0001 to 5% by weight, and preferably 0.01 to 2% by weight, based on the total weight of the therapeutic composition.
Použitý nosič může mít velmi odlišný charakter, avšak výhodné je fyziologicky přijatelné prostředí vhodné pro topické podání, které je samozřejmě kompatibilní s účinnou látkou.The carrier used may have a very different nature, but a physiologically acceptable environment suitable for topical administration, which is of course compatible with the active ingredient, is preferred.
Produkt 2,4-DPO se v takovém prostředí může nacházet buď v rozpuštěném stavu, nebo v dispergovaném stavu, a to zejména v mikronizované formě.The 2,4-DPO product in such an environment may be either dissolved or dispersed, especially in micronized form.
Uvedené fyziologicky přijatelné prostředí může být tvořenou vodou nebo směsí vody a rozpouštědla nebo směsí rozpouštědel. Z použitelných rozpouštědel lze zejména uvést nižšíSaid physiologically acceptable medium may be comprised of water or a mixture of water and solvent or a mixture of solvents. Among the solvents which can be used, in particular, lower
-2CZ 284476 B6 alkoholy obsahující 1 až 4 uhlíkové atomy, jako například ethanol, isopropanol, terč, butanol, alkylenglykoly, alkylenglykolalkylethery a dialkylglykoly, jakými jsou například ethylenglykolmonoethylether, propylenglykolmonomethylether a diethylenglykolmonoethylether. Tyto kompozice určené pro topické podání mohou také obsahovat alespoň jednu konvenční přísadu nebo účinnou látku.C1-C4 alcohols such as ethanol, isopropanol, tert-butanol, alkylene glycols, alkylene glycol alkyl ethers and dialkyl glycols such as ethylene glycol monoethyl ether, propylene glycol monomethyl ether and diethylene glycol monoethyl ether. These compositions for topical administration may also contain at least one conventional excipient or active ingredient.
Z těchto látek lze zejména uvést filtry UV.A a UV.B, jako methoxycinnamáty a deriváty benzofenonu, antioxidační činidla nebo/a činidla vázající volné radikály, jako DMSO, alfatokoferol, BHA, BHT, superoxid-dismutáza, hydratační činidla, jako močovina, glycerin, kyselina mléčná, hydroxykyselina, thiamorfolin a jeho deriváty a deriváty kyseliny pyrrolidonkarboxylové, zejména její sodné a draselné soli, steroidní a nesteroidní protizánětová činidla, jako hydrokortison, beta-methason, dexamethason, kyselina acetylsaicylová, indomethacin, isoprofen, vitamin D nebo kyselina niflumová, jakož i antibakteriální činidla, jakými jsou činidla patřící do skupiny makrolidů, pyranosidů a tetracyklinů, jako erythromycin.In particular, UV.A and UV.B filters, such as methoxycinnamates and benzophenone derivatives, antioxidants and / or free radical-binding agents, such as DMSO, alphatocopherol, BHA, BHT, superoxide dismutase, hydrating agents such as urea, glycerin, lactic acid, hydroxy acid, thiamorpholine and derivatives thereof and pyrrolidone carboxylic acid derivatives, in particular its sodium and potassium salts, steroidal and non-steroidal anti-inflammatory agents such as hydrocortisone, beta-methasone, dexamethasone, acetylsaicylic acid, indomethacin, isoprofen, vitamin D as well as antibacterial agents such as those belonging to the group of macrolides, pyranosides and tetracyclines such as erythromycin.
Tyto kompozice mohou rovněž obsahovat konzervační činidla, stabilizátory, činidla regulující pH, modifikátory osmotického tlaku a emulgační činidla.These compositions may also contain preservatives, stabilizers, pH regulating agents, osmotic pressure modifiers, and emulsifying agents.
Uvedené kompozice určené pro topické podání a jsoucí na bázi 2,4-DPO, mohou mít rozličné formy a mohou mít takto například formu lotionů, gelů, pěn, vesikulámích disperzí, sprejů nebo aerosolů.Said compositions intended for topical administration and being based on 2,4-DPO may take various forms and may thus take the form of, for example, lotions, gels, foams, vesicular dispersions, sprays or aerosols.
Tyto kompozice mohou mít rovněž formu zgelovatělých nebo zhutnělých kompozic. Ze zgelovatělých kompozic lze zejména citovat v podstatě ve Né kompc. 3 zgelovatělé heterobiopolysacharidy, jakými jsou xantanová guma, sklerog' y nebo deriváty' celulózy a zejména ethery celulózy, nebo hydroalkoholické kompozice zgeiovatě'é polyhydroxyethylakryláty nebo methakryláty. Z vodných zhutněných kompozic lze zejména m. t kompozice získané zejména pomocí zesíťované kyseliny polyakrylové, která je zesíťována polyfunkčním činidlem, jakým je řada komerčně dostupných produktů známých pod označením CarbopolR (Goodrich). Je nicméně možné použít jako zhutňovadlo libovolné zhutňovací činidlo běžně používané ve farmacii nebo v dermofarmacii.These compositions may also take the form of gelled or compacted compositions. Of the gelled compositions, in particular, reference may be made to essentially no-comp. 3 gelled heterobiopolysaccharides, such as xanthan gum, sclerogens or cellulose derivatives and in particular cellulose ethers, or hydroalcoholic compositions of gelatinised polyhydroxyethyl acrylates or methacrylates. Among the aqueous compacted compositions, in particular, compositions obtained using crosslinked polyacrylic acid, which is crosslinked with a polyfunctional agent such as a number of commercially available products known as Carbopol R (Goodrich), may be used. However, it is possible to use as a compacting agent any of the conventional agents used in pharmacy or dermopharmacy.
Při topickém podání se 2,4-DPO obecně aplikuje na části těla, které mají být léčeny, v množství od 0,0001 do 5 mg/kg a den, výhodně v množství od 0,001 do 1 mg/kg a den. V léčení se obecně pokračuje po celou dobu, v průběhu které dochází k akumulaci kolagenu, přičemž v něm může být případně pokračováno ještě po dobu 90 dnů po ukončení akumulace kolagenu.For topical administration, 2,4-DPO is generally applied to the body parts to be treated in an amount of 0.0001 to 5 mg / kg per day, preferably in an amount of 0.001 to 1 mg / kg per day. Treatment is generally continued for as long as the collagen accumulation occurs and may optionally be continued for 90 days after the collagen accumulation has ended.
V rámci vynálezu je rovněž možné použít 2,4-DPO pro přípravu terapeutických kompozic určených pro transdermální podání.It is also within the scope of the invention to use 2,4-DPO for the preparation of therapeutic compositions intended for transdermal administration.
Množství 2,4-DPO v tomto případě obecně činí 0,001 až 5% a výhodně činí 0,01 až 2%, vztažené na celkovou hmotnost kompozice.The amount of 2,4-DPO in this case is generally 0.001 to 5%, and preferably 0.01 to 2%, based on the total weight of the composition.
Pomocné farmaceutické látky použité v rámci těchto kompozic jsou obecně zvoleny z množiny zahrnující kopolymery nebo vinylové kopolymery, ke kterým byl případně přidán penetrační promotor.The excipients used in these compositions are generally selected from copolymers or vinyl copolymers to which a penetration promoter has optionally been added.
Kompozice určené pro transdermální aplikaci mohou být zejména podávány pomocí samolepicího systému lpícího ke kůži a zaručujícího po dobu alespoň 24 hodin průchod regulovaného množství účinné látky skrze pokožku do krevního oběhu.In particular, the compositions intended for transdermal administration can be administered by means of a self-adhesive system adhering to the skin and guaranteeing for at least 24 hours a controlled amount of the active ingredient through the skin into the bloodstream.
Z těchto systému lze zejména uvést systémy popsané ve francouzské patentové přihlášce FR88.11685 (2.653.979), jakož i systémy komercializované firmou Tilderm.Among these systems, in particular, those described in French patent application FR88.11685 (2.653.979), as well as those commercialized by Tilderm.
-3CZ 284476 B6-3GB 284476 B6
Produkt 2,4-DPO může být rovněž použit pro přípravu terapeutických kompozic určených pro intradermální podání.The 2,4-DPO product can also be used for the preparation of therapeutic compositions intended for intradermal administration.
Množství 2,4-DPO se v tomto případě pohybuje mezi 0,0001 a 5 % hmotnosti a výhodně mezi 0,01 a 1 % hmotnosti, vztaženo na celkovou hmotnost kompozice.The amount of 2,4-DPO in this case is between 0.0001 and 5% by weight and preferably between 0.01 and 1% by weight, based on the total weight of the composition.
V tomto případě se 2,4-DPO nachází v rozpuštěné formě ve fyziologicky přijatelném vehikulu, jakým je fyziologický roztok.In this case, 2,4-DPO is dissolved in a physiologically acceptable vehicle such as saline.
Kompozice určené pro intradermální podání mohou navíc obsahovat různá terapeutická činidla, jakými jsou například antibakteriální činidla, antioxidační činidla a steroidní nebo nesteroidní protizánětová činidla.In addition, compositions intended for intradermal administration may contain various therapeutic agents, such as antibacterial agents, antioxidants, and steroidal or non-steroidal anti-inflammatory agents.
Produkt 2,4-DPO se obecně podává při intradermální aplikaci v množství nižším nebo rovné 5 mg/kg a den a výhodně v množství pohybujícím se mezi 0,0001 a 1 mg/kg a den. Takové léčení se obecně provádí po celou dobu, v průběhu které dochází k akumulaci kolagenu nebo v něm může být pokračováno ještě po dobu 30 dnů po ukončení akumulace kolagenu.The 2,4-DPO product is generally administered when administered intradermally in an amount of less than or equal to 5 mg / kg per day and preferably in an amount ranging between 0.0001 and 1 mg / kg per day. Such treatment is generally carried out for as long as the collagen accumulation occurs or can be continued for 30 days after the collagen accumulation has ended.
Ačkoliv byly v přecházejícím textu činěny odkazy vztahující se ke kompozicím určeným pro farmaceutické použití, je samozřejmé, že tyto kompozice mohou být formulovány do formy, která je vhodnější při veterinárním použití, a to zejména pro léčení čeledi koňovitých, například pro léčení koňů.Although references have been made in the foregoing to compositions intended for pharmaceutical use, it is understood that such compositions may be formulated in a form more suitable for veterinary use, particularly for the treatment of the equine family, for example, for the treatment of horses.
Ať je způsob podání nebo použití kompozice jakýkoliv, tyto kompozice se připravují známými postupy.Whatever the mode of administration or use of the composition, these compositions are prepared by known methods.
V následující části popisu budou pro ilustraci uvedeny výsledky studií dokládajících účinnost produktu 2,4-DPO, jakož i příklady terapeutických kompozic.In the following, the results of studies demonstrating the efficacy of the 2,4-DPO product as well as examples of therapeutic compositions will be illustrated by way of illustration.
I) Studium ihnibice exprese RNAm kódující lysyl-hydroxylázu (LH)I) Study of lamb expression of RNAm encoding lysyl hydroxylase (LH)
Fibroplasmy z fíbroplastové kultury pocházející z vnějšího pojivového pláště lidského vlasu se po pěti přeočkování zaočkují v množství 2.105 fíbroplastů do Petriho misek o průměru 60 mm, které obsahují kultivační prostředí typu Eagle modifikované systémem Dulbecco a doplněné 2 mM L-glutaminu, lmM pyruvátu sodného, 100jedn./ml penicilinu G, 100gg/ml streptomycinu S, 250 mg/ml amfoterinu a 10 % fetálního telecího séra komercializovaného společností Gibco BRL.Fibroplasmas from the fibroblast culture derived from the outer connective sheath of the human hair are inoculated after 5 inoculations at 2.10 5 fibroblasts in 60 mm diameter Petri dishes containing Dulbecco-modified Eagle culture medium supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U / ml penicillin G, 100 g / ml streptomycin S, 250 mg / ml amphoterin and 10% fetal calf serum commercialized by Gibco BRL.
Po 24 hodinové kultivaci při teplotě 37 °C v sušárně s atmosférou tvořenou 95 % vzduchu a 5 % oxidu uhličitého se kultivační prostředí nahradí analogickým kultivačním prostředím, které však neobsahuje fetální telecí sérum. Buňky se potom inkubují při teplotě 37 °C po dobu 3 hodin (obr. IA) nebo po dobu 18 hodin (obr. 1B) v přítomnosti 5 mM Minixidilu, 5 mM 2,4-DPO nebo 5 mM sulfátu Minoxidilu.After cultivation for 24 hours at 37 ° C in an oven with an atmosphere of 95% air and 5% carbon dioxide, the culture medium is replaced with an analogous culture medium which does not contain fetal calf serum. The cells are then incubated at 37 ° C for 3 hours (Figure IA) or 18 hours (Figure 1B) in the presence of 5 mM Minixidil, 5 mM 2,4-DPO or 5 mM Minoxidil sulfate.
Potom se metodou popsanou v Short protocoles in molecular biologiy, Harvard medical school J. Willey and sons publischer, 1992, extrahuje celková RNA každého z buněčných preparátů, načež se tato celková RNA kvantitativně stanoví za použití spektroskopie v ultrafialovém světle s vlnovou délkou 280 nm.Thereafter, the total RNA of each cell preparation is extracted by the method described in the Short Protocols in Molecular Biology, Harvard Medical School, J. Willey and Sons Publischer, 1992, and the total RNA is quantitated using ultraviolet spectroscopy at 280 nm.
Za účelem umožnění analýzy exprese RNAm se provede její amplifikace řetězovou polymerační reakcí (PCR).In order to allow analysis of RNAm expression, it is amplified by a chain polymerization reaction (PCR).
-4CZ 284476 B6-4GB 284476 B6
Za použití 2 pg celkové RNA získané výše uvedeným způsobem pro každý buněčný preparát se syntetizuje in vitro komplementární DNA pomocí soupravy pro reverzní transkripci komercializované pod označením First strand C-DNA Synthesis kit společností Pharmacia LKB Biotechnology AB. Alikvotní frakce získané komplementární DNA se potom amplifikuje metodou PCR v přítomnosti specifických iniciátorů lysyl-hydroxylázy (LH) a prolyl-hydroxylázy (PH):Using 2 µg of total RNA obtained as described above for each cell preparation, in vitro complementary DNA was synthesized using a reverse transcription kit commercialized under the name First strand C-DNA Synthesis kit by Pharmacia LKB Biotechnology AB. An aliquot of the complementary DNA obtained is then amplified by PCR in the presence of specific initiators of lysyl hydroxylase (LH) and prolyl hydroxylase (PH):
mediátorový iniciátor LH: 5'GAAATGGGCCATGTGAGAGCG3' antimediátorový iniciátor LH: 5'TGTGGATGACAATAGTCGGCACG3' mediátorový iniciátor PH: 5'GTGGATGGAACAAGCCCTAAGGC3' antimediátorový iniciátor PH: 5'CCTCCCCACGGCACAGCATTTCG3' pro finální objem 50 μΐ.LH mediator initiator: 5'GAAATGGGCCATGTGAGAGCG3 'LH antisense initiator: 5'TGTGGATGACAATAGTCGGCACG3' PH initiator mediator: 5'GTGGATGGAACAAGCCCTAAGGC3 'antisense initiator PH: 5'CTCCGGACCGCCC3GCGGCCAGGCACCC3GCGGCCCGGCCCGCCCC3GCGCCCC3GCGCCCC3
μ směsi získané pro PCR se zavede na elektroforetický gel s obsahem 2 % agarózy v přítomnosti 0,5 pg/ml ethidiumbromidu a elektroforetického pufru Tris-acetát-EDTA (TAE) lx.μ of the mixture obtained for PCR is applied to an electrophoretic gel containing 2% agarose in the presence of 0,5 µg / ml ethidium bromide and Tris-acetate-EDTA (TAE) 1x electrophoretic buffer.
Po jednohodinové migraci ve 100 V elektrickém poli se analyzuje a kvantitativně stanoví intenzita pásů odpovídajících RNAn kódující lysyl-hydroxylázu resp. prolyl-hydroxylázu za použití obsahového analyzátoru a software komercionalizovaného pod označením BioprofilR společnosti Société Vilbert Lourmat.After a one-hour migration in a 100 V electric field, the intensity of the bands corresponding to the RNAn coding for lysyl hydroxylase and resp. prolyl hydroxylase using a content analyzer and software commercialized under the name Bioprofil R by Société Vilbert Lourmat.
Za použití stejného pracovního postupu, jaký byl popsán výše, se rovněž stanoví míra relativní exprese RNAm kódující lysyl-hydroxylázu a prolyl-hydroxylátu po 3 hodinách a 18 hodinách kultivace fibroplastů bez jakéhokoliv zpracování.Using the same procedure described above, the relative expression level of RNAm encoding lysyl hydroxylase and prolyl hydroxylate after 3 hours and 18 hours of fibroplast culture without any processing was also determined.
Získané výsledky jsou uvedeny v obr. IA a IB.The results obtained are shown in Figures IA and IB.
Při výše uvedené studiu bylo zjištěno, že inkubace fibroplastů po dobu 3 hodin v přítomnosti Minoxidilu nebo Minoxidil-sulfátu sníží míru relativní exprese RNAm kódující lysylhydroxylázu, přičemž tato míra činí 0,75.In the above study, incubation of fibroblasts for 3 hours in the presence of Minoxidil or Minoxidil sulfate reduced the relative expression level of RNAm encoding lysyl hydroxylase at 0.75.
Po třech hodinách inkubace v přítomnosti 2,4-DPO činí míra relativní exprese RNA kódující lysyl-hydroxylázu 0,55.After three hours of incubation in the presence of 2,4-DPO, the rate of relative expression of the RNA encoding lysyl hydroxylase is 0.55.
Produkt 2,4-DPO tedy inhibuje expresi RNAm kódující lysyl-hydroxylázu vyšší měrou, než tomu je v případě Minoxidilu nebo jeho sulfátového analogu.Thus, 2,4-DPO inhibits the expression of RNAm encoding lysyl hydroxylase to a greater extent than Minoxidil or its sulfate analog.
Stejné výsledky byly pozorovány po 18 hodinové kultivaci v přítomnosti různých testovaných inhibitorů.The same results were observed after 18 hours cultivation in the presence of various inhibitors tested.
Po 3 hodinové kultivaci v přítomnosti Minoxidilu nebo Minoxidil-sulfátu se míra relativní exprese RNAm kódující prolyl-hydroxylázu zvýší a dosahuje hodnot 1,25 resp. 1,85.After cultivation for 3 hours in the presence of Minoxidil or Minoxidil sulfate, the relative expression level of the RNAm encoding prolyl hydroxylase is increased to 1.25 and 1.25, respectively. 1.85.
Po 3 hodinové inkubaci v přítomnosti 2,4-DPO je míra relativní exprese RNAm kódující prolylhydroxylázu rovněž vyšší a činí takto asi 1,3.After a 3 hour incubation in the presence of 2,4-DPO, the relative expression level of the RNAm encoding prolyl hydroxylase is also higher, thus being about 1.3.
Po 18 hodinové kultivaci v přítomnosti Minoxidilu, Minoxidil-sulfátu nebo 2,4-DPO činí míry relativní exprese RNAm kódující prolyl-hydroxylázu 1,6, 1,3 resp. 1,15.After cultivation for 18 hours in the presence of Minoxidil, Minoxidil sulfate or 2,4-DPO, the relative expression rates of RNAm encoding prolyl hydroxylase are 1.6, 1.3, respectively. 1.15.
Nebyla tedy pozorována inhibice míry relativní exprese RNAm kódující prolyl-hydroxylázu v odezvu na tyto tři sloučeniny.Thus, no inhibition of the level of relative expression of RNAm encoding prolyl hydroxylase in response to these three compounds was observed.
Testované sloučeniny tedy vykazují specifickou inhibiční aktivitu lysyl-hydroxylázu.Thus, the test compounds exhibit specific lysyl hydroxylase inhibitory activity.
-5CZ 284476 B6-5GB 284476 B6
II) Studie účinnosti 2,4-DPO na kolagenovou síť přítomnou v extracelulámí matrici fibroplastůII) Study of the efficacy of 2,4-DPO on the collagen network present in the extracellular matrix of fibroplasts
K primární kultuře lidských dermálních fibroplastů pocházejících z prsní plasie v kultivačním 5 prostředí DMEM doplněné 10 % fetálního telecího séra se přidá 10 μΜ produktu 2,4-DPO.10 μΜ of 2,4-DPO is added to the primary culture of human breast-derived dermal fibroplasts in DMEM culture medium supplemented with 10% fetal calf serum.
Po třech dnech se provede lyže buněk hyposmotickým šokem a depozit kolagenu se fixuje 5% roztokem glutaraldehydu.After three days, the cells are lysed by hyposmotic shock and the collagen deposit is fixed with a 5% glutaraldehyde solution.
Potom se extracelulámí matrice fibroplastů pozoruje pomocí elektronového mikroskopu s bodovým ohmatáváním obrazu.Thereafter, the extracellular matrix of fibroplasts is observed by means of an electron microscope with a dot-wipe image.
Pomocí elektronového mikroskopu s bodovým ohmatáváním obrazu se rovněž pozoruje extracelámí matrice neošetřených fibroplastů.The extracellular matrix of untreated fibroplasts is also observed by means of a spot-scanning electron microscope.
Fotografie získané při tomto pozorování jsou zobrazeny na obr. 2 a obr. 3.The photographs obtained in this observation are shown in Figures 2 and 3.
Jak je to zřejmé z fotografií na obr. 2 a obr. 3, má extracelulámí matrice neošetřených fibroplastů hrubé svazky obklopující velké plochy, které jsou zcela prosté kolagenové sítě, zatímco extra20 celulámí matrice fibroplastů ošetřených 2,4-DPO vykazuje mnohem pravidelnější strukturní organizaci svazků, ve které nelze prakticky pozorovat žádná hrubá seskupení svazků, a ve které jsou plochy prosté kolagenové sítě mnohem menší.As can be seen from the photographs in Figures 2 and 3, the extracellular matrix of untreated fibroplasts has coarse bundles surrounding large areas that are completely free of collagen network, while the extra20 cellular matrix of 2,4-DPO treated fibroplasts exhibits a much more regular structural organization of the bundles , in which no coarse clustering is practically observed, and in which the collagen-free surfaces are much smaller.
Aplikace produktu 2,4-DPO na kulturu fibroplastů tedy způsobí prostorovou reorganizaci 25 mikrosítě vláken kolagenu.Thus, application of the 2,4-DPO product to a fibroplastic culture causes a spatial reorganization of the 25 microth network of collagen fibers.
Příklady provedení vynálezuDETAILED DESCRIPTION OF THE INVENTION
Příklad 1Example 1
Dermální krémDermal cream
Dermální krém se připraví smísením následujících složek:A dermal cream is prepared by mixing the following ingredients:
2,4-DPO 0,5g2,4-DPO 0,5g
Ceteareth 30 7gCeteareth 30 7g
Glycerylstearát 2gGlyceryl stearate 2g
Cetylalkohol 1,5gCetyl alcohol 1,5g
Polydimethylsiloxan 1,5gPolydimethylsiloxane 1.5g
Parafinový olej15 gParaffin oil15 g
Glycerin, lékopisná čistota20 gGlycerin, Pharmacopoeial purity20 g
Konzervační činidla, dostatečné množstvíPreservatives, sufficient
Demineralizovaná voda, doplnit do 100 g.Demineralized water, make up to 100 g.
-6CZ 284476 B6-6GB 284476 B6
Příklad 2Example 2
Dermální sprejový lotinDermal spray lotin
Dermální sprejový lotin se připraví smísením následujících složek:The dermal spray lotin is prepared by mixing the following ingredients:
2,4-DPO2,4-DPO
EthanolEthanol
Demineralizovaná voda, doplnit doDemineralized water, make up to
0,25 g g0.25 g g
100 g.100 g.
g g·g g ·
Příklad 3Example 3
Injikovatelný roztokInjectable solution
Injikovatelný roztok pro intradermální podání se připraví smísením následujících složek:An injectable solution for intradermal administration is prepared by mixing the following components:
2,4-DPO2,4-DPO
Fyziologický roztok (9 gNaCl/H2O dopl. do 100 ml) doplnit doSaline (9 g NaCl / H 2 O make up to 100 ml)
Claims (4)
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR9411133A FR2724561B1 (en) | 1994-09-19 | 1994-09-19 | USE OF 2,4-DIAMINO PYRIMIDINE 3-OXIDE OR ONE OF ITS SALTS IN THE TREATMENT OF MATURATION AND STRUCTURING DISORDERS OF COLLAGEN |
PCT/FR1995/001197 WO1996009048A1 (en) | 1994-09-19 | 1995-09-19 | Use of 2,4-diamino pyrimidine 3-oxide or a salt thereof for treating collagen maturation and structuring disorders |
Publications (2)
Publication Number | Publication Date |
---|---|
CZ84297A3 CZ84297A3 (en) | 1997-08-13 |
CZ284476B6 true CZ284476B6 (en) | 1998-12-16 |
Family
ID=9467049
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CZ97842A CZ284476B6 (en) | 1994-09-19 | 1995-09-19 | Use of 2,4-diaminopyrimidine-3-oxide or some of its salts for treating disorders of ripening and structure formation of collagen |
Country Status (22)
Country | Link |
---|---|
US (1) | US5846552A (en) |
EP (1) | EP0783307B1 (en) |
JP (1) | JP2945482B2 (en) |
KR (1) | KR100250939B1 (en) |
CN (1) | CN1070702C (en) |
AT (1) | ATE213414T1 (en) |
AU (1) | AU691336B2 (en) |
BR (1) | BR9508841A (en) |
CA (1) | CA2199995C (en) |
CZ (1) | CZ284476B6 (en) |
DE (1) | DE69525539T2 (en) |
DK (1) | DK0783307T3 (en) |
ES (1) | ES2171550T3 (en) |
FI (1) | FI971127A (en) |
FR (1) | FR2724561B1 (en) |
HU (1) | HU223143B1 (en) |
MX (1) | MX9701996A (en) |
NO (1) | NO311784B1 (en) |
PL (1) | PL186385B1 (en) |
PT (1) | PT783307E (en) |
RU (1) | RU2153874C2 (en) |
WO (1) | WO1996009048A1 (en) |
Families Citing this family (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0875781B1 (en) * | 1997-04-30 | 2005-08-17 | JSR Corporation | Liquid crystal alignment layer, production method for the same, and liquid crystal display device comprising the same |
US7763587B2 (en) | 2002-06-13 | 2010-07-27 | L'oreal S.A. | Derivative of glucose and of vitamin F, compositions comprising it, uses and preparation process |
US7326717B2 (en) * | 2003-05-06 | 2008-02-05 | L'oreal | Pyrimidine n-oxide compounds for stimulating the growth of keratin fibers and/or reducing loss thereof |
FR2871688B1 (en) | 2004-06-16 | 2008-05-16 | Oreal | METHOD FOR PROMOTING THE PENETRATION OF AN ACTIVE INGREDIENT AND COMPOSITION FOR ITS IMPLEMENTATION |
US7300649B2 (en) | 2005-02-11 | 2007-11-27 | Genepharm, Inc. | Cosmetic and cosmeceutical compositions for restoration of skin barrier function |
FR2902324B1 (en) * | 2006-06-20 | 2009-04-03 | Oreal | USE OF ELLAGIC ACID FOR THE TREATMENT OF CANITIA |
EP1897533A1 (en) * | 2006-09-08 | 2008-03-12 | Revotar Biopharmaceuticals AG | Use of 1,6-Bis [3-(3-carboxymethylphenyl)-4-(2-alpha -D-mannopyranosyl-oxy)-phenyl] hexane for the preparation of cosmetic compositions |
EP1946756A1 (en) * | 2007-01-17 | 2008-07-23 | Revotar Biopharmaceuticals AG | Use of entacapone in cosmetic, dermatological and pharmaceutical compositions |
EP2149368B1 (en) | 2008-07-29 | 2018-05-30 | L'Oréal | Cosmetic and dermatological use of probiotic Lactobacillus paracasei microorganisms for the treatment of greasy scalp disorders |
FR2951938B1 (en) | 2009-10-30 | 2012-01-06 | Oreal | USE OF A PUNICA GRANATUM EXTRACT TO COMBAT CANITIS |
CN104398418A (en) * | 2014-11-06 | 2015-03-11 | 陈爱华 | Hair-loss-resistant hair conditioner |
FR3130153A1 (en) | 2021-12-15 | 2023-06-16 | L'oreal | Use of at least one pyrimidine 3-oxide derivative to reinforce the barrier function of the skin |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0049902A3 (en) * | 1980-10-15 | 1982-09-01 | Teijin Limited | Novel thiazolo(3,2-a)pyrimidines, derivatives thereof, processes for production thereof, and pharmaceutical use thereof |
FR2644460A1 (en) * | 1989-03-16 | 1990-09-21 | Oreal | RETINOIC ESTERS OF D-DESOSAMINE, PROCESS FOR THEIR PREPARATION AND THEIR USE IN HUMAN OR VETERINARY MEDICINE AND IN COSMETICS |
LU87766A1 (en) * | 1990-07-20 | 1992-03-11 | Oreal | USE OF PYRIMIDINE 3-OXIDE DERIVATIVES FOR BRAKING HAIR LOSS AND TOPICAL COMPOSITIONS IMPLEMENTED |
EP0548883A1 (en) * | 1991-12-24 | 1993-06-30 | Hoechst Aktiengesellschaft | Substituted pyridine-N-oxides, process for their preparation and their use as medicines |
-
1994
- 1994-09-19 FR FR9411133A patent/FR2724561B1/en not_active Expired - Fee Related
-
1995
- 1995-09-19 PT PT95931260T patent/PT783307E/en unknown
- 1995-09-19 CA CA002199995A patent/CA2199995C/en not_active Expired - Fee Related
- 1995-09-19 RU RU97106336/14A patent/RU2153874C2/en not_active IP Right Cessation
- 1995-09-19 CZ CZ97842A patent/CZ284476B6/en not_active IP Right Cessation
- 1995-09-19 AU AU34765/95A patent/AU691336B2/en not_active Ceased
- 1995-09-19 HU HU9701236A patent/HU223143B1/en not_active IP Right Cessation
- 1995-09-19 DK DK95931260T patent/DK0783307T3/en active
- 1995-09-19 BR BR9508841A patent/BR9508841A/en not_active Application Discontinuation
- 1995-09-19 ES ES95931260T patent/ES2171550T3/en not_active Expired - Lifetime
- 1995-09-19 WO PCT/FR1995/001197 patent/WO1996009048A1/en active IP Right Grant
- 1995-09-19 MX MX9701996A patent/MX9701996A/en not_active IP Right Cessation
- 1995-09-19 JP JP8510645A patent/JP2945482B2/en not_active Expired - Fee Related
- 1995-09-19 CN CN95195438A patent/CN1070702C/en not_active Expired - Fee Related
- 1995-09-19 US US08/809,950 patent/US5846552A/en not_active Expired - Fee Related
- 1995-09-19 KR KR1019970701754A patent/KR100250939B1/en not_active IP Right Cessation
- 1995-09-19 DE DE69525539T patent/DE69525539T2/en not_active Expired - Lifetime
- 1995-09-19 EP EP95931260A patent/EP0783307B1/en not_active Expired - Lifetime
- 1995-09-19 AT AT95931260T patent/ATE213414T1/en not_active IP Right Cessation
- 1995-09-19 PL PL95319279A patent/PL186385B1/en not_active IP Right Cessation
-
1997
- 1997-03-14 NO NO19971182A patent/NO311784B1/en unknown
- 1997-03-18 FI FI971127A patent/FI971127A/en unknown
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP4801150B2 (en) | Reduction of hair growth | |
US10105444B2 (en) | Compositions and methods for treating diseases of the nail | |
EP2853274B1 (en) | Compositions and methods for treating diseases of the nail | |
Faergemann et al. | Double-blind, parallel-group comparison of terbinafine and griseofulvin in the treatment of toenail onychomycosis | |
EP2498783B1 (en) | Compositions and methods for stimulating hair growth | |
AU776167B2 (en) | Reduction of hair growth | |
CZ284476B6 (en) | Use of 2,4-diaminopyrimidine-3-oxide or some of its salts for treating disorders of ripening and structure formation of collagen | |
CA2222698C (en) | Use of bradykinin antagonists for stimulating or inducing hair growth and/or arresting hair loss | |
JP4359140B2 (en) | Formulation for removing abnormal keratinous substances | |
LU86969A1 (en) | COMBINATION OF PYRIMIDINE DERIVATIVES AND RETINOIDS IN SEPARATE COMPONENTS TO INDUCE AND STIMULATE HAIR GROWTH AND DECREASE | |
JPH11199450A (en) | Trichogenous suppressant | |
EP1401379B1 (en) | Reduction of hair growth | |
JP2693535B2 (en) | Topical scalp comprising a combination of a pyrimidine derivative and a nonsteroidal anti-inflammatory drug | |
JPH07116012B2 (en) | Cosmetic composition | |
JPH0460568B2 (en) | ||
WO2005013955A2 (en) | Topical composition comprising terbinafine and hydrocortisone | |
JPWO2020111047A1 (en) | Scalp Hair Composition | |
HU187612B (en) | Process for producing antimycotic gel-compositions with quick dissolution of active agents | |
JP2001502317A (en) | New carrier system | |
WO2022065415A1 (en) | Hair growth agent | |
KR20220161172A (en) | Composition for senomorphics or preventing skin aging | |
KR102611504B1 (en) | Composition for promoting the hair growth comprising kirenol | |
JP3624318B2 (en) | Hair nourishing agent | |
JP2004250380A (en) | Hair growth inhibitor | |
JPH08157321A (en) | Cosmetic |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
IF00 | In force as of 2000-06-30 in czech republic | ||
MM4A | Patent lapsed due to non-payment of fee |
Effective date: 20080919 |