CZ20012294A3 - Sulfonamide hydroxamates - Google Patents

Abstract

This invention relates to sulfonamide derivatives of formula (Ia) (in which R is -CH(R<2>)Ar<1> or -CH(R<2>)CH=CHAr<1>, and the other variables are as defined in the claims) that are inhibitors of procollagen C-proteinase, pharmacological compositions containing them, their use, intermediates and methods for preparing these compounds.

Description

Sulfonamide hydroxamates

Technical field

The present invention relates to certain sulfonamide derivatives that inhibit procollagen C-proteinase, to pharmaceutical compositions containing them, to their use, and to methods and intermediates for preparing these compounds.

BACKGROUND OF THE INVENTION

Collagens are integral components of connective tissues.

Currently, nineteen types of collagens have been identified. Interstitial collagen types I, II and III are the major collagen components of tissues. These collagens are synthesized as procollagen precursor molecules having amino- and carboxyl-terminal peptide extensions, also known as proregions. These pro-regions are typically cleaved to secrete a procollagen molecule to yield a mature collagen molecule capable of binding to highly structured collagen fibers {{see, for example, Fessler and Fessler, Annu. Roar. Biochem.

47, 129 (1978); Kivirikko et al., Extracellular Matrix

Biochemistry (1984) and Kuhn, Structure and Function of Collagen

Types ívvd. Mavene, R and Burgeson, R. E.)

Academie Press.

Inu., Orlando, Florida, sir.

1-42

). It is well known that excess collagen coatings are associated with fibrotic diseases such as interstitial pulmonary fibrosis, pericentral fibrosis, Symmers fibrosis, perimuscular fibrosis, renal fibrosis, endocardial sclerosis, hepatitis, acute respiratory stress syndrome, arthritis, cystic fibrosis, cystic fibrosis corneal scarring, surgical adhesion, scleroderma, chronic allograft rejection, hemodialysis shunt fibrosis, liver fibrosis and restenosis. These diseases are characterized by an excess of coatings of fibrillar interstitial collagens that are resistant to proteolytic degradation, leading to symptoms of fibrosis. Therefore, inhibition of collagen coatings will be useful in the treatment of these diseases.

Recent studies show that C-proteinase is a basic enzyme that catalyzes the cleavage of C-propeptide of collagen types I, II and III and is therefore helpful in the formation of functional collagen fibers (see Fertala et al. J. Biol. Chem. 269, 11584, (1994)). It is therefore desirable to provide procollagen C-proteinase inhibitors and thereby provide a means for treating diseases mediated by overcoating of these collagens. The compounds of the invention meet these and related needs.

SUMMARY OF THE INVENTION

In one aspect, the present invention provides sulfonamide derivatives selected from the group of compounds represented by Formula Ia:

n (ia)

R ¹ is alkyl, haloalkyl, heteroalkyl, cycloalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocyclylalkyl, cycloalkylalkyl,

- (alkylene) -C (O) -X (wherein X is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, amino, monosubstituted amino, disubstituted amino, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy, cycloalkoxy, cycloalkylalkoxy , heteroalkyloxy, aralkyloxy, or heteroaralkyloxy), or

-C (= NR ') NHSO 2 R (wherein R' is hydrogen or alkyl, and R is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, or heterocyclylalkyl);

R is -CH (R ² ) Ar ^x or -CH (R ² ) CH = CHAr ¹ , wherein R ² is hydrogen or alkyl; and Ar ¹ is aryl or heteroaryl;

Ar ² is either:

(i) a phenyl ring of the general formula

R ^J and R are, independently, hydrogen, alkyl, alkylthio, or halogen;

R 1 and R ¹ 'are, independently of each other, hydrogen, alkyl, or halogen;

R 10 is alkyl, haloalkyl, heterocyclyl, alkylthio, arylthio, aralkylthio, heteroarylthio, heteroaralkylthio, cycloalkylthio, cycloalkylalkylthio, alkoxy, aryloxy, aralkoxy, heteroaryloxy, heteroaralkyloxy, cycloalkoxy, cycloalkylalkoxy, hydroxyloxy, carboxy, carboxy amino, moalkylamino, dialkylamino, and 1. kylsulfonyl, arylsulfonyl, heteroarylsulfonyl, heteroaralkylsulfonyl, cycloalkylsulfonyl, cycloalkylalkylsulfonyl, or -Y- (alkylene) -C (O) -Z [wherein Y is a bond, -NR ¹ -, -O- or -S (0) _n - (wherein n is 0 to 2), ^{R is} hydrogen or alkyl, and Z is alkoxy, hydroxy, amino, monosubstituted amino, or disubstituted amino]; or

R together with R ^; they form -O- (CR ^H R ^U ) _; wherein n is 2 or 3 and each and F are, independently of each other, hydrogen or alkyl; or the carbon atoms to which they are attached R and ^R! are fused to C2-C3 carbons of the benzofuran ring;

provided at least two

R ³ , Po, R ⁶ and R ⁷ are not simultaneously hydrogen atoms; or (ii) a naphthyl ring of formula (b):

(b) where:

^Lu R is hydrogen, alkyl, alkoxy, or halogen; and

R ¹¹ is hydrogen, alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl provided that both R ¹⁰ and R ¹¹ are not simultaneously hydrogen atoms; and pharmaceutically acceptable salts, prodrugs, individual isomers, and mixtures of isomers thereof.

Definition

Unless otherwise specified, the following terms used in the specification and claims have the meanings indicated:

"Alkyl" means a linear saturated monovalent hydrocarbon group containing one to six carbon atoms or a branched saturated monovalent hydrocarbon group containing three to six carbon atoms, e.g., methyl, ethyl, n-propyl, 2-propyl, tert-butyl, pentyl, and the like.

"Alkenyl means a linear saturated divalent hydrocarbon group containing one to six carbon atoms or a branched saturated divalent hydrocarbon group containing three to six carbon atoms, eg, methylene, ethylene, propylene, 2-methylpropylene, pentylene, and the like.

"Alkenyl" means a linear monovalent hydrocarbon group containing two to six carbon atoms or a branched saturated monovalent hydrocarbon group containing three to six carbon atoms containing at least one double bond, eg, ethenyl, propenyl, and the like.

"Halogen" means fluorine, chlorine, bromine, or iodine, preferably fluorine and chlorine.

"Haloalkyl" means alkyl substituted with one or more identical or different halogen atoms, eg, -CH ₂ Cl, -CF ₃ , -CH ₂ CF ₃ , -CH ₂ Cl ₃ , and the like.

"Cycloalkyl" means a saturated monovalent cyclic hydrocarbon group containing three to seven ring carbon atoms. The cycloalkyl may be optionally substituted with one, two or three substituents selected from alkyl, haloalkyl, halo, nitro, cyano, optionally substituted phenyl, optionally substituted heteroaralkyl, -OR (where R is hydrogen, alkyl or haloalkyl), -NRR '(where R is and R 'are independently hydrogen or alkyl) or -C (O) R (wherein R is hydrogen, alkyl or optionally substituted phenyl). More specifically, the term cycloalkyl includes, for example, cyclopropyl, cyclohexyl, 1,2-dihydroxycyclopropyl, and the like.

"Monosubstituted amino means an -NHR radical wherein R is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, hydroxyalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocyclyl, or heterocyclylalkyl, e.g., methylamino, ethylamino, phenylamino, benzylamino, dibenzylamino, etc.

"Disubstituted amino means a -NRR ¹ radical wherein R and R ¹ are, independently of each other, alkyl, haloalkyl, cyanalkyl, cycloalkyl, cycloalkylalkyl, hydroxyalkyl, aryl, aralkyl, aralkenyl, hetoaryl, heteroaralkyl, heteroaralkyl, heterocyclyl, or heterocyclylalkyl, or R and R ¹ together with the nitrogen atom to which they are attached form a heterocyclyl ring. Exemplary examples include, but are not limited to, dimethylamino, methylethylamino, di (1-methylethyl) amino, piperazinyl, and the like.

"Monoalkylamino means an -NHR radical wherein R is alkyl ·, e.g., methylamino, ethylamino, and the like.

"Dialkylamino means a radical -NRR ', where R or R' are independently alkyl. Exemplary examples include, but are not limited to, dimethylamino, methylethylamino, di (1-methylethyl) amino, and the like.

"Aryl" means a monovalent or bicyclic aromatic hydrocarbon group containing 6 to 10 ring atoms, which is independently substituted with one or more substituents, preferably one, two or three substituents selected from alkyl, haloalkyl, thioalkyl, heteroalkyl, halogen, nitro, cyano, optionally substituted phenyl, heteroaryl, heterocyclyl, hydroxy, alkoxy, haloalkoxy, optionally substituted phenyloxy, heteroaryloxy, methylenedioxy, ethylenedioxy, -COR (where R is alkyl or optionally substituted phenyl), - (alkylene) .- COOR (where n is 0 or 1 and R is hydrogen, alkyl, optionally substituted phenylalkyl or heteroaralkyl), -NR'R ^r (where R ¹ and R ^c are independently of each other, hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, hydroxyalkyl, optionally substituted phenyl or heteroaryl), -NR COR ¹ (where R ' ¹ is hydrogen or alkyl and R ^k is hydrogen, alkyl, haloalkyl, or optionally substituted phenyl),

-S (O) _r , R [where n is an integer from 0 to 2 a

R is hydrogen (provided that n is 0), alkyl, cycloalkyl, cycloalkylalkyl, heteroalkyl, optionally substituted phenyl, γ- ί η 2 η n A 1 '

1 -., -. 4 -, -.-.-. - -. , 1 1

I1C1JU 1LC LC 1 UG.1 V 1 J /

(wherein R and R ^r are, independently, hydrogen, alkyl, hydroxyalkyl, or optionally substituted phenyl, or R ¹ and R ^b together with the nitrogen atom to which they are attached form a heterocyclic ring), -NRSChR '(where R is hydrogen or alkyl and R is alkyl, cycloalkyl, cycloalkylalkyl, heteroalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, or heteroaryl), -NRSONR'R (where R is hydrogen or alkyl and R'a R are, independently of one another, hydrogen, alkyl or hydroxyalkyl, or P 'and P "together with the nitrogen atom to which they are attached form a heterocyclic ring), or - (alkylene) _{r 1} -CONR ^and R ^b (where n is 0 or

1, and Ra and ^Rb are, each independently, hydrogen or alkyl, ^or R ^d and R ^fc, together with the nitrogen atom to which they are attached form a heterocyclic ring). More specifically, the term aryl includes, but is not limited to, phenyl, 1-naphthyl, and 2-naphthyl, and derivatives thereof.

"Optionally substituted phenyl means a phenyl ring which is optionally substituted independently with one or more substituents, preferably one or two substituents selected from alkyl, haloalkyl, thioalkyl, hydroxyalkyl, halogen, nitro, cyano, hydroxy, alkoxy, carboxy, alkoxycarbonyl, amino, methylenedioxy, ethylenedioxy, -COR (where R is alkyl), -COOR (where R is alkyl), -NR ^d R ^b (wherein R ^a and R ^b are independently hydrogen or alkyl), -NR ^and COR ^b (wherein R is hydrogen or alkyl and R ^1, is alkyl, haloalkyl, or optionally substituted phenyl), or -CONR ¹ R ^1, (wherein R ¹ and R ^b are independently hydrogen or alkyl). More specifically, the term aryl includes, but is not limited to, phenyl, 1-naphthyl, and 2-naphthyl, and derivatives thereof.

"Heteroaryl means a monovalent monocyclic or bicyclic aromatic group containing 5 to 12 ring atoms containing one, two or three ring heteroatoms selected from N, O, or S, the remaining ring atom being C. The heteroaryl ring is optionally independently substituted with one or more substituents, preferably one or two substituents selected from alkyl, haloalkyl, heteroalkyl,

+1 X _L I— J_ O /

K. , v-. . About Ti / 1. '1 _ r> -. alkyl, haloalkyl, optionally substituted phenyl or optionally substituted heteroaryl), -NRR '(wherein R and R' are, independently of each other, hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, hydroxyalkyl, or optionally substituted phenyl), -C (O) R (wherein

R is hydrogen, alkyl, or optionally substituted phenyl), ialkylene) -COOR (where n is 0 or 1 and 9 is hydrogen, alkyl, optionally substituted phenylalkyl, or optionally substituted heteroaralkyl), -S (OKR [wherein n is a whole the number from U to 2 and R is hydrogen provided that n is 0), alkyl, cycloalkyl, cycloalkylalkyl, heteroalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, or optionally substituted heteroaryl], -SO ₂ NR'R '' (where R 'and R''are independently hydrogen, alkyl, hydroxyalkyl or optionally substituted phenyl or R' and R together with the nitrogen atom to which they are attached form a heterocyclic ring), -NRC (O) R '(wherein R is hydrogen or alkyl and R 'is alkyl, haloalkyl, or optionally substituted phenyl), -NRSO ₂ R' (wherein R is hydrogen or alkyl and R 'is alkyl, cycloalkyl, cycloalkylalkyl, heteroalkyl, optionally substituted phenyl, optionally substituted phenylalkyl, or optionally substituted heteroaryl) , -NRSO ₂ NR'R (where R is hydrogen k or alkyl, and R 'and R are, independently of each other, hydrogen or alkyl, or R' and R together with the nitrogen atom to which they are attached form a heterocyclic ring), - (alkylene) _n -CONR'R (wherein n is 0 or 1 and R 'and R are, independently of each other, hydrogen or alkyl, or R' and R together with the nitrogen atom to which they are attached form a heterocyclic ring), or an amino protecting group. More specifically, the term heteroaryl includes, but is not limited to pyridyl, furanyl, thiophenyl, thiazolyl, isothiazolyl, triazolyl, imidazolyl, isoxazolyl, pyrrolyl, pyrazolyl, pyrimidinyl, benzofuranyl, isobenzofuranyl, benzothiazolyl, benzoisothiazolyl, benzotriazolyl, isoquinolyl, benzimidazolyl, benzisoxazolyl, benzothiophenyl, dibenzofuran, and benzodiazepin-2-on-5-yl, and derivatives thereof.

"Heterocyclyl" means a saturated cyclic group containing 3 to 8 ring atoms in which one or two ring atoms are heteroatoms selected from N, O, or S (O) .-, wherein n is an integer from 0 to 2, the remaining the ring atoms are C, where one or two C atoms may optionally be replaced by a carbonyl group. The heterocyclic ring may be optionally substituted independently with one, two or three substituents selected from alkyl, haloalkyl, halogen, nitro, cyano, optionally substituted phenyl, optionally substituted

heteroaryl, optionally substituted phenylalkyl, optionally substituted heteraralkyl, -OR (where R is hydrogen, alkyl, or haloalkyl), -NRR '(where R and R' are independently hydrogen or alkyl), -C (O) R (wherein R is hydrogen, alkyl, heteroalkyl, aryl, heteroaryl, or aryloxyalkyl), -COOR (wherein R is hydrogen, alkyl, aryl, aralkyl, heteroaralkyl), - (alkylene) -COOR (wherein R is hydrogen, alkyl, optionally substituted phenyl , optionally substituted phenylalkyl, or optionally substituted heteroaralkyl), -CONR'R, or - (alkylene) -COONR'R (wherein R 'and R' are independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, heterocyclyl, aryl, aralkyl , heteroaryl), -S (O) _n R (wherein n is an integer from 0 to 2 and R is hydrogen (provided that n is 0) or alkyl), alkoxycarbonyl, -NRC (O) R '(wherein R is is hydrogen or alkyl and R 'is hydrogen or alkyl and R' is hydrogen or alkyl), -NRSO-> R '(where R is hydrogen or alkyl and R' is alkyl), -NRS0. _; NR'R (wherein R, R 'and R are independently hydrogen or alkyl), or an amino protecting group.

The heterocyclic ring may also optionally be fused to an aryl ring as mentioned above. More specifically, the term heterocycle includes, but is not limited to, tetrahydropyranyl, piperidine, piperazine, morpholine and thiomorpholine, thiomorpholine-1-oxide, thiomorpholine-1,1-dioxide, and derivatives thereof.

"Heteroalkyl" means an alkyl, cycloalkyl or cycloalkylalkyl group as defined above, bearing a τ τ v v> v v rv J J J J nebo nebo nebo nebo nebo or -S (G) _n R ^d , where n is an integer from 0 to 2, R ^J - is hydrogen, alkyl, or -COR (wherein R is hydrogen, alkyl, or haloalkyl); R ^R 'is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, heterocyklyhydroxyalkyl, -COR (where R is hydrogen, alkyl, haloalkyl, monosubstituted aminoalkyl, aryloxyalkyl, cycloalkyl, cycloalkylalkyl, aryl , aralkyl, heteroaryl, heteroaralkyl, heterocyclylalkyl, or - (alkylene) -C (O) -X (wherein

X is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, amino, • φ * · φφ ·· · φ φφ · · ΦΦΦ

Φ φφφ * · · · φφ · * ·· * · · *

Φ φ * * · ·

Os * ΦΦ ·· ** * monosubstituted amino, disubstituted amino, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, or heterocyclyalkyl), -SO ₂ R (where R is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, amino, monosubstituted amino or disubstituted amino), -COOR (wherein R is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, or heterocyclylalkyl), -CONR'R, or - (alkylene) -CONR'R (wherein R 'and R are independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, heterocyclyl, aryl, aralkyl, heteroaryl, heteroaralkyl, or SO ₂ R (where R is alkyl, haloalkyl, cycloalkyl , cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, amine, monosubstituted amine or disubstituted amine), or R 'and R together with the nitrogen atom to which they are attached form a heterocyclic ring]; alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclylalkyl, -COR (wherein R is alkyl, haloalkyl, or heterocyclyl), or -CORR'R (wherein R 'and R are independently selected from hydrogen) , alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, or heteroaralkyl); ¹ and R ^'1 is hydrogen (provided that n is zero), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, amino, monosubstituted amino, or disubstituted amino. representative examples include, but are not limited to, hydroxymethyl, 2-hydroxyethyl, 2-methoxyethyl, benzyloxymethyl, thiophen-2-ylthiomethyl, and the like;

"Aralkyl means a group -R ^a R ^b , where R ^a is an alkylene Sphiapine and R a is an aryl group as set forth above, e.g., benzyl, phenylethyl, 3- (3-chlorophenyl) -2-methylpentyl, and the like.

1 "Aralkenyl means a group -R'FC,""Aralkenyl means a group -R'FC, wherein R ' ¹ is an alkenyl group and R ^b is an aryl group as mentioned above e.g.

3-phenyl-2-propenyl, and the like.

"Heteroaralkyl" means a group -R ^a R ^b , where R ^a is an alkylene group and R ^b is a heteroaryl group as set forth above, e.g., pyridin-3-ylmethyl, 3- (benzofuran-2-yl) propyl, and the like.

"Heteroaralkenyl means a group -R ^a R ^b , wherein R ^a is an alkenyl group and R ^b is a heteroaryl group as set forth above, e.g., 3-pyridin-3-ylpropen-2-yl, and the like.

"Heterocyclylalkyl means a group -R ^a R ^b , wherein R ^a is an alkylene group and R '^; is a heterocyclic group as mentioned above, e.g., tetrahydropyran-2-ylmethyl,

4-methylpiperazin-1-yl-ethyl, 2-, or 3-piperidinylmethyl, and the like.

"Cycloalkylalkyl" means a group -R 1 R ³ 'where R ^a is an alkylene group and R ^b is a cycloalkyl group as set forth above, e.g., cyclopropylmethyl, cyclohexylpropyl, 3-cyclohexyl-2-methylpropyl, and the like.

"Alkoxy," aryloxy, "aralkyloxy, or" heteroaralkyloxy means an -OR group wherein R is alkyl, aryl, aralkyl or heteroaralkyl, respectively, as noted above, eg, methoxy, phenoxy, pyridin-2-ylmethoxyloxy, benzyloxy, and the like .

as mentioned above, having one or more, preferably one, two or three hydroxy groups, provided that if it contains two hydroxy groups, they are not both on the same carbon atom. Representative examples include, but are not limited to, 2-hydroxyethyl, 2-hydroxypropyl, 3-hydroxypropyl, 1- (hydroxymethyl) -2-methylpropyl, 2-hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 2,3-dihydroxypropyl, 1- (hydroxymethyl) -2-hydroxyethyl, 2,3-dihydroxybutyl, 3,4-dihydroxybutyl and &lt; RTI ID = 0.0 &gt; 9 &quot; &lt; / RTI &gt; · · ♦ ·

2- (hydroxymethyl) -3-hydroxypropyl, preferably 2-hydroxyethyl, 2,3-dihydroxypropyl, and 1- (hydroxymethyl) -2-hydroxyethyl.

"Optional" means that the successive event or circumstance may or may not occur, and that the description includes examples where the event or circumstance occurs and examples in which it does not. For example, "a heterocyclic group optionally mono- or disubstituted with an alkyl group means that alkyl may or may not be present, and the description includes situations where the heterocyclic group is mono- or disubstituted with an alkyl group and a situation where the heterocyclic group is not substituted with an alkyl group.

"Amino-protecting group refers to those organic groups that are intended to protect the nitrogen atom from unwanted reactions during the synthetic process, such as benzyl, benzyloxycarbonyl (CBZ), tert-butoxycarbonyl (Boc), trifluoroacetyl, 2-trimethylsilylethanesulfonyl (SES) and the like .

Compounds having the same molecular formula but which differ in the nature or sequence of bonding of their atoms or the arrangement of atoms in space are called "isomers." Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers, and stereoisomers that are mirror images of each other are called" enantiomers. If the compound has an asymmetric center, for example where the carbon atom is attached to four different groups, a pair of enantiomers is possible. An enantiomer may be characterized by the absolute configuration of its asymmetric center and is described as an R- or S-sequence, according to Cahn and Prelog's rule, or in which the molecule rotates the plane of polarized light and is referred to as dextrorotatory or left-rotating (ie. (-) - isomers). The chiral compounds can exist either as single enantiomers of one or more of the enantiomers. Or mixtures thereof. A mixture containing the same ratios of enantiomers is called a "racemic mixture".

The compounds of the present invention may have one or more asymmetric centers; such compounds may be obtained as individual (R) - or (Ξ) - stereoisomers or mixtures thereof. Unless otherwise indicated, the description or naming of particular compounds herein and the claims includes both individual enantiomers and racemic or otherwise. Methods for determining the separation of stereoisomers are well known in their mixtures, stereochemistry and in the art (see discussion in Chapter 4, "Advanced

Organic Chemistry, 4th edition,

By J. March, John Wiley and Sons, "Pharmaceutically acceptable excipient" means an excipient that is useful in the preparation is generally safe, non-toxic and is not biologically or otherwise undesirable and includes an excipient that is acceptable for veterinary use as well as for pharmaceutical use. A "pharmaceutically usable excipient" as used in this pharmaceutical composition, which document and claims includes one or more such excipients.

A "pharmaceutically acceptable salt" of a compound means a salt that is pharmaceutically acceptable and that exhibits the desired activity of the parent compound. Such salts include:

acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like; or formed with organic acids such as acetic acid, propionic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, hexanoic acid, antaric acid, fumaric acid, tartaric acid, citric acid, benzoic acid, methanesulfonic acid , ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, acid

2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo [2.2.2] oct-2-ene-1-carboxylic acid, glucoheptanoic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, laurylsiric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid and the like; or (2) salts wherein the acidic proton present in the parent compound is replaced by either a metal ion, such as an alkali metal, alkaline earth metal or aluminum ion; or coordinates with organic bases such as ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine and the like.

"Prodrugs" means any compound that releases an active parent drug of Formula I in vivo when a prodrug is administered to a mammalian subject. Prodrugs of a compound of Formula I are prepared by modifying the functional groups present in a compound of Formula I in such a way that the modifications can be cleaved in vivo to release the parent compound. Prodrugs include compounds of Formula I wherein the hydroxy, amino, or sulfhydryl group in the compound of Formula I binds to any group that can be cleaved in vivo to form a free hydroxyl, amine, or sulfhydryl group.

Examples of prodrugs include, but are not limited to, esters (e.g., derivatives), carbamates (e.g., N, acetate, formate, and benzoate).

N-dimethylaminocarbonyl) compounds of the general formula

I and the like.

"Therapeutically effective amount" means an amount of a compound that, when administered to a mammal for treating a disease, is sufficient to effectively treat the disease.

the amount will vary depending on the compound, the disease and its severity, age, weight, etc., and the mammal to be treated.

The name and numbering of the compounds of the invention is shown below.

SOý

Ar ² (I)

The nomenclature used in this application is based on IUPAC recommendations, for example a compound of Formula I:

wherein R ¹ is -CH (CH 3) ₂ , R is -CH ₂ R ₂ , Ar ¹ , where F. ' is hydrogen, Ar ¹ is 3,4-methylenedioxyphenyl, Ar ^- is 4-methoxyphenyl, and the stereochemistry at the carbon to which R ^{1 is} attached is (R) is called N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) (4-Methoxybenzenesulfonyl) amino] -3-methylbutyramide.

where R 'is -CH 3 OH, R is CHR ³ Ar ¹ , where R "is hydrogen, Ar' is indol-5-yl, Ar is 2,3,6-trimethyl-4-methoxyphenyl, and stereochemistry at the carbon atom to which R 1 is ¹ binds them (R) is called N-hydroxy-2 (R) - [(1H-indol-5-ylmethyl) -4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-hydroxypropionamide.

While the broadest definition of the present invention is described above, certain compounds of Formula Ia are preferred.

R ‘(la)

Σ. More specifically, a group of compounds of formula Ia is preferred

I '; γ CHI Θ *

Φ · ΦΦ ♦ * * φ φ> · φ φ · · · · · · · · · · · · · · · Φ ··· · ···

R is -CH (R ² ) Ar ¹ , wherein R 1 is hydrogen.

(a) In this preferred group (I), a more preferred group of compounds is that wherein:

Ar ¹ is heteroaryl and Ar ² is the phenyl ring of formula (a).

(i) In this more preferred group (I) (a), an even more preferred group of compounds is that wherein:

R ³ and R ⁷ are, independently of each other, alkyl, alkylthio, or halogen;

R ⁴ is hydrogen, alkyl, or halogen;

R ⁵ is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino, or alkylsulfonyl; and

R is hydrogen;

more preferably, R ³ and R ⁷ are, independently of each other, alkyl or halogen;

R is alkyl; and

R ⁵ is alkyl, alkoxy, or halogen.

In these preferred, more preferred, and even more preferred groups of compounds, a particularly preferred group of compounds is one where:

Ar 1 is a heteroaryl ring, preferably an optionally substituted indolyl or imidazolyl, more preferably indol-5-yl, 1-methylindol-5-yl, 3-acetylindol-5-yl, 3-propionylindol-5-yl, 3- (2- methylpropionyl) indol-5-yl, imidazol-5-yl, 2-methylbenzimidazol-5-yl, or benzimidazol-5-yl;

R 1 and R 2 are, independently of each other, alkyl or halogen, preferably methyl, chlorine, or bromine;

R is hydrogen or alkyl, preferably methyl; a * φφ ♦ · · · · · • · • · • · · • · Φ · φ · φ · · · · · «·« · · · · · ···· · Φ φφ ··

R 'is alkyl, alkoxy, or halogen, preferably methyl, methoxy, chloro, or bromo; even more preferably R ¹ , R ⁷ and R ⁷ are methyl and P ⁷ ; is methoxy, chloro or bromo.

In these preferred, more preferred, and particularly preferred compounds, a group of compounds is even more preferred wherein:

R ¹ is alkyl, aralkyl, heteroalkyl, or - (alkylene) C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heteerocyclyl, more preferably 2-propyl, hydroxymethyl, t-butoxymethyl,

2-hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, or - (alkylene) C (O) -X, wherein X is 2- or 4-pyridylmethylamino, 1-alkoxycarbonylpyridin-4-ylamino, optionally substituted benzylamino, 4-optionally substituted benzyloxycarbonylpiperazin-1-yl, 4-optionally substituted phenylpiperazin-1-yl, 4-alkoxycarbonylpiperazin-1-yl, or

4-optionally substituted heteroarylpiperazin-1-yl, most preferably 2-propyl, hydroxymethyl, t-butoxymethyl, 2-hydroxyethyl, 2-hydroxypropyl,

2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl,

2- (2- or 4-pyridylmethylaminocarbonyl) ethyl, 2- (1-

-ethoxycarbonylpyridin-4-ylaminocarbonyl) ethyl, 2- (benzylbenzyl)

U.11J -1- f (4-thiazoloxyl-8-thionyl) β ip of 11h-1-ylcarbonyl) ethyl, 2- (4-phenylpiperazin-1-ylcarbonyl) ethyl,

2- (4-methoxycarbonylpiperazin-1-ylcarbonyl) ethyl, 2- (4-acetylpiperazin-1-ylcarbonyl) ethyl, or 2- (4-pyridin-2-ylpiperazin-1-ylcarbonyl) ethyl.

In these preferred, more preferred, and particularly preferred groups of compounds, alternatively, a more preferred group of compounds is: wherein:

Μ 9 * 99 ♦ · 9 · 9 9 * 9 Μ · 9

99 99 99999 9 9

9 9 9 9 9

99 99 999 99 99 999

R 1 is heteroalkyl or - (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, preferably i, methylsulfonylaminomethyl, phenylsulfonylaminomethyl, (3-nitrophenyl) CH 2 SO 2 NHCH 2, methylcarbonylaminomethyl, 4- (methoxycarbonyl) phenylcarbonylaminomethyl, 2- (pyrrol-l-yl) phenylcarbonylaminomethyl, 3 cyanophenylaminocarbonylaminomethyl, thien-2-ylcarbonylaminomethyl, phenylcarbonylaminomethyl, _{(CR 5} H) CHCH3NHCO (C ₂ H ₄₎ CONHCH _2, (4-methoxyphenyl enyl) COC2H4CONHCH2-, 4-chlorophenylsulfonylaminocarbonylaminomethyl, 5- (acetyl) thien-2-ylcarbonylaminomethyl, pyridin-3-ylcarbonylaminomethyl, (3,4,5-trimethoxyphenyl) C2H4CONHCH2-,

3-methoxyphenylaminocarbonylaminomethyl, (phenoxy) CH (CH 2 CH 3) CONHCH 2 -, 1- (ethoxycarbonyl) piperidin-4-yl-aminomethylcarbonylaminomethyl,

3- (benzyloxycarbonylamino) propyl, 2 - [(diphenyl) methylaminocarbonyl] ethyl, 2- [2- (methyl) butylaminocarbonyl] ethyl, or 2 - [(Cdb) CHCH 3 NHCO] ethyl.

(ii) In this more preferred group of (1) (a), there is an even more preferred group of compounds wherein:

R ¹¹ and R ¹¹ are hydrogen;

R and R are, independently of each other, alkyl or halogen; and

R ^J is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino, or alkylsulfonyl;

even more preferably R 'is alkyl; R 'is alkyl, alkoxy, or halogen; and R is alkyl or halogen.

• ·· • 9 • 9 · «· •  · 9 9 9 • · • · • • • 9 9 9 · 9 • ··· ···· ·· • 9 • 9 • 9

In these preferred, more preferred, and even more preferred groups of compounds, a group of compounds wherein:

Ar ¹ is a heteroaryl ring, preferably optionally substituted indolyl or imidazolyl, more preferably indol-5-yl, 1-methylindol-5-yl, 3-acetylindol-5-yl, 3-propionylindol-5-yl, 3- (2-methylpropionyl) indol-5-yl, imidazol-5-yl, 2-methylbenzimidazol-5-yl, or benzimidazol-5-yl;

R ³ is alkyl, preferably methyl;

R ⁵ is alkyl, alkoxy, or halogen, preferably methyl, methoxy, chloro, or bromo; and

R ⁷ is alkyl or halogen, preferably methyl, chloro, or bromo;

preferably, R ³ and R ^J are methyl and R ^J is methoxy, chloro or bromo.

In these preferred, more preferred, and particularly preferred groups of compounds, even more preferred is a group of compounds wherein:

R 'is alkyl, aralkyl, heteroalkyl, or - (alkylene) C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, more preferably 2-propyl, hydroxymethyl, tert-butoxymethyl, 2- hydroxyethyl, 2-hydroxypropyl,

methoxymethyl, or - (alkylene) -C (O) -X, wherein X is

2- or 4-pyridylmethylamino, 1-alkoxycarbonylpyridin-4-ylamino, optionally substituted benzylamino, 4-optionally substituted benzyloxycarbonylpiperazin-1-yl, 4-optionally substituted phenylpiperazin-1-yl, 4-alkoxycarbonylpiperazin-1-yl, or 4 optionally substituted heteroarylpiperazin-1-yl, more preferably 2-propyl, hydroxymethyl, t-butoxymethyl, 2-hydroxyethyl;

2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, 2- (2- or 4-pyridylmethylaminocarbonyl) ethyl, 2- (1-ethoxycarbonylpyridin-4-ylaminocarbonyl) ethyl, 2- (benzylaminocarbonyl) ethyl, 2- (4 -benzyloxycarbonylpiperizin-1-ylcarbonyl) ethyl, 2- (4-phenylpiperazin-1-ylcarbonyl) ethyl, 2- (4-methoxycarbonylpiperazin-1-ylcarbonyl) ethyl, 2- (4-acetylpiperazin-1-ylcarbonyl) ethyl, or 2- (4-pyridin-2-ylpiperazin-1-ylcarbonyl) ethyl.

In these preferred, more preferred, and particularly preferred groups of compounds, alternatively, a more preferred group of compounds is: wherein:

R ² is heteroalkyl or - (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, more preferably, methylsulfonylaminomethyl, phenylsulfonylaminomethyl, (3-nitrophenyl) CH. _; SO. NHCH _? -, methylcarbonylaminomethyl, 4- (methoxycarbonyl) phenylcarbonylaminomethyl, 2- (pyrrol-l-yl) phenylcarbonylaminomethyl, 3 cyanophenylaminocarbonylaminomethyl, thien-2-ylcarbonylaminomethyl, phenylcarbonylaminomethyl, (C ,, HJ CHCH ₃ NHCO (C_H ₄₎ CONHCH -, ( 4-methoxyphenyl) COClH1CONHCH4-, 4-chlorophenylsulphonylaminocarbonylamino-methyl-5- (acetyl) thien-2-ylcarbonylaminomethyl, pyridin-3-ylcarbonylaminomethyl, (3,4,5-trimethoxyphenyl) C2H4CONHCH2-, 3-methoxyphenyl, 3-methoxyphenyl, phenoxy) CH (CH.CH ·,) CONHCH. -,

1- (ethoxycarbonyl) piperidin-4-yl-aminomethylcarbonylaminomethyl, 3- (benzyloxycarbonylamino) propyl,

2 - [(diphenyl) methylaminocarbonyl] ethyl, 2- [2- (methyl) butylaminocarbonyl] ethyl, or 2 - [(C 5 H 5 CHCH 2 NHCO) ethyl.

I * (b)

In this (b) is

Φ a preferred group (I) is another compound of formula Ia wherein: aryl and Ar ² is a phenyl ring a more preferred group of formula (a).

or to this more preferred group (I) a more preferred group of compounds wherein: R ³ and R ⁷ are, halogen;

R ¹¹ is hydrogen, R ^b is alkyl, alkyloxycarbonyl, (b) is still independently from each other, alkyl, alkylthio, alkyl, or halogen; haloalkyl, alkylthio, alkoxy, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino, or alkylsulfonyl; and r ' ¹ is hydrogen.

In these preferred, more preferred and even more preferred classes of compounds, a particularly preferred class of compounds is: wherein:

Ar ¹ is a phenyl ring substituted with one or two substituents selected from hydroxy, methoxycarbonyl, dihydroxyphenyl,

R 1 and R 2 are methylenedioxy, or more preferably 3,4-methylenedioxyphenyl, 3,4 or 4-methoxycarbonylphenyl;

independently of one another, alkyl or halogen, preferably methyl, chlorine, or bromine;

R ^{1 is} alkyl, alkoxy, or halogen, preferably methyl, methoxy, chloro, or bromo;

more preferably R ³ , R ⁴ and R ⁴ are methyl and R 3 is methoxy, chloro, or bromo.

In these preferred, more preferred, and particularly preferred groups of compounds, even more preferred is a group of compounds wherein:

R 'is alkyl, aralkyl, heteroalkyl, or - (alkylene) C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, more preferably 2-propyl, hydroxymethyl, t-butoxymethyl, 2- hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, or - (alkylene) -C (O) -X, wherein X is 2- or 4-pyridylmethylamino, 1-alkoxycarbonylpyridin-4-ylamino, optionally substituted benzylamino , 4-optionally substituted phenylpiperazin-1-yl, 4-alkoxycarbonylpiperazin-1-yl, or

4-optionally substituted heteroarylpiperazin-1-yl, most preferably 2-propyl, hydroxymethyl, tert-butoxymethyl, 2-hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, 2- (2- or 4-pyridylmethylaminocarbonyl) ethyl 2- (1-ethoxycarbonylpyridin-4-ylaminocarbonyl) ethyl, 2- (benzylaminocarbonyl) ethyl, 2- (4-benzyloxycarbonylpiperazin-1-ylcarbonyl) ethyl, 2- (4-phenylpiperazin-1-ylcarbonyl) ethyl, 2- ( 4-methoxycarbonylpiperazin-1-ylcarbonyl) ethyl, 2- (4-acetylpiperazin-1-ylcarbonyl) ethyl, or 2- (4-pyridin-2-ylpiperazin-1-ylcarbonyl) ethyl.

In these \ 'r bi o Η τί Vri in j, j ·

-v Ί X S. J_ *

in i_h preferred groups of compounds, alternatively, a group of compounds wherein:

R 'is heteroalkyl or - (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, more preferably methylsulfonylaminomethyl, phenylsulfonylaminomethyl, (3-nitrophenyl) SO 2 NHCH -, methyl carbonylaminomethyl, 4- (methcx.ykarbonyl) phenylcarbonylaminomethyl, 2- (pyrrol-1-yl1fenyl23 «* · · · • · · · · · · _A« * «♦ ··· ·· ·· · ··· ♦ karbonylaminomethyl 3- cyanophenylaminocarbonylaminomethyl, thien-2-ylcarbonylaminomethyl, phenylcarbonylaminomethyl, _{(Ci, s)} CHCHjNHCO (C ₂ H ₄₎ CONHCH _2, (4-methoxyphenyl) COC ₂ H ₄ CONHCH ₂ -, 4-chlorfenylsulfonylaminokarbonylaminomethyl, 5- (acetyl) thien -2-ylcarbonylaminomethyl, pyridin-3-ylcarbonylaminomethyl, (3,4,5-trimethoxyphenyl) C ₂ H ₄ CONHCH ₂ -,

3-methoxyphenylaminocarbonylaminomethyl, (phenoxy) CH (CH ₂ CH ₃ ) CONHCH ₂ -, 1- (ethoxycarbonyl) piperidin-4-yl-aminomethylcarbonylaminomethyl,

3- (benzyloxycarbonylamino) propyl, 2 - [(diphenyl) methylaminocarbonyl] ethyl, 2- [2- (methyl) butylaminocarbonyl] ethyl, or 2 - [(C 8 H 5) CHCH ₃ NHCO] ethyl.

(ii) Another more preferred group of compounds in group (I) (b) is where:

R ⁴ and R ⁵ are hydrogen;

R 'and R' are, independently of each other, alkyl or halogen;

and

R ^r is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halo, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino, or alkylsulfonyl.

For example, a group of compounds is particularly preferred

Ar ¹ is a phenyl ring substituted with one or two substituents selected from hydroxy, methylenedioxy, or methoxycarbonyl, more preferably 3,4-methylenedioxyphenyl, 3,4-dihydroxyphenyl or 4-methoxycarbonylphenyl;

R 'is alkyl, preferably methyl;

R is alkyl, alkoxy, or halogen, preferably methyl, methoxy, chloro or bromo; and

9 9 9

99 «99999

99 · · · 99 • 99 * 9 * 9 ♦ · · · · ·

R 'is alkyl or halogen, preferably methyl, chloro or bromo; preferably, R ³ and R ^- 'are methyl and R ⁵ is methoxy, chloro or bromo.

In these preferred, more preferred and particularly preferred groups of compounds, an even more preferred group of compounds is: wherein:

R ¹ is alkyl, hydroxyalkyl, aralkyl, heteroalkyl, or - (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, more preferably 2-propyl, hydroxymethyl, t-butoxymethyl , 2-hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, or - (alkylene) -C (O) -X, wherein X is 2- or 4-pyridylmethylamino, 1-alkoxycarbonylpyridin-4-ylamino, optionally substituted benzylamino, N- (optionally substituted carbonyl) methylamino, N- (optionally substituted amido) methylamino, 4-optionally substituted benzyloxycarbonylpiperazin-1-yl, 4-optionally substituted phenylpiperazin-1-yl, 4-alkoxycarbonylpiperazin-1-yl, or 4-optionally substituted heteroarylpiperazin-1-yl, or 4-optionally substituted heteroarylpiperazin-1-yl, 4-methanesulfonyl-piperazin-1-yl, 4-acetylpiperazin-1-yl,

4-optionally substituted phenoxypiperazin-1-yl, most preferably 2-propyl, hydroxymethyl, t-butoxymethyl, 2-hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, 2- (2- or 4-pyridylmethylaminocarbonyl) ethyl, 2-; 1-ethoxycarbonylpyridin-4-ylamino carbonyl) ethyl, 2- (benzylamino carbonyl) ethyl,

2- (4-benzyloxycarbonylpiperazin-1-ylcarbonyl) ethyl,

2- (4-Phenylpiperazin-1-ylcarbonyl) ethyl

2- (4-methoxycarbonylpiperazin-1-ylcarbonyl) ethyl,

2- (4-acetylpiperazin-1-ylcarbonyl) ethyl, or

2- (4-Pyridin-2-ylpiperazin-1-ylcarbonyl) ethyl.

In these preferred, more preferred, and particularly preferred groups of compounds, alternatively, a more preferred group of compounds is: wherein:

R ¹ is heteroalkyl or - (alkylene) -C (O) - X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, preferably methylsulfonylaminomethyl, phenylsulfonylaminomethyl, (3-nitrophenyl) CH 2 _; SO _> NHCH ₂ -, methylcarbonylaminomethyl, 4- (methoxycarbonyl) phenylcarbonylaminomethyl, 2- (pyrrol-l-yl) phenylcarbonylaminomethyl, 3 cyanophenylaminocarbonylaminomethyl, thien-2-ylcarbonylaminomethyl, phenylcarbonylaminomethyl, (C "H, _H) CH. ₍ NHCO (C) CONHCH 3 -, (4-methoxyphenyl) COC 3 H 3 CONHCH 2 -, 4-chlorophenyl sulfonylaminocarbonylaminomethyl, 5- (acetyl) thien-2-ylcarbonylaminomethyl, pyridin-3-ylcarbonylaminomethyl, (3,4,5- trimethoxyphenyl) C.H.CONHCH -, 3-methoxyphenylaminocarbonylaminomethyl, (phenoxy) CH (CH-CHJ CONHCH.) -,

aminomethyl, 3- (benzyloxycarbonylamino) propyl,

2 - [(diphenyl) methylaminocarbonyl] ethyl, 2- [2- (methyl) butylaminocarbonyl] ethyl, or 2- [(C _-? Hd CHCH3NHCO] ethyl.

II. Another preferred group of compounds of Formula Ia is wherein:

F is -CH (R) Ar, wherein R is alkyl.

In this group (II), a group of compounds wherein:

• · · 99 99 ·· · • · «· · · · • • · · 9 9 • • · • 9 9 9 • * · · · · · · · ··· 99 * 9 • 9

(a) Ar ¹ is a heteroaryl ring, preferably optionally substituted indolyl or imidazolyl, more preferably indol-5yl, 1-methylindol-5-yl, 3-acetylindol-5-yl, 3-propionylindol-5-yl, 3- (2- methylpropionyl) indol-5-yl, imidazol-5-yl, 2-methylbenzimidazol-5-yl, benzimidazol-5-yl; and

Ar is a phenyl ring of formula (a).

Another more preferred group of compounds is that wherein:

(b) Ar ¹ is aryl, preferably a phenyl ring substituted with one or two substituents selected from hydroxy, methylenedioxy, or methoxycarbonyl, more preferably 3,4-methylenedioxyphenyl, 3,4-dihydroxyphenyl, or 4-methoxycarbonylphenyl; and

Ar is a phenyl ring of formula (a).

In more preferred groups II (a) and (b), a more preferred group of compounds is that wherein:

(i) R 1 and R 2 are, independently of each other, hydrogen, alkyl, alkylthio or halogen, preferably methyl, methylthio, chloro or bromo, more preferably methyl, chloro or bromo;

R 'is hydrogen, alkyl or halogen, preferably methyl, chloro or bromo;

R is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano,

Alkylsulfonyl, preferably alkyl, alkoxy or halogen, more preferably methyl, methoxy, chlorine or bromine; and

R 'is hydrogen.

(ii) Another even more preferred group of compounds in the groups

TL (a) and (b) are those where:

R 1 and R 2 are hydrogen;

R 1 and R 2 are, independently of each other, alkyl or halogen, preferably methyl, chlorine or bromine; and

• ·· ·· ·· • · • · • · ♦ • * ·· · · ♦ · ♦ • · · · • · · · · • · ♦ ·· ·· • · ♦ · * • · • · • ·

R ⁵ is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl, preferably alkyl, alkoxy or halogen, more preferably methyl, methoxy, chloro or bromo.

(iii) Another even more preferred group of compounds in the groups

II (a) and (b) is where:

R ⁴ and R ⁶ are hydrogen

R ³ and F. ' are, independently of one another, alkyl or halogen; and

R ⁵ is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl.

In the above preferred, more preferred and even more preferred groups (II) and a (II) b, a particularly preferred group of compounds is that wherein:

R ¹ is alkyl, aralkyl, heteroalkyl, or - (alkylene) C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, more preferably 2-propyl, hydroxymethyl, t-butoxymethyl, 2-hydroxyethyl , 2-hydroxypropyl,

methoxymethyl, or - (alkylene) -C (O) -X wherein X is 2- or 4-pyridylmethylamino, 1-alkoxycarbonylpyridin-4-ylamino, optionally substituted benzylamino, 4-optionally substituted benzyloxycarbonylpiperazin-1-yl, 4-optionally substituted phenylpiperazin-1-yl, 4-alkoxycarbonylpiperazin-1-yl, or 4-optionally substituted heteroarylpiperazin-1-yl,

Φ Φ Φ · · • Φ Φ Φ

Φ · ΦΦ · · · ·

Most preferably 2-propyl, hydroxymethyl, tert-butoxymethyl, 2-hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloymethyl, benzyl, methoxymethyl, 2- (2- or 4-pyridylmethylaminocarbonyl) ethyl, 2- (1-ethoxycarbonylpyridin-4-ylaminocarbonyl) ethyl, 2- (benzylaminocarbonyl) ethyl, 2- (4-benzyloxycarbonylpiperizin-1-ylcarbonyl) ethyl, 2- (4-phenylpiperazin-1-ylcarbonyl) ethyl, 2 - (4-methoxycarbonylpiperazin-1-ylcarbonyl) ethyl, 2- (4-acetylpiperazin-1-ylcarbonyl) ethyl, or 2- (4-pyridin-2-ylpiperazin-1-ylcarbonyl) ethyl.

In the above preferred, more preferred and even more preferred groups (II), alternatively a group of compounds wherein:

R ¹ is heteroalkyl or - (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, preferably methylsulfonylaminomethyl, phenylsulfonylaminomethyl, (3-nitrophenyl) CH ₂ SO. NHCH. methylcarbonylaminomethyl, 4- (methoxycarbonyl) phenylcarbonylaminomethyl, 2- (pyrrol-1-yl) phenylcarbonylaminomethyl, 3-cyanphenylaminocarbonylaminomethyl, thien-2-ylcarbonylaminomethyl, phenylcarbonylaminomethyl

CHCHNHCO (ΟΗ ₄ ) CONHCH phenyl) COCH 2 CHONONCH 2 -, 4-chlorophenylsulfonylaminocarbonylaminomethyl, 5- (acetyl) thien-2-ylcarbonylaminomethyl, pyridin-3-ylcarbonylaminomethyl, (3,4,5-trimethoxyphenyl) C 4 -C 4. _; C0'JHCH-, 3-methoxyphenylaminocarbonylaminomethyl, (phenoxy) CH (CH 2 CH 2) CONHCH

1- (ethoxycarbonyl) piperidin-4-yl-aminomethylcarbonylaminomethyl, 3- (benzyloxycarbonylamino; propyl,

2 - [(diphenyl) methylaminocarbonyl] ethyl, 2- (2- (methyl) butylaminocarbonyl] ethyl, or 2 - [(C 8 H 5) CHCH 3 NHCO] ethyl.

4 · * • · 44 4 · · > · • 4 4 · 4 4 4 · • 444 4 • • • · 4 · · • • ··· 4 * 44 • 4 4 · 44 • 4

III. A third preferred group of compounds of formula Ia is wherein:

R is -CH (R ² ) Ar ¹ wherein R ² is hydrogen;

Ar ¹ is heteroaryl; and

Ar 1 is a naphthyl ring of formula (b).

IV. A fourth preferred group of compounds of formula Ia is that wherein:

R is -CH ² R 5Ar ¹ , where R is hydrogen;

Ar ¹ is aryl; and

Ar ^- is a naphthyl ring of formula (b).

V. / VI. A fifth and sixth preferred group of compounds of formula (Ia) are those wherein:

R is -CH (R ² ) CH = CHAr ^; wherein R ² is hydrogen;

Ar 1 is heteroaryl and

Ar is a phenyl ring of formula (a); or

Ar 1 is heteroaryl and

Ar 1 is a naphthyl ring of formula (b).

V11 / VIII

The compound of formula Ia is that where:

R is -CH (R ² ) CH = CHAr ', wherein R "is hydrogen;

Ar 1 is aryl and

Ar 1 is a phenyl ring of formula (a); or

Ar ¹ is aryl and

Ar is a naphthyl ring of formula (b).

In the above preferred groups III. - VIII., Is a particularly preferred group of compounds wherein:

Φ φ

R ¹ is alkyl, aralkyl, heteroalkyl, or - (alkylene) C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, more preferably 2-propyl, hydroxymethyl, t-butoxymethyl, 2- hydroxyethyl, 2-hydroxypropyl,

2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, or - (alkylene) -C (O) -X wherein X is 2- or 4-pyridylmethylamino, 1-alkoxycarbonylpyridin-4-ylamino, optionally substituted benzylamino, 4-optionally substituted benzyloxycarbonylpiperazine 1-yl, 4-optionally substituted phenylpiperazin-1-yl, 4-alkoxycarbonylpiperazin-1-yl, or 4-optionally substituted heteroarylpiperazin-1-yl, most preferably 2-propyl, hydroxymethyl, t-butoxymethyl, 2-hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, 2- (2- or 4-pyridylmethylaminocarbonyl) ethyl, 2- (1-ethoxycarbonylpyridin-4-ylaminocarbonyl) ethyl, 2- (benzylaminocarbonyl) ethyl, 2- (4 -benzyloxycarbonylpiperazin-1-ylcarbonyl) ethyl, 2- (4-phenylpiperazin-1-ylcarbonyl) ethyl, 2- (4-methoxycarbonylpiperazin-1-ylcarbonyl) ethyl, 2- (4-acetylpiperazin-1-ylcarbonyl) ethyl or 2- (4-pyridin-2-ylpiperazin-1-ylcarbonyl) ethyl.

In the above preferred groups (III) - (VIII), alternatively a group of compounds wherein:

R ¹ is heteroalkyl or - (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl, preferably methylsulfonylaminomethyl, phenylsulfonylaminomethyl, (3-nitrophenyl) CH 3 O. NHCH. methylcarbonylaminomethyl, 4- (methoxycarbonyl) phenyl 31

karbonylaminomethyl, 2- (pyrrol-l-yl) phenylcarbonylaminomethyl, 3 cyanophenylaminocarbonylaminomethyl ·, thien-2-ylcarbonylaminomethyl, phenylcarbonylaminomethyl, (C ₆ H ₅₎ CHCHíNHCO _(C2 CONHCHs- HJ, (4-methoxyphenyl) COC ₂ H ₄ CONHCH _2- (4-chlorophenylsulfonylaminocarbonylaminomethyl), 5- (acetyl) thien-2-ylcarbonylaminomethyl, pyridin-3-ylcarbonylaminomethyl, (3,4,5-trimethoxyphenyl) C ₂ H ₄ CONHCH ₂ -, 3-methoxyphenyyinocarbonylaminomethyl, (phenoxy) CH (CH ₂ CH ₃ ) CONHCH ₂ -,

1- (ethoxycarbonyl) piperidin-4-yl-aminomethylcarbonylaminomethyl, 3- (benzyloxycarbonylamino) propyl,

2- [(diphenyl) methylaminokarbony1] ethyl, 2- (2- (methyl) butylaminocarbonyl] ethyl, or 2- [(C ₅ H _fi) CHCHjNHCO] ethyl.

Specific compounds of the above embodiments are listed below.

Representative compounds of the invention are as follows;

I. Compounds of formula (Ia) and (Ib) wherein R is -CH ¹ R 2 Ar ¹ and the remaining groups are defined as follows:

• · · · · · · ·

Merge. # Stereochemistry at c ’ R- R ¹ Ar ¹ Ar ^z tt ^ů c MH + i 1 (R) H 2-propyl indol-4-yl 4-methoxyphenyl 105- 107 439 2 (R) H (CHshCHCH; 3,4- methylenedioxyphenyl 4-bromophenyl 117,8- 119.2 499 3 (R) H 2-propyl 3,4- methylenedioxyphenyl 2-methoxy-6-naphthyl 152- 153 4Θ7 4 (R) H CH ₃ CO ₂ CH _; 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 78-81 547 5 (R) H hydroxymehtyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 167,3- 168, 1 467 6 (R) H 2-propyl 3,4-dihydroxyphenyl 4-methoxyphenyl 88,5- 92 425 Ί (R) H 2-propyl 3,4- methylenedioxyphenyl 4-chlorophenyl 441 8 (R) H 2-propyl 3, 4- methylenedioxyphenyl 4-methoxyphenyl 162,3- 163.6 437 9 (R) H 2-propyl 3,4- methylenedioxyphenyl 4-bromophenyl 485 10 (R) H benzyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 485 11 (R) H 2-propyl indol-5-yl 2,3,6-trimethyl-4-methoxyphenyl 103- 106 474 12 (R) H 2-propyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 129- 131 479 13 (P.) H 2-propyl 3,4-dihydroxyphenyl 2,2,5,7,8-pentamethylchroman-6-yl 144- 146 521 14 (R) H hydroxymethyl 3,4- methylenedioxyphenyl 2,5-dimethyl-4-chlorophenyl 457 15 Dec (R) H target. butoxymethyl indol-5-yl 2,3,6- trimethyl-4-methoxyphenyl 517 16 i R) 4- H 2-propyl 3,4- methylenedioxyphenyl dibenzofuran-4 yi 172,5- 175 497 1 ΐ i P.s) H ethyl 3,4- methylenedioxyphenyl 4-bromophenyl 471 18 (Ρ.Ξ) CH. ethyl 3,4- methylenedioxyphenyl 4-bromophenyl 4SS 19 Dec IR! H 2-propyl 8,4- methylenedioxyphenyl ? H H r R í í - / - - - 1-chlorophenyl 466 20 May (R) H 2hydroxyetnyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 481 21 1 (R) H 2-propyl 4- (CHOCOC) phenyl 4-methoxyphenyl 164- 165 451, 1

Merge. # Stereo chemistry on c ‘ R ' R ^l Ar ¹ Ar ^ m.p. ° c MH + [ 22nd (R) H 2-propyl 1- (methyl) indol-5-yl 2,3,6-trimethyl- 4methoxyphenyl 486 23 (R) H 2-propyl 3-nitro-4-methylphenyl 4-methoxyphenyl 452 24 (R) H target. butoxymethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl- 4- methoxyphenyl 523 25 (R) H 2-propyl 3-fluorophenyl 4-methoxyphenyl 159,8- 162.8 411 26 (R) H hydroxymethyl indol-5-yl 2,5-dimethyl-4-methoxyphenyl 448 27 Mar: (R) H 2-propyl 3-hydroxy-4-methoxyphenyl 4-methoxyphenyl 439 28 (R) H 2-propyl 4-hydroxyphenyl 4-methoxyphenyl 409 29 (R) H PhCONHCHj 4- (CHiOCO) phenyl 4-methoxyphenyl 542 30 (R) H 2-propyl 3,4- methylenedioxyphenyl 2-methyl-4-bromophenyl 499 31 (R) H 2-propyl 4-methylphenyl 4-methoxyphenyl 169,6- 170.5 407 32 (R) H (CH3), CHCH _: 3,4- methylenedioxyphenyl 2,3,6-trimethyl- 4methoxyphenyl 137- 138 493.21 (HRMS) 33 (R) H 2-propyl 3, 4- methylenedioxyphenyl 2,3,5,6- tetramethylphenyl 463 34 (R) H benzyl indol-5-yl 2,3,6-trimethyl- 4 methoxyphenyl 522 35 (R) H 2-propyl benzimidazol-5-yl 4-methoxyphenyl 433 36 (R) H 2-propyl 3,4- methylenedroxyphenyl 2,5-dimethyl-4-methoxyphenyl 465 37 (R) H methoxymethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl- 4-methoxyphenyl 481 38 (R) H 2-propyl 2- (methyl) benzimidazol-5-yl 4-methoxyphenyl 447 39 (R) H 2-propyl benzoxazol-5-yl 4-methoxyphenyl 434 40 (R) H 2-propyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 465 4 1 (R} H hydroxymethyl indol-5-yl 2,5-dimethyl-4-chlorophenyl 452 42 (R) H 2-propyl 3,4- methylenedioxyphenyl 4- methylthiophenyl 453 / 3 tn \ \ ^{4 in} / ’_R 2 propyl ‘I ~ hydroxymethylphenyl 4-thioxyphenyl 96-100 4 2 3

Merge. # Stereochemistry at c ’ iV R ' Ar ' Ar ^z t. t. C MH + 44 (R) H 2-propyl 3-amino-4-hydroxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 64- 65.5 465 45 (R) H C ₆ H ₅ SO ₂ NHCH 4- (CH 3 OOC) phenyl 4- methoxyphenyl 578 46 (R) H 2-propyl 4- (C ₆ H ₅ SO ₂ NH) phenyl 4methoxyphenyl 167,2- 169, 1 548 47 (R) H indol-3-ylmethyl 3,4- methylenedioxyphenyl 4methoxyphenyl 524 48 (R) H C ₆ H ₅ CONH ₂ 3-nitrophenyl 4- methoxyphenyl 529 50 (R) H phenyl 3, 4- methylenedioxyphenyl 4methoxyphenyl 471 51 (R) H 2-propyl 4- (CH ₃ CO) phenyl 4methoxyphenyl 164- 164.9 435 52 (R) H 2-propyl 3, 4- ethylenedioxyphenyl 4- methoxyphenyl 141- 144.5 451 53 (R) H 2- [4- (benzyloxycarbonyl} piperazin-1-ylcarbonyl] ethyl 3, 4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 711, 4 54 (R) H 2- (pyridin-3-ylmethylaminocarbonyl) ethyl 3-fluorophenyl 4- methoxyphenyl 531.2 55 (R) H 2- [4-Phenylpiperazin-1-ylcarbonyl] ethyl 3-nitro-4-methylphenyl 4methoxyphenyl 626, 4 56 (R) H 2- [4- (methoxycarbonyl) piperazin-1-ylcarbonyl] ethyl 3, 4- methylenedioxyphenyl 4methoxyphenyl 621.2 57 (R) H 2- [4-acetylpiperazin-1-ylcarbonyl] ethyl 3-fluorophenyl 2,3,6-trimethyl-4-methoxyphenyl 593, 4 se (R) H 2- [4- (ethoxycarbonyl) piperazin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6- trifluoromethyl-4-methoxyphenyl 649, 4

• · ·

31 ouč. Stereo- chemistry on C PC R ' Ar ¹ Ar ² t. t. C MH + 59 (R) H 2- [4- (ethoxycarbonyl) piperazin-1-ylcarbonyl] ethyl 3-fluorophenyl 4- methoxyphenyl 581.2 60 (R) H 2- [1- (ethoxycarbonyl) piperidin-4-ylaminocarbonyl] ethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 621.2 61 (R) H 2- (thiomorpholin-4-ylcarbonyl) ethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 552.2 62 (R) H 2- [1- (ethoxycarbonyl) piperidin-4-yl aminocarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 663.2 63 (R) H 2-benzylaminocarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 598.2 64 (R) H 2- [4-phenyl) piperazin-1-ylcarbonyl] ethyl 3, 4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 653.4 65 (R) H 2- [4- (pyridine- 2-yl; -piperazine- 1-ylcarbonyl] ethyl 3-fluorophenyl 4- methoxyphenyl 586.2 66 (R) H 2- (4-pyridin-4-ylmethylaminocarbonyl) ethyl 3-fluorophenyl 4- methoxyphenyl 531.2

• 9 ··

Merge. # Stereochemistry at C P. ' R * Ar ' Ar ‘ m.p. Noc: 2 ° C MH + 67 (R) H 2- (benzylaminocarbonyl) ethyl 3-fluorophenyl 4-methoxyphenyl 530.2 68 (R) H 2- [4- (pyridine- 2-yl) -piperazine- 1-ylcarbonyl] ethyl 3-fluorophenyl 2,3,6-trimethyl-4-methoxyphenyl 628.4 69 (R) H 2- (4- acetylpiperazin-1-ylcarbonyl) ethyl 3-fluorophenyl 4-methoxyphenyl 551.2 70 (R) H 2- (4- acetylpiperazin-1-ylcarbonyl) ethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 619, 4 71 (R) H 2- [1- (ethoxycarbonyl) piperidin-4-yl aminocarbonyl] ethyl 3-fluorophenyl 2,3,6-trimethyl-4-methoxyphenyl 637.4 72 (R) H benzyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 493.2063 (HRMS) 73 (R) H 2-propyl 3,4- methylenedioxyphenyl 4,8dimethoxynaft- 1-yl 517 74 (R) H 2-propyl · cinnamyl 4-methoxyphenyl 419 75 (R) H hydroxymethyl indol-5-yl 2,6-dimethyl- 4methoxyphenyl 448 76 (R) H hydroxymethyl · 3,4- methylenedioxyphenyl 2,6-dimethyl- 4-methoxyphenyl 164- 165.9 453 77 (R) H (CH ₂ CH ₂ - 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 137- 138 478.19 78 (R) H 2-propyl indol-5-yl 2,6-dimethyl- 4methoxyphenyl 115- 121 460 1 79 1 (R> H hydroxymethyl 3,4- methylenedioxyphenyl 2,5-dimethyl- 4-methoxyphenyl 135- 147.2 433

• * «

S1OUĚ. Stereochemistry at C R ' R ' Ar ¹ Ar tt ^{, J} C MH + 80 (R) H 1-hydroxyethyl Indo-5-yl 2,3,6-trimethyl-4-methoxyphenyl 409 81 (R) H 2-propyl 3- [1- (hydroximino) propyl] indol-5-yl 2,3,6- trimethyl-4-methoxyphenyl 54S 82 (R) H 2-propyl benzimidazol-5-yl 2, S, 6-trimethyl-4-methoxyphenyl 475 83 (R) H 2- (4- (4-methylphenylaminocarbonyl) -pipetazin-1-ylcarbonyl-ethyl) 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 710.8 84 (R) H 2- (4- (3- methoxyphenylaminocarbonyl) -piperazin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 726, 8 85 (R) H benzyl indol-5-yl 2,3,6- trimethyl-4-methoxyphenyl 522.21 86 (R) H hydroxymethyl indol-5-yl 2,3,6- trimethyl-4-methoxyphenyl 462.17 87 (R) H 1-hydroxyethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 95- 105 481 88 W H 2-propyl 3 - [(N-benzyloxy) methylimidoyl] indol-S-yl 2,3,6- trimethyl-4 methoxyphenyl 621 89 (R) H 2- (N-methylethylaminocarbonyl) ethyl 3, 4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 550, NO 90 (P.) H 2- [4-Acetylpiperazin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 619, 7

• φ

Merge. # Stereochemistry to c ‘ R ~ R ¹ Ar ' Ar ‘ m.p. 'C MH + 91 (R) H 2- [4- (phenoxymethyl-carbonyl) piperazin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 711.8 92 (R) H methoxymethyl indol-5-yl 2,3,6-trimethyl-4-methoxyphenyl 476 93 (R) H 2- [4- (methanesulfonyl) piperazin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 655.8 94 (R) H 2-hydroxyethyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 481.17 95 (R) H 2- (cyclopropylaminocarbonyl) ethyl 3,4- methylenedioxyphenyl 2,3,6-trimethyl-4-methoxyphenyl 548.6 96 (R) H 2- [4-benzyloxycarbonylpiperazin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 2,3,6- trimethyl-4-methoxyphenyl 711.8 97 (R) H 4- (methoxycarbonyl) phenylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 586, 6 98 (R) H 3- (benzyloxycarbonylamano) propyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 586 99 (R) H 2- (pyrrol-1-yl) phenylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 593.6 100 ALIGN! (R) H 2 - [(diphenyl) methylaminocarbonyl] ethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 632.7

• Φ · φ · *

Merge. # Stereochemistry to C * R R ¹ 1 Ar ‘ Whatever tt ^r 'c MH + 101 (R) H 3-cyanophenylaminocarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 568, 6 102 (R) H thien-2-ylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 534.6 103 (R) H phenylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 528.6 104 {Rl H (C ₆ H ₅ ) CHCH ₃ NHCO (C ₁ H ₆ ) CO NHCH 3 - 3,4- methylenedioxyphenyl 4- methoxyphenyl 627.7 105 (R) H (4- methoxyphenyl) - COCiHjCONHCH? - 3,4- methylenedioxyphenyl 4- methoxyphenyl 614.6 106 (R) H 4-chlorophenylsulfonylaminocarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 642.1 107 (R) H 5- (acetyl) thien-2-ylcarbonyl aminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 576, 6 108 (R) H pyridin-3-ylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 529, 5 109 (R) H 2- [2- (methyl) butylaminocarbonyl] ethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 536.6 110 (R) H (3,4,5-trimethoxyphenyl) C, H, CONHCH; 3,4- methylenedioxyphenyl 4- methoxyphenyl 646.7

Merge. # Stereochemistry at c ' R ^J R ¹ Ar ‘ Ar tt ^Ú C MH + 111 (R) H 3-methoxyphenylaminocarbonylaminomethyl 3,4- methylenedioxyphenyl 4methoxyphenyl 573.6 112 (R) H 2- [(C _fi HJ CHCHjNHCO] ethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 570.6 113 (R) H (phenoxy) CH (CH ₂ CH ₃ ) CON HCH ₂ - 3,4- methylenedioxyphenyl 4- methoxyphenyl 586, 6 114 (R) H (3-nitrophenyl) - CH ₂ SO ₂ NHCH ₂ 3,4- methylenedioxyphenyl 4- methoxyphenyl 623.6 115 (R) H 1- (ethoxycarbonyl) piperidin-4-ylaminomethylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 636.7 116 (R> H 4-ethoxyphenylaminocarbonylaminomethyl 3, 4- methylenedioxyphenyl 4- methoxyphenyl 587, 6 117 (R) H 2- chlorpyridine- 5-ylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 564.0 118 (R) H 2- [N, N- (ethyl cyano) (benzyl) aminocarbonyl] ethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 609.7

· ♦

Ou1ouč. # Stereo Chemistry on C * R · ' R ‘ Ar ' Whatever t. t. Y MH + 119 (R) H 4- (methylthio) phenylaminocarbonylaminomethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 589.7 120 (R) H 2,4- difluorophenylcarbonylaminomethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 564.5 121 (R) H 2-propyl 3- (acetyl) indol-5-yl 4-methoxyphenyl 474 122 (R) H 2- [4- (phenylcarbonyl) piperazin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 639.7 123 (R) H (4-hydroxyphenoxy) CH (CH ₃₎ CO NHCH; - 3,4- methylenedioxyphenyl 4-methoxyphenyl 58Θ, 6 124 (R) H 2- [4- (furan-2-ylcarbonyl) piperidin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 629.7 125 (R) H N- (3,5- (dimethoxy} phenylcarbonyl) aminomethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 588.6 126 (R) H 2-propyl 3- (acetyl) indol-5-yl 2,3,6-trimethyl-4-methoxyphenyl 163- 171 516 127 (R) H 2-propyl 3- (Isobutyro) indol-5-yl 2,3,6- trimethyl-4-methoxyphenyl 544 128 (R) H methyl sulfonylaminomethyl 3,4- methylenedioxyphenyl 2,6-dimethyl- 4- methoxyphenyl 98- 102 530 129 (R) H phenylsulfonylammomethyl 3, 4- methylenedioxyphenyl 2,6-dimethyl- 4- methoxyphenyl 103- 107 592

• B

Elephant. # Ξ thereochemistry on C R- R ^J Ar ' Ar ^J t. t. Noc: 2 ° C MH + 130 (R) H acetylaminomethyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 494 131 (R) H methoxycarbonylaminomethyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 510 132 (R) H 4- carboxyphenyl carbonylaminomethyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 150- 153 600 133 (R) H 4-methylbenzoate carboxamidomethyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 119- 124 614 134 (R) H (2-pyrrol-1-yl) phenylcarbonyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 104- 108 621 135 (R) H 4- (methoxycarbonyl) phenylcarbonylaminomethyl indol-5-yl 2,6-dimethyl-4-methoxyphenyl 122- 127 609 ' 136 (R) H 1-hydroxyethyl benzimidazol-5-yl 2,3,6-trimethyl- 4-methoxyphenyl 477 137 (R) H (imidazol-4-yl) methyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 503 138 (R) H N- (phenylcarbonyl) aminomethyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 556 139 (R) H 2-chlorophenylmethoxycarbonylaminomethyl 3,4- methylenedioxyphenyl 4-methoxyphenyl 592 140 (R) H 3-nitrophenylmethoxycarbonylaminomethyl 3,4- methylenedroxyphenyl 4-methoxyphenyl 603

• 4

Merge. « Stereochemistry at c ‘ R · ' R ¹ Ar ¹ Ar ^J t, t - ^r 'c MH + 141 (R) H 3,5-dichlorophenylmethoxycarbonylamino methyl 3, 4- methylenedioxyphenyl 4- methoxyphenyl 626 142 (R) H 2-propyl benzoxazol-5-yl 4- methoxyphenyl 434 143 (R) H 2- (pyrrol-1-yl) benzamidomethyl 3,4- methylenedioxyphenyl 2,6-dimethyl-4-methoxyphenyl 621 144 (R) H 1-hydroxyethyl 3,4- methyl endioxyphenyl 2,6-dimethyl- 4- methoxyphenyl 4 67 145 (R) H 2-propyl indol-5-yl 2,6-dimethyl4- methoxyphenyl 117- 121 460 146 (R) H benzyloxycarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 558 147 (R) H 4methoxyanilinocarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 573 148 (R) H 4-nitrobenzyloxycarbonylaminomethyl 3,4- methylenedioxyphenyl 4- methoxyphenyl 603 149 (R) H 2-bromobenzyloxycarbonylaminomethyl 3,4-methylenedioxyphenyl 4- methoxyphenyl 638

• ·

♦

Compounds of formula Ia and Ib, wherein R is -CH (R) Ar ', Ar ² is 2,3,6-trimethyl-4-methoxyphenyl or 2,6-dimethyl-4-methoxyphenyl, R ² is hydrogen and other groups are defined as follows:

HOHN

Ar ²

Compound R * Ar ¹ 1 N- [4- (methoxycarbonyl) phenyl- carbonylinomethyl 3,4- methylenedioxyphenyl 2 N- (benzyloxycarbonyl) aminopropyl 3,4- methylenedioxyphenyl 3 N- [2- (pyrrole-1-) yl) phenyl carbonylfaminomethyl 3, 4- methylenedioxyphenyl 4 2- (diphenyl) methyl- amino carbonyl] aminomethyl 3,4- methylenedioxyphenyl 5 N- [3- (cyano) phenylaminocarbonyl] aminomethyl 3, 4- methylenedioxyphenyl 6 N- (thien-2- ylcarbonyl) aminomethyl 3, 4- methylenediophenyl F N- (phenylcarbonyl) aminomethyl 3,4- methylenedioxyphenyl 8 (C7Hb) CHCH3 NHCO (C2H4) CONHCH3- 3, 4- methylenedioxyphenyl 9 (4-methoxyphenyl) COC2H4CONHCH2- 3,4- methylenedioxyphenyl 10 N- (4-chlorophenylsulfonylaminocarbonyl) aminomethyl 3, 4- methylenedioxyphenyl 11 N- (5- (acetyl) thien-2- 3,4-

· * Φ φ φ φ φ φ φ φ φ φ φ φ

ylcarbonyl) laminomethyl methylenedioxyphenyl 12 N- (pyridine-3- ylcarbonyl) aminomethyl 3,4- methylenedioxyphenyl 13 2 - [2 - (methyl) butylaminocarbonyl] ethyl 3, 4- methylenedioxyphenyl 14 (3,4,5-trimethoxyphenyl) - C ₂ H ₄ CONHCH ₂ - 3,4- methylenedioxyphenyl 15 Dec N- (3- (methoxy) phenylamino- carbonyl) aminomethyl 3,4- methylenedioxyphenyl 16 2 - [(C ₆ H ₅ ) CHCH ₃ NHCO] ethyl 3,4- methylenedioxyphenyl 17 (phenoxy) CH (CH. CH ₂ ) CONHCH ₂ - 3, 4- methylenedioxyphenyl 18 (3-nitrophenyl) CH ₂ SO ₂ NHCH ₂ - 3, Zl- endioxy phenyl 19 Dec N- [1- (ethoxycarbonyl) piperidine- 4-ylaminomethylcarbonyl) aminomethyl 3, 4- methylenedioxyphenyl 20 May N- (4- (ethoxy) phenylamino- carbonyl) aminomethyl 3,4- methylenedioxyphenyl 21 N- (2-chloropyridin-5-ylcarbonyl) aminomethyl 3, 4- methylenedioxyphenyl 22nd 2- [N, N- (ethylcyano) (benzyl) amino- 1 r v · O >> «7 1 1 with 4- V *> 7 7 1 ACIX kJLJll V _L j EN L_ 1 1 _y J_ .3,4- Methylenedioxyphenyl 23 N- (4- (methylthio) anilino- carbonyl) aminomethyl 3, 4- methylenedioxyphenyl 24 N- (2,4-difluorophenylcarbonylaminomethyl) 3,4- methylenedioxyphenyl 25 2-propyl (3-Acetyl) indole-5- yi 26 2- [4- (phenylcarbonyl) piperazin-1-ylcarbonyl 3,4- me r hy1end i o y y phy1 27 Mar: and__________________________________________________________________________________________________________ ; 4-hydroxyphenoxy) CH (CH3) - 3,4-

CONHCH; methylenedioxyphenyl 28 2- [4- (furan-2-ylcarbonyl) piperidin-1-ylcarbonyl] ethyl 3,4- methylenedioxyphenyl 29 N- (3,5- (dimethoxy) phenylcarbonyl) aminomethyl 3, 4- methylenedioxyphenyl 30 N- (benzyloxycarbonyl) aminopropyl benzoxazol-6-yl 31 N- (benzyloxycarbonyl) aminopropyl benzofuran-5-yl

In a third aspect, the present invention provides a process for the preparation of compounds of formula I, the process comprising (i) reacting a compound of formula 1:

wherein R ', R', Ar ¹ are as defined in claim 1 and Y is a hydroxy, halogen, alkyl or succinimide ester, with a hydroxylamine of formula NHROR, wherein R 'is hydrogen or a nitrogen protecting group and R''is a protecting group for O then removing the protecting group (s) to give a compound of formula (Ia); or (ii) reacting a compound of formula 2 wherein R ¹ and Ar 1 are as defined in claim 1 and R ^d and R ^b are suitable protecting groups for O and N:

R ^and O-N '

··· R ^fc «♦ ♦ ·· ·· · ··· · * aIky1ačnim with a reagent of formula R ² X or Ar'CHR

Ar ¹ CH = CHCHR ² X, wherein Ar ¹ , R ² are as defined in claim 1 and X is a leaving group, under alkylation reaction conditions or an alcohol of formula AR 1 HR 4 OH in the presence of a coupling agent and a trialkylphosphine, and then removed a protecting group to form a compound of formula (Ia); and (iii) optionally converting the compound of formula Ia prepared in steps (i) - (ii) to the corresponding acid addition salt by treatment with acid (iv) optionally converting the compound of formula Ia prepared in steps (i) - (ii) from above to the corresponding acid addition salt. a free base by treatment with a base; and (v) optionally separating the mixture of stereoisomers of the compound of formula (Ia) prepared in steps (i) - (iv) to give the individual stereoisomers.

In this process, the term "protecting group" refers to a grouping of atoms that, when attached to a reactive group in a molecule, masks, reduces, or prevents its reactivity. Examples of protecting groups can be found in T.W. Greene and P.G. Futs, Protective Groups in Organic Chemistry, (Wiley, 2nd Edition, 1991) and Harrison and Harrison et al. Compendium of Synthetic Organic Methods, Vol. 1-8 (John Wiley and Sons. 19711996). Representative amino protecting groups include formyl, acetyl, trifluoroacetyl, benzyl, benzyloxycarbonyl (CBT), tert-butoxycarbonyl (Boc), trimethylsilyl (ΤΜΞ), 2-trimethylsilylethanesulfonyl (SES), trityl and substituted trityl groups, allyloxycarbonylmethyl, 9fluorocarbonyl (9f) , nitroveratryloxycarbonyl (NVOC) and the like. Representative hydroxy protecting groups include those wherein the hydroxy group is either acylated or alkylated, such as benzyl and trityl ethers, as well as alkyl ethers, tetrahydropyranyl ethers, trialkylsilyl ethers and allyl ethers.

The term "leaving group" means an atom or group that can be displaced by a nucleophile and includes halogen (such as chlorine, bromine, iodine), alkanesulfonyloxy, arensulfonyloxy, alkylcarbonyloxy (e.g. acetoxy), arylcarbonyloxy, mesyloxy, tosyloxy, trifluoromethanesulfonyloxy, aryloxy (e.g. (4-dinitrophenoxy), methoxy, N, O-dimethylhydroxylamino and the like.

The method for introducing a group R, wherein R is -CH 2 R 4, JAr ^1, comprises alkylating the nitrogen atom with a Mitsonobu reaction. In this method, the joint alcohol of formula Ar CHR ^{x of} the compound of formula 13 in the presence of, for example, triphenylphosphine and diethyl azodicarboxylate or a diphenylpyridylphosphine terč.butylazodikarboxylátu (see Tetrahedron Lett., 40: 44974500 (1999). The alkylation is conveniently carried out in a solvent, which is inert under the reaction conditions, preferably in an open chain ether or cyclic ether, at a temperature of about -20 ° C to about 100 ° C, preferably at a temperature of about 0 ° C to about 30 ° C (or at room temperature Regarding other alkylation methods, primary and secondary alcohols are most suitable for reactions under these conditions.

In yet another aspect, the present invention relates to compounds of formula II

wherein R, R ¹ and Ar ^- are as defined above for the compound of formula (Ia).

In yet another aspect, the present invention relates to compounds of formula III * ♦

(R ¹ ) wherein R, R ¹ and Ar ² are as defined for the compound of formula (Ia) above and R ¹² is an alkyl group.

In yet another aspect, the present invention relates to compounds of formula IV

(iv) the meaning defined for the compound of formula (Ia) above and R 'is H or a protecting group and R' is a protecting group.

The compounds of the invention, including the intermediate mentioned above, can be prepared by the methods illustrated in the reaction schemes below.

The starting materials and reagents used in the preparation of these compounds are either available from commercial suppliers such as Aldrich Chemical Co., (Milwaukee, Wisconsin, USA), Bachem (Torrance, California, USA), Emka-Chemie or Sigma (St. Louis, Missouri, USA), Calbiochem-Novabiochem (San Diego, CA) or Tndofine Chemical Co. (Bellemead, NJ, USA) or prepared by methods known to those skilled in the art, such as those disclosed in Fieser and Fieser's Reagents for Organic Synthesis, Vol. 1-15 (John Wiley &amp; Sons, 1991); Rodd's Chemistry of Carbon Compounds, Vol. 1-5 and additions (Elsevier)

Science Publishers, 1989), Organic Reactions, Vol. 1-40 (John Wiley &amp; Sons, 1991) March's Advanced Organic Chemistry (John

Comprehensive Organic

Transformations (VCH Publishers Inc.) Are merely illustrative of some methods by which the compounds of the invention can be prepared by a number of modifications to these schemes.

and the skilled person can do this

The starting materials and reaction intermediates can be isolated and purified using conventional techniques, including, but not limited to, filtration, distillation, crystallization, chromatography, and the like. Such materials can be characterized using conventional methods, including physical constants and spectral data.

Preparation of compounds of formula Ia and Ib

Scheme A, B and compounds of general formula

C describe alternative methods of preparing Formula Ia above and Ib below.

A compound of formula Ia or Ib wherein R is CH (R) Ar ', R ^L and Ar' are as described in the description is prepared from the appropriately N-protected α-amino compound 1 as shown in Scheme A.

Scheme A

^ ^CtQR ²

ROUN

HOHN

By the reaction of α-aminoacetate of formula 1 (wherein R is alkyl, such as

V-, 1 1 1 τ Ί »-. Λ 1—. Λ hcuu _{Λ Λ} Ί 1. . . Ί Cl J- CL -L Λ-_y -L Ζ jciku Je berizyl)

the compound of formula 2 wherein R ² is hydrogen or alkyl under reductive amination reaction conditions, i.e. in the presence of a suitable reducing agent (e.g., sodium cyanoborohydride, triacetoxyborohydroid and the like) and an organic acid (e.g. glacial acetic acid, trifluoroacetic acid and the like) to give the N-alkylated α-aminoester of formula 3.

Suitable solvents for the reaction are halogenated hydrocarbons (e.g. 1,2-dichloroethane, chloroform and the like).

Compounds of formula I are commercially available or can be prepared by methods well known in the art. For example, natural or non-natural amino acid esters such as D-valine benzyl ester p-tosylate, D-valine ethyl ester hydrochloride, D-valine tert-butyl ester hydrochloride, L-, D- or DL-serine methyl ester are commercially available. Alpha-thiomethylamino acids can be prepared according to the procedures described by Arnold, L. D., Kalantar, T. H., Vederas, J. C., J. Am. Chem. Soc. 107, 7108 (1985).

Others can be prepared by esterification of N-protected amino acids (suitable amino protecting groups are tert-butoxycarbonyl, benzyloxycarbonyl, and the like), followed by removal of the amino protecting group as described in Example 1.

Sulfonylation of 3 with the arylsulfonyl chloride of formula 4 provides 2- (arylsulfonylamino) acetate of formula 5. The sulfonylation reaction may be carried out by methods well known in the art by reaction of 3 with a compound of formula 4 in the presence of trimethylsilyl cyanide in acetonitrile. Compounds of formula 4 are commercially available or can be prepared by methods well known in the art. For example, 4-methoxybenzenesulfonyl chloride, 4-methoxy-2,3,6-trimethylbenzenesulfonyl chloride, 4-chloro-2,5-dimethylbenzenesulfonyl chloride, 2-dibenzofuransulfonyl chloride, 4-bromobenzenesulfonyl chloride, 2-naphthalenesulfonyl chloride and 1-naphthalenesulfonyl chloride are commercially available. Others can be prepared according to the procedures described by Bosshard, E. H et al., Helv. Chim. Acta, 42, 1653 (1959); Colter, A.K. and Turkos, R. E. C., Canadian J. of Chem., 56, 585 (1978); Buchanan, G. W. et al., J Org. Chem.,

U ^! 2357-2359 (1975) and Fujrno, Μ. , et al., Chem. Pharm. Bull., Le, 2825-2831 (1981). Typically, the non-sulfonylated arene will be in the form of a non-sulphonylated arene.

-5 ° C to 10 ° C to give the desired arenesulfonyl chloride.

The conversion of 5 to the corresponding carboxylic acid depends on the nature of the R group. For example, if R is a benzyl group, then it is removed under hydrogenation reaction conditions. When R is an alkyl group such as methyl or ethyl, then it is removed under basic hydrolysis reaction conditions, i.e., in the presence of a suitable aqueous base (e.g. sodium hydroxide, lithium hydroxide and the like) in an alcoholic solvent such as methanol, ethanol etc. If R is a tert-butyl group, then it is removed under acidic reaction conditions.

Compound 6 can be converted to a compound of Formula Ia or Ib by converting 6 to an acyl derivative of Formula 7 wherein Y is a leaving group under acylation conditions (e.g., chloro, succinimido, and the like). Treatment of 7 with N, O-bis-trimethylsilylhydroxylamine followed by treatment with acid or addition of methanol gives the compound of formula Ia or Ib directly.

The acyl derivative 7 can be prepared by methods known to those skilled in the art. For example, a compound of formula 7 wherein Y is chlorine can be prepared by reacting compound 5 with a chlorinating agent such as oxalyl chloride in a suitable organic solvent such as methylene chloride.

Alternatively, a compound of Formula Ia or Ib can be prepared from a compound of Formula 6 by two steps of first reacting 6 with an O-substituted hydroxylamine (e.g., O-benzylhydroxylamine, O-tert-butylhydroxylamine and the like) to provide an O-protected hydroxamate of Formula 8. The reaction is carried out in the presence of a coupling reagent (e.g., N, N-dicyclohexylcarbodiimide, N-ethyl-N '- (3-dimethylaminopropyloxycarbodiimide and the like), an organic base (e.g., dimethylaminopyridine, triethylamine, pyridine, N-methylmorpholine and the like); hydroxybenzotriazole.

Suitable solvents for the reaction are methylene chloride, dichloroethane, dimethylformamide and the like. Removal of the protecting group yields a compound of formula Ia or Ib. The reaction conditions employed depend on the nature of the group R ', for example if R' is a tert-butyl group, then the reaction is carried out in an inert solvent such as dichloromethane in the presence of an acid (e.g. dry hydrogen chloride, trifluoroacetic acid and the like). When R 1 is benzyl, a catalyst such as palladium in an inert solvent such as ethyl acetate or tetrahydrofuran is used under hydrogenolysis conditions. A compound of formula 5, Ί or 8 can be converted to a compound of formula Ia or Ib by the procedures described in PCT Application No. 98/32748.

A compound of formula (Ia) or (Ib) wherein R is -CH (R ² ) Ar and the other groups defined herein are also prepared from α-aminoacetate 1 as shown in the scheme.

B.

Scheme B

O

and with ₂ c

H _?

N-S0 ₂ -Ar ²

Ar ¹ R ² CHX st

Ar 2 CHOH

(Ia) / (Ib)

Sulfonylation of a compound of Formula 1 with arylsulfonyl chloride under the reaction conditions described in Scheme A above provides 2-arylsulfonyl acetate of the general formula

of Formula 9, which is converted to a compound of Formula 5 either:

(a) reacting compound 9 with an alkylating agent of the formula Ar ¹ CHR ² X (where X is a leaving group such as chlorine, bromine, mesylate, triflate and the like under alkylating conditions) in the presence of a base (e.g. sodium carbonate, potassium carbonate, cesium carbonate and the like) and suitable solvents such as tetrahydrofuran, dioxane, N, N-dimethylformamide and the like; or (b) reacting compound 9 with an alcohol of formula Ar ¹ CHR ² OH in the presence of trialkylphosphine or triarylphosphine, preferably tributylphosphine, triphenylphosphine, preferably tributylphosphine and a dialkyl azodicarboxylate such as diethyl or diisopropylazodicarboxylate or (1,1'-azodicarbonyl) dipiperidine 1,1'-azodicarbonyl) dipiperidine. Suitable solvents include aromatic hydrocarbons such as benzene and the like.

Compound 5 can then be converted to a compound of formula Ia or Ib as shown in Scheme A above.

A compound of formula (Ia) or (Ib) wherein R is -CH (R ') Ar ‘and the other groups have the meaning herein can also be prepared from the α-amino acid 11 as shown in Scheme C.

Scheme C

deprotection (Ia) / (Ib) ~ τ

R

N-S0 ₂ -Ar ²

Sulfonylation of the α-amino acid 11 with an arylsulfonyl chloride of formula 4 in the presence of a base such as triethylamine provides 2-arylsulfonylaminoacetic acid of formula 12. The reaction is carried out in a mixture of an organic solvent and water such as tetrahydrofuran and water. Compound 12 can be converted to a compound of formula Ia or Ib by method (a) or (b).

In method (a) by esterification 12, a compound of formula 9 (wherein R is an alkyl group such as methyl, tert-butyl or aralkyl such as benzyl) is obtained, which is then converted to a compound of formula Ia or Ib by treatment as described in Schemes A and B above.

In method (b), compound 12 is reacted with an N, O-protected hydroxylamine such as O- (2,4-dimethoxybenzyl) -N- (2,4,6-trimethoxybenzyl) hydroxylamine under the conditions described in Barlaam, B et al. Tet. Lett., Vol 39, 7865, (1998) to give a compound of formula 13. Alkylation of 13 gives a compound of formula 14 which, by treatment with trifluoroacetic acid in methylene chloride in the presence of triethylsilane, provides a compound of formula Ia or Ib (see Barlaam, B). et al., Tet. Lett., Vol. 39, 7865 (1998)).

A compound of formula (Ia) or (Ib) wherein R is -CH (R'j CH = CHAr ') and other groups as defined herein may also be prepared from α-aminoacetate 1 as shown in Scheme D.

Scheme D

Ar ¹ CH = CHCH (R ² ) X

(Ia) / (Ib)

A compound of formula (Ia) or (Ib) wherein R is a group

-CH (R-) CH = CHAr 'is prepared by alkylating a compound of Formula 9 (R cannot be benzyl) with an alkylating agent of Formula 15 wherein X is a leaving group under alkylating conditions (e.g., chlorine, bromine, mesylate, triflate and the like) ) in the presence of a base (e.g. sodium carbonate potassium carbonate, cesium carbonate and the like) and in a suitable solvent such as tetrahydrofuran, dioxane, N, N-dimethylformamide and the like to give a compound of formula 16. Hydrolysis of ester group 16 provides the corresponding acid, which is then converted to a compound of formula Ia or Ib by preparation of an acid chloride derivative followed by treatment with N, O-bis-trimethylsilylhydroxylamine, as described in Scheme A above.

«·« «« «· · · · · · · · · · · · · · · · · · · ·

A compound of formula 15, such as cinnamyl chloride, is commercially available.

A compound of formula (Ia) or (Ib) wherein Ar ² is defined herein, R is CH ² Ar ¹ (where Ar ¹ is 3,4-methylenedioxyphenyl) and R ¹ is -CH 2 NHCOOR (wherein R 'is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl or heterocycloalkyl) can be prepared from the N-protected diaminopropionic acid 2 as outlined in Scheme E and described in more detail in Example 16.

Scheme E

DIC / DMAP / CH 2 Cl 2

QXoh> AG-OH

2. pip / DMF o

QroV ^N ^

BOCHN ''

Al 2 SO 3 Cl

O

Q ^ O ^ NH ^ Ar ² = '/ V *> 00

BOCHN ca piperonyl alcohol

ADDP / BU3P Torque ₂

--——> TEA / CH ₂ Cl ₂

BOCHN

TMSCI / phenol

cAo- ^r

N ^ .Ar * Λ h ₂ n ^x nh ₂ ohthf

------------ ►ROCOpSu

------ ►

TEA / DMAP ch ₂ or ₂ ^H % X

H = hX

, s- ^Ar2

A compound of formula (Ia) or (Ib) wherein Ar 'is defined herein, R is CH ₂ Ar' (wherein Ar ¹ is 3,4-methylenedioxyphenyl) and R ¹ is -CH ₂ NHCONHAr may be prepared from a resin of Formula 7 (scheme E) as shown in the scheme

F and described in more detail in Example 17.

Scheme F

ArNCO

THF

NH ₂ OH / THF

---->

HIM.

In another aspect, the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of a compound of Formula Ia according to various methods as defined above and a pharmaceutically acceptable excipient.

The compounds of the present invention can be used as therapeutically active substances, especially in the form of medicaments. In particular, the compounds of the invention are useful in the treatment of diseases associated with an overcoating of interstitial collagen, such as interstitial pulmonary fibrosis, pericentral fibrosis, Symmers fibrosis, perimuscular fibrosis, kidney and liver fibrosis, endocardial sclerosis, hepatitis, acute respiratory stress syndrome, arthritis respiratory distress, arthritis fibrosis, tendon surgery, corneal scarring, surgical adhesion and restenosis.

The compounds of the present invention are procollagen C-proteinase inhibitors.

Therefore, they inhibit the C-terminal processes of type I, II and III collagens that are necessary for their ability to form insoluble collagen fibrils. Further, selected compounds of the invention selectively inhibit procollagen C-proteinase over other collagen degradation enzymes such as collagenase-1, collagenase-2 and collagenase-3. Thus, the natural collagen resorption mediated by collagenase-1, collagenase-2, and collagenase-3 is largely unchanged, resulting in compounds with higher therapeutic efficacy. Preferred compounds of the present invention inhibit procollagen Cproteinase with more than 100 fold selectivity than collagenase-1, collagenase-2 and collagenase-3. Selective inhibition of procollagen C-proteinase in comparison! with collagenase-1, collagenase-2, and coagenase-3 was demonstrated by the assays described in the examples. Accordingly, the present invention enables the treatment of fibrotic diseases by administering to the patient an agent that selectively inhibits procollagen Cpolecan, bruviae coli ď zOU-1, coli enaZOU-2, and collagenase-3.

In yet another aspect, the present invention provides the use of a compound of formula Ib hohn

(lb)

· · ♦ ♦ v v v v. V v

Where:

cycloalkyl, aryl,

R 1 is alkyl, haloalkyl, heteroalkyl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocyclylalkyl, cycloalkylalkyl,

- (alkylene) -C (O) -X (wherein X is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, amino, monosubstituted amino, disubstituted amino, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy, cycloalkoxy, cycloalkylalkoxy , heteroalkyloxy, aralkyloxy, or heteroaralkyloxy), or —C (-NR ') NHSO ₂ R (wherein R' is hydrogen or alkyl, and R is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, or heterocyclylalkyl );

R is -CH (R ² ) Ar ¹ or -CH (R ² ) CH = CHAr ¹ , where R ² is

Ar ¹ is aryl or heteroaryl;

hydrogen or alkyl; and

Árje either:

ii) a phenyl ring of the general formula

T .5 independent or halogen;

R ¹ and R ^s; are, independently

on each other, hydrogen, alkyl, or halogen;

R 'is alkyl, haloalkyl, heterocyclyl, alkylthio, arylthio, aralkylthio, heteroarylthio, heteroaralkylthio, cycloalkylthio, cycloalkylalkylthio, alkoxy, aryloxy, aralkoxy, heteroaryloxy, heteroaralkyloxy, cycloalkoxy, cyclcalkylalkoxy, alkyloxycarbonyl, amino, alkoxycarbonyl, hydroxy, carboxy, hydroxy, , moalkylamino, dialkylamino,

Alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, heteroarylsulfonyl, heteroaralkylsulfonyl, cycloalkylsulfonyl, cycloalkylalkylsulfonyl, or -Y- (alkylene) -C (O) -2 [wherein Y is a bond, -NR ^a ~, -O-, or -S (O) _n - (wherein n is from 0 to 2), R ^a is hydrogen or alkyl, and Z is alkoxy, hydroxy, amino, monosubstituted amino, or disubstituted amino]; or

R ⁵ together with R ⁴ form -O- (CR ⁸ R ⁹ ) wherein n is 2 or 3 and each R ^e and R ⁹ are independently hydrogen or alkyl; or the carbon atoms to which R ⁵ and R ⁴ are attached are fused to the C 2 -C 3 carbons of the benzofuran ring; provided that at least two of R ³ , R ⁴ , R ⁶ and R 'are not simultaneously hydrogen; or (ii) a naphthyl ring of formula (b):

(b) where:

R 1 is hydrogen, alkyl, alkoxy, or halogen; and

R '^; is hydrogen, alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl and their pharmaceutically acceptable salts, prodrugs, individual isomers, and mixtures of isomers;

for the preparation of a medicament for the treatment of a disease treatable by a procollagen C-proteinase inhibitor, preferably for the treatment of diseases such as interstitial pulmonary fibrosis, pericentral fibrosis, Symmers fibrosis, perimuscular fibrosis, kidney and liver fibrosis, idiopathic pulmonary fibrosis, endocardial sclerosis, nepatitis, acute stress syndrome , arthritis, cystic fibrosis, tendon surgery, corneal scarring, surgical adhesion and restenosis. Preferred compounds of formula (Ib) are those described above for various embodiments of compounds of formula (Ia).

The ability of compounds of formulas Ia and Ib to inhibit procollagen C-proteinase activity can be demonstrated by a variety of in vitro assays known to those skilled in the art, such as that described in Example 21. The selectivity to collagenase enzymes can be determined by the assay described in Example 22.

For selected compounds, the following inhibitory and selective data were obtained based on the results of Test A of Example 21 and Test of Example 22.

Table I, merge C. ICr, for PCP (pm) Selectivity for PCP / Col-1 Selectivity for PCP / Col-2 Selectivity for PCP / Col-3 12 0,0690 89, 9 23.2 14, 5 5 0.0730 520, 5 123, 3 15 Dec 0,0660 515, 1 454.5 145 0,1100 400, 0 136, 4 40 0, 0680 367, 6 55, 9 126 0, 0260 128 0,0300 82 0,0400 1775.0 250, 0 1950,0 4 0, 04 950 180

The in vivo efficacy of compounds of formulas Ia and Ib against fibrotic disease and collagen coatings can be demonstrated in a variety of animal models, including the murine bleomycin-induced pulmonary fibrosis model ((Phan, SH, et al., Bleomycininduced Pulmonary Fibrosis, Am. Rev. Respir. Dis.). , 124: 428434 (1981) and Piguet, PF et al., "Effective Treatment of Pulmonary Fibrosis Elicited in Balls by Bleomycin or Silica with Anti-CD-1 Antibodies, Am. Rev. Resp. Dis., 147: 435- 441 (1993)), an implanted fungal model (Immnemri, EN et al.

Σ. · ♦ ····

Human Relaxin Decreases Coliagen Acumulation In Vivo in Two Rodent Model of Fibrosis, J. Invest. Dermatol., 101: 280-285 (1993), a carbon chloride or NMDU induced renal fibrosis model, as well as other animal models cited in WO 97/05865 ("C-Proteinase Inhibitors Treatment of Disorders Relating to Overproduction of Coliagen"), published 20.2. .1997.

In general, the compounds of formulas Ia and Ib of the invention as defined in the various embodiments above are administered in a therapeutically effective amount by any known route of administration for substances for similar purposes. The actual amount of the compound of the invention, i.e. the active ingredient, depends on numerous factors, such as the severity of the disease being treated, the age and health of the subject being treated, the potency of the compound being administered, the form of administration, and other factors. The medicament may be administered more than once daily, preferably once or twice daily.

The therapeutically effective amount of the compounds of Formula Ia or Ib is in the range of about 0.05-50 mg / kg body weight of the subject to be treated per day, preferably 0.3-20 mg / kg / day. Thus, when administered to a 70 kg person, the daily dose will range from 21 mg to 1.5 g.

In general, the compounds of the invention are administered in the form

Administration: oral, systemic (e.g., transdermally, intranasally, or suppository), or paranterally (e.g., intramuscularly, intravenously, or subcutaneously). A preferred route of administration is systemic use using the usual daily dosage regimen, which may be adjusted to the degree of difficulty.

Intranasal administration is typically carried out with dry powder formulations, liquid solutions or suspensions suitable for mist formation or with aerosol propellants suitable for use in metered dose inhalers.

Alternatively, the drugs may be associated with microspheres made of suitable materials such as gelatin, dextran, collagen, or albumin. These microspheres are preferably supplied in a freeze-dried form with a nasal device for introducing air or powder into the body cavities or in a pressurized aerosol canister. Penetration enhancers, such as amphiphilic steroids, can be used as additives that enhance systemic absorption of the drug into tissues.

Effective administration can also be achieved by pulmonary or respiratory delivery since the polypeptides are readily absorbed in the cellular alveoli of mammalian lungs. Preferably such administration does not require the use of penetration enhancers. Devices and methods for pulmonary delivery deep into the lungs are described in US Patent No. 5,780,014, issued July 14, 1998 and US Patent 5,814,607, issued September 20, 1998.

Finally, the compounds of the invention may be administered transdermally, whereby the drug is typically placed on the skin surface and allowed to penetrate the skin. Transdermal delivery involves the use of structures such as adhesive patches or the like that serve as a reservoir for the drug and allow the drug to diffuse skin contact. In one general type, the structure is a three-dimensional stable matrix known as a monolithic matrix.

Such matrices are described in more detail in US Patent No. 5,804

/ Ί á 1 á Q Π / Q “£ 1 ~ 7 1 -i f 1 1 -i 4 - - f - * * - --- - · - - - - CSλΰ triCS zhu t O Θ from a polymer and copolymer of acrylic latex, methacrylic esters and vinyl acetate. acrylic esters,

The choice of formulation depends on various factors such as the mode of administration of the drug (e.g., tablets, pills or capsules are suitable for oral administration) and the bioavailability of the drug. More recently, pharmaceutical formulations have been developed specifically for pharmaceuticals having poor bioavailability on the principle that bioavailability can be increased by increasing the surface area, i.e. by reducing the particle size.

A ·

For example, U.S. Pat. No. 4,107,288 describes a pharmaceutical composition having a particle size of 10 to 1000 nm, wherein the active agent is carried on a cross-linked matrix of a macromolecule. U.S. Pat. No. 5,145,684 discloses a method of manufacturing a pharmaceutical composition wherein the drug is pulverized to nanoparticles (mean size 400 nm) in the presence of a surface modifier and dispersion in a liquid medium to obtain a pharmaceutical composition with significantly higher bioavailability.

The pharmaceutical compositions generally comprise a compound of Formula Ia or Ib together with at least one pharmaceutically acceptable excipient. Acceptable excipients are nontoxic excipients which do not adversely affect the therapeutic effect of the compound of formula Ia or Ib. Such excipients may be solid, liquid, semi-solid or, in the case of aerosols, gaseous excipients which are generally available to those skilled in the art.

Solid pharmaceutical excipients include, for example, starch, cellulose, talc, glucose, lactose sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, whey powder and the like. Liquid and semi-solid pharmaceutically acceptable excipients include, for example, glycerol, propylene glycol, water, ethanol, various oils, including petroleum oils and animal, vegetable and synthetic oils, for example peanut oil, soybean oil, mineral and sesame oil. Preferred liquid carriers, especially for injectable solutions, are water, brine, aqueous dextrose and glycols.

Compressed gases may be used to disperse the compounds of the invention in aerosol form. As inert gases, preferably nitrogen, carbon dioxide, etc. are used.

Other suitable pharmaceutical excipients and formulations are disclosed in Remington's Pharmaceutical Science, edited by E.W. Martin (Mack Publishing Company, 1st Edition, 1990).

• · · · · · · · · · ·

The amount of active ingredient in the pharmaceutical composition can vary within wide limits, as is known to those skilled in the art. Generally, the composition comprises from 0.01% to 99.99% by weight of the compound of formula (I), based on the composition as a whole, with up to 100% being supplemented with suitable excipients. The preferred weight content of the compound is 1-80%. Representative pharmaceutical formulations comprise a compound of Formula Ia or Ib as described in Example 18.

DETAILED DESCRIPTION OF THE INVENTION

The following preparations and examples are given by way of illustration only and are not intended to limit the scope of the present invention in any way.

Example 1

N-Hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutyramide (Table 1, Compound 12)

Step 1

N-tert-butoxycarbonyl-D-valine (70 g, 0.32 mol) and cesium carbonate (200.2 g, 0.615 mol) were stirred in dry dimethylformamide (550 mL). Benzyl bromide (40.32 mL, 0.336 mol) was added and the reaction was stirred overnight at room temperature. Concentrate the material on a rotary evaporator and dissolve the residue in methylene chloride (200 mL), and layer.

methylene chloride was washed with water and brine, dried over magnesium sulfate and concentrated to give the benzyl ester

N-tert-butoxycarbonyl-D-valine (97 g) as a viscous oil.

Step 2

N-tert-butoxycarbonyl-D-valine benzyl ester (70.7 g, 0.23 mol) was dissolved in a 1: 4 mixture of trifluoroacetic acid and methylene chloride (150 mL) and the reaction mixture was heated at 50-60 ° C. . After 6 hours, the reaction mixture was concentrated to give D-valine benzyl ester of the trifluoroacetic acid salt (156.8 g) as a viscous oil which was converted to the free amine before use.

Step 3

1N Sodium hydroxide (80 ml) was added to a solution of D-valine benzyl ester of the trifluoroacetic acid salt (10 g, 31.1 mmol) in methylene chloride (80 ml) and the reaction mixture was stirred until the starting material was converted to the free amine. The organic phase was collected and washed with brine, dried over magnesium sulfate, and concentrated to give D-valine benzyl ester (5.35 g) as a clear oil.

Step 4

To a solution of D-valine benzyl ester (4 g, 19.3 mmol) and trimethylsilyl cyanide (7.2 mL, 57.9 mmol) in acetonitrile (40 mL) was added 4-methoxy-2,3,6-trimethylbenzenesulfonyl chloride (4, 20 mL). 8 g, 19.3 mmol). After 3 hours, the reaction mixture was diluted with ethyl acetate (100 mL), and transferred to a separatory funnel. Add aqueous hydrochloric acid (120 mL, 2.51), separate the organic layer, wash with 5 sodium bicarbonate and brine

and then dried over magnesium sulfate. The organics were removed in vacuo to give 2 (R) - (4-methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3-methyl-butanoic acid benzyl ester (8 g) as a brown oil.

Step 5

To a mixture of 2 (R) - (4-Methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3-methyl-butanoic acid benzyl ester (4.5 g, 10.72 mmol), 3,4- (methylenedioxy) phenylmethanol (2.04) g, 13.41 mmol), and tributylphosphine (3.35 mL, 13.4 mmol) in dry benzene (60 mL) cooled in an ice bath were added 1.1 (azodicarbonyl) dipiperidine (3.38 g, 13, 4 mmol). The reaction mixture was stirred overnight at room temperature and then flash chromatographed on a silica gel column (5-10% ethyl acetate / hexanes) to give 2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2) benzyl ester. 3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (4.8 g) as a white solid.

Step 6

To a solution of 2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid benzyl ester (4.7 g, 8.49 mmol) in 4: 1% ethanol / tetrahydrofuran (40 mL) was added with 10% Pd / C (0.15 g). The reaction mixture was placed under a hydrogen balloon. After 3 hours, the reaction mixture was filtered through celite and the celite cake was washed with ethanol. The filtrate was concentrated to give 2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (3.9 g) as a white foam .

Step 7

• ♦ · · ·

Κ a solution of 2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (3.82 g, 8.24 mmol) in dry methylene chloride (20 mL) was added oxalyl chloride (2.2 mL, 24.72 mmol) and a drop of dimethylformamide. The reaction mixture was stirred for 4 hours and then concentrated. The residue was dissolved in methylene chloride (20 mL), and N, O-bistrimethylsilylhydroxylamine (8.8 mL, 41.2 mmol) was added. After 4 hours, methanol (1 mL) was added and stirring was continued for 30 minutes. Silica gel (10 g) was added and the material was concentrated to dryness. The resulting powder was flash chromatographed on a silica gel column eluting with 50% ethyl acetate / hexanes to give N-hydroxy-2 (R) - [(3,4-methyldioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutyramide (2.46 g).

Example 2

N-Hydroxy-2 (R) - [(4-methoxycarbonylbenzyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutyramide (Table 1, Compound 21)

HOHN

Step 1

To an ice-cooled solution of D-valine (50.5 g, 0.43 mol) and triethylamine (145 mL, 1.034 mol) in a 1: 1 mixture of tetrahydrofuran and water (350 mL) was added 4-methoxybenzenesulfonyl chloride (88.2 g, 0.43 mmol). The reaction mixture was stirred and warmed to room temperature overnight. Volatile organic components were removed and the aqueous phase was extracted with diethyl ether. The aqueous layer was acidified to pH 3 with 10¾ hydrochloric acid, and the product was extracted into ethyl acetate. The ethyl acetate layer was washed with brine, dried over magnesium sulfate, and then concentrated to give 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid (90.45 g).

Step 2

To a solution of 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid (40 g, 139.2 mmol) and cesium carbonate (85.7 g, 444 mol) in dimethylformamide was added benzyl bromide (16.1 g, 135 g). mmol). The reaction mixture was stirred overnight. Dimethylformamide was removed on a rotary evaporator and the residue was dissolved in ethyl acetate (200 mL) and partitioned between equal amounts of water. The organic phase was collected and washed with the same amount of brine. The aqueous phases were re-extracted with ethyl acetate (2 x 150 mL), combined, dried over magnesium sulfate and condensed to give 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid benzyl ester (42.6 g) as white crystalline solid.

Step 3

To a solution of 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid benzyl ester (1 g, 2.65 mmol) and 4-carboxymethylbenzyl bromide (0.577 g, 2.52 mmol) in dry dimethylformamide (60 mL) was added carbonate potassium (0.55 g, 4 mmol). The reaction mixture was stirred overnight and then condensed on a rotary evaporator. Purification by silica gel flash column chromatography using (5%) ethyl acetate / hexanes as eluent gave 2 (R) - [(4-methoxycarbonylbenzyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid benzyl ester (0.965 g) which is converted to N-hydroxy-2 (R) - [(4-methoxycarbonylbenzyl) -

• ·· · * ··. 71 ·· · · ···· · J · > j. ······: ,,,. ··· · · * · · · · · · - (4-methoxybenzenesulfonyl) amino] -3-methylbutyramide according to

procedures described in steps 6 and 7 of Example 1 above.

Example 3

N-Hydroxy-2 (R) - [(1H-indol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutyramide (Table 1, Compound 3)

HOHN

About me

Step 1

To a solution of 5-indolecarboxylic acid (5.08 g, 31.5 mmol) in 1: 1 methanol / methylene chloride (40 mL) was added portionwise over 15 minutes (trimethylsilyl) diazomethane (33 mL, 2M solution in hexanes). The yellow colored solution was concentrated on a rotary evaporator to give the 5-indolecarboxylate as a white powder (5.5 g).

Step 2

To a solution of methyl b-indolecarboxylate (4.9 g, 27.97 mmol) in dry acetonitrile (45 mL) was first added di-tert-butyl hydrogen carbonate (6.41 g, 29.36 mmol) followed by 4-dimethylaminopyridine (142 mL). mg, 1.43 mmol). The reaction mixture was stirred for 3 hours and then packed with a flash silica gel column eluting with ethyl acetate / hexanes (5%) to give methyl (N-tert-butoxycarbonyl) indole-5-carboxylate as a clear viscous oil (7.69 g).

Step 3 • * ♦ · ·

To a cold solution (-78 ° C) of methyl (N-tert-butoxycarbonyl) indole-5-carboxylate (7.6 g, 27.9 mmol) in dry tetrahydrofuran (75 mL) was added diisobutylaluminum hydride (57 mL) via syringe over 5 minutes. ml, 1.5 M in toluene). After 1.5 hours, the reaction was quenched by the careful addition of methanol (15 mL) and heated at room temperature for 45 minutes. Under vigorous stirring, water (20 mL) and saturated ammonium chloride solution (10 mL) were added, and the resulting inorganic precipitate was removed by filtration. The filtrate was condensed on a rotary evaporator and the residue was partitioned between 1: 1 ethyl acetate / water (160 mL). The ethyl acetate phase is washed with brine, and the aqueous phase is extracted again with ethyl acetate. The organic phase was combined, dried over magnesium sulfate, filtered and concentrated to give (N-tert-butoxycarbonyl) indole-5-methanol (7.35 g) as a semi-viscous oil which was used in the next step without further purification. .

Step 4

To an ice-cooled mixture of 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid benzyl ester (5 g, 13.25 mmol) [prepared according to the procedure described in Example 2], N-tert-butoxycarbonyl-5- of indolmethanol (3.8 g, 14.6 mmol) and tributyl estride (3.6 mL, 14.6 mmol) in dry benzene (60 mL) were added [1,1'-azodicarbonyl] dipiperidine (3.68 g, 14 mL). , 6 mmol). The reaction mixture was stirred at room temperature overnight and then chromatographed on a silica gel column eluting with (5-10%) ethyl acetate / hexanes to give 2 (R) - [(N-tert-butoxycarbonylindol-5-ylmethyl) - (benzyl ester) - ( 4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid (6.5 g) as a foaming semi-solid of white color.

Step 5

A solution of 2 (R) - [(N-tert-Butoxycarbonylindol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid benzyl ester (2.7 g, 4.45 mmol) and trifluoroacetic acid (5 mL) in methylene chloride (15 ml) was stirred at room temperature for 2 hours. The organics were removed in vacuo, the residue was dissolved in ethyl acetate (80 mL) and the ethyl acetate layer was washed with 5 5 sodium bicarbonate and brine. The organic layer was dried over magnesium sulfate and concentrated to give a white foamy solid which was chromatographed on a silica gel column eluting with (5-100%) ethyl acetate / hexanes. This gave 2 (R) - [(1H-indol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid benzyl ester (1.7 g) as a white foamy semi-solid which was converted to 2 (R) - [(1H-Indol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid according to the procedure described in Example 1, Step 6 above.

Step 6

To an ice-cooled solution of 2 (R) - [(1H-indol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid (0.32 g, 0.77 mmol), O-benzylhydroxylamine (0, 35 mL, 2.3 mmol),

-h vdrox vben zntri aznl h vrh rn (Π. Ί 1 0 yy f) ΊΊ mmn 1 ϊ = _í - - ---- a ------ 1 - r --- r ⁱⁿ ffr -

N-methylmorpholine (0.12 mL, 1.1 mmol) in anhydrous dimethylformamide was added 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride salt (0.221 g, 1.2 mmol). The reaction mixture was stirred overnight and then concentrated. The residue was dissolved in ethyl acetate (80 mL), and washed with 1.5% hydrochloric acid, 5% sodium bicarbonate, and brine. Crystallization of the residue from the hot CH.Cl mixture. _: / Hexanes, followed by purification of the mother liquor by preparatory chromatography, thin «·; . · ···.:.

Layer using 5% methanol / methylene chloride as eluent yielded 2 (R) -N-benzyloxy - [(1H-indol-5-ylmethyl) - (4)].

(methoxybenzenesulfonyl) amino] -3-methylbutyramide (0.31 g) as a brownish crystalline powder.

Step 7

To a solution of 2 (R) -N-benzyloxy - [(1H-indol-5-ylmethyl) - (4-methoxy-benzenesulfonyl) amino] -3-methylburamide (0.34 g, 0.58 mmol) in 1: 1 Pd / C (0.075 g) was added to the ethanol / tetrahydrofuran mixture (15 ml). The reaction mixture was placed under a hydrogen balloon. After 2.5 hours, the reaction mixture was filtered through a pad of celite (3.0 g) and the pad of celite was washed with ethanol (200 mL). The filtrate was concentrated to give a brownish semi-solid. Purification by preparative thin layer chromatography (7% methanol / methylene chloride) afforded N-hydroxy-2 (R) - [(1H-indol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methyibutyramide (200 mg) as a brownish solid.

Example 4

N-Hydroxy-2 (R) - [(3-nitro-4-methylbenzyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutyramide (Table 1, Compound 23)

HOHN

Step 1

To an ice-cooled solution of 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid (30 g, 104.4 mmol), [prepared according to the procedure described in Example 2, Step

1], in methylene chloride was added via addition funnel over 45 minutes

N, N'-diisopropyl-O-tert-butylisourea [may be prepared according to the procedure described in Lon J. Mathias, Synthesis, 561-576, (1979)] (75 mL, 3.5 M solution). The reaction mixture was kept at 0 ° C for 2 hours and then warmed to room temperature overnight. Purification by silica gel flash column chromatography eluting with (10-20%) ethyl acetate / hexanes gave 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid tert-butyl ester (18 g) as a white crystalline solid. .

Step 2

To a solution of 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid tert-butyl ester (0.15 g, 0.44 mmol) and potassium carbonate (0.32 g, 2.32 mmol) in dry dimethylformamide (15 mL). mL) was added 3-nitro-4-methylbenzyl chloride (81.1 mg, 0.44 mmol). The reaction mixture was stirred overnight and concentrated on a rotary evaporator. The residue was dissolved in a 1: 1 mixture of ethyl acetate and brine (50 mL). The organic phase was isolated, dried over magnesium sulfate, concentrated to give 2 (R) - [(3-nitro-4-methylbenzyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid tert-butyl ester (0.196 g) ) as a yellow viscous oil which is converted to 2 (R) - [(3-methyl-4-methylbenzyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid according to the procedure described in Example 10, Step 8 further. 2 (R) - [(3-Nitro-4-methylbenzyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid is then converted to N-hydroxy-2 (R) - [(3-nitro-4-methylbenzyl) 1- (4-methoxy-7-benzenesulfonyl) amino] -3-methylbutyramide according to the procedure described in Example 1, steps 6 and 7 above.

Example 5

N-Hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-hydroxypropionamide (Table 1, Compound 5)

Step 1

To the D-serine suspension (6.95 g,

66.1 mmol) in acetonitrile (100 mL) was added trimethylsilyl cyanide (40 mL,

298 mmol) and the resulting solution was heated to 80 ° C. After 1 hour, 4-methoxy-2,3,6-trimethylbenzenesulfonyl chloride (17.3 g, 69.4 mmol) was added and heating was continued. After 12 hours, the reaction mixture was cooled to room temperature. Methanol (15 mL) was added, and the organics were removed in vacuo. The residue was diluted with diethyl ether (300 mL), cooled to 0 ° C and adjusted to pH 8 with 6N aqueous sodium hydroxide. The organic layer was collected and the aqueous layer was extracted with diethyl ether. The aqueous layer was adjusted to pH 4 and extracted again with ethyl acetate. The combined organic extracts were dried over magnesium sulfate and concentrated to give 2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonylamino) -3-hydroxypropionic acid (20.5 g) as a brown foam which was used without further cleaning.

Step 2

• ·· 99 9 9 • 9 • · 9 · • · »9 · ·· • 9 • 9 9 · · 99 9 · 9 · 9 9 * 9 9 9 9 • 9 ··. 9 9 9 · 9 9 · 9 • 9 • 9 • 9 9 ··

To a solution of 2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonylamino) -3-hydroxypropionic acid (27.9 g, 87.9 mmol) in dimethylformamide (280 mL) at 0 ° C was added carbonate potassium (72.9 g, 527 mmol) and a solution of 3,4-methylenedioxybenzyl chloride (60 g, 170.8 mmol), 50% (w / w)) in methylene chloride. After 2 hours, lithium iodide (5.88 g, 44 mmol) was added and the reaction mixture was heated at room temperature for 2 hours. After 6 hours, the reaction mixture was partitioned between ethyl acetate (600 mL) and water (250 mL). The organic layer was separated, dried over magnesium sulfate and concentrated in vacuo. The crude product is chromatographed (300 g SiO ₂ , 15% ethyl acetate-hexanes) to give 2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonylamino) -3-hydroxypropionic acid 3,4-methylenedioxybenzyl ester (38, 4 g), which is used directly in the next reaction without further purification.

Step 3

2 (R) - (4-Methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3-hydroxy-propionic acid 3,4-methylenedioxybenzyl ester (38.4 g) was dissolved in methylene chloride (140 mL) and dihydropyran (23 mL). The reaction mixture was cooled to 0 ° C and p-toluenesulfonic acid monohydrate (0.78 g) was added. After 1 h, the reaction mixture was poured into saturated aqueous sodium bicarbonate (200 mL). The organic layer was separated, dried over magnesium sulfate, and concentrated in vacuo. This residue was chromatographed (300 g SiO 2, 157 ethyl acetate / hexanes) to give

2 (R) - (4-Methoxy-2,6-dimethyl-benzenesulfonylamino) -3- (tetrahydropyran-2-yloxy) -propionic acid 3,4-methylenedioxybenzyl ester <41.4 g).

Step 4

·· • 9 9 « • 9 • · • · • * • · • 9  · ·· ♦ • • · • • ·· ·· tet

* * ·

To a solution of 3,4-methylenedioxybenzyl ester 2 (R) - (4-methoxy-2,6)

-dimethylbenzenesulfonylamino) -3- (tetrahydropyran-2-yloxy) propionic acid (9.0 g, 16.8 mmol) in benzene (150 mL) at 0 ° C was added 3,4-methylenedioxyphenylmethanol (3.8 g,

25.2 mmol), tri-n-butylphosphine (5.1 g, 25.2 mmol), and 1,1 '- [azodicarbonyl] dipiperidine (6.35 g, 25.2 mmol). The reaction mixture was heated at room temperature for 4 hours. After 16 hours, the reaction mixture was diluted with an equal amount of hexanes, cooled at 0 ° C for 2 hours, and filtered. The residue was chromatographed (300 g SiO ₂ , 15% ethyl acetate / hexanes) to give 3,4-methylenedioxybenzyl ester 2 (R) - [(3,4-methylenedioxybenzyl) 3,4-methylenedioxybenzyl ester.

- (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3- (tetrahydropyran-2-yloxy) propionic acid (10.0 g) as a light orange oil.

Step 5

To a solution of 2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3- (tetrahydropyran-2-yloxy) propionic acid 3,4-methylenedioxybenzyl ester (3, 26 g (4.57 mmol) in argon degassed 80% ethanol / tetrahydrofuran (100 mL) was added 10% Pd-C (2 g) and the resulting reaction mixture was hydrogenated at atmospheric pressure for 45 min. The reaction mixture was poured into water. aryonerii, kSG Sé filLLiijě piěS celit, ď. The celite pad was washed with 80% ethanol / methylene chloride. The filtrate was concentrated and azeotroped with tetrahydrofuran (200 mL) and the residue was dissolved in dimethylformamide (25 mL). O-benzylhydroxylamine (1.75 g, 14.5 mmol), HOBT (0.71 g, 5.2 mmol), and EDAC (2.75 g) were added, and the reaction mixture was stirred for 16 hours.

The reaction mixture was diluted with ethyl acetate and washed with 2.4 N aqueous hydrochloric acid and saturated aqueous sodium bicarbonate. The mixture was then dried over magnesium sulfate and concentrated in vacuo to give crude

N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3- (tetrahydropyran-2-yloxy) propionamide (2.8 g), which is used directly in the next reaction without further purification.

Step 6

To a solution of N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3- (tetrahydropyran-2-yloxy) propionamide (1,7 g, 4.3 mmol) in methanol (100 mL). p-toluenesulfonic acid monohydrate (150 mg) was added at 0 ° C. After 12 hours, the reaction mixture was warmed to room temperature and stirred for an additional 5 hours. The reaction mixture was concentrated and the residue was chromatographed (Biotage 40M; 20% to 50% ethyl acetate-hexanes) to give N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6) (Dimethylbenzenesulfonyl) amino] -3-hydroxypropionamide (1.60 g).

Step 7

To a solution of N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3-hydroxypropionamide (3.0 g, 5.39 mmol) in argon Deoxygenated ethanol-tetrahydrofuran (160 mL) was added with 10% Pd-C (1.3 g) and the resulting mixture was hydrogenated at atmospheric pressure for 45 min. The reaction mixture was degassed under argon and the slurry filtered through celite. The celite cake was washed with 80% ethanol-methylene chloride and the filtrate was concentrated to near dryness to crystallize to near dryness. The slurry was filtered, washed with 50% diethyl ether-hexanes to give N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3- hydroxypropionamide (2.38 g) as a white solid.

Example 6

N-Hydroxy-3-acetoxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] propionamide (Table 1, Compound 14)

Step 1

To a solution of N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3-hydroxypropionamide (450 mg, 0.82 mmol) in pyridine (2). ml) acetic anhydride (0.09 ml, 0.98 mmol) was added at 0 ° C. The reaction mixture was heated at room temperature for 12 hours and then partitioned between 2N aqueous hydrochloric acid and methylene chloride (100 mL). The methylene chloride layer was separated, dried over magnesium sulfate and filtered. Purification of the residue by preparative TLC (30% ethyl acetate-hexanes) afforded N-benzylxy-2 (R) -1- (3,4-methylpyrimidin-2-yl) - (4-methyl-2,6-dimethylbenzenesulfonyl) amino] -3-acetoxypropionamide .

Step 2

To a solution of N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3-acetoxypropionamide, dissolved in an argon-deoxygenated mixture of 80% ethanol and tetrahydrofuran (15 mL) , add 10 ·? Pd-C (100 mL) and the resulting mixture was hydrogenated at atmospheric pressure for 45 min. The reaction mixture was degassed under argon and the slurry filtered through celite. The celite cake was washed thoroughly with 80% ethanol / methylene chloride and the filtrate was concentrated. dissolved in ethyl acetate (1-2 mL), and slowly added to rapidly stirred hexanes (100 mL) to form a precipitate, the precipitate was filtered and dried (50 ° C; 1 tor) to give N-hydroxy-2 ( R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3-acetoxypropionamide (171.3 mg) as a white powder.

Example 7

N-Hydroxy-2 (R) - [(4-methoxy-2,5,6-trimethylbenzenesulfonyl) - {1 H}

-indol-5-ylmethyl) amino] -3-tert-butoxypropionamide (Table 1, Compound 15)

HOHN

Step 1

To a solution of 1H-indole-5-carboxylic acid (5 g, 31.0 mmol) in 70% methanol / methylene chloride (105 mL) at 0 ° C was added trimethylsilyldiazomethane in hexanes (46 mL, 46 mmol).

After 45 minutes, the reaction mixture was concentrated to give 1H-indole-5-carboxylic acid methyl ester (5.2 g).

Step 2

To a solution of 1H-indole-5-carboxylic acid methyl ester

(3.6 g,

20.6 mmol) in tetrahydrofuran (180 mL) at 0 ° C was added sodium hydride (0.65 g, 21.9 mmol). After 10 minutes, 2-trimethylsilanylethanesulfonyl chloride (4.4 g, 2.19 mmol) was added, and the reaction mixture was warmed to room temperature. After 3 hours, acetic acid (1.6 mL, 26.8 mmol) was added and the reaction mixture was concentrated. The crude product was chromatographed (Biotage 40M column, 2.5% ethyl acetate-hexanes) to give 1- (2-trimethylsilanylethanesulfonyl) indole-5-carboxylic acid methyl ester (5.43 g) as a white solid.

Step 3

To the 1- (2 -) methyl ester solution

-trimethylsilanylethanesulfonyl) indole-5-carboxylic acid (7.4 g, 21.9 mmol) in tetrahydrofuran (100 mL) at -78 ° C was added DIBALH® (44 mL, 1.5M, 65.5 mmol) in toluene.

The reaction mixture was stirred at -78 ° C for 45 minutes, at 0 ° C for 10 minutes, and at room temperature for 15 minutes. The reaction mixture was recooled to -78 ° C and ethyl acetate (100 mL) and saturated aqueous ammonium chloride (50 mL) were added. The reaction mixture was warmed to room temperature and the bulk white precipitate was filtered through celite. The biphasic mixture was extracted with ethyl acetate. The combined organic layers were washed with water, dried over magnesium sulfate and concentrated. The solid residue was triturated with 30% diethyl ether / hexane to give [1- (2-trimethylsilanylethanesulfonyl) indol-5-yl] methanol (6.7 g), which was used in step 6 below.

Step 1

To a suspension of O-tert-butyl-D-serine (2.66 g, 16.5 mmol) in acetonitrile (25 mL) was added dimethylsilylquanide (10 mL,

74.5 mmol) and the reaction mixture was heated at 80 ° C for 1 h. 4-Methoxy-2,3,6-trimethylbenzenesulfonyl chloride (4.3 g, 17.4 mmol) was added and heating was continued. After 12 hours, the reaction mixture was cooled to room temperature and methanol (15 mL) was added. The reaction mixture was concentrated in vacuo and the residue was diluted with diethyl ether (100 mL). The reaction mixture was cooled to 0 ° C, and the pH was adjusted to 8 using 6N aqueous sodium hydroxide solution. The layers were precipitated and the aqueous layer was extracted with diethyl ether. The aqueous layer was then adjusted to pH 4 and extracted with ethyl acetate. The combined organic extracts were dried over magnesium sulfate and concentrated to give 2 (R) -2- (4-methoxy-2,3,6-trimethylbenzenesulfonylamino) -3-tert-butoxypropionic acid (5.1 g) as a brown foam , which was used without further purification.

Step 5

To a solution of 2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonylamino) -3-tert-butoxypropionic acid (2.79 g, 7.5 mmol) in 70% methanol / methylene chloride (50 mL) was added. 1M trimethylsilyldiazomethane in hexanes (22.5 mL, 23 mmol) was added at 0 ° C. After 45 minutes, the reaction mixture was concentrated and chromatographed using preparative chromatography (9% ethyl acetate-hexanes) to give 2 (R) - (4-methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3-tert-methyl ester. butoxypropionic acid (2.4 g).

Step 6

To a solution of 2 (R) - (4-methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3-tert-methyl ester methyl ester. butoxypropionic acid (1.1 g, 2.84 mmol) in benzene (50 mL) at 0 ° C was added [1- (2-trimethylsilylethanesulfonyl) indol-5-yl] methanol (1.33 g, 4.26 mmol) tri-n-butylphosphine (1.07 mL, 4.26 mmol), and 1,1 '- [azodocarbonyl] dipiperidine (1.08 g, 4.26 mmol). The reaction mixture was heated at room temperature for 4 hours. After 16 hours, the reaction mixture was diluted with an equal amount of hexanes, cooled at 0 ° C for 2 hours, and filtered. The residue was purified by preparative chromatography (20% ethyl acetate-hexanes) to give 2 (R) - {(4-methoxy-2,3,6-trimethylbenzenesulfonyl) - [1- (2-trimethylsilylethanesulfonyl) indol-5-ylmethyl} methyl ester amino-3-tert-butoxypropionic acid (1.79 g) as a pale yellow oil.

Step 7

To a solution of 2 (R) - [(4-methoxy-2,3,6-trimethylbenzenesulfonyl) - [1- (2-trimethylsilylethanesulfonyl) indol-5-ylmethyl] amino} -3-tert-butoxypropionic acid methyl ester (1,63) g, 2.55 mmol) in tetrahydrofuran (50 mL) was added 1M tetrabutylammonium fluoride (6.4 mL, 6.4 mmol) in tetrahydrofuran, and the mixture was heated to 40 ° C. After 1 hour, the reaction mixture was partitioned between ethyl acetate and 1M hydrochloric acid. The ethyl acetate layer was separated, dried over magnesium sulfate, and concentrated. The residue was purified by preparative chromatography (20% ethyl acetate-hexanes) to give 2 (R) - {(4-methoxy-2,3,6-trimethyl-benzenesulfonyl) - [1H-indol-5-ylmethyl] amino} -3 methyl ester tert -butoxypropionic acid (1 g), which was used directly in the next reaction.

Step 8

To a solution of 2 (R) - {(4-methoxy-2,3,6-trimethyl-benzenesulfonyl) - [1H-indol-5-ylmethyl] amino} -3-tert-methyl ester. butoxypropionic acid (1.0 g, 1.94 mmol) in a 50 směsi mixture of methanol and

tetrahydrofuran (10 mL) was added a solution of LiOH.H ₂ O (160 mg, 3.88 mmol) in water (1 mL). The reaction mixture was heated at 40 ° C for 12 h and an additional amount of LiOH.H ₂ O (160 mg, 3.88 mmol) in water (1 mL) was added. After 3 hours, the aqueous solution was acidified to pH 3 using 2N aqueous hydrochloric acid and the product was extracted with ethyl acetate. The combined ethyl acetate layers were dried over magnesium sulfate and concentrated to give 2 (R) - [(1H-indol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-tert-butyl ester butoxypropionic acid (0.90 g).

Step 9

To a solution of 2 (R) - [(1H-indol-S-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-tert. butoxypropionic acids (0.90 g, 1.8 mmol) were added O-benzylhydroxylamine (0.67 g, 5.4 mmol), 1-hydroxybenzotriazole (0.31 g, 1.98 mmol), N-methylmorpholine (0 , 36 g, 3.6 mmol) and 1- (dimethylaminopropyl) -3-ethylcarbodiimide (1.04 g, 5.4 mmol). After 16 hours, the reaction mixture was diluted with ethyl acetate (200 mL), washed with 2.4 N aqueous hydrochloric acid, saturated aqueous sodium bicarbonate, dried over magnesium sulfate, and concentrated. Purification by preparative chromatography (33 methanol / methylene chloride) afforded 2 (R) -N-benzyloxy - [(1H-indol-4-yloxy) -cyclohexylamine].

t-butoxypropionamide (0.85 g).

Step 10

To a solution of 2 (R) -N-benzyloxy - [(1H-indol-5-ylmethyl) - (4-methoxy)

-2,3, c-trimethylbenzenesulfonyl) amino] -3-tert. butoxvpropionamide x f X IILLUO X //

T — O r ·, I 'A - X ΥΛ T T — l V, ·· Γ Τ', Τ 'O Tr * r ~ »/ 4 I' t f. * · 1 ΐ <·. --A A <“« Tr \ A <“Ί

4-In L. L-CH 2 OH-UV-2-oxyl-ethanol-10-ethanol-tetrahydrofuran (10 mL), 10 Pd-C (0 mL) was added. , 4 g;, and the resulting mixture is hydrogenated at atmospheric pressure for 60 minutes, the reaction mixture is degassed under argon, and filtered through celite, the celite cake is washed with 80¾ ethanol / methylene chloride, and the filtrate is concentrated. ethyl acetate (5 mL) and slowly added to rapidly stirred hexanes (300 mL) to form a precipitate which was filtered and dried (50 ° C; 1 tor) to give N-hydroxy-2 (R) - [ (1H-Indol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-tert-butoxypropionamide as a white powder (500 mg).

Following the procedure described in Example 7, but substituting [1- (2-trimethylsilanylethanesulfonyl) -1H-indol-5-yl] methanol for 3,4- (methylenedioxy) phenylmethanol, 2 (R) was obtained. 1 - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-tert. butoxypropionamide.

Example 8

N-Hydroxy-2 (R) -2 - [(1H-indol-5-ylmethyl) - (4-methoxy-2,5-dimethylbenzenesulfonyl) amino] -3-methylbutyramide (Table 1, Compound 145)

HOHN

About me

Step 1

To a solution of 1H-indole-5-carboxylic acid methyl ester (16.8 g, 95.9 mmol) in dry acetonitrile (150 mL) was added tert-butoxycarbonyl anhydride (22 g, 100.8 mmol) first, followed by 4 h. dimethylaminopyridine (0.58 g, 4.75 mmol). The reaction mixture was stirred for 3 hours, then concentrated and chromatographed (300 g SiO 2, 5% ethyl acetate-hexanes) to give N-tert-butoxycarbonylindole-5-carboxylic acid methyl ester (23.6 g) as a colorless oil.

Step 2

To a solution of N-tert-butoxycarbonylindole-5-carboxylic acid methyl ester (23.6 g, 85.7 mmol) in dry tetrahydrofuran (225 mL) at -78 ° C was added 1.5 M DIBALH in toluene (171 mL, 257 mL). mmol). After 2 hours, the reaction was quenched by the slow addition of methanol (45 mL), water (60 mL), and saturated aqueous NH ₄ Cl (30 mL). Remove the ice bath, stir the reaction for an additional 1 hour, and then filter through celite. The celite cake was washed with tetrahydrofuran and the filtrate was concentrated to remove the more volatile tetrahydrofuran. The biphasic mixture was extracted with ethyl acetate. The combined organic layers were washed with water and the aqueous layer was re-extracted with ethyl acetate. The combined organic layers were washed with brine, dried over magnesium sulfate, and concentrated to give N-tert-butoxycarbonylindol-5-ylmethanol (21.2 g).

Step 3

To a solution of N-tert-butoxycarbonylindol-5-ylmethanol (2.56 g, 10.35 mmol) in dry methylene chloride (60 mL) was added manganese oxide (9 g, 103.5 mmol). The reaction mixture was stirred at room temperature for 3 hours and then heated to reflux. After 3 hours, the heterogeneous slurry was filtered through celite and concentrated to give N-tert-butoxycarbonyl-5-formylindole (2.5 g).

Step 4 «« # # # # # # # # # # # # # # # # # # #

Κ a solution of D-valine hydrochloride benzyl ester (2.49 g, 10.21 mmol) in dry methylene chloride (30 mL) was added

N-tert-butoxycarbonyl-5-formylindole (2.5 g, 10.21 mmol) and sodium triacethoxytetraborohydride (3.24 g, 15.29 mmol). The reaction mixture was stirred for 15 hours and then quenched by the addition of saturated aqueous sodium bicarbonate. The aqueous layer was separated and extracted with methylene chloride. The combined methylene chloride layers were washed with brine, dried over magnesium sulfate, and concentrated. The residue was chromatographed (Biotage 40M column, 10% ethyl acetate-hexanes) to give 2 (R) - [(N-tert-butoxycarbonylindol-5-yl) amino] -3-methylbutyramide O-benzyl ester (3.32 g) as colorless oil.

Step 5

To a solution of 2 (R) - (N-tert-Butoxycarbonylindol-5-yl) amino] -3-methylbutyramide O-benzyl ester (2.34 g, 5.36 mmol) in acetonitrile (15 mL) was added trimethylsilyl cyanide (2, 3, 14 mL, 16.1 mmol). After 1 h, 4-methoxy-2,5-dimethylbenzenesulfonyl chloride (3.18 g, 10.69 mmol) was added, and the reaction was heated at 70 ° C for 16 h. The reaction mixture was cooled to room temperature. Methanol (15 ml) was then added and the reaction mixture was concentrated in vacuo. The residue was chromatographed (Biotage 40M column, 10% ethyl acetate-hexanes) to give 2 (R) - [(N-tert-butoxycarbonylindol-5-yl) - (4-methoxy-2,5-dimethylbenzene-) O-benzyl ester. sulfonyl) amino] -3-methylbutyramide (1.56 g) as a colorless oil.

Step 6

To a solution of 2 (R) - [(N-tert-Butoxycarbonylindol-5-yl) - (4-methoxy-2,5-dimethylbenzenesulfonyl) amino] -3-methylbutyramide O-benzyl ester (0.45 g, 0.71 mmol) ) in methylene chloride (10 mL) was added trifluoroacetic acid (2.5 mL) at 0 ° C.

The reaction mixture was stirred for 40 minutes, then warmed to room temperature and stirred for an additional 2 hours. The reaction mixture was diluted with ethyl acetate. This organic layer was separated and washed with saturated aqueous sodium bicarbonate, dried over magnesium sulfate, and concentrated. The residue was chromatographed (Biotage 40M column, 20% ethyl acetate-hexanes) to give 2 (R) - [(1H-indol-5-yl) - (4-methoxy-2,5-dimethylbenzenesulfonyl) amino] -3-benzyl ester methylbutyramide (0.28 g) as a colorless oil.

Step Ί

To a solution of 2 (R) - [(1H-Indol-5-yl) - (4-methoxy-2,5-dimethyl-benzenesulfonyl) -amino] -3-methyl-butyramide O-benzyl ester (1.1 g, 2.06 mmol) in Argon-deoxygenated mixture of 50% ethanol and tetrahydrofuran (30 mL) was added with 10% Pd-C (0.6 a), and the resulting mixture was hydrogenated at atmospheric pressure. After 1.5 hours, the reaction mixture was degassed under argon and the slurry was filtered through celite. The celite cake was washed thoroughly with 80% ethanol / methylene chloride. The filtrate was concentrated and azeotroped with tetrahydrofuran to give 2 (R) - [(1H-indol-5-yl) - (4-methoxy-2,5-dimethylbenzenesulfonyl) amino] -3-methylbutancic acid (1.014 y) / ktβΐ £ in duty. The 151tl step is used without further purification.

Step 8

To an ice-cooled solution of 2 (R) - [(1H-indol-5-yl ^1- (4-methoxy-2,5-dimethylbenzenesulfonyl; amino) -3-methylbutanoic acid in dimethylformamide (20 mL) was added 1-hydroxycenzotriazole monohydrate ( 384 mg, 2.51 mmol), O-benzylhydroxylamine (844 mg, 6.85 mmol), N-methylmorpholine (462 mg, 4.57 mmc1), and

1- (dimethylaminopropyl) -3-ethylcarbodiimide (1.31 g, 6.85 mmol). The reaction mixture was warmed to room temperature. After 16 hours, the reaction mixture was partitioned between ethyl acetate (300 mL) and 1.5% aqueous hydrochloric acid (50 mL). The ethyl acetate layer was washed with saturated aqueous sodium bicarbonate, dried over magnesium sulfate, and concentrated. The residue was chromatographed (Biotage 40M column, 50% EtOAc-hexanes) to give N-benzyloxy-2 - [(1H-indol-5-ylmethyl) - (4-methoxy-2,5-dimethylbenzenesulfonyl) amino] -3- methyl butyramide hydroxamate (0.61 g).

Step 9

To a solution of 2 - [(1H-indol-5-ylmethyl) - (4-methoxy-2,5-dimethylbenzenesulfonyl) amino] -3-methylbutyramide hydroxamate (0.61 g, 1.1 mmol) in argon, deoxygenated with 50% ethanol and tetrahydrofuran (20 mL) was added 10% Pd-C (600 mg) in argon. The resulting reaction mixture was hydrogenated at atmospheric pressure for 2 hours. The reaction mixture was degassed under argon and the slurry filtered through celite. Wash the celite cake thoroughly with 80% ethanol / methylene chloride and concentrate the filtrate. The crude mixture was dissolved in ethyl acetate (1 mL). The solution was slowly added to rapidly stirred hexanes (100 mL) and a precipitate formed. The precipitate was filtered and dried (50 ° C; 1 tor) to give 2 (R) -N-hydroxy-2 - [(1H-indol-5-ylmethyl) - (4-methoxy-2,5-dimethylbenzenesulfonyl) 3-Methylbutyramide (477 mg) as a white powder.

Example 9

N-Hydroxy-2 (R) -2 - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3-methylbutyramide (Table 1, Compound 40) · To * * * * to * * * to to to

ΗΟΗΝ

Step 1

Κ benzyl ester free base solution

D-valine (12.92 g, 62 mmol) was added 3,4- (methylenedioxy) phenylmethanol (9.45 g, 62 mmol) and sodium triacethoxytetrahydroborate (18.50 g, 86.8 mmol). After 15 hours, the reaction was quenched by addition of saturated aqueous sodium bicarbonate (120 mL), and the aqueous layer was extracted with methylene chloride.

The combined methylene chloride layers were washed with brine, dried over magnesium sulfate, and concentrated. The residue was chromatographed (300 g SiCL, 51 ethyl acetate / hexanes) to give 2 (R) - (3,4-methylenedioxybenzylamino) -3-methylbenzyl ester Step 2

To a solution of benzyl ester 2 (R) - (3,4-methylenedioxybenzylamino) -3

-methylbutanoic acid (3.0 g, 8.79 mmol) in acetonitrile (15 mL) was added trimethylsilyl cyanide (3.5 mL, 26.3 mmol). The reaction mixture was heated to 80 ° C. After 1 hour, add

4-methoxy-2,6-dimethylbenzenesulfonyl chloride (3.14 g, 10.55 mmol) and heating was continued. After 36 hours, the reaction mixture was cooled to room temperature. Methanol (15 mL) was added and the solution was concentrated in vacuo. The residue was chromatographed (Biotage 40M column, 101 ethyl acetate-hexanes) to give a 9% yield. ·

(Dimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (4.33 g) as a colorless oil.

Step 3

To a solution of 2 (R) -2 - [(3,4-methyledioxybenzyl) - (4-methoxy-2,6-dimethylbenzenesulfonyl) amino] -3-methylbutanoic acid benzyl ester (2.6 g, 4.81 mmol) in argon Deoxygenated 50% ethanol / tetrahydrofuran (20 mL) was added 10% Pd / C (2 g). The resulting mixture was degassed under argon and the slurry was filtered through celite and washed thoroughly with 80% ethanol / methylene chloride. The filtrate was concentrated and azeotroped with tetrahydrofuran (22 mL), and the residue was dissolved in methylene chloride (20 mL). The solution was cooled to 0 ° C, and oxalyl chloride (0.8 mL, 9.17 mmol) and 4 drops of dimethylformamide were added. The reaction mixture was warmed to room temperature, stirred for 4 hours, and then concentrated. The crude acid chloride was then dissolved in methylene chloride (20 mL), cooled to 0 ° C, and N, O-bistrimethylsilylhydroxylamine (4 mL, 18.7 mmol) was added. The reaction mixture was warmed to room temperature and after 3 hours methanol (20 mL) was added. After 30 minutes, the reaction mixture was concentrated and chromatographed using preparative TLC (5¾ methanol / methylene chloride) to give N-hydroxy-2 (R) -2 - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,6) (Dimethylbenzenesulfonyl) amino] -3-methylbutyramide (1.0 g).

Example 10

N-Hydroxy-2 (R) - [(4-methoxybenzenesulfonyl) - (ΙΗ-benzimidazol-5-ylmethyl) amino] -3-methylbutyramide (Table 1, Compound 35) ···

ΗΟΗΝ

Step 1

Κ ice-cooled solution of 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid (7.0 g, 21.25 mmol) in dry methylene chloride was added over 45 minutes via a separatory funnel N, N'-diisopropyl-O-tert. butylisourea (12.1 mL, 3.5M). The reaction mixture was kept at 0 ° C for 2 hours and then warmed to room temperature overnight. Load the reaction mixture onto silica gel in a flash chromatography column and elute with ethyl acetate / hexane (5¾) to give 2 (R) - (4-methoxybenzenesulfonylamino) -3-methylbutanoic acid tert-butyl ester (7.02 g) as a white crystalline solid substance.

Step 2

To a mixture of 4-amino-3-nitrobenzoic acid (10 g, 54.9 mmol) and trimethylsilyl cyanide (20.6 mL, 3 eq.) In dry acetonitrile (120 mL) was added o-phthaloyl dichloride (7.9 mL, 54 mL). (9 mmol) and the material is heated to reflux. After 8 hours, an additional amount of o-phthaloyl dichloride (1 mL, 6.94 mmol) was added. After 16 hours, cool the reaction mixture to room temperature and add ethyl acetate (100 mL). The organic layer was separated and washed successively with an equal amount of 5¾ hydrochloric acid followed by brine. The aqueous phase was re-extracted with ethyl acetate (150 mL). The residue was crystallized from hot ethyl acetate / hexane to give 3-nitro-4- (aminophthaloyl) benzoic acid (5.85 g) as a brown crystalline solid.

Step 3

To a mixture of 3-nitro-4- (aminophthaloyl) benzoic acid (5.85 g, 18.74 mmol) and diisopropylethylamine (3.9 mL, 22.49 mmol) in tetrahydrofuran. (120 mL) was added benzotriazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (9.95 g, 22.49 mmol). The material was stirred for 5 minutes. Sodium borohydride (744 ng, 19.7 mmol) was added in 3 portions over 5 minutes and the reaction stirred for 0.5 hour. Ethyl acetate (100 ml) was added and the organic phase was washed sequentially with 5% hydrochloric acid, 5% sodium bicarbonate and brine and extracted again with ethyl acetate (150 ml). The organic phase was condensed on a rotary evaporator and the residue was purified by silica gel flash chromatography using ethyl acetate / hexane (50%) as eluent to give 3-nitro-4- (aminophthaloyl) benzyl alcohol as a yellow solid (4.61) g).

Step 4

To a mixture of 2 (R) - (4-methoxybenzenesulfonylamino) 3-methylbutanoic acid tert-butyl ester (1.91 g, 5.6 mmol), 3-nitro-4- (aminophthaloyl) benzyl alcohol (1.75 g, 5.87) mmol) and tributylphosphine (1.5 mL, 5.87 mmol) in dry benzene (40 mL) were added (1,1'-azodicarbonyl) dipiperidine (1.48 g, 5.87 mmol). The reaction mixture was stirred overnight and then loaded onto a silica gel flash chromatography column. The column was eluted with ethyl acetate / hexane (5-15%) to give 2 (R) - {[(3-nitro-4- (aminophthaloyl) benzyl]] - (4-methoxybenzenesulfonyl) amino} -3 tert-butyl ester -butyric acid (437 mg).

Kro k · 9 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ···

Κ a solution of 2 (R) - {[(3-Nitro- (4-aminophthaloyl) benzyl] - (4-methoxybenzenesulfonyl) amino} -3-methylbutanoic acid tert-butyl ester (420 mg, 0.673 mmol) in ethanol / tetrahydrofuran ( 15 ml, 1: 1 ratio) was added 10% Pd / C (40 mg), placed under a hydrogen balloon and stirred for 4 hours, filtered through a short plug of Celite (2 g, sintered glass funnel). , and well washed with ethanol (100 mL) .The filtrate was concentrated to give 2 (R) - {[(3-amino- (4-aminophthaloyl) benzyl] - (4-methoxybenzenesulfonyl) amino} -3- tert -butyl ester. methylbutanoic acid (375 mg).

Step 6

To a solution of 2 (R) - {[(3-Amino-4- (aminophthaloyl) benzyl] - (4-methoxybenzenesulfonyl) amino} -3-methylbutanoic acid tert-butyl ester (370 mg, 0.623 mmol) in methanol / methylene chloride (12 mL, 1: 1 ratio) was added hydrazine (0.39 mL, 20 eq.) The reaction mixture was stirred for 16 h, filtered and the filtrate was concentrated on a rotary evaporator. rotary evaporator to give 2 (R) - {[(3,4-diamino) benzyl] - (4-methoxybenzenesulfonyl) amino} -3-methylbutanoic acid tert-butyl ester (288 mg).

Step 7

To a mixture of 2 (R) - {[(3,4-Diamino) benzyl] - (4-methoxybenzenesulfonyl) amino} -3-methylbutanoic acid tert-butyl ester (90 mg, 7.194 mmol) and trimethyl orthoformate (0.022 mL, 1.05) equiv) in dry toluene (10 mL) was added KSF montmoronite (25 mg). The reaction mixture was heated at reflux for 6.5 hours and then cooled to room temperature. After reaching room temperature, the mixture was condensed

under vacuum and the residue was placed on the plate by thin layer chromatography. Elution with methanol / methylene chloride (10%) gave tert-butyl ester 2 (R).

- [(benzimidazol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3

methyl methyl butanoic acid (79 mg).

Step 8

A solution of 2 (R) - [(Benzimidazol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid tert-butyl ester (74 mg, 0.156 mmol) in 1: 4 trifluoroacetic acid / methylene chloride (5 mL) ) was stirred for 2 hours. The reaction mixture was concentrated on a rotary evaporator and then on a high vacuum pump to give 2 (R) - [(benzimidazol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid (about 0.135 mmol).

Step 9

To a solution of 2 (R) - [(benzimidazol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutanoic acid (0.13 mmol), O-benzylhydroxylamine (0.1 mL, 0.52 mmol), 1-hydroxybenzotriazole hydrate (24 mg, 0.16 mmol), and N-methylmorpholine (0.05 mL, 0.39 mmol) in anhydrous dimethylformamide (10 mL) were added 1-ethyl-3- (3-dimethylamino) hydrochloride salt. propylcarbodiimide (45 mg, 0.24 mmol). The reaction mixture was stirred overnight and then condensed on a rotary evaporator. The residue was taken up in ethyl acetate (40 mL), and washed sequentially with 2% aqueous ammonium chloride, 5% sodium bicarbonate, and brine, and then concentrated in vacuo. The residue was purified by preparative thin layer chromatography using methanol / methylene chloride (10%) as eluent to give

sulfonyl) amino] -3-methylbutyramide (48 mg, 71%).

Step 10

To a solution of 2 (R) -N-benzyloxy - [(benzimidazol-5-ylmethyl) - (4-methoxybenzenesulfonyl) amino] -3-methylbutyramide (42 mg, 0/08 mmol) in a 3: 1 mixture of ethanol / tetrahydrofuran (10 ml) was added 10% Pd / C (40 mg). The reaction mixture was placed under a hydrogen balloon. After 2 hours, the reaction mixture was filtered through a short plug of celite (1 g on a sintered glass funnel), and the celite pad was washed with ethanol (100 mL). The filtrate was concentrated on a rotary evaporator, and the residue was purified by preparative thin layer chromatography using methanol / methylene chloride (10%) as eluent to give N-hydroxy-2 (R) - [(benzimidazol-5-ylmethyl) - (4-Methoxybenzenesulfonyl) amino] -3-methylbutyramide (23 mg).

Example 11

N-hydroxy-2 (R) - [(1H-3-acetylindol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutyramide (Table 1, Compound 126)

HOHN

Step 1

In a dry round - bottomed flask under nitrogen and

100 containing 2 (R) - [(1H-indol-5-ylmethyl) - (4-methoxy) methyl ester

-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (1.41 g, 2.98 mmol) [prepared according to the method described in Example 2, Step 1 and instead of Example 2, Step 2 (alkylation) carboxylic acid (benzyl bromide), methyl ester formed using trimethylsilyldiazomethane (see Example 3, step 1)], N, N-dimethylacetamide (1.75 mL, 14.9 mmol) was added first with vigorous stirring, then added dropwise phosphorus oxychloride (1.4 mL, 11.92 mmol). After the addition was complete, the mixture was heated for 3.5 hours (80-90 ° C, oil bath). The material was cooled to ambient temperature and 1N sodium hydroxide was added under vigorous mechanical stirring. After 5 minutes, methylene chloride and water (1: 1; 120 mL) were added, and the material was separated, and the organic phase was collected. The methylene chloride phase was then washed sequentially with an equal amount of water and brine, and the aqueous phases were again extracted with methylene chloride (2 x 60 mL). The combined organic phases were dried over magnesium sulfate, filtered and condensed. The residue was purified by preparative thin layer silica gel chromatography using 3% methanol / methylene chloride as eluent to give 2 (R) - [(1H-3-acetylindol-5-ylmethyl) - (4-methoxy-2) methyl ester. , 3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (815 mg) as

V1 SkuΣΓι 1 ΰ 1 Z Z 1 1 · Krok Step 2

To a solution of 2 (R) - [(1H-3-Acetyl-indol-5-ylmethyl) - (4-methoxy-2,3,6-trimethyl-benzenesulfonyl) -amino] -3-methyl-butanoic acid methyl ester (805 mg, 1.56 mmol) in methanol (30 mL) was added an aqueous solution of 1.0 N lithium hydroxide (3.1 mL). The mixture was heated at reflux for 12 hours. An additional 1.0N lithium hydroxide was added, and the mixture was heated for an additional 8 hours. The material is cooled

101

4 ·· »· ·· • · * ♦ · φ · • 3 «·» · to · · ì • * ·· »· • · · ·· ··  · • · • it ··

to ambient temperature, and concentrated in vacuo, and the residue taken up in water-ether (1: 1, 50 mL). Separate layers! and the aqueous layer was collected and acidified (5% aqueous HCl to pH = 3) in the presence of the same amount of ethyl acetate. The ethyl acetate phase is collected and washed with an equal amount of brine. The aqueous phases were re-extracted with ethyl acetate (2 x 80 mL), combined, dried over magnesium sulfate, filtered and condensed to give 2 (R) - [(1H-indol-3-acetyl-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (586 mg) as a light brown powder.

Step 3

To a mixture of 2 (R) - [(1H-3-acetylindol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutanoic acid (580 mg, 1.16 mmol), 2,4-Dimethoxybenzylhydroxylamine (255 mg, 5.15 mmol), 1-hydroxybenzotriazole hydrate (178 mg, 1.16 mmol), and N-methylmorpholine (0.2 mL, 1.74 mmol) in dry dimethylformamide were added the hydrochloride salt 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide (333 mg, 1.74 mmol). The reaction mixture was stirred overnight and then concentrated on a rotary evaporator pump. The residue was taken up in ethyl acetate (80 mL) and 2% aqueous ammonium chloride solution (80 mL) and separated. The organic phase was collected and washed successively with an equal volume of 5% aqueous sodium bicarbonate and brine. The aqueous phases were re-extracted with ethyl acetate (2 x 80 mL), and the combined organic phases were dried over magnesium sulfate, and concentrated in vacuo to give crude N- (2,4-dimethoxy) benzyloxy-2 (R) - [ (1H '3-N- (2,4-dimethoxybenzyloxyiminoacetyl) indol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutyramide, which is used directly in the next reaction without further cleaning.

102

* this  · it· • do it ·· · · • · • it • • * it it to · • it • • • it it to * · • · « • · it it • · to · • it • • this ♦ ··· • it • it ·· this it

Step 4

To a solution of N- (2,4-dimethoxy) benzyloxy-2 (R) - [(1H-3-N- (2,4-dimethoxybenzyloxyiminoacetyl) indol-5-ylmethyl) - (4-methoxy-2,3,6) (trimethylbenzenesulfonyl) amino] -3-methylbutyramide (1.1 mmol) in 5% trifluoroacetic acid / tetrahydrofuran (15 mL) and water (2 mL) was added triethylsilane (0.7 mL, 3.9 mmol). The mixture was stirred at ambient temperature for 1 hour, and then additional trifluoroacetic acid (0.5 mL) was added. The material is heated (60-70 ° C) under a nitrogen atmosphere. After 0.5 h, additional trifluoroacetic acid (0.5 mL) was added, and heating was continued for an additional 4 h. The mixture was cooled to ambient temperature and diluted with water (60 mL) and ethyl acetate (60 mL). The material was separated and the organic phase was collected and washed with an equal amount of brine. The aqueous phases were re-extracted with ethyl acetate (2 x 60 mL), combined and dried over magnesium sulfate. The material was condensed and the residue was purified by preparative thin layer silica gel chromatography using 10% methanol / methylene chloride as eluent to give N-hydroxy-2 (R) - [(1H-3-acetylindol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3-methylbutyramide (320 mg) as a brownish solid powder.

Example 12

N-hydroxy-2 (R) - [{3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3- (methanesulfonyl) aminopropionamide (Table 1, Compound 128)

103

·· · * 9 • · • * • · · ♦ · • · • · · · • ·· • · • • · · • • • ··

ΗΟΗΝ

Step 1

Κ an ice-cooled solution of N-BOC-D-serine (10 g, 48.7 mmol) in methylene chloride (50 mL) was added via addition funnel over 30 minutes with N, N'-diisopropyl-O-tert-butyl urea (35 mL, 3). 5 M). The reaction mixture was kept at 0 ° C for 2 hours and then warmed to room temperature overnight. The material was recooled to 0 ° C and a second portion of N, N'-diisopropyl-O-tert-butylisourea (28 mL, 3.5 M) was added. The material was stirred at 0 ° C for 2 hours and then reheated at room temperature overnight. Purification by silica gel flash chromatography using ethyl acetate / hexanes (20%) as eluent gave O-tert-butyl-N-BOC-D-serine (7.97 g) as a viscous oil which solidified on standing.

Step 2

To a solution of O-tert-butyl-N-BOC-D-serine (4 g, 15.31 mmol), phthalimide (3.38 g, 22.9 mmol), and triphenylphosphine (6.03 g, 22.9 mmol) ) in tetrahydrofuran (120 mL, anhydrous) was added diisopropylazodicarboxylate (4.5 mL, 22.9 mmol). The mixture was stirred under nitrogen atmosphere overnight. Tetrahydrofuran was removed on a rotary evaporator and the residue was taken up in methylene chloride (60 mL) and charged. flash silica gel column. Eluting with ethyl acetate / hexanes (19%) was added

104

tert-butyl 2 (R) - [(tert-butoxycarbonyl) amino] -3-phthalamidopropionate (3.74 g) was obtained as a white powder.

Step 3

Tert -Butyl-2 (R) - [(tert-butoxycarbonyl) amino] -3-phthalamidopropionate (8.58 g, 21.8 mmol) was taken up with an anhydrous solution of hydrochloric acid in dioxane (100 mL, 4% w / w) . The reaction flask was fitted with a receiver, sealed with a Teflon stopper, and the mixture was heated to 80 ° C (for safety reasons, a Plexiglas shield was used). After 1.5 hours, the material was cooled to room temperature, and all volatiles were removed on a rotary evaporator. The white solid was taken up in methylene chloride (100 mL) and transferred to a separatory funnel. The solution was partitioned with an equal amount of aqueous sodium hydroxide (1.0 N), and the organic phase was collected. It was then shaken successively with brine solution (2 x 100 mL, successively) and the aqueous phases re-extracted with methylene chloride (3 x 100 mL). The organic phases were combined, dried (MgSO 4, filtered and condensed to give tert-butyl 2 (R) -amino-3-phthalimidopropionate (5.7 g) as a white powder.

Step 4

To a stirred solution of tert-butyl 2- (R) -amino-3-phthalamidopropionate (5.7 g, 19.63 mmol) in dry acetonitrile (60 mL) was added trimethylsilyl cyanide (8.6 mL, 68.7 mmol). . After 5 minutes 2,6-dimethyl-4-methoxybenzene sulfonyl chloride (4.84 g, 20.6 mmol) was added in one portion. The material was stirred at ambient temperature for 1 hour, then ethyl acetate (80 mL) was added, and the mixture was transferred to a separatory funnel. The organic phase was partitioned with aqueous hydrochloric acid (1.5%,

100 ml), collected, washed with an equal amount of brine

The aqueous phases are re-extracted with ethyl acetate (2 x 80 mL), and the organic phases are separated

105 were combined, dried over magnesium sulfate, filtered and condensed. The residue is chromatographed (flash silica,

Ethyl acetate / hexanes) to give tert-butyl 2 (R) - (2,6-dimethyl-4-methoxybenzenesulfonylamino) -3-phthalimidopropionate as a white semi-solid (6.9 g).

Step 5

To an ice bath of a cooled solution of tert-butyl 2 (R) - (2,6-dimethyl-4-methoxybenzenesulfonylamino) -3-phthalamidopropionate (6.9 g, 14.12 mmol) in dry benzene (150 mL) with piperonyl alcohol ( 3.22 g, 21.2 mmol) and tributylphosphine (5.3 mL, 21.2 mmol) were added 1.1 (azodicarbonyl) dipiperidine (5.35 g, 21.2 mmol). Heat the mixture at room temperature overnight. The material was loaded onto a silica gel flash chromatography column and eluted with ethyl acetate-hexanes (30%) to give tert-butyl 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl). amino] -3-phthalamidopropionate as a white solid (8.59 g).

Step 6

To a stirred solution of tert-butyl 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-phthalamidopropionate (3.9 g, 6.2 mmol) ) in 78% methylene chloride / methanol (47 mL) was added hydrazine hydrate (3.9 mL, 125 mmol), and the mixture was stirred for 5 hours, during which time a solid phthalhydrazine precipitate formed. The material was filtered and washed with methylene chloride. The filtrate was then evaporated on a rotary evaporator and taken up in methylene chloride (80 mL) and transferred to a separatory funnel. After partitioning with an equal amount of water, the organic phase is collected and washed with an equal amount of brine. The aqueous phases were re-extracted with methylene chloride (2 x 80 mL). The methylene chloride phases were combined, dried over sulfate

106 · · · · · · ·· ¹ ♦ «·« * ··· * · ·· · ♦ · · · · · • ···· 99 9 «· ·· 999 sulphate, filtered and condensed to provide tert-butyl 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-aminopropionate as a white semi-solid (3.0 g).

Step 7

To a mixture of tert-butyl 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-aminopropionate (1.02 g, 2.0 mmol) with trimethylsilyl cyanide (0.7 mL, 5.2 mmol) in dry acetonitrile (15 mL) was added methylsulfonyl chloride (0.18 mL, 2.3 mmol) and the material was stirred overnight. Ethyl acetate (80 mL) was added, and the material was partitioned with aqueous hydrochloric acid (1.5%, 80 mL). The organic phase was collected and washed with the same amount of brine. The aqueous phases were re-extracted with ethyl acetate (2 x 80 mL), and the organic phases were combined, dried over magnesium sulfate, filtered and condensed to give tert-butyl 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino-3-methanesulfonylaminopropionate as a semi-viscous oil of pale yellow color (1.4 g).

Step 8

Tert-butyl 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6) solution

Dimethyl-4-methoxybenzenesulfonyl) amino] -3-methanesulfonyl aminopropionate (1.37 g, 2 mmol) in 207 trifluoroacetic acid-methylene chloride (15 mL) was stirred for 1 hour.

Additional trifluoroacetic acid (0.5 mL) was added and stirring was continued for 2 hours. The material was then condensed on a rotary evaporator and the residue was taken up with toluene (40 mL), and condensed again. This procedure was repeated twice (2 x 40 mL)

107 *

• toluene (to remove traces of trifluoroacetic acid) to give 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4);

(methoxybenzenesulfonyl) amino] -3-methanesulfonylaminopropionic acid as a foamy greenish brown solid (1.02 g).

Step 9

To a mixture of 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-methanesulfonylaminopropionic acid (1 g, 1.9 mmol), O-benzylhydroxylamine (0, 95 mL, 6 mmol), 1-hydroxybenzotriazole hydrate (370 mg, 1.9 mmol), and N-methylmorpholine (0.7 mL, 5.7 mmol) in anhydrous dimethylformamide (20 mL) were added 1-ethyl- 3- (3-dimethylamino) propylcarbodiimide. The mixture was stirred overnight and then condensed on a rotary evaporator. The residue was taken up in ethyl acetate (60 mL), and partitioned with an equal amount of 5% hydrochloric acid. The ethyl acetate phase was collected and washed sequentially with 5% sodium bicarbonate and brine. The aqueous phases were re-extracted with ethyl acetate (2 x 60 mL), and the organic layers were combined, dried over magnesium sulfate, filtered and condensed. The residue was purified by preparative thin layer chromatography using 65% ethyl acetate-hexanes as eluent to give N-benzyloxy 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-methanesulfonylaminopropionamide as a yellow viscous oil (591 mg).

Step 10

To a solution of N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-methanesulfonyl aminopropronamide (580 mg, 0.94 mmol) in 3: 1 ethanol / tetrahydrofuran (30 mL) was added 10%. palladium na

108

activated carbon (60 mg). The reaction mixture was placed under a balloon of hydrogen and stirred for 6 hours. The material was filtered through a short plug of silica, washing with ethanol (200 mL). The filtrate was condensed on a rotary evaporator and the residue was purified by preparative thin layer chromatography using 8.5% methanol-methylene chloride as eluent to give N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2) 6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-methanesulfonylaminopropionamide as a brownish powder (223 mg).

By replacing methanesulfonyl chloride in step 7:

benzenesulfonyl chloride, acetyl chloride, benzoyl chloride,

4-methoxycarbonylbenzoyl chloride, and methyl chloroformate; is obtained

N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino-3-benzenesulfonylaminopropionamide (Table 1, Compound 129)

N-Hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-α platinum-aminopropionamide (Table 1, Compound 130)

ΛΤ_1—> τ rz-l v i 7_ O f D λ _ Γ / / 1 _ το o + ki i r 1 o / -] n r * v r tVs ο, ο n t r 1 1

1 * H Ca χ Ό Λ 4- \ X \ / | _ \ / “3 ll.O LU J ±) i o

/ 1

-methoxybenzenesulfonyl) amino] -3-benzoylaminopropionamide (Table 1, Compound 138)

N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3- (4-methoxycarbonylbenzoyl) aminopropionamide (Table 1, Compound 133), and

N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-methoxycarbonylaminopropionamide (Table 1, Compound 131).

109 • ····

Example 13

N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3 - [(2-pyrrol-1-yl) phenylcarbonylamino] propionamide (Table 1, Compound 143)

About me

Step 1

To a mixture of tert-butyl-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-aminopropionate (1.02 g, 2.0 mmol), 1- (2-carboxyphenyl) pyrrole (581 mg, 3.1 mmol), 1-hydroxybenzotriazole hydrate (279 mg, 2.0 mmol), N-methylmorpholine (0.8 mL, 7.3 mmol) and 4-dimethylaminopyridine ( 30 mg, 0.25 mmol) in dry dimethylformamide (25 mL) was added 1-ethyl-3,3, - (dimethylamino) propylcarbodiimide hydrochloride (600 mg, 3.1 mmol), and the material was stirred overnight. Dimethylformamide was removed on a rotary evaporator and the residue was taken up in ethyl acetate (80 mL), and partitioned with an equal amount of aqueous hydrochloric acid (1.5%, 80 mL).

The organic phase was collected and washed with an equal amount of 5% aqueous sodium bicarbonate followed by brine. The aqueous phases are re-extracted with ethyl acetate (2 x 80 mL), and the organic phases are combined, dried over magnesium sulfate, filtered, condensed, and give a residue. This material was chromatographed using preparative TLC plates (45%).

110 ethyl acetate / hexanes) to give tert-butyl-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3 - [(2-pyrrol-1)]. -yl) phenylcarbonylamino] propionate as a foamy solid of pale yellow color (927 mg).

Step 2

A solution of tert-butyl 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3 - [(2-pyrrol-1-yl) phenylcarbonylamino] propionate (915 mg, 1.3 mmol) in 20% trifluoroacetic acid / methylene chloride (15 mL) was stirred for 1 hour. Additional trifluoroacetic acid (0.5 mL) was added, and stirring was continued for 1.5 hours. The material was then condensed on a rotary evaporator and the residue was taken up with toluene (40 mL), and condensed again. This procedure was repeated twice (2 x 40 mL toluene to remove traces of trifluoroacetic acid) to give 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino 3 - [(2-pyrrol-1-yl) phenylcarbonylamino] propionic acid as a brown-gold solid (896 mg).

Step 3

To a mixture of 2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3 - [(2-pyrrol-1-yl) phenylcarbonylamino] propionic acid (about 1.3 mmol) , O-benzylhydroxylamine (0.6 mL, 3.9 mmol), 1-hydroxybenzotriazole hydrate (199 mg, 1.3 mmol), and N-methylmorpholine (0.44 mL, 3.9 mmol) in anhydrous dimethylformamide (20 mL). ml) was added 1-ethyl-3- (3-dimethylamino) propylcarbodiimide hydrochloride (375 mg, 1.95 mmol). The mixture was stirred overnight and condensed on a rotary evaporator. The residue was taken up in ethyl acetate (60 mL), and partitioned with an equal amount of 1.5 ^; hydrochloric acid.

The ethyl acetate phase was collected and washed successively with an equal amount of 5% sodium bicarbonate and then brine. The aqueous phases were re-extracted with ethyl acetate (2 x 60 mL), and the organic layers were combined, dried over magnesium sulfate, filtered and condensed. The residue was purified by preparative TLC (2% methanolmethylene chloride) to give N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3-. - [(2-pyrrol-1-yl) phenylcarbonylamino] propionamide as a foamy solid of pale yellow color (490 mg).

Step 4

To a solution of benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino] -3- (2'-pyrrolo) benzamidopropionamide (480 mg, 0.675 mmol) in 3: 1 ethanol / tetrahydrofuran (30 mL) was added 10% palladium on charcoal (60 mg). The reaction mixture was placed under a hydrogen balloon and stirred for 8 hours, during which additional catalyst (2 x 60 mg) was added. Filter the material through a short plug of silica gel, washing with ethanol (200 mL). The filtrate was condensed on a rotary evaporator and the residue was purified by preparative TLC (7% methanol-methylene chloride) to give a mixture of N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4). -methoxybenzenesulfonyl) amino] -3 - [(2-pyrrol-1-yl) phenylcarbonylamino] propionamide and N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (2,6-dimethyl-4-methoxybenzenesulfonyl) amino 3 - [(2-pyrrolidin-1-yl) phenylcarbonylamino] propionamide (82:18) as a brownish powder (216 mg).

Example 14

N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,612)

(trimethylbenzenesulfonyl) amino] -3 (S) -hydroxybutyramide (Table

1, compound 94)

HOHN

Step 1

To a suspension of D-threonine (7.87 g, 66.1 mmol) in acetonitrile (100 mL) was added trimethylsilyl cyanide (40 mL, 298 mmol), and the resulting solution was heated to 80 ° C. After 1 hour, 4-methoxy-2,3,6-trimethylbenzenesulfonyl chloride (17.3 g, 69.4 mmol) was added and heating was continued. After 12 hours, the reaction mixture was cooled to room temperature. Methanol (15 mL) was added and the organics were removed in vacuo. The residue was diluted with diethyl ether (300 mL), cooled to 0 ° C, and adjusted to pH 8 with 6N aqueous sodium hydroxide solution. The organic layer was collected and the aqueous phase was extracted with diethyl ether. The aqueous layer was adjusted to pH 4 and extracted again with ethyl acetate. The combined organic extracts were dried over magnesium sulfate, concentrated to give 2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonylamino) -3 (S) -hydroxybutyric acid (22 g) as a brown foam, which was used without further purification.

Step 2

To a solution of 2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonylamino) -3 (R) -hydroxybutyric acid (29.13 g, 87.9 mmol) in dimethylformamide (280 mL) at 0 ° C was added potassium carbonate (72.9 g, 527 mmol) and a solution of 3,4-methylene

113 dioxybenzyl chloride (60 g, 170.8 mmol, 50% (w / w)) in methylene chloride. After 2 hours, lithium iodide (5.88 g, 44 mmol) was added and the reaction mixture was heated at room temperature for about 2 hours. After 6 hours, the reaction mixture was partitioned between ethyl acetate (600 mL) and water (250 mL). The organic layer was separated, dried over magnesium sulfate and concentrated in vacuo. The crude residue was chromatographed (300 SiO ₂ , 15% ethyl acetate-hexanes) to give 2 (R) - (4-methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3 (S) -hydroxybutyric acid 3,4-methylenedioxybenzyl ester ( 40.4 g), a portion of which is used directly in the next reaction without further purification.

Step 3

2 (R) - (4-Methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3 (S) -hydroxybutyric acid 3,4-methylenedioxybenzyl ester (10.9 g, 23.41 mmol) and imidazole (2.07 g, 30.43 mmol) was dissolved in tetrahydrofuran (28 mL). The reaction mixture was cooled to 0 ° C, and 1M triethylsilyl chloride in tetrahydrofuran (28 mL, 28 mmol) was added. After 1 hour, the reaction mixture was concentrated and chromatographed on a 401 Biotage column (eluting with 10% ethyl acetate-hexanes) to give (R) - (4-methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3-methylenedioxybenzyl ester -3,4 (S) - (triethylsilyloxy) butanoic acid (13.5 g).

Step 4

To a solution of 2 (R) - (4-methoxy-2,3,6-trimethyl-benzenesulfonylamino) -3 (S) - (triethylsilyloxy) butanoic acid 3,4-methylenedioxybenzyl ester (3.3 g, 5.7 mmol) in benzene ( 100 mL) at 0 ° C was added first 3,4-methylenedioxyphenylmethanol (1.3 g, 8.5 mmol) and tri-n-butylphosphine (2.1 mL, 8.5 mmol), followed by 1.1 l 1 - [azodicarbonyl] dipiperidine (2.2 g, 8.5 mmol). The reaction mixture was heated at room temperature for 4 hours. After 72 hours

114 the reaction mixture was diluted with an equal amount of hexanes, cooled to 0 ° C, and filtered. The residue was concentrated and chromatographed (300 g SiO ₂ , 15% ethyl acetate-hexanes) to give 2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-) - 3,4-methylenedioxybenzyl ester. trimethylbenzenesulfonyl) amino] -3 (S) - (triethylsilyloxy) butanoic acid (3.3 g) as a yellow oil.

Step 5

To a solution of 2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3 (R) - (triethylsilyloxy) butanoic acid 3,4-methylenedioxybenzyl ester (3, 3 g (4.62 mmol) in argon-deoxygenated 80% ethanol / tetrahydrofuran (100 mL) was added 10% Pd-C (2 g) and the resulting mixture was hydrogenated at atmospheric pressure for 45 min. The reaction mixture was degassed under argon, the slurry was filtered through celite, and the celite pad was washed thoroughly with 80% ethanol-methylene chloride. The filtrate was concentrated and azeotroped with tetrahydrofuran (200 mL), and the residue was dissolved in dimethylformamide (25 mL). O-benzylhydroxylamine (2.0 g, 16.2 mmol), HOBT (0.71 g, 5.2 mmol), and EDAC (3.1 g, 16.2 mmol) were added and the reaction stirred for 16 hours . The reaction mixture was diluted with ethyl acetate and washed with 2.4 N aqueous hydrochloric acid and saturated aqueous sodium bicarbonate. The mixture was then dried over magnesium sulfate and concentrated in vacuo to give crude N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] - 3 (S) -Hydroxybutyramide (1.25 g), which was used directly in the next reaction without further purification.

Step 6

To a solution of N-benzyloxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4115

-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3 (R) -hydroxybutyramide (1.25 g, 2.19 mmol) in an arrogon-oxygenated 80% ethanol-tetrahydrofuran (100 mL) mixture is added with 10% Pd- C (0.7 g), and the resulting mixture was hydrogenated under atmospheric pressure for 60 minutes. The reaction mixture was degassed under argon and the slurry filtered through celite. Wash the celite cake thoroughly with 80% ethanol-methylene chloride and concentrate the filtrate to near dryness. The mixture was dissolved in 4 mL of ethyl acetate and slowly added dropwise to 100 mL of vigorously stirred hexanes. The slurry was filtered to give N-hydroxy-2 (R) - [(3,4-methylenedioxybenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3 (R) -hydroxybutyramide (0.67) (g) as a white solid.

Example 15

N-hydroxy-2 (R) - [(1H-benzimidazol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3 (R) -hydroxybutyramide (Table 1, Compound 136)

Step 1

Conditions for esterification of N-carbobenzyloxy-D-threonine

The N, N'-diisopropyl-O-tert-butyl isourea resulting in the preparation of O-tert-butyl-N-carbobenzyloxy-D-threonine are identical to those described in Example 12, step 1 above.

Step 2

116

To a mixture of O-tert-butyl-N-carbobenzyloxy-D-threonine (2.74 g, 8.86 mmol), triethylamine (1.9 mL, 13.29 mmol), and 4-dimethylaminopyridine (50 mg) in dry tert-Butyldimethylsilyl chloride (1.47 g, 9.8 mmol) was added to dimethylformamide (20 mL). The mixture was stirred overnight under argon. Triethylamine (1 mL) and tert-butyldimethylsilyl chloride (500 mg) were added, and the mixture was heated at 80 ° C for 6 hours. The material is cooled to ambient temperature and condensed on a rotary evaporator. The residue was taken up in methylene chloride (80 mL) and partitioned with an equal amount of brine. The organic phase was collected and the aqueous phase was re-extracted with methylene chloride (2 x 80 mL). The methylene chloride phases are combined, dried over magnesium sulphate and codified. The residue was purified by chromatography (flash silica, 15% ethyl acetate-hexanes) to give O-tert-butyl-N-carbobenzyloxy-β-Ο-tert-butyldimethylsilyl-D-threonine (3.27 g) as a clear viscous oil.

Step 3

To a solution of O-tert-butyl-N-carbobenzyloxy-β-Ο-tert-butyldimethylsilyl-D-threonine (3.26 g, 7.7 mmol) in 3: 1 ethanol / tetrahydrofuran (30 mL) was added 10% palladium on activated carbon (80 mg). The mixture was placed under a hydrogen balloon and stirred for 1.5 hours. The material was filtered through a short plug of Celite and washed with ethanol (200 mL). The filtrate was condensed on a rotary evaporator to give α-O-tert-butyl-β-Ο-tert-butyldimethylsilyl-D-threonine (2.2 g) as a clear viscous oil.

Step 4

To a stirred solution of α-O-tert-butyl-p0-tert-butyldimethylsilyl-D-threonine (2.15 g, 7.65 mmol) in dry acetonitrile (30 mL) was added trimethylsilyl cyanide (2.9 mL, 22.9 mmol). . After 5 φ φ

2,3,6-trimethyl-4-methoxybenzenesulfonyl chloride (2.02 g, 8.1 mmol) was added over 117 minutes and the mixture was stirred for 2 hours. Ethyl acetate (80 mL) was added and the material was partitioned with an equal amount of aqueous 1.5% hydrochloric acid. The organic phase is collected and shaken with the same amount of brine. The ethyl acetate phase was isolated and the aqueous phase was re-extracted with ethyl acetate (2 x 80 mL). The organic phases were combined, dried over magnesium sulphate and condensed to give tert-butyl-2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3 - [(R) -terminus]. Butyldimethyl silyloxy] butyrate (3.85 g) as a foamy semi-solid material.

Step 5

To a solution of tert-butyl-2 (R) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino] -3 - [(R) -ter. butyldimethylsilyloxy] butyrate (3,83 g, 7,63 mmol) and 3-nitro-4- (N-phthaloyl) benzyl bromide (3.03 g, 8.4 mmol) in dry dimethylformamide (30 ml) are added potassium carbonate (1, 7 g, 12.3 mmol) (Note: The synthesis for 3-nitro-4- (N-phthaloyl) benzyl bromide is shown below in step 5A). The mixture was stirred for 12 hours and additional 3-nitro-4- (N-phthaloyl) benzyl bromide (1.0 g) was added. After a further 6 hours the mixture was condensed on a rotary evaporator. Purification by chromatography (silica gel, 10% to 15% ethyl acetate-hexanes) affords tert-butyl 2 (R) - [(3-nitro-4- (N-phthalamido) benzyl) - (4-methoxy-2,3, 6-trimethylbenzenesulfonyl) amino] -3 - [(R) - tert. butyldimethylsilyloxy] butyrate as a white powder.

Step 5A

Preparation of 3-nitro-4- (aminophthaloyl) benzyl bromide:

To a cooled solution of 3-nitro-4- (aminophthaloyl) benzyl alcohol (5.94 g, 19.92 mmol) in an ice bath [the synthesis of this alcohol is ·· ♦ · ··

118 • Φ

Φ * · 4 · 4 · φ ··

Φ · φ φ φ φ φ φ · ·

Described in Example 10, steps 2 and 3] and triphenylphosphine (7.83 g, 29.9 mmol) in dry methylene chloride (90). mL) was added carbon tetrabromide (9.92 g, 29.9 mmol). The mixture was stirred at 0 ° C for 1 hour and then heated at ambient temperature for about 1 hour. The whole mixture was then packed with a silica gel flash chromatography column and eluted with 30% ethyl acetate / hexanes to give 3-nitro-4- (aminophthaloyl) benzyl bromide as a yellow-white powder (5.03 g).

Step 6

Conditions for reducing tert-butyl 2 (R) - [(3-nitro-4- (N-phthalamido) benzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino}] - 3 - [(R) tert-Butyldimethylsilyloxy] butyrate to give tert-butyl-2 (R) - [(3-amino-4- (N-phthalamido) benzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino) 3 - [(R) -tert-Butyldimethylsilyloxy] butyrate are the same as those described in Example 10, Step 5 above.

Step 7

Tert-butyl-2 (R) - [(3-amino-4- (N-phthalamido) benzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] - 3 - [(R) ) -terč. butyldimethylsilyloxy] butyrate to give tert-butyl 2 (R) - [3,4-diaminobenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] - 3 - [(R) -tert-butyldimethylsilyloxy] butyrate are similar to those described in Example 10, Step 6 above.

Step 8

Conditions for clay-catalyzed conversion of tert-butyl-2 (R) - [3,4119 · · · · · · 3,4 3,4 3,4 3,4 3,4 3,4 3,4 3,4 3,4 3,4 3,4 3,4 3,4 3,4 · ♦

-diaminobenzyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] - 3 - [(R) -tert-butyldimethylsilyloxy] butyrate, which results in tert-butyl-2 (R) - [benzimidazole- 5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] - 3 - [(R) -tert-butyldimethylsilyloxy] butyrate are similar to those described in Example 10, step 7 above.

Step 9

In an ice-cooled flask containing pure tert-butyl-2 (R) - [benzimidazol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] - 3 - [(R) -tert-butyldimethylsilyloxy] butyrate (2.53 g, 4.0 mmol) was added a 1.0 M solution of tetra-N-butylammonium fluoride (16 mL) under a syringe under argon. The mixture was stirred at 0 ° C for 15 minutes and then warmed to ambient temperature. After 30 minutes, additional tetra-N-butylammonium chloride (5 mL) was added, and stirring was continued for 2 hours. Saturated aqueous ammonium chloride solution (80 mL) was added followed by ethyl acetate (60 mL). The material was separated and the organic phase was collected and washed successively with three equal amounts of brine solution. The aqueous phases were re-extracted with ethyl acetate (2 x 80 mL). The organic phases were combined, dried over magnesium sulfate and condensed. The residue was purified by chromatography (silica gel, 100% ethyl acetate as eluerite) to give Leu; • butyl 2 (R) - [benzimidazol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] -3 (R) hydroxybutyrate as a viscous clear oil.

Step 10

Tert-Butyl-2 (R) - [benzimidazol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] -3 (R) -hydroxybutyrate is converted to 2 (R) - [ benzimidazol-5-ylmethyl) - (4-methoxy-2,3,6-trimethyl-120) 9 and 9 9 9 9 9 (Benzenesulfonyl) amino) -3- (R) -hydroxybutyric acid according to the procedure described in Example 10, Step 8, above.

Step 11 (R) - [Benzimidazol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] -3 (R) -hydroxybutanoic acid is then converted to N-hydroxy-2 (R) - [benzimidazol-5-ylmethyl) - (4-methoxy-2,3,6-trimethylbenzenesulfonyl) amino)] -3 (R) -hydroxybutyramide according to the procedure described in Example 3, steps 6 and 7 above.

Example 16

Synthesis of the compound of the following formula as shown in Scheme E

IQ

Step 1

To the ArgoGel-OH (Formula 1) in an empty, solid phase extraction vial equipped with a tap was added 3 eq. of compound of Formula 2 (Fmoc-D-Dpr (BOC)), 3 eq. diisopropylcarbodiimide (DIC), and 0.05 eq. 0.116 M solution of dimethylaminopyridine (DMAP) in THF. Sufficient CH 2 CR is added to swell the resin (about 12.5 ml / gr resin). The reaction mixture was then placed on a rotary machine and rotated overnight. The reaction mixture was then filtered by vacuum filtration and washed three times with CH ₂ Cl ₂ , three times with MeOH, once 1: 1 HOAc / CH ₂ Cl ₂ , three times with MeOH and finally

121 three times with CH 2 Cl 2, and dried, to obtain AG-D-Dpr (BOC) Fmoc resin .

The resulting resin (AG-D-Dpr (BOC) -Fmoc) was treated with a solution of 20% piperidine in DMF (pip / DMF) for 20 minutes. The reaction mixture was then filtered by suction filtration and washed three times ΟΗ Ο12 _2, three times with MeOH, once with 1: 1 HOAc / CH ₂ C1 _2, three times with MeOH and then lastly three times with CH ₂ C1 _2nd A resin of formula 3 (AG-D-Dpr (BOC) NH ₂ ) is obtained.

Step 2

Sufficient CH ₂ Cl ₂ is added to the resin of formula 3 (AG-D-Dpr (BOC) -NH ₂ ) to swell the resin (about 12.5 ml / g resin). Then, 3 eq. sulfonyl chloride of formula 4 (Ar-SO ₂ Cl) and 3 eq. triethylamine (TEA). The reaction mixture was then placed on a rotary machine and rotated overnight. The reaction mixture was then filtered by vacuum filtration and washed three times with CH ₂ Cl ₂ , three times with MeOH, once 1: 1 HOAc / CH ₂ Cl ₂ , three times with MeOH, and finally three times with CH ₂ Cl _{2 to} give resin of formula 5 (AG-D-Dpr ( BOC (NHSO.Ar).

Step 3

To the resin of formula 5 (AG-D-Dpr (BOC) -NHSOiAr) is added a sufficient amount of a mixture of toluene and CH 2 Cl 2 to swell the resin (about 12.5 ml / g resin). Then, 10 eq. 1,1 '- (azodicarbonyl) dipiperidine (ADDP), 10 eq.

Bu .-, P and 10 eq. piperonyl alcohol (ROH). The reaction mixture was then placed on a rotary machine and rotated overnight. The reaction mixture is filtered by vacuum filtration, and washed three times with CH 2 Cl 2, three times with MeOH, once 1: 1 HOAc / CHCl 3, three times with MeOH, and finally three times with CHCl 3, to give the resin of formula 6 (AG-D-Dpr ( BOC) (NRSO Ar).

122

Step 4

The resin of formula 6 (AG-D-Dpr (BOC) -NRSO ₂ Ar ² ) was treated with a solution of 1M chlorotrimethylsilane in 3M phenol / CH ₂ Cl _{2 for} 30 minutes. The reaction mixture was then filtered by vacuum filtration, and washed three times with CH ₂ Cl ₂ , three times with MeOH, once 1: 1 HOAc / CH ₂ Cl ₂ , three times with MeOH, and finally three times with CH ₂ Cl ₂ , to give a resin of formula 7 (AG- D-Dpr-NRSO ₂ Ar ^2).

Step 5

To the resin of formula 7 (AG-D-Dpr-NRSO ₂ Ar ² ) was added 3 equiv.

succinimidyl carbonate of formula 8 (R 'OCO ₂ Su), 3 eq. Et ₃ N (TEA), and 0.05 eq. 0.116 M solution of 4-dimethylaminopyridine (DMAP) in THF. Sufficient CH 2 Cl 2 is added to swell the resin (about 12.5 mL / g resin). The reaction mixture was then placed on a rotary machine and rotated overnight. The reaction mixture was then filtered by vacuum filtration and washed three times with CH ₂ Cl ₂ , three times with MeOH, one time 1: 1 HOAc / CH ₂ Cl ₂ , three times with MeOH, and finally three times with CH ₂ Cl ₂ , to give a resin of formula 9 (AG-DDpr (COOR) -NRSO _: Ar ^;

Step 6

The resin of formula 9 (AG-D-Dpr (COOR ") - ₂ Νκ8Ο Αγ ²⁾ is first washed with THF. Sufficient THF was added to swell the resin (about 12.5 mL / g resin). Then 25 eq. 50% aqueous NH ₂ OH, and the reaction mixture is rotated for 2 days. The reaction mixture was then filtered by vacuum filtration, and washed with CH _; Cl ₂ , MeOH, and then CH 2 Cl 2. The filtrate was concentrated on a Speed Vac to give the compound of formula 10 (HONH-Dpr (COOR ') NRSO Ar ^_) which was purified by RP-HPLC.

123

Using the sulfonyl chloride of formula 4 and the appropriate succinimide carbonate of formula 8, the following compounds are prepared as listed in Table 1: compound 139, compound 140, compound 141, compound 146, compound 148, and compound 149.

Example 17

Synthesis of the compound of the following formula as shown in Scheme F

Step 1

The resin of formula 7 (AG-D-Dpr-NRSOAr ² ) was first washed with THF, then 15 eq. isocyanate of formula 8 (ArNCO). Sufficient THF was added to swell the resin (about 12.5 mL / g resin; the reaction mixture was then placed on a rotary machine and rotated overnight. The reaction mixture was then filtered by vacuum filtration and washed three times with CH ₂ Cl _{2 2} , three times MeOH, once 1: 1 HOAc / CH ₂ Cl ₂ , three times MeOH, and finally three times CH ₂ Cl ₂ , to give the resin of formula 9 (AG-D-Dpr (CONHAr) -NRSO ₂ Ar ² ).

Step 2

The resin of formula 9 (AG-D-Dpr (CONHAr) -NRSO ₂ Ar) was first washed with THF. Sufficient THF is added to effect

124

to swell the resin (ca. 12.5 ml / g resin) and then 25 eq. 50% aqueous NH ₂ OH, and the reaction mixture is rotated for two days. The reaction mixture was then filtered by vacuum filtration and washed with CH ₂ Cl ₂ , MeOH, and CH ₂ Cl ₂ . The filtrate was concentrated to Speed Vac to give a compound of Formula 10 (HONH-Dpr (CONHAr) NRSO ₂ Ar ² ) which was purified by RP-HPLC.

Using the appropriate isocyanate of formula 8, the following compound, which is shown in Table 1, was prepared: compound 147.

Example 18

Formulation examples

The following representative pharmaceutical formulations comprise a compound of Formula I.

Tablet formulation

The following ingredients are immediately mixed and compressed into individual scored tablets.

Quantity / tablet component in mg compound of the invention 400 corn starch 50 croscarmellose sodium 25 lactose 120 magnesium stearate 5

Capsule formulation

The following ingredients are immediately mixed and filled into hard gelatin capsules

Ος · 1 »··· ♦ IZj ··· _and ··· · · · ♦ · * ·· • · · · • · the" ··· ·· · · ♦ ♦ ♦ · · Component amount / tablet in mg a compound of the invention 200

lactose, spray - dried 148 magnesium stearate 2

Suspension formulation

The following ingredients are combined to form a suspension for oral administration

Component amount a compound of the invention 1/0 g fumaric acid 0.5 g sodium chloride 2,0 g methylparaben 0.15 g propylparaben 0.05 g granulated sugar 25,5 g sorbitol (70% solution) 12.85 g Veegum K (Vanderbilt Co.) 1.0 g aromat 0.035 ml dyes 0.5 mg Distilled water q.s. to 100 ml

Injectable formulation

The following ingredients are mixed to form an injectable formulation.

Component amount a compound of the invention 0.2 g

sodium acetate buffer solution, 0.4 M 2.0 ml

HCl (IN) or NaOH (1 N)

Water (distilled, sterile)

• · · · · · · · · ♦ 4 • ♦ · * · · · · • · · · · 126 • · ♦ • ♦ • · · · · · • • · • · «· ···· • · ·· * · • · q. Ξ on appropriate pH q.S. on 20 ml

Liposomal formulations

The following ingredients are combined to form a liposomal formulation.

Quantity component

a compound of the invention 10 mg L-α-phosphatidylcholine 150 mg tert.butanol 4 ml

The frozen sample is lyophilized overnight. The sample is diluted with 1 ml 0.9% saline. Liposome size is reduced by sonication.

Example 19

Isolation and preparation of procollagen C-proteinase

Human PCP cloning and HT-1080 vector construction

Human procollagen C-proteinase (PCP, also known as Bone Morphogenetic Protein-1 or BMP-1) is cloned from the human fibroblast cDNA library (Stratagene, San Diego, CA). Cloning is performed by PCR based on said nucleotide sequence (Wozney, JM, Rosen, V, Celeste, AJ, Mitstock, LM, Whitters, MJ, Kriz, RW, Hewick, RM, and Wang, EA (1989) , GenBank accession number M22488, location of genes in chromosome HUMBMP1), using Taq polymerase, 5'primer GCGCGCGGTACCCGCCCCGCCAGCATGCCCGGCGTGGCCCGCCTGCC

GCTGCTGCTCGGGCTGCTGCTGCTCCCGCGTCCCGGCCGGCCGCTGGA

127

- * r r *, ϊ »» » . * ·· »·· * _t * · ··· · · · · · • · · *" ···· ·· ·· ·· ···

CTTGGCCGACTACACCTATGACCTGGC (SEQ ID NO: 1) (01igoTherapeutics, Inc., Wilsonville, OR) and 3 'reverse standard primers CCGCTCGAGCCTCACTGGGGGGTCCGGTTTCTTTTCTGCACTCGGAAT

TTGAGCTGGTG (SEQ ID NO: 2) (Gibco) to obtain a full length nucleotide encoding a signal sequence, a propeptide, a catalytic domain and all C-terminal domains into a natural translational termination site. The PCR product was purified by gel electrophoresis using Wizard DNA purification system (Promega, Madison, WI) and ligated directly into mammalian expression vector pCR3.1 (Invitrogen, Carlsbad, CA) by the TA cloning method. The ligated product was used to transform E. coli strain TOPIOF '(Invitrogen, Carlsbad, CA) by a standard heat shock method and transformants were selected by restriction analysis or purified plasmid using HindIII and BamHI enzymes. PCP insert positive positive transformants were sequenced using a Perkin-Elmer / ABI system. Two clones were selected to encode an input amino acid sequence identical to that predicted by Wozney et al. These two clones are recombined by restriction using enzymes BbrI, which cleaves at the naturally occurring internal site and EcoRV, which cleaves at the junction site of the insert and the vector.

The excised fragments were religated into EcoRV-treated pCR3.1. The resulting construct contains an input coding sequence that is identical to the sequence designated by Wozney et al. except for two latent mutations in the G -> A signal sequence at both positions 39 and 45, counting from the translation start site (ATG). The complete plasmid construct was enlarged in E. coli DH5α and purified using anion exchange chromatography (MaxiPrep column from Qiagen (Valencia, CA), catalog 12162).

Transfection of HT-1080 and selection of a clone expressing PCP

The HT-1080 human fibrosarcine line (ATCC) was grown in DEEM glucose (DMEM-HG) enriched with 10 heat-inactivated heat.

128 germline bovine serum (HI-FBS) in 100 mm culture dishes (Falcon, Becton Dickenson, Franklin, NJ) and transfected with 2 μ5 purified plasmid using the standard method for Lipofectamine (Gibco, Bethesda, MD) in serum free medium. Stable transfectants were selected by treating the culture with 400 µg / ml G418 (Gibco). After selection for 10 days, the adherent individual colonies are picked from the plate, transferred again to 12-well plates and allowed to grow until confluence.

Individual stable colonies are sorted for PCP expression by TaqMan (Perkin-Elmer, Foster City, CA) analysis using an equivalent amount of total RNA, 5 'primer

GACGAAGAGGACCTGAGGGCCTT (SEQ ID NO: 3) (Perkin-Elmer). The stable line, HT-1080 / hPCP-23, is selected with respect to the highest level of PCP mRNA expression in TaqMan. Stock solutions of the stable HT1080 / hPCP-23 line are transferred to DMEM-HG supplemented with 5% HI-FBS and 10¾ DMSO (no G418 added) and slowly frozen overnight at -70 ° C and transferred to a liquid nitrogen bath. for long-term storage. Revitalized HT-1080 / hPCP-23 is maintained in DMEM-HG enriched with 10 µl HI-FBS and 250 µg / ml G418 for no more than 7 passes. Expression of PCP for collection is performed by repeating and culturing HT-1080 / hPCB-23 on rat tail collagen type I coated plates (Falcon) in OptiMEM (Gibco) serum free medium without G418 for 24 hours.

PCP production in HT1080 cells.

HT1080 cells that are transformed to produce PCP are adapted to grow in a suspension of OptiMEM medium (Gibco) supplemented with 5 fetal bovine serum and 4 ml / l G418 (Gibco). The culture is maintained at 37 ° C and a dissolved oxygen concentration of 30 L. A typical batch size is 10 liters. When the cell density reaches 4-6 x 10 ⁴ cells / ml, the culture medium becomes

Collect 129 and filter through 0,2 μπι membranes. Alternatively, the cultures are sprayed with fresh medium at a rate of 0.8 to 1.0 culture volume / day. The density of the trimming cultures reaches 1-2.5 x 10 ⁶ cells / ml and is maintained for 2 weeks under continuous harvesting.

Purification of PCP from HT 1080 cells

Packed with Dyematrex Gel Green A (Millipore,

Bedford, MA) was equilibrated to 50 mM HEPES, pH 7.2, containing 6 mM CaCl ₂ and 0.3 M NaCl. After loading with HT 1080 cell culture liquid, the column is washed with ten column volumes of buffer buffer containing 1.0 M NaCl. PCP is eluted with 50 mM HEPES pH 7.2 containing 3 M NaCl, 2 M urea and 6 mM CaCl ₂ . The elution fractions were combined and concentrated to 150-200 mL and dialyzed overnight with 4.0 L of 50 mM HEPES, 6 mM CaCl 2, pH 7.2. This material is centrifuged at 5000 g for 15 minutes to remove precipitates. The sample containing PCP is dried at -20 ° C until the next process.

The sample containing PCP is thawed and diluted with 50 mM HEPES pH 7.2, containing 6 mM CaCl ₂ , if necessary to adjust the NaCl concentration to 0.1-0.15 M. Then the pH is adjusted to 6.7 with 2 N HCl. The protein solution is filtered through a 0.45 μιη filter to remove precipitates. The precipitate was then transferred to a column packed with high-performance Q-Sepharose (Pharmacia, Piscataway, NJ) which was equilibrated with 50 mM HEPES pH 6.7 containing 6 mM CaCl? and 0.15 M NaCl. The PCP is not retained in the column and is present in the stream in fractions. PCP was concentrated to 1 mg / ml and used for monitoring.

PCP production in Drosophila cells

Drosophila cells that have been transformed into PCP production are grown in a biological reactor at a typical batch volume.

130 liters in SF900 II SF medium (Gibco). • 130 liters in SF900 II SF medium (Gibco). The temperature is maintained at 30 ° C and the dissolved oxygen concentration is 30%. Periodically, cells are supplied with a cocktail containing glutamine, lipids and yeast. When the cell density reaches 30-50 x 10 ⁶ cells / ml, the supernatant is collected by centrifugation and concentrated by ultrafiltration using a 30 Kd membrane.

Purification of PCP from culture media from Drosophila cells

The culture medium from drosophila cells is concentrated eight-fold and the pH is adjusted, if necessary, to 7.1-7.2. The culture fluid is centrifuged at 3000 g for 10 minutes and then filtered through 0.45 μιη filters. The culture liquid was transferred to a column packed with carboxysulfone packing material (JT Baker / Mallinckrodt, Philisburg, NJ) that was equilibrated with 0.1 M NaCl, 50 mM HEPES, 6 mM CaCl ₂ , pH 7.2. After loading, the column is washed with 10 column volumes of buffer buffer. The retained proteins are eluted with a gradient of 0.1 to 1.0 M NaCl with 9 column volumes. Fractions with PCP activity were pooled for further purification.

The PCP eluted from the carboxysulfone column was loaded onto a Dyematrex Gel Green A column (Millipore, Bedford, MA) that was equilibrated with 50 mM HEPES, pH 7.4, containing 6 mM CaCl ₂ and 0.3M NaCl. The column is washed with ten column volumes of buffer containing 1.0 M NaCl. The retained proteins are eluted with 50 mM HEPES pH 7.2, containing 3 M NaCl, 2 M urea and 6 mM CaCl ₂ . The elution peak is dialyzed against 50 mM HEPES, pH 7.4 containing 0.3 M NaCl, 6 mM CaCl ₂ . The precipitate is centrifuged at 3000 g for 10 minutes. Brij 35 (Sigma, Madison, WI) was added to the supernatant to a final concentration of 0.02 3. This material was used for monitoring.

Example 20

131

Isolation of collagenase enzymes

The catalytic domain of human collagenase-1 was expressed as a fusion protein with ubiquitin in E. coli (Gehring ER et al. J. Biol. Chem., 270, 22507, (1995). Purification of the fusion protein liberated the collagenase-1 catalytic domain by treatment with 1 mM aminophenyl mercuric acetate (ΑΡΜΑ) for 1 hour at 37 ° C and purified by zinc chelate chromatography.

Human collagenase-2 and gelatinase B were isolated in active form from leukocyte coatings (Mookhtiar et al., Biochemistry, 29, 10620, (1990)).

The propeptide and part of the catalytic domain of human collagenase-3 were expressed in E. coli as an N-terminal fusion protein with ubiquitin. After purification, the catalytic domain was obtained by treatment with 1 mM ΑΡΜΑ for 1 hour at 37 ° C and purified by zinc chelate chromatography.

Rat collagenase-3 was purified in active form from uterine smooth muscle cell culture medium (Roswit, W. T. et al., Arch, Biochem. Biophys., 225, 285-295 (1983)).

Example 21

Inhibition of procollagen C-proteinase activity

The ability of compounds to inhibit PCP was demonstrated in the following in vitro assay using a synthetic peptide as substrate.

Test A

The continuous assay is performed using 20 μΜ of substrate (Dabcyl-Pro-Tyr-Tyr-Gly-Asp-Glu-Pro-n-Leu-Edans) (SEQ ID NO: 6). Final test conditions are 20 μΜ of substrate, 50 mM HEPES pH 7.5, 50 mM NaCl, 3% DMSO, 30 ° C and PCP enzyme. The product formed is

132

monitors by fluorescence spectroscopy, Ex. = 335 nm, Em = 490 nm. IC ₅₀ is calculated from the dose response of the compounds.

Assay B μΐ of Buffer A (20 mM HEPES) containing the desired concentrations of the test compound in DMSO or vehicle is mixed with 10 μΐ of approximately 1 mm / ml PCP and 10 μΐ of 0.1 mM substrate, both in 20 mM HEPES. The contents were mixed, incubated at room temperature for 1-2 hours and florescent readings were performed with a Victor plate reader (Ex. 405 nm, Em. 460 nM lamp energy 2000-40000, 0.1-1 sec / well). The substrate was DACM-Cys-Pro-Tyr-Gly-Asp-Glu-Pro-nLeu-Lys-FITC-OH. (SEQ ID NO: 7) (DACM = dimethylaminocumaryl maleaimide, FITC = fluorescein isothiocyanate). IC 50 is calculated from a graph of initial velocity vs-compound concentration.

A further in vitro assay using natural procollagen as a substrate may also be used, and this assay is described in more detail in WO 97/05865 ("C-Proteinase Inhibitors for Treatment of Disorders Relating to the Overproduction of Collagen), published February 20, 1997.

The compounds listed in Table I have IC _5n in the range of 0.01 to 2 μΜ.

Example 22

Measurement of collagenase activity.

In vitro inhibitory activity of the compounds of the invention against collagenase-1, collagenase-2 and collagenase-3 was determined by hydrolysis of MCA-Pro-Leu-Gly-DPA-Ala-Arg-NH ₂ (SEQ ID NO: 8) (Bachem, Inc) at 37 ° C as described by Knight, CG et al., FEBS Lett., 296 (3): 263-266 (1992).

The collagenase enzyme is diluted with assay buffer (50 mM Tricine pH 7.5, 200 mM Naci, 10 mM CaCl 2, and 0.005% Brij-35) containing 1 pmol of the above substrate dissolved in DMSO.

• «

133 · · · · ·- _{# # # # # # # # # # # # # # # # #}

Compounds of the invention dissolved in DMSO or only DMSO (control) were added such that the final concentration in all assays was 2.5%. Fluorescence changes are monitored with a Perkin-Elmer LS-50B fluorimeter using an excitation wavelength of 328 nm and an emission wavelength of 393 nm.

The selected compounds of Tables I were 100-1000 times more selective for PCP inhibition than the collagenase-1 and collagenase-2 enzymes.

The above invention is described to illustrate and illustrate examples of embodiments of the invention. It is understood that changes and modifications may be made by those skilled in the art without departing from the scope of the invention. All such modifications are intended to fall within the scope of the appended claims.

Claims (24)

PATENTOVÉ Claims 1. A compound of formula Ia: n (Ia) where: R ¹ is alkyl, haloalkyl, heteroalkyl, cycloalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocyclylalkyl, cycloalkylalkyl, - (alkylene) -C (O) -X (wherein X is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, amino, monosubstituted amino, disubstituted amino, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy, cycloalkoxy, cycloalkylalkoxy , heteroalkyloxy, aralkyloxy, or heteroalkyloxy), or -C (= NR ') NHSO 1 R (where R' is hydrogen or alkyl, and R is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, or heterocyclylalkyl); R is -CH (R 11) Ar ^; or -CH (R) CH = CHAr ¹ wherein R ¹ is hydrogen or alkyl; and Ar 'is aryl or heteroaryl; Ar 'is either: (i) a phenyl ring of formula (a): where: Self, hydrogen, alkyl, alkylthio, 135 R ³ and R ⁷ are, independently of, or halogen; R ⁴ and R ⁶ are, independently of halogen; R ⁵ is alkyl, haloalkyl, itself, hydrogen, alkyl, or heterocyclyl, alkylthio, arylthio, aralkylthio, heteroarylthio, heteroaralkylthio, cycloalkylthio, cycloalkylalkylthio, alkoxy, aryloxy, aralkoxy, heteroaryloxy, heteroaralkyloxy, cycloalkoxy, hydroxy, alkoxy, cycloalkylalkoxy, cyano, carboxy, nitro, amino, moalkylamino, dialkylamino, alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, heteroarylsulfonyl, heteroaralkylsulfonyl, cycloalkylsulfonyl, cycloalkylalkylsulfonyl, or -Y- (alkylene) -C (O) -Z [wherein Y is a bond, -NR ³ - , -O-, or -S (O) _r - (wherein n is from 0 to 2), R ^a is hydrogen or alkyl, and Z is alkoxy, hydroxy, amino, monosubstituted amino, or disubstituted amino]; or R ⁵ together with R '' form -O- (CR ^and R ^Q ) _n wherein n is 2 or 3 and each R ^h and R 7 ', independently of each other, is hydrogen or alkyl; or the carbon atoms to which R ⁵ and R ⁴ are attached are fused to the C 2 -C 3 carbons of the benzofuran ring; provided that at least two of R ^3, R ^4, R ^fc and ^R7 are not simultaneously hydrogen; or (ii) a naphthyl ring of formula (b): (b) R ¹ is hydrogen, alkyl, alkoxy, or halogen; and R 6 is hydrogen, alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, 136 nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl provided that both R ¹⁰ and R ¹¹ are not simultaneously hydrogen atoms; and pharmaceutically acceptable salts, prodrugs, individual isomers, and mixtures of isomers thereof. A compound according to claim 1, wherein R is -CH (R ² ) Ar ¹ , wherein R ² is hydrogen. A compound according to claim 1 or claim 2, wherein Ar ¹ is heteroaryl and Ar ^{2 is a} phenyl ring of formula (a). The compound of claim 3, wherein: R ³ and R ⁷ are independently alkyl, alkylthio or halogen; R ⁴ is hydrogen, alkyl or halogen; R ⁵ is alkyl, haloalkyl, alkylthio, alkoxy, alkoxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl; and R is hydrogen. The compound of claim 4, wherein R 1 and R 2 are independently alkyl or halogen; R is alkyl; and R ⁵ is alkyl, alkoxy or halogen. The compound of claim 5, wherein: ^L Ar is indol-5-yl, l-methylindole-5-yl, 3-acetylindole-5-yl, 3-propionylindol-5-yl, 3- (2-methylpropionyl) indol-5-yl, imidazol-5- yl, 2-methylbenzimidazol-5-yl or benzimidazol-5-yl; R ', R' and R 'are methyl; and R 'is methoxy, chlorine or bromine. The compound of claim 3, wherein: 137 R? and R ⁶ are hydrogen; R ³ and R ⁷ are independently alkyl, halogen; and R ⁵ is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl. The compound of claim 7, wherein R ³ is alkyl; R ⁵ is alkyl, alkoxy or halogen; and R ⁷ is alkyl or halogen. The compound of claim 8, wherein: Ar ¹ is indol-5-yl, 1-methylindol-5-yl, 3-acetylindol-5-yl, 3-propionylindol-5-yl, 3- (2-methylpropionyl) indol-5-yl, imidazole-5- yl, 2-methylbenzimidazol-5-yl or benzimidazol-5-yl; R ³ and R are methyl; and R ⁵ is methoxy, chloro or bromo. A compound according to claim 2, wherein Ar ¹ is aryl and Ar ² is a phenyl ring of formula (a) The compound of claim 10, wherein: R 1 and R 2 are independently alkyl, alkylthio or halogen; R ¹¹ is hydrogen, alkyl or halogen; R ⁵ is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl; and R 1 is hydrogen. The compound of claim 11, wherein: 138 Ar ¹ is a phenyl ring substituted with one or two substituents selected from hydroxy, methylenedioxy or methoxycarbonyl; and R ³ and R ⁷ are independently alkyl or halogen; R ⁴ is alkyl; and R ⁶ is alkyl, alkoxy or halogen. The compound of claim 12, wherein: Ar ¹ is 3,4-methylenedioxyphenyl, 3,4-dihydroxyphenyl or 4-methoxycarbonylphenyl; R ³ , R ⁴ and R ⁷ are methyl; and R ⁵ is methoxy, chloro or bromo. The compound of claim 10, wherein: R ⁴ and R ⁴ are hydrogen; R ³ and R 'are independently alkyl or halogen; and R ⁵ is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl. The compound of claim 14, wherein: ^Ar1 is a phenyl ring substituted with one or two substituents selected from hydroxy, methylenedioxy, or HN ΓΊΡ t ret rhnn k \ r 1 ---------- j J _V XX R ³ is alkyl; R ^? is alkyl, alkoxy or halogen; and R is alkyl or halogen. The compound of claim 15, wherein: Ar 1 is 3,4-methylenedioxyphenyl, 3,4-dihydroxyphenyl or 4-methoxycarbonylphenyl; R 'and R' are methyl; and R is methoxy, chloro or bromo. 139 The compound of claim 1, wherein R is -CH (R ² ) Ar ¹ wherein R ² is alkyl. A compound according to claim 17, wherein Ar ¹ is heteroaryl and Ar ² is a phenyl ring of formula (a). The compound of claim 18, wherein; R ³ and R ⁷ are independently from each other hydrogen, alkyl, alkylthio or halogen; R ⁴ is hydrogen, alkyl or halogen; R ⁵ is alkyl, alkoxy or halogen; and R ^b is hydrogen. A compound according to claim 17, wherein Ar ¹ is aryl and Ar ² is a phenyl ring of formula (a). The compound of claim 20, wherein: Ar ¹ is phenyl, substituted with one or two substituents selected from hydroxy, methylenedioxy or methoxycarbonyl; and R 'and R' are independently from each other hydrogen, alkyl, alkylthio or halogen; R ⁴ is hydrogen, alkyl or halogen; R 'is alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl; and R 1 is hydrogen. A compound according to claim 2, wherein Ar ¹ is heteroaryl and Ar is a naphthyl ring of formula (b). 140 23. The compound of claim 2, wherein Ar ¹ is aryl and Ar is ^a naphthyl ring of formula (b). The compound of claim 1, wherein R is -CH (R ² ) CH = CHAr ^x wherein R ² . is hydrogen. 25. Compound according to claim 24, wherein Ar ¹ Yippee heteroaryl and Ar ² Yippee a phenyl ring of formula (a). 26. Compound according to claim 24, wherein Ar ¹ Yippee aryl and Ar ² Yippee a phenyl ring of formula (a). 27. Compound according to claim 24, wherein Ar ¹ Yippee heteroaryl and Ar ² Yippee naphthyl ring of formula (b). 28. Compound according to claim 24, wherein Ar ¹ Yippee aryl and Ar ² Yippee naphthyl ring of formula (b). 29. Compound according to any of claims 1 to 28, where R ¹ Yippee alkyl, aralkyl, heteroalkyl or - (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl. A compound according to claim 29, wherein R ¹ is 2-propyl, hydroxymethyl, t-butoxymethyl, 2-hydroxyethyl, 2-hydroxypropyl, 2-amidopropyl, acetyloxymethyl, benzyl, methoxymethyl, or - (alkylene) -C (O) - X wherein X is 2- or 4-pyridylmethylamino, 1-alkoxycarbonylpyridin-4-ylamino, optionally substituted benzylamino, 4-optionally substituted benzyloxycarbonylpiperazin-1-yl, 4-optionally substituted phenylpiperazin-1-yl, 4-alkoxycarbonylpiperazin-1- yl, or 4-optionally substituted heteroarylpiperazin-1-yl. 141 ·· · 9 · Φ Φ Φ Φ Φ · · · · · · · · · · · · · · · · · · The compound of claim 29, wherein R ¹ is heteroalkyl or (alkylene) -C (O) -X, wherein X is alkyl, amino, monosubstituted amino, disubstituted amino, or heterocyclyl. The compound of claim 31, wherein methylsulfonylaminomethyl, phenylsulfonylaminomethyl, (3-nitrophenyl) CH ₂ SO ₂ NHCH ₂ , methylcarbonylaminomethyl, 4- (methoxycarbonyl) phenylcarbonylaminomethyl, 2- (pyrrol-1-yl) phenylcarbonylaminomethyl, 3-cyanphenylaminocarbonylaminocarbonylaminomethyl, kyanfenylaminokarbonyl aminomethyl, thien-2-ylcarbonylaminomethyl, phenylcarbonylaminomethyl, (C ₆ H ₅₎ CHCH ₃ NHCO (C ₂ H ₄₎ CONHCH _2, (4-methoxyphenyl) COC ₂ H ₄ CONHCH _2, 4-chlorfenylsulfonylaminokarbonylaminomethyl, 5- (acetyl) thien-2-ylcarbonylaminomethyl, pyridin-3-ylcarbonylaminomethyl, (3,4,5-trimethoxyphenyl) C ₂ H ₄ CONHCH ₂ -, 3-methoxyphenylaminocarbonylaminomethyl, (phenoxy) CH (CH ₂ CH ₃ ) CONHCH ₂ -, 1 - (ethoxycarbonyl) piperidin-4-yl-aminomethylcarbonylaminomethyl, 3- (benzyloxycarbonylamino) propyl, 2 - [(diphenyl) methylaminocarbonyl] ethyl, 2- [2- (methyl) butylaminocarbonyl] ethyl, or 2-E (C 1 H 5) CHCH 3 NHCO] ethyl. Compounds of formula (II) (ii) wherein R ', R and Ar' are as defined in claim 1. 34. Compounds of formula III (Hi) 142 wherein R ¹ , R ² and Ar ² are as defined in claim 1 and R ¹² is alkyl. Compounds of formula IV wherein R ¹ , R and Ar ² are as defined in claim 1 and R 'is hydrogen or a protecting group and R''is a protecting group. 36. A process for the preparation of a compound according to claim 1, wherein the process comprises: (ii) reacting a compound of formula 1: wherein R ¹ , R 1, Ar ¹ and Ar ¹ are as defined in claim 1 and Y is a hydroxy, halogen, alkyl or succinimide ester, with a hydroxylamine of formula NHROR, wherein R 1 is hydrogen or a nitrogen protecting group and R '' is a protecting group for O, then removing the protecting group (s) to give a compound of formula Ia; or (ii) reacting a compound of formula 2 wherein R ¹ and Ar ² are as defined in claim 1 and R ^a and R ^b are suitable protecting groups for O and N: ·· 143 • · · · · · · · · · · · · · · · · · · ·. With an alkylating agent of the formula Ar ^J CHR ² X or Ar ¹ CH = CHCHR ² X, wherein: Ar ¹ , R ² are as defined in claim 1 and X is a leaving group, under alkylation reaction conditions or with an alcohol of formula AR / CHR 4 H in the presence of a coupling agent and a trialkylphosphine, and then deprotecting to form a compound of formula Ia; and (iii) optionally converting the compound of formula Ia prepared in steps (i) - (ii) to the corresponding acid addition salt by treatment with an acid; (iv) optionally converting the compound of formula Ia prepared in steps (i) - (ii) above to the corresponding free base by treatment with base; and (v) optionally separating mixtures of stereoisomers of the compound of formula Ia prepared in steps (i) - (iv) to obtain the individual stereoisomers. A pharmaceutical composition comprising a therapeutically effective amount of a compound according to any one of claims 1 to 32 and a pharmaceutically acceptable excipient. Compounds according to any one of claims 1 to 32 for use as a therapeutically active substance. Use of a compound according to any one of claims 1 for the preparation of a medicament comprising a compound according to any one of claims 1 to 32 for the treatment of diseases such as interstitial pulmonary fibrosis, pericentral fibrosis, Symmers fibrosis, perimuscular fibrosis, kidney and liver fibrosis, idiopathic pulmonary fibrosis, endocardial sclerosis , hepatitis, acute respiratory stress syndrome, arthritis, cystic fibrosis, tendon surgery, corneal scarring, surgical adhesion and restenosis. 144:. · · · · Compounds according to any one of claims 1 to 32, prepared according to the process of claim 36. 41. Use of a compound of formula Ib Ar ² (Ib) R ¹ is alkyl, haloalkyl, heteroalkyl, cycloalkyl, aryl, aralkyl, aralkenyl, heteroaryl, heteroaralkyl, heteroaralkenyl, heterocyclylalkyl, cycloalkylalkyl, - (alkylene) -C (O) -X (wherein X is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, amino, monosubstituted amino, disubstituted amino, aryl, aralkyl, heteroaryl, heteroaralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy, cycloalkoxy, cycloalkylalkoxy , heteroalkyloxy, aralkyloxy, or heteroaralkyloxy), or -C (= NR ') NHSOxR (wherein R' is hydrogen or alkyl, and R is alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, or heterocyclylalkyl); R ¹ is -CHÍRKAr or -CH ^(R2) CH = CHAr ^l, wherein R ² is hydrogen or alkyl; and Ar 'is aryl or heteroaryl; Ar is either: (i) a phenyl ring of formula (a): where: * φ 145 R ³ and R ⁷ are, independently of each other, hydrogen, alkyl, alkylthio, or halogen; R ⁴ and R ⁶ are, independently of each other, hydrogen, alkyl, or halogen; R ⁵ is alkyl, haloalkyl, heterocyclyl, alkylthio, arylthio, aralkylthio, heteroarylthio, heteroaralkylthio, cycloalkylthio, cycloalkylalkylthio, alkoxy, aryloxy, aralkoxy, heteroaryloxy, heteroaralkyloxy, cycloalkoxy, cycloalkylalkoxy, alkyloxycarbonyl, amino, alkoxycarbonyl, carboxy, , moalkylamino, dialkylamino, alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, heteroarylsulfonyl, heteroaralkylsulfonyl, cycloalkylsulfonyl, cycloalkylalkylsulfonyl, or -Y- (alkylene) -C (O) -Z [wherein Y is a bond, -NR ^d -, -O-, or " S (O) _n - (wherein n is from 0 to 2), R ^a is hydrogen or alkyl, and Z is alkoxy, hydroxy, amino, monosubstituted amino, or disubstituted amino]; or R ⁷ together with R ⁴ form -O- (CR ⁸ R ⁹ ) wherein n is 2 or 3 and each R- and R 'are, independently of each other, hydrogen or alkyl; or the carbon atoms to which R 1 and R ⁴ are attached are fused to the C 2 -C 3 carbons of the benzofuran ring; provided that at least two of R ³ , R ⁴ , P? and R ⁷ are not simultaneously hydrogen atoms; or (ii) a naphthyl ring of formula (b): (b) where: R 6 is hydrogen, alkyl, alkoxy, or halogen; and 146 9 ···· ♦ t ·· • 9 9 · * 9 · 9 R ¹¹ is hydrogen, alkyl, haloalkyl, alkylthio, alkoxy, alkyloxycarbonyl, aryloxy, hydroxy, halogen, cyano, carboxy, nitro, amino, monoalkylamino, dialkylamino or alkylsulfonyl; and pharmaceutically acceptable salts, prodrugs, individual isomers and mixtures of isomers thereof for the preparation of a medicament comprising a compound of formula Ia as defined above for the treatment of a disease treatable with a procollagen Cproteinase inhibitor, preferably for the treatment of interstitial collagens such as interstitial pulmonary fibrosis, pericentral fibrosis, Symmers fibrosis. , perimuscular fibrosis, kidney and liver fibrosis, idiopathic pulmonary fibrosis, endocardial sclerosis, hepatitis, acute respiratory stress syndrome, arthritis, cystic fibrosis, tendon surgery, corneal scarring, surgical adhesion and restenosis. 42. Novel Compounds, Intermediates, Formulations and Methods and Uses as essentially described hereinabove.