CZ20004509A3 - Method of executing gene therapy - Google Patents

Abstract

The use of the transcription factor Egr-1 polypeptide is described or a biologically active fragment thereof and nucleic acid molecules acids encoding such polypeptides in the manufacture of a medicament suitable for treating wounds in a mammal comprising a human. In addition, a sequence is disclosed that is likely to include important areas involved in transcription of the egr-1 factor people and its regulation. This sequence can be used to designing suitable nucleic acid molecules and vectors that are can be used in wound treatment as well as in other treatments.

Description

Method of gene therapy

Technical field

The invention describes the use of gene therapy methods in wound healing and related conditions. In particular, it describes a novel use of a polynucleotide that encodes an early growth response-1 (Egr-1) transcription factor in the treatment of wounds, wound healing and related conditions such as the treatment of ischemia-related skin ulcers, diabetes-related neuropathy, peripheral occlusive disease arteries, deep vein thrombosis, chronic venous insufficiency and pressure sores, reduction of post-operative scars associated with cataracts, skin grafts after burns, psoriasis, acceleration, remodeling and tissue regeneration, hard tissue repair such as bones, soft tissue repair, such as tendon, ligament, muscle, in promoting angiogenesis, restoration of the vascular endothelium following percutaneous trans-luminal coronary angioplasty, inhibition of left ventricular heart hypertrophy, modulation of vessel wall calcification, and promoting nerve regeneration.

Further, the invention relates to the inhibition of fibrotic conditions, such as pulmonary and liver fibrosis, and the prevention of baldness.

The invention describes transcription of Egr-1 and its regulation.

BACKGROUND OF THE INVENTION

Wound healing is a wide range of cellular, molecular, physiological and biochemical phenomena. During the knotting process, the cells migrate to the wound site, where components of the extracellular matrix are propagated and synthesized in order to restore the tissue to be very similar to the original uninjured tissue. This activity is regulated by mediators selected from cells located at the edges of the wounds. These include platelet-derived growth factor (PDGF), epidermal growth factor (EGF),

9 9

9 9 9 9 • 9

Transforming growth factor beta (TGF) and other cytokines. The positive effects of these agents on cells have been demonstrated both in vitro and in vivo (Moulin et al., J. Cell Biol. 68, 1-7, 1995) and include preferred PDGF applications in rat diabetes models (described in Brown et al., J. Surg. Res. 56: 562-570 (1994).

Over the past five years, a number of factors have been shown to accelerate cell proliferation in vitro and thus promote wound healing in animal models. Most attention is paid to TGF beta in the context of wound healing, as it promotes cell proliferation, differentiation and matrix production. TGF beta applied either superficially or systemically accelerates skin wound healing in animal models. (Aschcroft et al., Nature Medicine, 3, 1209-1215, 1997, Sporn and Roberts, J. Cell Biol. 119, 10171021, 1997, Beck et al., J. Clin. Invest. 92, 2841-2849, 1993) . PDGFs have also been shown to promote epithelial and vascular renewal in ischemic tissues and in animals with diabetes (Uhl et al., Lagenbecks Archive Fur Surgery Supplement-Kongerssband 114, 705-708, 1997 and Dirks and

Bloemers Mol. Biol. Reports 22, 1-24 (1996).

The transcription factor Egr-1 is a potential regulator of 30 genes and plays an important role in growth, development and differentiation (Liu et al., Crit Rev. Oncogenesis 7, 101-125, 1996, Khachigian and Collins Circ. Res. 81, 457-461

1997). Egr-1 is induced in vascular endothelial injury (Khachigian et al., Science, 271, 1427-1431, 1996) and targets for transcriptional activation are a number of genes that include epidermal growth factor (EGF), growth factor A platelet derived (PDF-A), basic fibroblast growth factor (bFGF), induction of PDGF A, PDGF B, TGF beta, bFGF, uro-plasminogen activator (u-PA), tissue factor and insulin-2-like growth factor ( IGF-2).

The transcription complex that mediates the induction of vascular endothelial factor (VEGF) depends on AP2 and not directly on Egr-1 (Gille et al., EMBO J. 16, 750-759, 1997). PDGF B directly decreases VEGF expression (Finkelzeller Oncogene 15, 669-676, 1997). Transcription of mRNA

VEGF was amplified by a number of factors including PDGF B, bFGF, keratinocyte growth factor (KGF), EGF, tumor necrosis factor alpha (TNF), and TGF beta1. VEGFs promote re-formation of endothelium in arterial injury. Data obtained in rabbit tests show stent passivation affecting inhibition of interstitial neo-intima formation, decreased thrombotic occlusion, accelerated endothelial recovery in prostheses, and increased vasomotor activity (van Belle, E. et al., Bichem. Biophys. Res. Comm., 235, 311-316.

1997, van Belle, E. et al., J. Am. Coll. Cardiol., 29, 13711379, 1997; Asahara, T., et al., Circulation, 94, 3291-3302, 1997). In 1996, NIH approved a pilot study investigating whether VEGF promotes endothelial recovery in humans. In addition, HGF has also been shown to promote endothelial recovery following angioplasty in a rat carotid artery model (Nakamura et al., Abstract 1681, American Heart Addociation Meeting, Dallas, 1998). In an animal model, VEGF-driven passage of metal stents has been shown to inhibit neointima formation, accelerate endothelial recovery, and increase vasomotor activity (Asahara et al., Circulation, 94, 3291-3302).

VEGF expression has been associated with wound and skin wound healing. In both cases, TGF alpha and its EGF receptor ligand (EGFr) are positively regulated. EGF expression induces Egr-1 (Iwami et al., Am. J. Physiol. 270, H2100-2107, 1996, Fang et al., Calcified Tissue International

57, 450-455, 1995; J. Neuroscience Res. 36, 58-65 (1993).

There is evidence that Egr-1 can activate expression of intracellular adhesive molecule-1 (ICAM-1) in phorbolester-stimulated B cells (Maltzman et al., Mol.

• ·

Cell. Biol. 16, 2283-2294, 1996) and can activate TNF alpha expression by the presence of an Egr-1 binding site in the TNF alpha promoter (Kramer et al., Biochim. Biophys. Acta 1219, 413-421, 1994). Finally, Egr-1 knockout mice are sterile and show luteinizing hormone (LH) deficiency (Lee et al., Science 273, 1219-1221, 1996), suggesting that the LH promoter may also be a target activation of Egr-1.

Bone penetration, mechanical stress, and fluid flow in osteoblast-like cells of MC3T3E1 induces Egr-1 (Dolce et al., Archs. Oral Biol. 41, 1101-1118, 1996, Ogata J. Cell Physiol. 170, 27). -34, 1997) with concomitant activation of growth factors. In the cartilage and bone of developing mice, expression of Egr-1 is predominant (McMahon et al., Development 108, 281-287) and causes regulation of the growth and differentiation of osteoblast cells (Chaudhary et al., Mol. Cell. Biochem. 156: 69-77 (1996). Egr-1 and related "zinc finger transcription factor of Wilm's tumor 1 (WT1)" are implicated in the regulation of osteoclastogenesis (Kukita et al., Endocrinology 138, 4384-4389, 1997) and prostacyclin E2 (PGE2) and EGF are induced by Egrl (Fang et al., Calcífíed Tissue Intarnational 57, 450-455, 1995; Fang et al., Prostoglandind, Leukotrienes and Essential Fatty Acids 54, 109-114, 1996). Vascular calcification is actively regulated in a manner similar to bone formation involving cells and factors known to be important in the regulation of bone metabolism (Dermer et al., Trends Cardiovsc. Med. 4, 45-49, 1994). Regulators of osteoblastogenesis and / or osteoclastogenesis can be adjusted to the degree of vascular calcification.

Hypertrophic stimuli such as hemodynamic dose and angiotensin II can be used to control negative production

dominated by Egr-1, which are under the control of a myocyte-specific promoter and are used in the treatment of heart failure.

Egr-1 is essential in the expression of the nerve growth factor (NGF) P75 receptor in Schwann cells (Nikam et al., Mol. Cell. Neuroscience 6, 337-348, 1995). NGF induces expression of Egr-1 with concomitant activation of growth factors (Kendall et al., Brain Research. Molecular Brain Research. 25: 73-79, 1994; Kujubu et al., Journal of Neuroscience Research 36, 58-65. , 1993).

Application of polynucleotides encoding the transcription factor Egr-1 at the wound site and its subsequent expression has been found to promote accelerated healing.

SUMMARY OF THE INVENTION

The invention provides the use of a nucleic acid molecule comprising a sequence encoding a transcription factor Egr-1 polypeptide or a biologically active fragment thereof in the manufacture of a medicament for the treatment of wounds in mammals that include humans.

To avoid error, the term "polynucleotide" refers to any reference to a nucleic acid molecule.

The invention further provides a method of treating a wound in a mammal that includes a human. The method comprises administering to a mammal a nucleic acid molecule comprising a sequence encoding a Egr-1 transcription factor polypeptide or a biologically active fragment thereof.

The invention further provides a nucleic acid molecule comprising a sequence encoding a transcription factor Egr-1 polypeptide or a biologically active fragment thereof that can be used in wound healing.

• · ·

The invention further provides a pharmaceutical compound comprising a nucleic acid molecule comprising a sequence encoding Egr-1 or a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers.

The invention further provides the therapeutic use of polynucleotides encoding the transcription factor Egr-1 in the treatment of wounds. The invention further describes the therapeutic use of Egr-1 transcription factor alone in the treatment of wounds as described below.

«

The invention further provides the use of Egr-1 polypeptides and E nucleic acid sequences encoding Egr-1 of any origin or species. Protein sequences are highly conserved among species. For example, in rats and mice, the sequences exhibit 98% homology. The mouse Egr-1 DNA sequence is known (Cell, 53, 37-43, (1998)). The deduced amino acid sequence shows a long open reading frame with a stop codon (TAA) at position 1858). The deduced amino acid sequence contemplates a polypeptide comprising 533 amino acids with a molecular weight of 56,596. Corresponding sequences from each species can be obtained by methods known in the art, for example, by testing a genomic or cDNA library using oligonucleotide sequences based on or derived from the sequence. mouse Egr-1. Human Egr-1 cDNA is known to be described in Nucleic Acids Research 18 p4283, 1990. Similarity between mouse and human. the sequence is 87% and 94% at the nucleoside and protein levels, respectively.

References to Egr-1 polypeptides and polynucleotides described herein can generally be applied to sequences of any origin that include murine Egr-1 DNA and corresponding amino acid sequences as described in Cell, 53, 37-43 (1988) and human sequences cited herein. in Nucleic Acids Research 18, p4283, 1990 and the sequence ", "

from other species. As described above, the term Egr-1 also includes variants, fragments, and analogs of Egr-1. The use of a human sequence is most preferred.

The term "wound treatment" includes treatment of conditions associated with injury, wound healing, and related conditions and therapy that promotes, enhances or accelerates tissue healing and includes treatment of ulcers formed in association with diabetes and occlusive diseases of peripheral arteries, postoperative scars, burns, psoriasis. tissue remodeling and bone correction and promotion of angiogenesis, endothelial re-formation following percutaneous trans-luminal coronary angioplasty, inhibition of left ventricular cardiac hypertrophy, vascular wall calcification and neurogeneration support. Further, the term includes the inhibition of fibrotic conditions such as pulmonary and liver fibrosis and the prevention of alopecia.

The term "biologically active fragment of Egr-1" means a fragment that exhibits Egr-1 activity comprising the wound healing properties of the invention.

The term "genetic elements" means polynucleotides comprising a region that encodes a polypeptide or a region of a polynucleotide that regulates replication, transcription or translation, or other processes that are important for expression of polypeptides in a host cell, or a polynucleotide comprising both polypeptide encoding regions and an operably linked region that regulates expression. Genetic elements may be contained in a vector that replicates as an episomal element. That is, it exists as a molecule physically independent of the host cell genome. These molecules may be contained in plasmids. Genetic elements may also occur in the genome of the host cell, not in its natural state. Then there is manipulation like insulation,

8 • 00 · 1 · • * · · · · · • · · · · • ··· 0 0 · · 0 ·· • · · 0 0 ··· ·· «« i • · · * · 0 0 • 0 0 0 0 0 0 • »0 0 0 0 0 cloning a introduction into host cells in the form purified DNA or in vector. Date “Host cell is a cell, which is

transformed or transfected, or is capable of transforming or transfecting with an exogenous polynucleotide sequence.

The term "identity" is the relationship between two or more polypeptide sequences or two or more polynucleotide sequences as defined by sequence comparison. The term also means the degree of sequence alignment between polypeptide or polynucleotide sequences, for example, pairing between bands of such sequences. You can easily calculate a match (see Computational

Molecular Biology, Gloss, A.M. ed., Oxford University Press, New York, 1988, Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993, Computer Analysis of Sequence Data, Partl, Griffin, A.M. and Griffin, HG, eds., Humana Press, New Jersey, 1994, Sequence Analysis in Molecular Biology, von Heinje, G. Academic Press, 1987, and Sequence Analysis Avg, Gribskov, M. and Devereux, J. eds., M Stockton Press, New York, 1991). While there are a number of methods that determine the degree of agreement between two polynucleotide or polypeptide sequences, this term is well known in the art (Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987, Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and Carillo, H., over Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Methods commonly used to determine sequence identity include, but are not limited to, those described in Carillo, H., and Lipman, D., Siam J. Applied Math., 48: 1073 (1988). to produce the maximum number of pairs between the sequences tested.

codify by computer program. Preferred computational methods suitable for determining sequence identity between two sequences include, but are not limited to, the GCG program (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BLASTP, BLASTIN, and BLASTIN. FASTA (Atschul, SF et al., J. Molec. Biol. 215: 403 (1990)).

The term "isolated" means altered by man from his natural stage. This means that if it occurs in nature, it will be removed from its natural environment, or its natural environment will change, or both. For example, a naturally occurring polynucleotide or polypeptide that occurs in a living organism in its natural state is not considered "isolated," but the same polynucleotide or polypeptide separated from an existing natural state material is called isolated. As part of the isolation process or after isolation, such polynucleotides may be coupled to other polynucleotides, such as DNA, for mutagenesis, to produce a fusion protein, and for propagation or expression in the host. Isolated polynucleotides alone or linked to other polynucleotide sequences, for example in the form of vectors, can be introduced into host cells, cell culture, or whole organisms. If the DNA is introduced into the host cell in culture or in the whole organism, then such DNA will still be isolated because it does not occur in its natural form or in its natural environment. It remains isolated polynucleotides or polypeptides as defined herein.

The term " polynucleotides " generally means any polyribonucleotide or polydeoxyribonucleotide that can be untreated RNA or DNA or modified RNA or cDNA. For example, polynucleotides include, but are not limited to, single-stranded and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, or single-stranded, double-stranded, and triple-stranded regions. , single-stranded and double-stranded RNA and RNA, which is a mixture of single-stranded and double-stranded regions, hybrid molecules containing DNA and RNA, which may be single-stranded, typically double-stranded and triple-stranded, or may be present as a mixture of single-stranded and double-stranded regions. In addition, a polynucleotide herein refers to triple-stranded regions containing RNA and DNA, or both DNA and RNA. The chains of such regions may originate from the same molecule or from different molecules. Regions may include all molecules, but typically include only a region of any of the molecules. One of the triple helix molecules of the region is often an oligonucleotide. The term polynucleotide includes DNA or RNA as described above containing one or more engineered bases. DNA or RNA with a backbone modified to be more stable or for other purposes is " polynucleotides " as used herein. DNA or RNA containing unusual bases such as inosine or engineered bases such as tritylated bases are polynucleotides within the meaning of the term herein. It is preferred that a large number of DNA and RNA treatments be carried out, which can then serve a variety of purposes well known in the art. The term "polynucleotide" means chemically, enzymatically, or metabolically engineered forms of polynucleotides, as well as chemical forms of DNA or RNA of characteristic viruses and cells that include individual cells or complexes thereof. Polynucleotides are short polynucleotides, referred to herein as oligonucleotides.

The term "polypeptides" includes all polypeptides as described below. The basic structure of polypeptides is well known and described in many textbooks and other publications. As used herein, any peptide or protein comprising two or more amino acids linked to one another in a linear chain by peptide bonds. The term includes short chains, commonly known in the art as peptides, oligopeptides and oligomers, and longer chains, which are generally called proteins, of which there are many species. Preferably, the polypeptides comprise amino acids other than 20 naturally occurring amino acids. These amino acids, including terminal amino acids, can be treated in a given polypeptide either by natural processes, such as posttranslational processing, but also by chemical modification methods well known in the art. Even the common modifications that occur naturally in the modifications are so many that their list cannot be listed here. However, these modifications are very clearly described in basic textbooks and in greater detail in monographs as well as in the scientific literature and are well known in the art.

Known modifications of the polypeptides include several illustrative examples. It is acetylation, acylation, ADPribosylation, amidation, covalent attachment of flavin, covalent attachment of a hemocomponent, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphothidyllinositol, crosslinking, forming a cycle, forming disulfide bond, demethylation cystine formation, proglutamate formation, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylazing, sulfation, RNA transfer mediated by amino acid addition to proteins, such as arginylation and ubiquitination. Such modifications are well known in the art and are described in the literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, and ADP-ribosylation are described, for example, in Proteinsstructure and Molecular Properties, 2 ^nd Ed., TE Creighton, WH Freeman and Company, New York (1993). . In Wold, F., Posttranslational Protein Modifications: Perspectives and «

Prospects, pgs. 1-12 in Postranslational covalent modification of proteins, B.C. Johnson, (1983), Seifter et al., Math. Ratten et al., Protein

Ed., Academic Press, New York Enzymol. 182: 626-646 (1990);

Synthesis: Posttrantlational modifications and aging, Ann. N.Y. Aca. Sci. 663: 48-62. Preferably, the polypeptides are always linear.

Polypeptides may generally be the results of post-translational processing, including natural processing or human manipulation that does not naturally occur. Cyclic, branched and branched cyclic polypeptides can be synthesized by a non-translational natural process and a fully synthetic process. Modifications can occur at any point in the polypeptide, including the peptide backbone, the amino acid god chain, and the N- or C-terminus. In fact, blocking an amino or carboxyl group in a polypeptide or blocking both of these groups by covalent modification is common in naturally occurring and synthetic polypeptides, and such modifications may occur in the polypeptides of the invention. For example, the N-terminal residue of polypeptides prepared in E. coli or other cells prior to proteolytic processing will be almost without exception N-formylmethionine. During post-translational modification of the peptides, the methionine residue at the NH 2 -terminus may be deleted. The invention contemplates the use of variants of the protein of the invention which contain or do not contain methionine at the end. Polypeptide modifications often function as they were made. In the case of polypeptides prepared by expression of a cloned gene in a host, the nature and extent of the modifications will be largely determined by the post-translational modifying capacity of the host cell and by the modifying signals present in the amino acid sequence of the polypeptide. For example, as is known, glycosylation often does not occur in bacterial hosts such as E. coli. Where glycosylation is required, the polypeptide may be expressed in the host where the glycosylation proceeds, in the general modifications present in the present case, as described in the different case in the eukaryotic cell. Insect cells often undergo post-translational gycosylation, such as mammalian cells, and therefore insect cell expression systems have been developed to efficiently express mammalian proteins having natural glycosylation patterns. Similar consideration may be considered with others. It is desirable that the same type of modification be the same or varying in degrees at several sites within a given polypeptide. A given polypeptide may contain various types of modifications. In general, the term polypeptide encompasses all such modifications, particularly those that are present in the polypeptides. synthesized recombinantly by expressing the polynucleotide in a host cell.

The term "polynucleotide or polypeptide variants" includes polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide. Such variants are discussed below. (1) A polynucleotide whose nucleotide sequence from others is called a reference polynucleotide. In general, the differences are limited so that the reference nucleotide sequence and variant are similar and many regions are the same. As discussed below, changes in the nucleotide sequence of the variants are silent. That is, it does not change the amino acids encoded by the polynucleotide. When the changes are limited to silent changes of this type, the variant polynucleotide encodes a polypeptide with the same amino acid sequence as the reference polynucleotide. As also described below, changes in the nucleotide sequence of a mohp may alter the amino acid sequence of the polypeptides encoded by the reference polynucleotide. Such nucleotide changes may result in amino acid substitutions, additions, deletions, fusions, and truncations in the polypeptides encoded by the reference sequence as described 2) A polypeptide that differs in amino acid of another is referred to as a reference polypeptide.

In general, the differences are limited so that the reference sequence and variant are similar and identical in many regions.

below, sequences from • flflfl fl flfl fl fll fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl Fl fl

The variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions, and truncations, which may also occur in any combination.

The term "treatment / therapy" encompasses a regimen that is beneficial to a human or animal. Treatment may be based on existing conditions or may be prophylactic treatment (preventive treatment).

The term "comprising" includes everything having the specified feature / characteristic, but also anything having one or more other features / characteristics. Thus, in the case of a nucleic acid / protein sequence comprising a given sequence, the sequence itself is covered by a longer sequence.

The term "homolog" includes any variant of a specified biological molecule that exhibits one or more biological activities of the molecule.

The invention provides therapeutic use of nucleic acid molecules comprising a sequence that encodes an Egr-1 polypeptide. The invention also relates to the therapeutic use of fragments of said polynucleotide sequence which encode biologically active fragments of Egr-1 or polynucleotide sequence variants which, as a result of the genetic code, encode functional Egr-1 fragments and functionally equivalent allelic variants and related sequences modified by addition, substitution and or by deleting one or more bases that encode polypeptides having Egr-1 activity.

These polypeptides are possible by standard cloning procedures well known in the art.

Polynucleotides encoding the transcription factor Egr-1 may exist in the form of DNA, cDNA, or RNA such that mRNA is obtained.

cloning or produced by chemical synthesis. The DNA is single stranded or double stranded. The single stranded DNA may be a coding or anticoding DNA strand or it may be a non-coding or coding DNA strand. For therapeutic use, the polynucleotide is in a form capable of expressing a functional transcription factor Egr-1 at the wound site of the subject to be treated. Polynucleotides can also be used in the in vitro production of an Egr-1 polypeptide suitable for further therapeutic application, as described below.

Polynucleotides of the invention that encode an Egr-1 transcription factor polypeptide may include, but are not limited to, the coding sequence of an Egr-1 polypeptide or biologically active fragments thereof. The polynucleotide may be prepared in conjunction with other coding sequences, including, for example, 5 'and 3' non-coding sequences, such as transcribed non-translated sequences involved in transcription (including, e.g., termination signals), ribosome binding, mRNA stability elements, and other coding sequences, that encode additional amino acids, such as those that exhibit additional functions. Polynucleotides of the invention also include, but are not limited to, polynucleotides comprising the structural gene Egr-1 and its naturally linked genetic elements.

The term "polynucleotide encoding a polypeptide" describes polynucleotides that include a sequence encoding the Egr-1 transcription factor polypeptide. The term describes polynucleotides that include a single continuous region or non-continuous regions encoding a polypeptide (for example, interrupted by an incorporated phage or an inserted sequence) together with other regions that may also contain coding and / or non-coding sequences.

The invention further provides variants of the above-described polynucleotides that encode fragments, analogs and derivatives. · ·

The polypeptide is a 9-fold polypeptide. The polynucleotide variant may include a naturally occurring variant or may be a non-naturally occurring variant. Such non-naturally occurring variants of a polynucleotide can be made by mutagenesis methods, including those methods that apply to polynucleotides, cells, and organisms.

These variants include variants that differ from the aforementioned polynucleotides by substitution, deletion or addition of nucleotides. The substitutions, deletions or additions may include one or more nucleotides. Variants may vary in the coding or non-coding regions, or both. Changes in the coding regions can produce conservative or non-conservative amino acid substitutions, deletions, or additions.

Further preferred embodiments of the invention are polynucleotides having at least 70% identity over the entire length of a polynucleotide encoding a polypeptide having the amino acid sequence set forth in Cell 53 37-43 (1988) (mouse sequence), more preferably at least 70% identity over the full length. a polynucleotide encoding the sequence of the human cDNA and its complementary polynucleotides (human sequence) (Nucleic Acids Research 18 4283, 1990 and polynucleotides that are complementary to such polynucleotides. Otherwise, most preferred are polynuleotides that comprise a region that exhibits at least 80% identity over the full length polynucleotide encoding the polypeptide of the invention At least 90% identity over the full length is preferred for polynucleotides.

Preferred are polynucleotides that encode polypeptides that retain substantially the same biological function or activity as the mature Egr-1 polypeptide encoded by the mouse DNA sequence (Cell 53, 37-43 (1988). More preferably, the polypeptide is encoded by the human sequence described in Nucleic Acids Research 18, 4283, 1990.

• 99 • • 99

999 ··

9 9 • · · ·

9 9999

9 ·

9 «·

The invention further provides polynucleotides as described above. The invention provides polynucleotides that hybridize to the polynucleotides described above.

means that hybridization occurs, at least 95% and preferably 97 sequences that hybridize according to the invention encoded the biological activity of Egr-1.

hybridizing is further described under stringent conditions with the term "stringent conditions" if the sequences also show identity. It is preferred that the sequence is a polypeptide that binds

Polynucleotides can encode a polypeptide that is a mature protein plus additional amino acids at the N- and C-termini. Such additional sequences may be involved, for example, in increasing or decreasing the half-life of a protein and allowing manipulation of a protein suitable for assay or production. Generally, in vivo additional amino acids can be obtained from the mature protein by cellular enzymes.

Polynucleotides suitable for use in gene therapy of the invention can be prepared alone or as part of a vector, as an expression vector known in the art.

A polynucleotide encoding Egr-1 can be used therapeutically in a method of the invention by a gene therapy method wherein the polynucleotide is applied to a wound or other tissue to be treated in a form capable of directing the production of Egr1 or a biologically active fragment thereof in situ . Egr-1 is believed to promote wound healing by activating genes involved in wound healing such as genes encoding VEGF, PDGF, EGF, TGF beta, fibroblast growth factor, UPA, and tissue factor.

In gene therapy, a polynucleotide expressed in an individual is preferably administered by administering in the form of a recombinant DNA molecule comprising a polynucleotide encoding

A * AAAA AAAA AAAA

Egr-1 operably linked to a nucleic acid sequence that directs expression, such as expression of a vector. Such a vector will then include suitable transcriptional control signals that include a region of a promoter capable of expressing a coding region, said promoter being operably linked to a subject to be treated. In the case of gene therapy applied to humans, the term includes not only the sequence necessary to direct RNA polymerase to the transcription start site, but also, where appropriate, operative and control sequences that include an enhancer, a human promoter sequence from a human gene or typically expresses in humans such as the human cytomegalovirus (CMV) promoter. Known suitable eukaryotic promoters include the intermediate early promoter, the HSV thymidine kinase promoter, the SV40 early and late promoters, the retroviral LTR promoters, such as the Rous sarcoma virus (RSV), and a metallothionein promoter such as the mouse metallothionein promoter I.

As discussed below, the natural Egr-1 promoter can be used. The published sequence shown for the human Egr-1 promoter was found to be incorrect and a new sequence was published with different differences compared to said published sequence.

The polynucleotide and transcriptional control sequences may be cloned into a replicable plasmid vector based on commercially available plasmids such as pBR322, or may be constructed from available plasmids by well known published procedures.

The vector may also include transcriptional control signals positioned on the polyadenylation recognizable.

The 3 'end of the sequence signals that code for Egr-1 are in treatment

Such as, for example, the corresponding and also the subject sequences from viruses. In the case of human treatment, for example, the virus may be used.

SV40. Further, other transcriptional control sequences are well known in the art and may also be used.

Expression vectors may also include selectable markers, such as antibiotic resistance, which allow the propagation of the vectors.

Expression vectors capable of in situ synthesizing Egr-1 can be introduced into the site of injury directly by physical methods. Examples of this procedure include the surface application of the bare vector nucleic acid in a suitable composition, for example in solution in a pharmaceutically acceptable excipient, such as phosphate buffered saline, or the application of the vector by physical methods such as particle bombardment as described in US-537 1015 particles such as gold particles coated with a vector are sufficiently accelerated to pass through the surface at the site of injury, for example, skin cells by firing from a high pressure device (the invention also discloses particles coated with a nucleic acid molecule of the invention and devices comprising such particles).

Other physical methods of applying DNA directly to a recipient include ultrasound, electrical stimulation, electroporation, and micro-seeding.

Particular preference is given to micro-seeding, which is a system for introducing genetic material into cells of a patient. The method is described in US Patent No. 5,697,901.

The nucleic acid sequence encoding Egr-1 suitable for use in the therapy of the invention can also be introduced by the introduction of vectors. These vectors include viral vectors, such as adenoviral or retroviral delivery vectors, which are well known in the art.

• ·

· «···· · · · · 9 9

Other non-viral delivery vectors include lipid delivery vectors including lipid delivery vehicles that are well known in the art.

The nucleic acid sequences encoding Egr-1 can also be applied to the site of injury by transformed host cells. Such cells include cells obtained from a subject into which the nucleic acid sequence has been introduced by gene transfer methods well known in the art. This is followed by culturing the transformed cells and introducing the graft into the subject.

Expression constructs as described above can also be used in various methods of therapy of the invention. They can be directly introduced into the injury site of the subject, or they can also be used to prepare recombinant Egr-1 transcription factor itself, which can be applied to the injury site. The invention further provides host cells that are genetically manipulated by constructs comprising an Egr-1 polynucleotide or polynucleotides of the invention, or genetic allies as defined above. The invention further provides the use of said vectors and cells in the therapeutic methods of the invention. These constructs can be used in the therapeutic methods of the invention or can be used in the preparation of the Egr-1 polypeptide.

For example, the vector may be a plasmid vector, a single-stranded or double-stranded phage vector, a single-stranded or double-stranded RNA or a DNA viral vector, depending on whether the vector is applied directly to the site of injury (e.g., in situ synthesis for Egr-1) or the synthesis of recombinant Egr-1 can be used. The starting plasmids described herein are publicly available and can be constructed from available plasmids by conventional application of a well known published procedure. Many plasmids and others

2ΐ ..... ... The cloning and expression vectors that can be used according to the invention are well known and readily available.

Generally, vectors suitable for expressing the Egr-1 polypeptide of the invention comprise cis-acting control regions that are effective for expression in a host that is operably linked to the expressed polynucleotide. Appropriate trans-acting factors are provided by either the host or complementary vector or the vector itself upon introduction into the host.

In certain embodiments, vectors suitable for expression are used. In the case of the production of recombinant Egr-1 by such specific expression, the expression can be inducible or only in other cell types, or it can be inducible and cell specific. Particularly preferred among the inducible vectors are vectors in which expression can be induced by environmental factors which can be easily influenced. These include temperature and nutritional supplements. Various vectors suitable for use in the invention include constitutive and inducible expression vectors useful in prokaryotic and eukaryotic hosts.

A number of expression vectors can be used in the expression of Egr-1 for use in the invention. Such vectors include, but are not limited to, chromosomal, episomal, and virus-derived vectors. These include vectors derived from bacterial plasmids, bacteriophage, transposons, yeast episomes, insertion elements, yeast chromosomal elements, viruses such as baculoviruses, papa viruses such as SV40, vaccinia viruses, adenoviruses, smallpox virus, rabies virus and retroviruses and vectors obtained from combinations thereof, such as those derived from plasmids and bacteriophage genetic elements, such as cosmids and phagemids. All may be used in the expression of the invention. In general, any vector will be "" * «• • • * * * * * *

suitable for the maintenance, propagation or expression of polynucleotides in order to express the polypeptide in a host can be used in expression.

A suitable DNA sequence can be incorporated into the vector by any well known methods, such as described in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2 ^nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). ).

The nucleic acid sequence in the expression vector is operably linked to a suitable expression control sequence, including, for example, a promoter suitable for directing mRNA transcription. Representatives of such promoters include, but are not limited to, the lambda PL phage promoter, the E. coli lac, trp and tac promoters for recombinant expression and the SV40 early and late promoters, and retroviral LTR promoters for in situ expression.

Generally, expression constructs will contain sites suitable for initiation and termination of transcription and, in the transcribed region, a ribosome binding site suitable for translation. The coding portion of the mature transcripts expressed by the constructs includes a translation initiating the AUG codon and a termination codon suitably located at the end of the polypeptides to be translated.

The constructs may additionally comprise control regions that regulate and induce expression. Generally, in accordance with commonly used procedures, such regions may operate by transcription control. These include transcription factors, repressor binding sites, and termination.

Vectors suitable for propagation and expression include suitable markers and amplification regions such as those described in Sambrook et al., Molecular Cloning, A Laboratory. • · • • • • • • • • • *

Manual, 3 ^nd Ed. Cold Spring Harbor Laboratory Press, Spring Harbor, New York (1989).

Cold

Representative examples of suitable hosts for recombinant expression of Egr-1 include bacterial cells such as staphylococci, streptococci, E. coli, streptomyces and Bacillus subtillis cells, fungal cells such as yeast and Aspergillus cells, insect cells such as Drosophila S2 cells and Spodoptera Sf9 cells, animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 cells, and Bowes melanoma and plant cells.

The following vectors are commonly available with the method described in the Examples. Among the vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen, pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene and ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 available from Pharmacia and pBR322 (ATCC 37017). Preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors, which can be used for recombinant expression and in situ expression, are reported in a manner depicting many commonly available and well known vectors. Suitably, any other plasmid or vector suitable, for example, for the introduction, maintenance, propagation or expression of a polynucleotide or polypeptide useful in the therapy of the invention.

Examples of vectors suitable for use in the present invention include expression vectors in which the Egr-1 cDNA sequences have been inserted into a plasmid, the expression of the gene under the control of the human intermediate early cytomegalovirus enhancer (Foecking and Hofstetter, Cell, 45, 101-105,

1986). Such expression plasmids may contain signals for the processing of SV40 RNA by such signals as polyadenylation and termination signals. Expression constructs that use the CMV promoter and which are commercially available are pCDM8, pcDNA1 and derivatives thereof, pcDNA3 and derivatives thereof (Invitrogen). Other common expression vectors that can be used are pSVK3 and pSVL, which contain the SV40 promoter and mRNA splice site and SV40 polyadenylation signals (pSVK3) and SV40 VP1 processing signals (pSVL, Pharmacie vectors).

Promoter regions can be selected from any gene of interest using vectors that contain a transcriptional unit that has a reporter promoter region, such as a transcriptional lacking unit, of chloramphenicol acetyltransferase (CAT) downstream of the gene from the restriction site or sites for introduction of the promoter fragment. fragment which may contain a promoter. As is well known, the introduction of a promoter-containing fragment into a vector into a restriction site upstream of the cleavage site induces the production of CAT activity, which can be detected by standard CAT assays. Vectors suitable for this end are well known and readily available. Examples are pKK232-8 and pCM7. Promoters suitable for the expression of polynucleotides used in the therapy of the invention include not only well known and readily available promoters, but also promoters that can be readily obtained by the following procedure using a reporter gene. When expressed in situ, such a promoter must be recognized in the subject to be treated.

Among the known prokaryotic promoters suitable for the expression of the polynucleotides and polypeptides of the invention in the therapy of the invention, the lacI promoters of E. coli and lacZ and the T3 and T7 and gpt promoters, lambda PR, PL promoters and trp promoters can be used.

Recombinant expression vectors include, for example, origins of replication, a promoter preferably derived from a strongly expressed gene, wherein these fragments direct transcription downstream of the structural sequence and a selectable marker that allows the vector-containing cell to be isolated upon introduction of the vector.

Polynucleotides suitable for use in the therapy of the invention that encode a heterologous structural sequence of a polypeptide of the invention are generally incorporated into a vector using standard procedures by operably linking to an expression promoter. The polynucleotide is positioned such that the transcription start site is located exactly at the 5 'end of the ribosome binding site. The binding site on the ribosome will be towards the 5 'end of the AUG codon that initiates translation of the expressed polypeptide.

In general, there is no other open reading frame that begins with the initiation codon, usually AUG, and lies between the ribosome binding site and the initiation codon. In general, there is also a translation terminating codon at the end of the polypeptide, and in the constructs there will be a polyadenylation signal in eukaryotic hosts. The transcription termination signal is preferably located at the 3-terminus of the transcribed region and may also be. found in a polynucleotide construct.

In order to secrete the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment, it is necessary to incorporate appropriate secretion signals into the expressed polypeptide during its recombinant synthesis. These signals may be endogenous to the polypeptide or may be heterologous signals.

The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also other heterologous functional regions.

For example, a region of charged amino acids, polypeptides, to add additional amino acids in the host cell, particularly to the N- or C-terminus, may improve stability and persistence during purification or during subsequent handling and storage. Also, a region that allows purification may be added to the polypeptides. Such regions may be removed prior to final preparation of the polypeptides. In addition to the peptide portions of the polypeptides, methods well known in the art are used to secrete or excretion, to improve stability, or to allow purification. A preferred fusion protein comprises a heterologous region of immunoglobulin that can be used to dissolve or purify the polypeptides. The cells are then typically harvested by centrifugation, opened by physical or chemical methods, and the resulting crude extract is stored for further purification.

The microbial cells used to express the proteins can be opened by any other method, including a melting and freezing cycle, sonication, mechanical disruption or the use of cell lysing agents. Such methods are well known in the art.

Mammalian expression vectors may include an origin of replication, a suitable promoter and enhancer, as well as any ribosomal binding site, polyadenylation regions, splice donor and acceptor sites, transcription-terminating sequences and 5 'flanking sequences that are not transcribed and that are necessary for expression.

In addition, genetically manipulated host cells may be used in the preparation of the Egr-1 polypeptides of the invention. Introduction of a polynucleotide into a host cell may be affected by sodium phosphate transfection, transfection mediated by

DEAE-dextran, mediated by cationic microinjection transection, lipid transfection, electroporation, transduction, bullet, infection or other methods. Such methods are described in many standard manuals such as Davis et al., Basic Methods in Molecular Biology (1986) and sambrook et al., Molecular Cloning: A laboratory manual, 2 ^nd Ed., Cold Spring Harbor Laboratory Press, Cold. Spring Harbor, NY (1989).

The mature proteins can be expressed in host cells, which include mammalian cells such as CHO cells, yeast cells, bacteria, or other cells under the control of a suitable promoter. Non-cell translation systems can be used to produce such proteins using RNA obtained from the DNA constructs of the invention. Suitable cloning and expression vectors suitable for use in prokaryotic and eukaryotic hosts as described in Sambrook et al., Molecular Cloning: A laboratory manual, 2

Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).

nd

The polypeptide can be obtained and purified from recombinant cell culture by known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion and cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography . Most preferably, high performance liquid chromatography is used for purification. In the case of protein refolding, a regenerated active conformation can be used wherein the polypeptide denatures during isolation and purification.

For therapy, a polynucleotide encoding Egr-1, for example, in the form of a recombinant vector, can be purified by methods well known in the art, such as column chromatography, as described in Sambrook et al., Molecular Cloning:

Laboratory Manual, 2 ^nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).

As discussed below, Egr-1 may be administered to the site of injury, either as a nucleic acid encoding Egr-1 that transcribes and translates to Egr-1 at the site of injury as a gene therapy, or the transcription factor itself may be directly applied .

Further, the invention provides the use of a transcription factor Egr-1 polypeptide or a biologically active fragment thereof in the manufacture of a medicament for the treatment of an injury in a mammal, including a human.

The invention further provides a method of treating an injury in a mammal comprising a human comprising administering to the mammal a therapeutically effective amount of a transcription factor Egr-1 polypeptide or a biologically active fragment thereof.

The invention further provides the use of the transcription factor Egr-1 or a biologically active fragment thereof for use in the treatment of wound healing and wound healing.

Further, the invention provides a pharmaceutical composition comprising the transcription factor Egr-1 or a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers.

The term "Egr-1 transcription factor polypeptide includes naturally and recombinantly produced Egr1 transcription factor, natural, synthetic and biologically active polypeptide analogs or variants or derivatives thereof, or biologically active fragments thereof, or variants, derivatives and analogs thereof.

Egr-1 transcription factor protein products comprising biologically active fragments of Egr-1 transcription factor are

A · · · · · · · ·

A A can be generated and / or isolated well known in the art.

the general method that is

Egr-1 and the foregoing fragments and derivatives thereof suitable for use in the therapies of the invention can be extracted from natural sources by methods well known in the art. Such methods include purification by sequence-specific DNA affinity chromatography methods as described in Briggs et al., Science 234, 47-52, 1986 using DNA-binding oligonucleotides that recognize Egr-1. The polypeptide can also be prepared by recombinant DNA methods as described above, i.e., by expressing the described construct in host cells. Alternatively, the polypeptides of the invention may be synthetically produced on conventional peptide synthesizers.

The invention also relates to the use of fragments, analogs and derivatives of Egr-1. The terms "fragment," "derivative," and "analog" refer to a polypeptide that exhibits the same biological function or activity as the polypeptide. Thus, the analog comprises a proprotein that can be activated by cleavage of the proprotein moiety to produce active mature polypeptides.

The fragment, derivative or analog of the polypeptides may be (i) one of the amino acid residues in which one or more is substituted by a conservative amino acid residue by an amino acid residue) the amino acid residue may be genetic code or (ii) or (preferably and such non-conserved conserved substituted or not) wherein one or more amino acid residues comprise a substituent group; or iii) one wherein the mature polypeptide fuses with another compound as the compound increases the half-life of the polypeptides (e.g., polyethylene glycol); or iv) one in which other amino acids fuse with the mature polypeptide such as or a secretory sequence or sequence that is used to purify a mature polypeptide or proprotein sequence. Such fragments, derivatives and analogs are within the scope of the invention.

Preferred variants include those that differ from naturally occurring Egr-1 by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide for another amino acid with similar characteristics. Typically, conservative substitution refers to the substitution of one amino acid for another between the aliphatic amino acids Ala, Val, Leu, and Ile, internal substitution of hydroxyl residues Ser and Thr, alteration of acidic residues Asp and Glu, substitution between amide residues Asn and Gin, aromatic residues Phe , Tyr.

Further particularly preferred for this reason are variants, analogs and derivatives of fragments having the amino acid sequence of a polypeptide in which several 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residue is substituted, deleted or added in any combination. Particularly preferred are silent substitutions, additions and deletions that do not alter the properties and activities of the polypeptide of the invention. Conservative substitutions are also particularly preferred.

Particularly preferred fragments are biologically active fragments. That is, fragments that retain the wound healing properties of the parent polypeptide.

The polypeptides and polynucleotides of the invention may preferably be in isolated form and are preferably purified to a degree of homogeneity.

Egr-1 polypeptides suitable for use in the invention include an Egr-1 polypeptide as well as polypeptides that exhibit at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, and increasingly preference for at least 95% identity (still more preferably (at least 99% identity) to the murine polypeptide sequence as described in Cell 53 37-43 (1988) and to the polypeptides encoded by the human sequence, and also include portions of such polypeptides encoded by the human sequence and also include portions of such polypeptides with such portions of the polypeptide , which generally comprises at least 30 amino acids and preferably at least 50 amino acids.

Fragments and portions of polypeptides used in the therapy of the invention can be used to produce the corresponding full-length polypeptide by peptide synthesis. Therefore, these fragments can be used as intermediates in the production of full-length polypeptides. Fragments or portions of the polynucleotides of the invention may be used to synthesize full-length polynucleotides of the invention.

The invention further provides the use of fragments of the Egr-1 polypeptide as defined above and fragments of variants and derivatives thereof.

A fragment is a polypeptide having an amino acid sequence that is exactly the same as a portion, but not the entire amino acid sequence, of Egr-1 polypeptides and variants or derivatives thereof.

Such fragments may occur freely, that is, they are not part of or fused to other amino acids or polypeptides, or are not contained within a larger polypeptide of which they form part or region. When they form part of a larger polypeptide, said fragments in most cases form a single continuous region. Several fragments are contained in a single larger polypeptide. For example, in a certain preferred embodiment of the invention, fragments of the polypeptide of the invention contained in a precursor polypeptide designed for expression in a host and having prepolypeptide and propolypeptide regions fused to the N-terminus of the fragment and another region fused to the C-terminus of the fragment are used. Thus, the term "fragments" means a portion or portions of a fusion polypeptide or fusion protein obtained from a polypeptide of the invention.

The invention provides fragments characterized by the structural or functional features of a polypeptide that can be used in the therapy of the invention. Preferred embodiments of the invention include fragments comprising alpha-helix and alpha-helix forming regions, beta sheet and beta sheet forming regions, loop and loop forming regions, spiral and spiral forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface forming regions, substrate binding region, and polypeptide regions of the invention with regions of high antigenic index, and combinations of such fragments.

Most preferred are fragments having chemical, biological, or other activities of the polypeptide of the invention that include similar activities or improved activities or with reduced activity desired. Other preferred polypeptide fragments are those containing antigenic or immunogenic determinants in an animal, particularly a human.

It is also preferred that the invention also describe, inter alia, polynucleotides describing the foregoing fragments, particularly those that hybridize under stringent conditions and polynucleotides such as PCR primers for amplifying polynucleotides that encode the fragments. Preferred polynucleotides are those that correspond to the preferred fragments as described above.

Another embodiment of the invention includes biologically, prophylactically, clinically or therapeutically useful variants, analogs, or derivatives thereof, or fragments comprising fragments of variants, analogs, and derivatives, and compositions containing the same. The invention further provides biologically active variants, analogs or fragments.

The invention further provides compositions comprising the polynucleotides or polypeptides described above. Therefore, the polynucleotides or polypeptides of the invention can be used in combination with a pharmaceutically acceptable carrier or carriers.

Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.

Polypeptides and polynucleotides may be used according to the invention alone or in conjunction with other compounds, such as therapeutic compositions.

The pharmaceutical compositions may be administered by any effective suitable method that is effective in targeting wound sites, such methods including, but not limited to, topical, intravenous, intramuscular, intranasal, or intradermal administration. In general, the compositions may be applied topically to wounds or in similar conditions.

In the case of therapy or prophylaxis, the active agent may be administered to an individual as an injectable composition. For example, as a sterile aqueous dispersion, the isotonic dispersion being preferred.

Alternatively, a topical compound may be prepared in the form of, for example, ointments, creams, solutions, eye ointments, eye drops, ear drops, mouthwash, saturated dressings and surgical threads and aerosols, and may contain suitable conventional additives including, for example, preservatives, solvents which aid in the penetration of drugs, and emollients in ointments and creams. Such surface formulations may also contain compatible conventional J < + > J < + >

FA carriers which are suitable, for example, as an ointment or cream base and ethanol or oily alcohol in the case of solutions. Such carriers may contain from about 1% to about 98% by weight of the formulation. They usually contain up to about 80% by weight of the formulation.

For administration to mammals and especially humans, it is expected that the daily dose of the active ingredient will be from 0.01 mg / kg to 1.0 mg / kg. Typically, the daily dose is 1mg / kg. The physician will determine the actual dose that will be most suitable for an individual based on their age, body weight and individual response. The above doses are examples of an average example. Of course, there may be individual instances where higher or lower doses are desirable.

The invention provides a pharmaceutical compound comprising a transcription factor Egr-1 nucleic acid molecule comprising a sequence encoding Egr-1 together with one or more pharmaceutically acceptable carriers.

An advantage in therapy where transcription factors are used to accelerate wound healing is the activation of multiple target genes that promote accelerated healing. Egr-1 is naturally activated in response to injury, and enhancing the natural response is also an advantage. The treatment is DNA-based and provides a suitable and reproducible delivery system.

When the Egr-1 polynucleotide of the invention is used in therapeutic methods, the polynucleotide is used as part of an expression construct. For example, in the form of an expression vector. In such a method, the construction is introduced at the site of injury where Egr-1 is produced in situ. The constructs used may be standard vectors and / or gene delivery systems such as liposomes, receptor-mediated delivery systems, and viral vectors.

· ♦

• 4444 «4 •

The invention is further suitable for wound healing purposes, including limb ulcers accompanying diabetes and peripheral arterial occlusive disease, post-operative scar healing, burns and psoriasis.

As described above, the Egr-1 polypeptides or nucleic acids of the invention can be administered locally to the site of tissue damage by any suitable method, for example by topical application. One method of introducing nucleic acid products is to use gene gun technology, wherein the isolated Egr-1 nucleic acid molecule, for example in the form of cDNA or in the form of an expression vector, is immobilized on gold particles and fired directly at the site of injury. The invention further provides the use of a nucleic acid molecule comprising a sequence encoding Egr-1 in a gene gun in the treatment of an injury. Further disclosed is a compound suitable for gene gun therapy comprising a sequence encoding the transcription factor Egr-1 and gold particles.

A preferred introduction of the nucleic acid or polypeptide of the invention is micro-seeding as described in US 5,697,901.

As described previously, a polynucleotide comprising a sequence encoding Egr-1 or a biologically active fragment thereof may be under the control of at least a portion of the natural Egr-1 promoter. The human Egr-1 promoter is preferred.

The mouse Egr-1 promoter was isolated and sequenced (Morris, Nucleic Acid Research, 16: 8835-3346). Potential regulatory sequences include the AAATA element ("TATA homology") at positions -26 to -22, the CCAAT box at positions 337 to -333, the five serum response elements (SREs) at positions -110 to -91, -342 to -324, -358 to -339, -374 to -355 and -412 to 393, two Aβ sites at -610 to -603 and -867 to -860, four Spi sites at -285 to -280, -649 to -644 , -700 to • · 9 · · · · ··· <9

-695 and -719 to -714 and two cAMP response elements at positions 138 to -131 and -631 to -624. Egr-1 shows that it binds to the mouse Egr-1 promoter and decreases the transcription of its own expression. The sequence of this promoter is described in FIG.

9.

Less is known about the regulation of the human Egr-1 promoter, the putative human Egr-1 sequence was prepared. 695 nucleotides of the sequence upstream of the gene were identified relative to the start site at +1 mRNA. This upstream gene sequence comprises an AAATA element ("TATA homology") at positions -26 to -22 and a number of potential regulatory elements that include two Spi sites at positions -505 to -499 and -647 to -642, two cyclic response elements on AMP at positions -134 to -127 and -630 to -623, five serum response elements (SRE) at positions -108 to -89, -344 to -326, -359 to -340, -376 to 357, and - 410 to -394, an Egr-1 binding site (EBS) at positions 597 to 598, and a tetradecanoylforboacetate (TPA) responsive element (Aβ binding site) at positions -609 to -602. It is known that the TPA binding site is functional as TPA stimulates expression from a plasmid expressing the chloramphenealacetyltransferase gene. SREs 3 and 4 mediate the stress response of the Egr-1 promoter and can confirm the stress response of the SV40 promoter. Deletion of EBS from the human promoter element leads to an increase in stress response of this promoter, leading to a discussion of the role of Egr-1 in reducing regulation of activity from the human promoter.

The published sequence prepared for the human Egr-1 promoter was found to be incorrect and provides a new sequence with different differences from the published sequence. These sequence differences cannot be predicted and at least some of them are considered functionally relevant. Further, the entire sequence was prepared while said promoter sequences of human Egr-1 comprise various holes.

• · · · · ·; . ,: · ♦ j / ..............:

* ·· ·· ·· * ...:.

A nucleic acid molecule comprising a sequence encoding Egr-1 or a biologically active fragment thereof may be operably linked to a nucleic acid sequence that

(a) it has a chain containing the sequence shown in Figure 7 for GW SEQ

b) has a chain comprising one or more deletions, insertions and / or substitutions related to GW SEQ, but which does not contain the sequence shown in Figure 7 as ON SEQ and which does not further comprise the sequence shown in Figure 9.

The invention further provides a nucleic acid molecule which:

a) has a chain comprising the sequence shown in Figure 7 for GW SEQ

b) has a chain comprising one or more deletions, insertions and / or substitutions related to GW SEQ, but which do not contain the sequence shown in Figure 7 as ON SEQ, and which also does not contain the sequence shown in Figure 9; or

c) has a chain that hybridizes to a chain as described in a) or b) above.

The molecules of the invention described in a), b) or

(c) are described in more detail:

a) a nucleic acid molecule having the sequence shown in Figure 7 for GW SEQ

It can be seen that the GW SEQ sequence shown in Figure 7 shows various regions enclosed within the frame. It is believed that these areas are functionally relevant and that the functions of the various areas enclosed in the box are shown in Figure 7 below:

Spi (two areas)

Spi refers to a sequence suitable for binding of Spi transcription factor and homologs.

0 0 0 0 0 0 0 0 0 0 0 0 0 0

The cAMP RE (two regions) cAMP RE indicates the sequence of a suitable transcription factor ATF and homologs. This is cAMP and the sequence is then referred to as the cAMP response element.

TPA RE

TPA RE refers to a sequence suitable for binding of transcription factor API and homologs. These include, for example, a TPA phorbol ester and a sequence called a TPA response element.

EBS

EBS refers to the sequence for binding of the transcription factor Egr-1 and homologs.

SRE (SRE5, SRE3, SRE2, SRE1)

SRE refers to a sequence providing a serum response (i.e., a serum response element). Together with the associated Ets (specific for E26 transformation), the binding sites of the serum response elements bind transcription factors such as SRF, Elk-1 and / or F-ACT1, as well as its homologues.

DAD

It is believed that the TATA box is required to assemble a transcription complex that contains a number of transcription factors necessary to initiate transcription. If necessary, they do not include the exact TATA sequence because it is a conventional sequence and some degree of variation occurs.

The GW SEQ shows different sequence differences with respect to the published human Egr-1 sequence (referred to herein as "ON SEQ). The differences are discussed with respect to the alignment of the GW SEQ and ON SEQ sequences shown in Figure 7.

As can be seen from Figure 7, GW SEQ shows five nucleotides that have changed from specific nucleotides • 0

000 · 0 · ·· provided at the corresponding positions in the ON sequence SEQ. These are considered substitutions in relation to ON SEQ. Two of them are located in areas that are enclosed in boxes. These two substitutions are G with T and G with C. They are in the first box cAMP RE and in the box SRE3.

GW SEQ also exhibits other ON SEQ-related nucleotides (i.e., nucleotides not specifically identified in ON SEQ). These may be considered inserts related to the sequence ON SEQ. Four of them are present in the SRE5 box (three of them are A inserts and one is C inclusion).

The GW SEQ shows one deletion compared to the ON SEQ. It's a deletion G. It's not in the frame region. It is located between the second box Spi and SRE5.

Of course, the molecules described in the invention a) have additional sequences upstream and downstream of the GW SEQ. For example, one or more regions that are involved in transcription / translation or their regulation may be prepared. A coding region (preferably encoding Egr-1 or a biologically active fragment thereof) may also be prepared. Other areas are described below.

b) a nucleic acid molecule having a chain comprising one or more deletions, insertions and / or substitutions as compared to GW SEQ, but which do not contain the sequence shown in Figure 7 as ON SEQ and which also do not contain the sequence shown in Figure 9

Changes in the nucleotide sequence relative to the GW SEQ sequence may be prepared to produce other molecules that are still in use. Such changes are described in the invention. They include allelic and non-allelic variants.

Preferred variants according to the invention b) will usually comprise one or more regulatory regions having one or more regulatory regions.

.. * ··· * ·· ·· «, a function corresponding to the function of one or more of the areas enclosed in the frame displayed in GW SEQ (even if the function is regulated positively or negatively relative to one or more of the enclosed areas shown in the GW SEQ ). It is most preferred that such molecules have one or more regions that have the same sequences as one or more regions enclosed in the frame shown in the case of GW SEQ.

Desired variants of the invention b) will exhibit substantial sequence identity with all or part of said GW SEQ over the entire length of said QW SEQ or portion thereof.

If the variant has one or more regions that correspond to one or more of the enclosed regions shown in Figure 7 in the case of GW SEQ, it is preferred that there are no or only a few such differences relative to said enclosed regions. in general, for example, it is preferred that they have only a maximum of 1, 2 or 3 differences with respect to the area enclosed in the frame). There may be multiple sequence changes outside the enclosed areas. Such variants may relatively have a lower degree of sequence identity with the corresponding portion of GW SEQ with respect to regions not enclosed in the boxes of Figure 7. Some variants do not have one or more regions that correspond to one or more regions outside said enclosed regions with respect to GW SEQ.

Preferred nucleic acid molecules described herein include one or more regulatory regions capable of altering the transcription potency of Egr-1 in mammals (more preferably in humans) in response to in vivo conditions. Such nucleic acid molecules can be administered to mammals to form Egr-1 in a manner that allows their expression to be regulated at the level of transcription.

In general, therefore, they may have a substance that (these nucleic acid molecules optionally include a region encoding the Egr-1 activity).

One or more serum response elements (SREs) may be present. One or more of these must be stress response elements. These are areas that confirm the response to stress in the case of transcription.

A large number of SSREs can work together to provide a response to stress. They must be associated with or include one or more Ets. In some cases, it is necessary that only one site (preferably together with an Ets site) is present in order to provide a degree of stress response.

The preferred SSRE is shown in Figure 7 as SRE5 for the sequence "GW SEQ. These regions have been shown to be functional, while the SRE5 sequence appears to be non-functional with respect to the ON SEQ sequence. The SRE5 region itself as well as the SRE5 variants are able to provide a stress response in accordance with the invention. Such variants preferably include at least one nucleotide difference present in GW of SEQ SRE5 as compared to ON of SEQ SRE5.

Other preferred SSREs are SRE3 and SRE4 as shown in Figure 7 for GW SEQ as well as variants capable of providing stress response.

Most preferably, all SRE3, SRE4 and SRE5 regions (or variants thereof that are capable of providing a response to stress) are present.

Regardless of whether a particular SRE region is present, the nucleic acid molecule of the invention is necessarily contained in a TATA box (which will not necessarily include a Z.).

conventional sequence (TATA). It will also typically include a CCAAT box (which will not necessarily include a conventional CCAAT sequence).

Typically, at least one or more Sp1 binding regions are present. One or both of the Sp1 binding regions may be the Sp1 binding sequences shown in Figure 7 for GW SEQ.

A cAMP response region may be present. Such preferred regions comprise the sequences shown in Figure 7 and are designated cAMP RE with respect to the GW sequence SEQ. Most preferred is the first cAMP RE shown in Figure 7 for GW SEQ. This allows regulation of transcription by cAMP.

An EGR-1 binding site (EBS) may be present. This site is believed to play an important role in the negative regulation of Egr-1 transcription after the amount of Egr-1 has exceeded a certain parental value. Thus, Egr-1 may limit its own expression after stress stimulation. In general, EBS is used if it is necessary to limit the amount of Egr-1 in this way. The EBS may have the sequence shown in Figure 7 for GW SEQ as EBS. Nucleotide changes can be made to form EBS, producing variants thereof. Variants can be prepared with limited affinity for Egr-1 as compared to EBS as shown in Figure 7 for GW SEQ. One such variant is the EBS shown in Figure 8. In some cases, a functional EBS cannot be present and therefore Egr-1 control can be completely removed (for example, a complete EBS deletion may occur). Nucleotide changes can also be prepared in EBS to give increased affinity for Egr-1. It is useful when self-regulation of Egr-1 expression needs to be enhanced.

··· • · ♦

(c) a nucleic acid molecule having a strand having a strand which hybridizes to a strand as described in (a) or (b) above.

The invention provides nucleic acid molecules that can hybridize to one or more of the nucleic acid molecules described above. Such nucleic acid molecules are referred to as "hybridizing nucleic acid molecules." It is necessary that the hybridizing molecules of the invention contain at least 10 nucleotides and preferably at least 25, at least 50, at least 100 or at least 200 nucleotides.

The hybridizing nucleic acid molecule of the invention may exhibit a high degree of full-length sequence identity with a nucleic acid molecule complementary to the nucleic acid of the invention a) and b) (e.g. at least 50%, at least 75%, at least 90%, at least 95% or at least 98% consistency), although this is not essential. The higher the degree of sequence identity given by a single-stranded nucleic acid molecule to another single-stranded nucleic acid molecule, the more likely it will hybridize to a single-stranded nucleic acid molecule that is complementary to another single-stranded nucleic acid molecule under appropriate conditions.

Preferred hybridizing molecules hybridize! under medium or high stringency conditions. Hybridization conditions are described at page 1.101 to 1.110 11.45 to 11.61, and Sambrook et al (Molecular Cloning, ^2nd Edition, Cold Spring Harbor Laboratory Press (1989)). One example of the hybridization conditions that can be used involves the use of 5x concentrated SSC wash buffer, 0.5% SDS, 1.0 mM EDTA (pH 8.0), with the hybridization overnight at 55 ° C using 5x SSC. However, there are many other options. Some of these are listed in Table 1 of WO 98/45 435 (in particular, it is advisable to examine the conditions indicated by the letter A). «« «

-. * · • · »»

F in the table and less preferred are the conditions indicated by the letters G to L or M to R).

Another approach is to determine the Tm for a given full duplex (i.e., no mismatches) of leaf length under given conditions then to hybridize to a single duplex chain under the given conditions, but at a temperature sufficiently below Tm to form stable formation. hybrids at an acceptable rate. While a significant degree of hybridization specificity is needed. The Tm temperature for such a duplex can be determined empirically by providing the duplex and gradually increasing the temperature until the Tm value is reached. Tm can also be estimated using, for example, the equation Tm - 81.5 + 16.6 (log 10 [Na ⁺ ]) + 0.41 (G + C fraction) - (600 / N), where N is the length of the chain (this formula it is accurate for Na ⁺ 1 M concentrations or less and for polynucleotide lengths of 14 to 70, but less accurate if these parameters are not achieved). In the case of a nucleic acid molecule of greater than 200 nucleotides, the hybridization can take place at a temperature that is 15 to 25 ° C lower than the T m of the preferred hybrid (i.e., without mismatch) under the given conditions. As the interval increases, the Tm value decreases so that hybridization at a Tm value of -25 ° C is sometimes inappropriate. Hybridization with shorter nucleic acid molecules is therefore often performed at a temperature that is only 5-10 ° C lower than the Tm value. As a rule, every 1% of mismatch reduces the Tm by 1 to 1.5 ° C. It is preferred that the hybridization conditions be selected such that less than 25% of the incorrect pairs occur. More preferably, the occurrence of incorrect pairs is less than 10% or less than 5%. Hybridization is followed by washing under more stringent conditions. Initial washing may be performed under low stringency conditions, but then followed by washing under stringent conditions until conditions of hybridization have been achieved.

φ «

Φ Φ

Φ · ΦΦ «ν

φφ φφ · •>

Φ •

Φ ΦΦ Φ · »Φ» »» φ φ φ φ φ φ φ φ

Since one of ordinary skill in the art is able to vary the parameters as appropriate to achieve a suitable hybridization condition and it is also possible to include polynucleotide length, base representation, duplex nature (i.e. DNA / DNA, RNA / RNA or DNA / RNA), type ion present, etc.

Most preferably, the hybridizing nucleic acid molecules of the invention hybridize to a DNA molecule having the sequences shown in Figure 7 in the case of GW SEQ or with one or more regions enclosed in the frame of Figure 7.

Hybridizing nucleic acid molecules can be used, for example, as probes or primers.

The probes can be used in the purification and / or identification of nucleic acids. They can also be used in diagnosis. For example, probes can be used to determine whether individuals exhibit a defect in their genome that can affect Egr-1 transcription or regulation of such transcription. Such defects can lead to various disorders in individuals that can be treated according to the invention. For example, wound healing can be disrupted by mutations in one or more SREs. Such mutations can be identified using probes that hybridize with a higher degree of specificity to one or more SREs shown for GW SEQ as compared to the corresponding SRE mutant (and vice versa).

If necessary, the hybridizing molecules of the invention hybridize more strongly to a DNA molecule having the sequence shown in Figure 7 in the case of GW SEQ or with one or more boxed regions as compared to a DNA molecule having the sequence shown in Figure 7 in or a sequence of ON SEQ or one or more regions thereof in the box. For example, the hybridizing molecule may be designed with a high degree of specificity for one or more of the 91

The SRE3, SRE5, and cAMP regions shown for GW SEQ in Figure 7 (all of these regions show sequence differences from the corresponding ON SEQ regions).

Hybridizing nucleic acid molecules of the invention include primers. The primers can be used to amplify nucleic acids or portions thereof, for example by PCR.

In addition to being used as probes and primers, hybridizing nucleic acid molecules can be used as antisense molecules to alter expression. This procedure can be used in antisense therapy. For example, antisense molecules can be used to block or reduce Egr1 expression by preventing or limiting the transcription potency. Alternatively, binding to a region to which the regulator would normally bind may be used to prevent or reduce the regulation of Egr-1 transcription by a given regulator.

It should be noted that the nucleic acid molecules suitable for use in the invention include not only those molecules with the classical DNA or RNA structure, but also those variants with modified (not phosphodiester) backbones. For example, morpholino derivatives and peptide nucleic acids (PNA) that contain a pseudopeptide backbone based on N- (2-aminoethyl) glycine (Nielsen, PE, Annual Review of Biophysics and Biomolecular Structure, 24 167-83 (1995)). ). Modified backbone nucleic acid variants may exhibit increased stability over untreated nucleic acids and are particularly useful where long-term hybridization is required (e.g., in antisense therapy).

It follows from the foregoing that the invention describes a large number of nucleic acids. It follows that the nucleic acid molecules of the invention may exhibit one or more of the following characteristics:

·· · · · · · · · · · · · · · ·

1) They may be in the form of DNA or RNA (including variants of naturally occurring DNA or RNA structures that exhibit non-naturally occurring bases and / or non-naturally occurring frameworks).

2) They may be single-stranded or double-stranded (they include both the given strand and its complement, whether or not they are joined).

3) They may exist in recombinant form, i.e., they are covalently linked by a heterologous sequence flanking the 5 'and / or 3' end to form a chimeric molecule (for example, a vector) that does not appear in nature.

4) May occur without 5 'and / or flanking sequences

3'end that normally occur in nature.

5) They may be in substantially pure form (e.g., in isolated form). This can be done, for example, using probes to isolate cloned molecules having the desired target sequence or using a chemical synthesis method. Thus, the nucleic acids may be in a form that is substantially free of contaminating proteins and / or other nucleic acids.

6) They may occur with or without introns (for example, as a full-length gene).

The nucleic acid molecules of the invention may comprise any desired sequence. For example, one or more serum response elements may be operably linked to a coding sequence that is not normally associated with such elements. This can be used, for example, in wound healing if it is necessary to obtain a serum response with respect to a given therapeutic agent encoded by a coding sequence that normally does not show a serum response.

However, it is preferred that the nucleic acid molecules of the invention comprise the coding sequence of Egr-1 or a biologically active fragment thereof.

It is necessary that the nucleic acid molecules of the invention include a promoter region and can be used to produce Egr-1 by allowing transcription of Egr-1 mRNA. This can be translated by ribosomes present in the host. The nucleic acid molecules may be administered to a subject (preferably a human or other mammal) such that others in the subject may be synthesized, or (less preferred) may be used to prepare Egr-1 itself, which may then be administered to the subject.

Preferred nucleic acid molecules of the invention administered to a subject can be rewritten in such a way that transcription can be regulated by one or more factors that regulate Egr-1 transcription in the subject.

For example, one or more SSREs (as described above) may be prepared to achieve stress-responsive Egr-1 transcription. It is particularly preferred that the nucleic acid molecules of the invention are administered to a patient (rather than to Egr-1 alone). Stress response is preferred where the nucleic acid molecules of the invention are used in vivo to treat wounds. This is because stress at the site of injury may result in the secretion of factors that bind to SSRE, which may stimulate increased transcription of Egr-1. Increased levels of Egr-1 may accelerate wound healing.

In some cases it may be necessary to limit the strength of the response to stress. For example, it may be necessary to slow the treatment of injuries in this manner (for example, to reduce scars). Otherwise, the risk of stress-related cardiovascular problems must be reduced.

The invention further describes the entire sequences of five human SREs associated with the regulation of transcription of human Egr-1. One or more SREs may be mutated to reduce response to •

stress on the response power obtainable using one or more of the SREs shown in Figure 7 for GW SEQ.

Alternatively, it may be necessary to increase the strength of the stress response by performing mutations in one or more of the five SREs such that the stress response is increased compared to the response using the SRE shown for GW SEQ in Figure 7. Such mutations may, for example, be used to accelerate wound healing.

The nucleic acid molecules of the invention may, although not essential, be in the form of vectors. They can be administered to a patient by physical methods. Such methods include surface application of the exposed nucleic acid vectors in a suitable vehicle, for example, in a solution of a pharmaceutically acceptable excipient such as phosphate buffered saline (PBS). Such methods include particle bombardment (also known as gene gun technology) and is described in US-5,371,015. Inert particles such as gold particles coated with nucleic acid are accelerated at a rate sufficient to penetrate the surface to the site of injury (e.g., through the skin) ) by a high pressure discharge method from a suitable firing device (the particles are coated with a nucleic acid molecule of the invention, the invention also includes a device comprising such particles). Other physical methods of applying DNA directly to the recipient include ultrasound, electrical stimulation, electroporation, and micro-seeding. Particularly preferred is the micro-sowing mode. This is described in US-5,697,901.

The nucleic acid molecules of the invention can also be delivered by specialized delivery vectors.

Any vector suitable for gene therapy may be used. Gene therapy approaches are described, for example, by:

in Verna et al, Nature 389: 239-242. Both viral and non-viral systems can be used.

Virus-based systems include the retroviral, lentiviral, adenoviral, adeno-associated viral, and herpes and vaccinia-based systems.

Non-viral systems include direct nucleic acid delivery and liposome-based systems.

The nucleic acid sequences of the invention can even be applied in the manner of transformed host cells. Such cells include cells obtained from an object. The nucleic acid molecules of the invention can be introduced into such cells in vitro and the transformed cells can later be returned to the subject. Nucleic acid molecules need not be introduced as vectors since non-vector nucleic acid molecules can be introduced. Some molecules may be incorporated into a nucleic acid that is already present in the host cell by homologous recombination.

The invention further encompasses expression systems that can be used to produce polypeptides (e.g., Egr-1). Such polypeptides can then be used in therapy.

Preferred expression vectors are eukaryotic vectors. However, prokaryotic vectors may also be used. Suitable vectors generally include a coding sequence operably linked to one or more regulatory sequences. It is preferred that the coding sequence encodes Egr-1.

A variety of expression systems are described in Sambrook et al (Molecular Cloning, 2nd Edition, Cold Spring Harbor Laboratory Press (1989)).

It follows from the foregoing discussion that it is appropriate that the nucleic acids of the invention (which may be present in the form of 9 9 4 9

Vectors) could be used in a variety of therapeutic applications, as well as polypeptides produced using such nucleic acids. The invention further provides pharmaceutically acceptable compounds comprising said nucleic acids or polypeptides, particularly in combination with a pharmaceutically acceptable carrier or carriers.

Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.

Polypeptides and nucleic acids can be used according to the invention alone or in conjunction with other agents, such as therapeutic agents. Under certain circumstances, Egr-1 repressors (such as NAB1 and / or NAB2) may be applied (for example, if scar formation must be minimized to inhibit resteriosis, to regulate vascular wall calcification and / or to inhibit cell proliferation (e.g. malignancy)). If two or more active agents are to be administered, this may be accomplished by a combination preparation for simultaneous, separate or sequential use.

The pharmaceutical compounds of the invention may be administered by any effective route, including, but not limited to, by topical, intravenous, intramuscular, intranasal, or intradermal routes. In general, it is preferred that the compounds can be administered locally, for example, at or near the site of injury. However, a system application may be used.

The active agent may be administered to an individual as an injectable compound, for example, as a sterile aqueous dispersion. Preferably, it is practically isotonic with the patient's body fluids (e.g., the patient's blood).

4 may be prepared so that it is in the form of an ointment, for example.

xj Z

Alternatively, the compound is suitable for topical application of creams, solutions, eye ointments, eye drops, ear drops, mouthwash, saturated dressings and surgical threads, and in the form of aerosols. They may contain additives which include, for example, preservatives, solvents to aid drug penetration, and emollients in ointments and creams. Such surface compounds may also contain compatible carriers such as creams or ointment bases and ethanol or oleyl alcohol in the case of solutions. Such carriers may comprise from about 1% to about 98% by weight of the compound. They will typically comprise up to about 80% by weight of the formulation.

Most preferred are pharmaceutical compounds comprising the nucleic acids of the invention adapted for application by gene gun technology. Such nucleic acids can be associated with particles (e.g., gold particles), which can then be used as projectiles.

For administration to mammals, particularly humans, it is expected that the daily dose of active agent will be in the range of 0.01 mg / kg to 10 mg / kg, typically about 1 mg / kg. In practice, the physician will determine the actual dosage that will be most suitable for the individual and may vary with the age, body weight, and condition of the individual. If side effects develop, the dose can be reduced according to clinical practice.

In addition to therapeutic use, the invention may also be used in diagnosis. As mentioned above, the invention describes probes that can be used in the diagnosis of various disorders. These may exist as part of the diagnostic kit, which may include other components. For example, one or more wash solutions, methods for detecting hybridization, instructions for use. The probes may be labeled with a detectable marker (e.g., a fluorescent marker or a radioactive label).

The invention may be used for screening. A nucleic acid molecule of the invention (such as a molecule comprising GW SEQ shown in Figure 7 or a portion thereof) can be used to test compounds that bind to it. Such agents may be tested to determine if they affect the transcription of Egr-1. They can also be used in the design of medicaments for the treatment described above. Alternatively, the nucleic acid molecule of the invention may be used in testing a substance capable of blocking the binding of another compound to a nucleic acid molecule. When another compound is a transcriptional regulator of Egr-1, the compounds blocking said binding can also be used in the design of drugs useful in the treatment mentioned above.

The invention can also be used in research. The nucleic acid molecules of the invention can be used as starting material in a study where one or more changes are made and relate to a given nucleic acid molecule. This can be done to determine which portion is important in the transcription of Egr-1 or are important in the regulation of such transcription. For example, insertions / deletions / replacements may be made with respect to one or more regions enclosed in the frame shown in Figure 7 for GW SEQ, and it is possible to investigate the effect of such insertions / deletions / replacements. Changes may be made to attempt to identify nucleic acid molecules capable of increasing or decreasing Egr1 transcription.

Overview of the drawings

1a and b show the expression of Egr-1 VEGF.

• · · · · ·

On image lc a d j e displayed expression Egr-1 TGF- Bl. On image le a f is displayed expression Egr-1 PDGF AND. On image 2a Yippee displayed effect Egr-1 on retraction

cut wounds in rats.

Figure 2b shows the effect of Egr-1 DNA transfection on histology of healing of excised wounds in rats.

Figure 2c shows the effect of Egr-1 on collagen deposition in excised wounds in rats.

Figure 2d shows the effect of Egr-1 on the angiogenic profile in excised wounds in rats using WF immunostaining.

Figure 3a shows the optimization of the lipid: DNA ratio (volume / weight) when transfecting the luciferase-driving plasmid pGL3 into an angiogenesis co-culture system using Mirus TranslT (Cambridge Bioseciences).

Figure 3b shows the effect of Egr-1 on angiogenesis.

Figure 4a shows bone entry samples using western blot analysis.

Figure 4b shows Western blot analysis of Egr-1 protein in human TE85 bone cells that have been plated.

Figure 4C shows analysis of PDGF BB by ELISA, wherein PDGF BB is produced from TE85 bone cells after challenge.

Figure 4d shows the detection of VEGF and TGF-B1 after transfection of CMV-TGF-B1 into ROS cells.

• · · ··· · *

Figure 4e shows the detection of VEGF and TGF-B1 after transfection of CMV-TGF-B1 into MC3tE1 cells.

Figure 5 shows the effect of Egr-1 on the amount of alkaline phosphatase in an ectopic bone formation model.

Figure 6a shows staining of CMV Egr-1 transfected human smooth muscle cells using antiEgr-1 antibodies.

Figure 6b shows staining of smooth muscle cells transfected with CMV Egr-1 DNA with anti-Egr-1 antibodies.

Figure 6c shows Fugene optimization of transfection of pGL3 lucifarase control into human SMCs.

Figure 6d shows Fugene optimization of transfection of pGL3 lucifarase control into porcine SMC.

Figure 6e shows activation of VEGF production / secretion by transfection of CMV-Egr-1 into human SMCs.

Figure 6f shows activation of HGF production / secretion by transfection of CMV-Egr-1 into human SMCs.

Figure 6g shows activation of PDGF production / secretion by transfection of CMV-Egr-1 into human SMCs.

Figure 6h shows immunostaining of Egr-1 protein in the vessel wall before and after injury.

Figure 7 shows a comparison of two nucleotide sequences designated GW SEQ and ON SEQ. The ON sequence SEQ is the published early growth response promoter 1 (Sakamoto et al., Oncogene. 6, 867-871, 1991) and the GW SEQ is a sequence according to the invention which comprises a number of base / substitution insertions / deletions (bold underlined).

• «

A • • • • 9 •

Figure 8 shows a variant of the sequence shown in Figure vykazuje that shows a modified EBS region. The mutation at the Egr-1 binding site (EBS) is highlighted by a bold underline.

Figure 9 shows the published 5 'upstream sequence of the mouse Egr-1 gene (Morris, Nucleic Acids Research, 16: 8835-8846). Nucleotides are numbered from space = +1. Putative TATA and CCAAT elements are enclosed in boxes. Potential control elements are underlined and shown in the figure. The dotted underline shows the position of the 29-meter used in primer extension studies.

Figure 10 shows activation of SRE5 by transient transfection of pFA-MEK1.

DETAILED DESCRIPTION OF THE INVENTION

Examples 1 and 2 describe the introduction of plasmid DNA expressing βgalactosidase and Egr-1 by means of a gene gun into rodent skin, said DNA complexing with gold particles.

a) Piping preparation

The pipeline preparation apparatus was placed in a sterile fume hood with laminar air extraction and wiped with 70% I.M.S. and air dried in a fume cupboard. The gas pipe from the nitrogen cylinder to the pipe preparation device was autoclaved and a 0.2 µm Gelman filter was inserted. The autoclaved piping was connected to the gas inlet port on the pre-set by a luer connector and the gas was allowed to flow at a rate of 0.2 liters / minute to completely dry the piping.

9

The particle introduction pipe was connected to the preparation apparatus and the gas was allowed to flow to completely dry the inside of the pipes. The residual moisture in the tubes is due to the weak or imperfect deposition of gold particles on the tube walls and may negatively damage the experiment output data.

(b) preparation of microcarrier gold particles with DNA:

Gold particles of 1.0 µπι were obtained from BioRad UK. An aliquot of gold particles (53 mg) was weighed into a microcentrifuge tube and 100 μΐ 0.05 M spermidine was added and vortexed gently.

100 μΐ of DNA solution containing 100 to 120 μρ of plasmid DNA expressing either Egr-1 or β-galactosidase was added, then 100 μΐ of 1M CaCl2 solution was added dropwise with vortex stirring. · This mixture was allowed to stand for 10 minutes at room temperature and then centrifuged. The supernatant of the gold particle pellet was removed and washed three times in absolute EtOH.

The gold particles were finally resuspended in absolute ethanol containing 0.1 mg / ml polyvinylpyrrolidone (PVP).

Estimation of DNA coating efficiency on gold microcarriers and release in aqueous solution: All samples (starting material, precipitation supernatant, DNA / gold complexing and eluted material) were tested for DNA using the GeneQuant assay (Pharmacia). The residual DNA after precipitation indicates the rate of unbound material and the ratio of bound to starting material gives a coating efficiency.

(c) depositing the DNA / microcarrier suspension in the gold tube:

• 0 • 00 • 000 0 b8

The gold particle suspension in the ethanol / PVP mixture was then applied to the feed line using a syringe and the suspension was allowed to stand for 3 to 5 minutes in the line. During this time, the particles precipitated on the inner surface of the pipe, allowing ethanol to be removed by syringe. When ethanol was to be removed, the conduit was rotated and particles distributed on the inner surface of the conduit. After 2-3 minutes of rotation, nitrogen was passed through the pipe at a rate of 0.1 liters / minute to remove residual ethanol and allow the gold particles to adhere. After 10 minutes the pipeline was removed, cut to appropriate lengths using a knife provided by Bio-Rad UK) and the cut pipeline was loaded into a gene gun.

Egr-1 expression and activity was determined using standard immunohistochemistry with commercially available antibodies to detect Egr-1 (Santa Cruz), and production and expression of the Egr-1 target gene (Santa Cruz or R plus D systems) was monitored for 1 to 7 days. . The negative control did not contain DNA.

Example 1: Introduction of Egr-1 DNA into intact rodent skin

1.1 Ways

Expression of plasmids containing the Egr-1 cDNA driven from the human cytomegalovirus (hCMV) promoter (Houston et al., Arterioscler. Thromb. Vasc. Biol., 19, 281-289, 1999) was introduced into the back of uninjured mice fed.dh .i.pfeyim gene gun technology. Gold / DNA complexes were prepared as described above and 0.5-1.0 µg of DNA was introduced into one animal using a 2.45 MPa gene gun and 1.6 micron gold particles. Animals were sacrificed on days 0, 1, 2 and 6 after DNA introduction and the skin was placed in OTC and frozen rapidly in dry ice / hexane. Sections of 0.7 µm thickness were prepared and Egr-1 target growth factors were tested by immunoassay.

staining using antibodies directed against VEGF, PDGF A, TGF β and Egr-1.

1.2 Results

Immunohistochemical data are shown for Egr-1 activation of VEGF (Figures 1a and 1b), TGF β (Figures 1c and 1d) and PDGF A (Figures 1e and 1f), respectively. The results show dramatic positive regulation of VEGF protein on days 1 and 2 declining on day 6, positive regulation of TGFb on day 6 but not on days 1 and 2 and rapid positive regulation of PDGF A two hours after introduction of Egr-1 DNA (denoted as day 0) ).

1.3 Conclusion

These data confirm that Egr-1 can activate the expression of target growth factors in vivo. These data illustrate that activation of Egr-1 growth factors occurs on a temporally separate timeline.

After confirming activation of the target Egr-1 genes using intact rodent skin (Example 1), the Egr-1 and β-galactosidase genes were introduced into excised rat wounds using a gene gun to determine the effect of Egr-1 on the healing rate.

Example 2: Use of Egr-1 transcription factor to promote wound healing in rodents

2.1 Methods

2.1.1. Construction of plasmids

CMV expression plasmids driven by β-galactosidase and Egr-1 were used in this study (Houston et al., Arterioscler. Thromb. Vasc. Biol., 19, 281-289, 1999).

♦ «9 9 9 9 ••• 9 9 · 9

9 · «

9 'Μ · ··· · · 9999

OU · · · 9 9 ··· ·· 99 ·

Plasmids were expanded in Escherichia coli XL-2 Blue MR and DNA was prepared using the Qiagen kit.

2.1.2. Gene transfer mediated by particles of Sprague Dawley rats having a body weight of 250 g were anesthetized with isoflorane in a 2: 1 oxygen / nitrogen oxide mixture. Two transfection sites (8 cm from the skull, 1.5 cm on both sides of the spine) were prepared on the back of the rats by first snapping the skin and then cutting through a razor blade. Two transfections with accelerated DNA / gold particle complexes with either Egr-1 or βgalactosidase into the skin at a pressure of 2.45 MPa were performed at one 8 mm side wound site. The total amount of DNA was less than 1.7 pg per transfection (3.4 pg per wound).

2.1.3. The cut wound healing model hours after transfection, the animal was anesthetized and 2 full width wounds (8 mm in diameter) were prepared using a biopsied razor blade at the actual transfection site (described below). Immediately after wound preparation, each wound was sutured using a camera / video set and the animal was allowed to recover from anesthesia. At 2, 4 and 6 days after wound formation, 6 animals were sacrificed and each wound was sutured using the same camera-video set. The wounds were dissected, followed by sampling for histology and immunohistochemistry.

2.1.4 Healing Analysis

(i) Macroscopic evaluation

The wound area was determined using image analysis and the healing was expressed as an increase in the original wound area. Statistical significance of differences between treated and control groups was evaluated using the Mann-Whitney test.

(ii) Microscopic evaluation ♦♦ 00 0 0 0 0

000 00 0 0000 ••• 1

Histological analysis:

Each wound at a certain point in time split horizontally after excision. One half was placed in 4% formaldehyde for 24 hours and processed for histological analysis using wax. 5 µm sections were cut from each wound using a microtome and stained according to van Geison. Using this histological dye, key markers of wound healing including epithelial recovery and collagen content were evaluated, and these markers were compared between control and treated sections.

Immunohistochemistry:

Immunological cytochemical analysis was performed to quantify differences using histology. After freezing in OCT, the other half of each wound was divided into sections of 7 µm thickness using a cryostat. Two sections from each wound were fixed in ice-cooled acetone and fluorescence immunostaining of collagen I and von Willebrand (vWF) was performed. Immediately after immunostaining, each slide was placed under a fluorescent microscope and the wound area was sutured using a 25x magnification. The image was integrated and a sensitivity band was determined to minimize the background. The area and staining intensity was measured using image analysis and plotted. Statistically significant differences between the treated and control groups were evaluated using the Man-Whitney test without parameters.

2.2. Results

2.2.1 Effect of Egr-1 on Cut Wound Healing in Rats (i) Wound Withdrawal

The full thickness of rat dermal wounds, which is 8 mm in diameter, withdrew apparently faster due to the response to

9 · • 9 9 9 • 99999 • 9 9

9 9 9 9 9 99

Egr-1 transfection compared to control (β-galactosidase) up to 6 days after wound formation. A statistically significant increase in contraction (p <0.05) occurred 6 days after wound formation, with wounds treated with Egr-1 shrinking to an area 7% smaller than in the control (Figures 2a).

(ii) Histological analysis

Wound sections stained by van Gieson show large differences in wound histology 4-6 days after wound formation. On the second day after wound formation, there was little difference between wounds transfected with Egr-1 and β-galactosidase. In both types of treatment, mononuclear cells exist at the site of injury, indicating an early inflammatory response with scab formation, but no epithelial re-formation. 4 days after epithelial formation, the wounds did not fully heal, but wounds transfected with Egr-1 had more collagen compared to the βgalactosidase transfected wound site. Six days after the wounds were treated with Egr-1, they showed more mature granular tissue that showed appreciable more collagen at the site of injury compared to βgalactosidase, to the extent that thin fibers of collagen could be clearly seen. Epithelial recovery is complete in 50% of injuries treated with Egr-1 compared to 0% β-galactosidase. In terms of histology, wounds treated with Egr-1 show accelerated healing compared to β-galactosidase (Figure 2b).

(iii) quantifying the effect of Egr-1 on collagen deposition using immunohistochemistry and imaging analysis:

Immunological staining of collagen I was performed using wound cryosections of 7 gm thickness that were treated with Egr-1 or βgalactosidase, and staining was quantified using image analysis. Injuries treated with β-galactosidase showed significantly more collagen 2 days after wound formation compared to Egr-1. At 4 and 6 days after transfection of the wound Egr-1, more collagen was deposited in the wounds than in controls (β- galactosidase), confirming findings using routine wax histological methods. Egr-1 transfection increased the amount of collagen deposition four to days after wound formation (Figures 2c).

(iv) Quantification of the effect of Egr-1 on angiogenesis using immunohistochemical and imaging analysis:

Angiogenesis was quantified using von Willenbrand factor immunostaining using wound cryosection and image analysis to measure the area of positive staining at the wound site. Two days after transfection of Egr-1, the wounds showed significantly more blood vessels (p value less than 0.01) compared to control (β-galactosidase). A similar degree of angiogenesis was achieved at 4 and 6 days after transfection of Egr-1 and β-galactosidase. Transfection of Egr-1 expressing DNA shows angiogenesis two days earlier by β-galactosidase. Transfection of Egr-1 expressing DNA promotes angiogenesis two days later than in the control (Figure 2d).

Conclusions

Transfection of Egr-1 ° cuts in rats accelerated healing by increasing the rate of healing, epithelial recovery, and collagen deposition. Egr-1 transfection also promotes angiogenesis two days after wound formation.

Example 3: Use of Egr-1 transcription factor to promote angiogenesis

3.1 Methods

Egr-1 under the control of the hCMV promoter (see

Houston et al., Aretrioscler. Thromb. Vasc. Biol., 19, 281289, 1999) was transfected into a system of co-cultures of human cells to determine the level of angiogenesis in vitro. The angiogenesis kit (TCS Biologicals) was used as described.

9 ·

9 9 9 «

9 99 99 manufacturer using VEGF protein (2 ng / ml) and suramine (20 μΜ) as positive and negative controls in case of angiogenesis.

Optimization of transfection in the co-culture system was performed using pGL3 control luciferase (Promega) with 1.0 gg and 0.5 gg CMV-β gal, as a normalization plasmid suitable for transfection control. Two lipid: DNA (v / v) ratios, 2: 1 and 4: 1 were used (Figure 3a). CMV Egr-1 DNA was transfected at 0.5, 1.0, 1.5 and 2.5 gg per well in triplicate on a 24-well microtiter plate using Mirus Transit (Cambridge Biosciences) in proportion to DNA 2: 1 (v / v). VEGF protein was added to the wells as a positive control and suramine as a negative control. After 11 days of co-culture, angiogenesis was determined by staining the endothelial cell marker PECAM-1 and visualizing the BCIP / NBT substrate.

Representative images of tubule formation were recorded using all four doses of Egr-1 expression plasmid together with VEGF protein (positive control) and suramine (negative control) and processed for image analysis using a Quantimet 600 image analyzer and appropriate software.

Results

Angiogenesis described by tubular formation visible by light microscopy was detected after 11 days of co-culture. Angiogenic scores are presented as whole-cell imaging analysis and the results are presented as tubules per unit area versus treatment (Figure 3b).

VEGF-treated cells show increased tubule formation (suramin-treated cells and increased tubule formation). Egr-1 has been shown to exhibit increased tubule formation in an inverse dose manner.

0

0

0 • 0

0 ··· * 0

0 0 0

000

3.3 Conclusions

In the co-culture system, expression of the transcription factor Egr-1 is angiogenic. This is supported by the data of Example 1, where Egr-1 has been shown to positively regulate the expression of a growth factor (e.g. VEGF) when introduced into mouse skin by the gene gene, and the data of Example 5 where Egr-1 transfection shows an increased amount of VEGF. produced in human vascular smooth muscle cells. The inverse dose response of Egr-1 as a pro-angiogenic stimulus is consistent with the results obtained in Example 6 and with the idea that Egr-1 may negatively regulate its own production (Cao, X. et al., J. Biol. Chem. 268, 16949-16957

1993, Schwachtgen, J.-L. et al. J. Clin. Invest., 101, 2542549,1998).

Example 4: Use of a transcription factor to promote osteogenesis in vitro

4.1 Application to bone and determination of growth factors

4.1.1 Methods:

The cells used were TE85, an osteoblast-like cell line derived from osteosarcoma. Sub-confluent cell layers were trypsinized and resuspended in DMEM containing 10% fetal calf serum (FCS) and 1% penicillin instreptomycin (PS). The cell suspension was plated on a substrate (18x18 mm square of tissue culture plastic). Cells were allowed to capture overnight. When cells are retained on the substrate, they are transferred to a container containing DMEM with 2% FCS and 1% PS, where they are allowed to rest for an additional 24 hours to stimulate.

Figure 4a shows four sets of conditions for each time point:

(1) deposition (200 cycles of 2000 micro - chains at a speed of

232 micro-strings per second).

* · ♦ ·

2) Control (not applied) 3) positive control (100 ng / ml PMA for 1 hour) 4) soluble control. When the cells were aseptically transferred from the cells

standard tissue culture into the chamber. The loading time of the cells into the chamber is 4 minutes. After plating, the cells returned to their original culture conditions. Control treated cells were treated in exactly the same way except that they were not loaded into the chamber.

The results were analyzed in two different ways. First, the presence of transcription factor Egr-1 was determined by Western blot analysis of the cell pellet. Cell pellets were collected after loading experiments (Figure 4b). Second, the presence of secreted growth factors was determined by tissue culture ELISA (Figure 4C).

Conclusions

These results show that under the conditions of bone insertion, the transcription factor Egr-1 is produced in osteoblast-like cells derived from human osteosarcoma. Application of the introduction in human TE85 cells stimulates the production and secretion of growth factors such as PDGF B.

4.2 Transfection of CMV TGF-βΙ into MC3T3E1 and ROS cells followed by ELISAs of human TGF-βΙ and mouse VEGF in cell culture supernatants.

4.2.1 Materials:

(i) Transfection

Mouse osteoblast cells (MC3T3E1) and rat osteoblastoma cells (ROS17 / 2.8) were used for seeding on 6-well plates.

MC3T3E1 cells were cultured in MEM-α (Sigma), 10% fetal calf serum (Life technologies), 1%

L-glutamine (Life Technologies), 1% penicillin-streptomycin (Life Technologies).

ROS cells were cultured in F12 HAM, F-12 HAM with glutamine (Life Technologies), 10% fetal calf serum (Life

Technologies), 1% penicillin-streptomycin (Life Technologies).

Cells were transfected using Fugene (Boehringer

Mannheim) with a plasmid expressing CMV TGF-βΙ as described by Benn, S.I. et al., J. Clin. Invest., 1996, 98, 28942902). Transfection into cells was performed as described:

1) A 6-well plate was prepared, each containing 2 x 10 ⁵ cells and allowed to stand overnight until a confluency of 50-70% was achieved.

2) 94 μ den serum free culture medium (SFM) was added the next day and 6 μΐ of Fugene was added to each Eppendorf tube and allowed to stand at room temperature for 5 minutes.

3) Of the 6 separate tubes, no DNA was placed in 2 tubes, while 4 µg of CMV-TGF-βΙ DNA was added to the remaining 4 tubes.

4) Mixture. described in step 2) of fugene / SFM was added dropwise to the tubes described in paragraph 3), the tubes were inverted several times and incubated for 15 minutes at room temperature.

5) The fugene / SFM / DNA transfection mixture was added dropwise to each of the wells while mixing the 6-well plate. The plate was incubated at 37 ° C for 48 hours.

6) Cell culture supernatants were aliquoted and stored at -20 ° C. The above protocol was performed for both MC3T3E1 and ROS cell types.

¹ · · «· · · · · · · · · · · · · · · · · · · · · · · · ·

The presence of TGF-ββ1 and VEGF in cell culture supernatant was detected by ELISA (R plus D Systems) using a strepatividine-HRP-based color detection system.

4.2.2. Results:

Production and detection of TGF-βί and VEGF after transfection with CMV-TGF-βΙ is shown for ROS cells (Figure 3) and MC3T3E1 cells (Figure 4). These data indicate that the Egr-1 target gene, in this TGF-βί example, activates VEGF production.

4.3 Conclusion

Egr-1 expression and activation of Egr-1 target genes can synergistically activate VEGF.

Example 5: Use of Egr-1 transcription factor to promote osteogenesis in vivo

5.1 ectopic bond formation in rats

Subcutaneous implantation of rodent-inducing compounds is a biological test system (see Wozney, J.M., Cell. Mol. Biol., 131-167, 1993).

The use of a carrier matrix increases the reproducibility and sensitivity of the binding induction response. In the test system (Reddi, A. H., et al., Proc. Natl. Acad. Sci. USA, 69, 1601-1605, 1972, Sampath, T. K. ibid, 78, 7599-7603,

(1981), the carrier matrix was obtained from diaphyseal portions of rat long bones, which were cut into portions of a certain size, then demineralized and the biological activity removed by guanidine extraction. The remaining carrier contains primarily bound collagen without osteoinductive capacity. The test compound or substance is then stored in the matrix by precipitation with alcohol, dialyzed against water or lyophilized. This matrix combination is then implanted into the · · · · · · · az * · * · • · ··· _»e;

And rat subcutaneous tissues for a number of days (12 days for the experiment). Implants were then tested histologically and biochemically for their ability to induce bone formation (Sampath, TK et al., Proc. Natl. Acad. Sci. USA, 80, 6591-6595, 1983, Sampath, TK et al. ibid, 84, 7109-7113, 1987, Wang, E. ibid, 85, 9484-9488,

Wang, E. et al., Ibid., 87, 2220-2224; Sampath, T.K. et al., J. Cell Biol., 98, 2192-2197, 1984).

5.1.1 Experimental methods

Twenty male Sprague Dawley rats (age 42-49 days, weight 170-220 g) were prepared. They were chosen randomly to receive two implants inserted under the skin into the dorsal thorax under anesthesia with halothane. The implants were treated with one of four treatments:

• negative control - carrier alone (DGBM bone matrix demineralization extracted with guanidine) • CMV Egr 1, 500 qg DNA on DGBM carrier • CMV Egr 1, 500 qg DNA plus recombinant bone morphogenetic protein (BMP) 4,5 μς on DGBM carrier, ( BMP4 is used for its chemotactic effects) • recombinant BMP4 protein, 5 qg on DGBM carrier

The day of incorporation was designated as day 0 and 12 days later all rats were sacrificed using a modified method, implants were removed, soft tissue removed and divided into equal halves. One half was placed in 10% formalin for histological testing and the other half was frozen and stored at -20 ° C. This sample was then tested for calcium content and alkaline phosphatase activity.

5.1.2 Preparation of demineralized bones in rats

The middle part of the femur, tibia and humerus of adult Sprague Dawley rats were removed, the soft part removed, and

Φ99 • · · ··· * ·

9 • 9 9 • 9 9 9 ·· 9 9900 9 «99 99 · ·

9

9

9

999 sealed cavities were rinsed with normal saline. Fat was then removed from the bones by stirring in 100 ml of chloroform: methanol (2: 1) for 30 minutes. This step was repeated once more, followed by air drying in an oven. The middle bones were then frozen in liquid nitrogen and pulverized on a CRC micro-mill. The resulting powder was sieved to capture a discrete particle size of 75-425 μπι and then demineralized in 0.5 M HCl for 3 hours with stirring. The mixture was then centrifuged for 30 minutes at 190,000 rpm. (Kontron CentriksT124, Rotor A8.24) at 15 ° C. The pellet was resuspended in 100 ml of water, stirred for one hour and centrifuged. This step was then repeated. The pellet was then resuspended in 100 ml of ethanol, stirred for one hour and centrifuged. Ethanol was evaporated and the sample was resuspended in 4M guanidine hydrochloride / 50 mM Tris, pH 7.4 and stirred overnight. Further centrifugation was performed with the pellet resuspended in 50 ml of water stirred for one hour and centrifuged. This step was repeated two more times. The sample was then dried overnight in an oven. DNA was added to the bones by mechanical agitation and lyophilization.

5.2 Histological examination

After initial fixation in formalin, samples were embedded in methyl methacrylate and sections of 1 µ 1 thickness were sectioned and stained with von Koss and toluidine blue. Three non-adjacent sections were evaluated from each implant.

For cartilage and bones, a standard scoring system was used.

± tentative identification of bone or cartilage

1. > 10 O. Ό every section new cartilage or bones 2. > 25 O, Ό every section new cartilage or bones 3. > 50 O, O every section new cartilage or bones 4. > 75 Q. Ό every section new cartilage or bones

• ·

5.> 80% of each section of new cartilage or bone

5.3 Biochemical test

The tissue was homogenized in a 2 ml ice-cooled mixture of 0.25 M sucrose and 3 mM NaHCO 3. The homogenates were centrifuged at 12,000 g for 15 minutes in two centrifugation stages and the suspernatants were collected for enzyme assay. Alkaline phosphatase activity was determined using a p-nitrophenyl phosphate (PNP) colorimetric assay as substrate. After incubation of the test samples with PNP at 37 ° C, the optical density at 405 nm was determined on a standard microplate reader.

5.4. Results

The results are shown in Figure 5. Data obtained from treatment of two implanted independent sites for each rat were analyzed. Due to the small amount of data and asymmetric data distribution, the mean value and the internal quartile range (IQR) are presented. The Kruskal Wallis tests were performed on the above variables and it was found that the amount of alkaline phosphatase differed substantially from one another.

Bone formation was positive for one implant for five implant sites in only one group (CMV Egr-1 DNA / BMP). The initial experiment used a single time point for a 12-day test that was selected to obtain predicted results. At this point in time, the alkaline phosphatase activity of the CMV Egr-1 and CMV Egr-1 DNA / BMP4 DNAs was substantially evaluated. Such a temporary increase in alkaline phosphatase activity can typically be seen (as a precursor in bone formation) with compounds such as BMP that stimulate bone formation for a maximum of 10 to 15 days and then decrease. The calcium content of the samples did not show substantial differences, although early calcification was observed in a number of histological cases

samples in the CMV-Egr-1 / BMP4 group. This can be explained by the planned biopsies at a time when calcification has just begun.

5.5 Conclusion

Egr-1 increases the potency of alkaline phosphatase in the rodent model of ectopic bone formation and can promote localized bone formation.

Example 6: Use of a transcription factor in promoting re-endothelization after percutaneous transluminal coronary angioplasty in vitro.

6.1 Methods

Human or porcine vascular smooth muscle cells (SMC, Clonetics) were thawed and maintained in culture medium and passed 4 passages according to the manufacturer's instructions. SMCs were transfected with an expression plasmid containing the Egr-1 cDNA expressed from the CMV promoter Houston et al. , Arterioscler. Thromb. Vasc. Biol., 19, 218-289 (1999). DNA expressing Egr-1 was transfected into SMC using fugene (Boehringer Mannheim) after optimizing SMC with a control, which is the lucifarase reporter vector pGL3 (Promega) or Mirus Transit (Cambridge Biosciences), both of which were transfected f

protocols used β-galactosidase as a normalization plasmid suitable for transfection control.

6.2 Results

CMV Egr-1 DNA was transfected into human SMCs and Egr-1 protein was detected by immunohistochemistry using polyclonal antibodies (Santa Cruz) and peroxidase detection (Sigma and Vector Laboratories). Human SMCs were transfected with CMV Egr1 DNA (right side panel) or mock transfections (left side panel) shown in Figure 6a. Porcine SMCs were transfected with CMV Egr-1 DNA (right panel) or

false transfection se (panel on the left) is shown in Figure 6b. Egr-1 protein expression is detectable as a brown color. Optimization of DNA transfection was achieved using fugene 6 (for further in vitro characterization, Figure 6c) and Mirus Transit (essential in the in vivo study, Figure 6d). Based on these data, 4 µg of CMV-Egr-1 DNA was used in the growth factor activation experiments using a 3: 1 lipid: DNA mixture. A 3: 1 lipid: DNA mixture is also used in in vivo gene introduction experiments.

Activation of Egr-1 three growth factors were analyzed cell supernatants by ELISA. VEGF production (Figure 6e), HGF (Figure 6f) and PDGF-AB (Figure 6g) increased in response to activation Egr-1. Activation occurs based on the dose; and k inverse response per dose, as described from above. Sure DNA concentration (Egr-1) are displayed in Example 3. 6.3 Conclusion

The Egr-1 protein was expressed in SMC tramsfected with CMV Egr-1 DNA. Egr-1 transfection increased the production / secretion of PDGF, HGF and VEGF obtained from SMC.

Example 7: EGR-1 promoter sequences

The human Egr-1 promoter fragment located at -674 to +12 was synthesized by PCR in a reaction containing 0.5 µg of human placenta! genomic DNA, such as a template, 0.4 mM dATP, dCTP, dGTP and dTTP, 25 pmol of straight primers (5'-GGC CAC GCG TCG TCG GTT CGC TCT CAC GGT CCC-3 ', (a site that recognizes the restriction enzyme MluI is 25 pmoles of reverse primers 5 '-GCA GCT CGA GGC TGG ATC TCT CGC GAC TCC-3' (site that recognizes XhoI is underlined), and Vent polymer DNA (NEB) The PCR fragment was digested with MluI restriction enzymes. and Xhol, separated on an agarose gel and cloned • ·

between sites that recognize the restriction enzymes MluI and XhoI at the multiple cloning site of the pGL3 base vector (Promega).

The entire sequence was obtained by following the gaps in the published sequence. This is shown in Figure 7, where the entire sequence (GW SEQ) was compared to the previously published sequence (ON SEQ). This promoter sequence is functional and has been investigated in the study of stress in endothelial cells.

An important difference between the published human Egr-1 promoter sequence and the sequence described (in Figure 8) lies in previously unknown SREs. While it has been reported that the SRE 5 and SRE 1 sequences do not bind serum response factor (SRF) and are not functional (Nurrish SJ, Treisman R, Mol Cell Biol 1995, 15 (8): 4076-85), they have been found to be within in accordance with the SRF sequence (Figure 7).

There is great interest in the SRE5 sequence. A new SRE5 sequence was synthesized in conjunction with Ets transcription factor binding sites in the form of double-stranded oligonucleotides and inserted into the NheI restriction site upstream of the SV40 minimal promoter vector gene (pSV40).

SRE5 has the sequence:

AG

GCTGCGACCCGGAAATGCCATATAAGGAGCAGGAAGGATCCCCCCGCGC

G

CGACGCTGGGCCTTTACGGTATATTCCTCGTCCTTCCTAGGGGGGCGGCC

GA

The two Ets are highlighted in bold and the SRE is underlined. The AG overhang is used to clone into the partially filled Nhe restriction site of the pGLE promoter.

»9

/ 5

The resulting reporter plasmid pSVSRE5 was transiently transfected into HeLa cells along with plasmids pFA-dbd (a construct encoding a Gal4 DNA binding domain (dbd) or pFA-MEK1 (a construct encoding a Gal4 DNA binding domain fusion protein (dbd) and a MAP kinase kinase kinase MEK1 domain) The Gal4-MEK1 fusion protein is still active and phosphorylates Elk1 and SRF and binds to SRE5.

The results shown in Figure 10 show that the isolated SRE5 sequence is activated three times by the presence of MEK1, while the SV40 pormotor shows only minimal activation.

The results indicate that the new SRE5 is functional.

Claims (18)

PATENT FEATURES 0 · 0 · 0 0 0 · · · 0 years containing the Egr-1 factor or its sequence Use of a nucleic acid molecule encoding a transcriptionally biologically active fragment polypeptide in the manufacture of a medicament suitable for treating wounds in a mammal, including a human. The use of claim 1, wherein the Egr-1 is human Egr-1. The use of claim 1 or 2, wherein the nucleic acid molecule comprises said sequence encoding the Egr-1 transcription factor polypeptide or a biologically active fragment thereof operably linked to a nucleic acid sequence that directs expression. The use of claim 3, wherein the nucleic acid sequence that directs expression: (a) it has a chain containing the sequence shown in Figure 7 for GW SEQ b) has a chain comprising one or more deletions, insertions and / or substitutions of related GW SEQ, but does not contain the sequence shown in Figure 7 as ON SEQ, and which also does not contain the sequence shown in Figure 9. Use according to any one of the preceding claims, wherein the nucleic acid molecule is designed to be suitable for administration to a mammal by physical means. The use of claim 5, wherein the nucleic acid molecule is designed to be suitable for administration to a mammal by particle bombardment. The use of claim 6, wherein the nucleic acid molecule is immobilized on gold particles. The use of claim 5, wherein the nucleic acid molecule is designed to be applied by micro-seeding. Use according to any one of claims 1 to 9, wherein the nucleic acid molecule is in a vector. • 9 The use of claim 9, wherein the nucleic acid molecule is in a cell. A nucleic acid molecule comprising a sequence encoding a transcription factor Egr-1 polypeptide or a biologically active fragment thereof suitable for use in the treatment of wounds. 12. A pharmaceutical composition comprising a nucleic acid molecule comprising a sequence encoding a Egr-1 transcription factor polypeptide or a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers. 13. A method of treating a wound in a mammal comprising a human comprising the method of administering to the mammal a nucleic acid molecule comprising a sequence encoding a transcription factor polypeptide or a biologically active fragment thereof. Use of a transcription factor Egr-1 polypeptide or a biologically active fragment thereof in the manufacture of a medicament for treating wounds in a mammal that comprises a human. Use according to claim 14, wherein Egr-1 or a biologically active fragment thereof is produced naturally, synthetically or recombinantly. Use according to claim 14 or 15, wherein Egr-1 is human Egr1. A transcription factor Egr-1 polypeptide or a biologically active fragment thereof suitable for use in the treatment of wounds. 18. A method of treating a wound in a mammal comprising a human comprising administering to the mammal a therapeutically effective amount of a transcription factor polypeptide or a biologically active fragment thereof. A pharmaceutical composition comprising the transcription factor Egr-1 and / or. and) (b) c) a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers. A nucleic acid molecule having a sequence comprising the sequence shown in Figure 7 for GW SEQ, a sequence comprising one or more deletions, insertions and / or substitutions related to the GW SEQ, but does not contain the sequence shown in Figure 7 as ON SEQ and which also does not comprise the sequence shown in Figure 9 or a chain that hybridizes to a chain as described in a) or b) above. The nucleic acid molecule of claim 20, which comprises one or more serum response elements (SREs). The nucleic acid molecule of claim 21, which comprises the sequence shown in Figure 7 as SRE 5 for GW SEQ or a functional variant thereof. The nucleic acid molecule of claim 22, wherein said variant exhibits at least one of the nucleotide differences present in GW of SEQ SRE 5 compared to ON SEQ SRE 5 shown in Figure 7. The nucleic acid molecule of any one of claims 20 to 23, which comprises the serum response elements shown in Figure 7 as SRE3 and SRE4 or a functional variant thereof. The nucleic acid molecule of any one of claims 20 to 24, comprising a TATA box. The nucleic acid molecule of claim 25, wherein the TATA box comprises an AAATA sequence. The nucleic acid molecule of any one of claims 20 to 26, which comprises an Egr-1 binding site (EBS). The nucleic acid molecule of claim 27, wherein the Egr-1 binding site has the sequence shown in Figure 7 for GW SEQ as EBS or has a variant of said sequence. fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl fl The nucleic acid molecule of any one of claims 20 to 28, wherein said variant exhibits limited affinity for Egr-1 compared to the sequence shown as EBS in Figure 7 for GW SEQ. The nucleic acid molecule of claim 29, wherein said variant comprises the sequence shown in Figure 2 for EBS. The nucleic acid molecule of any one of claims 20 to 26, which does not comprise an Egr-1 binding site. The nucleic acid molecule of any one of claims 20 to 31, comprising a sequence capable of binding Sp1. The nucleic acid molecule of claim 32 comprising two sequences capable of binding Sp1. Nucleic molecule. The acid of claim 32 or 33 comprising one or both of the Sp1 binding sequences shown in Figure 7 for GW SEQ. The nucleic acid molecule of any one of claims 20 to 34, which comprises an element corresponding to cAMP. The nucleic acid molecule of claim 35 comprising at least one element corresponding to cAMP shown in Figure 7 for GW SEQ as cAMP RE. Nucleic acid molecule according to claim 35 or 36 comprising first the cAMP RE shown in Figure 7 for GW SEQ. A nucleic acid molecule comprising all of the sequences shown in the boxes of Figure 7 for GW SEQ with the possible exception of the EBS sequence. A nucleic acid molecule comprising a variant of the molecule shown in Figure 7 for GW SEQ, which is capable of enhancing the transcription of Egr-1 compared to the molecule shown in Figure 7 for GW SEQ. 40. A nucleic acid molecule comprising a variant of the molecule shown in Figure 7 in the case of GW SEQ, which is capable of a · · ♦ · · · and Thus, the post-operative remodeling attenuates the transcription of Egr-1 compared to the molecule shown in Figure 7 for GW SEQ. The nucleic acid molecule of any one of claims 20 to 40 comprising a sequence encoding Egr-1. A nucleic acid vector comprising the molecule of any one of claims 20 to 41. A cell comprising the nucleic acid molecule of any one of claims 20 to 41 or the vector of claim 42. treating a patient comprising administering to the patient a nucleic acid molecule according to any one of claims 20 to 41, a vector according to claim 42, or a cell according to claim 43. A method of treating a patient comprising administering to a patient an Egr-1 produced by using a nucleic acid molecule according to any one of claims 20 to 41 using a vector according to claim 42 or using a cell according to claim 43. The method of claim 44 or 45, wherein the treatment is wound treatment (including healing and associated conditions and therapy that promotes, intensifies or accelerates tissue healing and includes treatment of skin ulcers in diabetes, peripheral artery occlusive disease, scars, burns psoriasis, acceleration and regeneration of bones, promoting angiogenesis, restoration of the vascular endothelium following percutaneous transluminal coronary angioplasty. The method of any one of claims 44 to 46, wherein the nucleic acid molecule or Egr-1 is applied directly to or close to the wound. A method of diagnosing comprising the use of a nucleic acid molecule according to any one of claims 20 to 40 as a probe to determine whether or not a genetic defect exists. O X 4 4 4 4 4 95 4 4 4 • ♦ · • · 4 4 • · · · · · · • · · · · 4 4 4 4 4 49. Test Method, v y z n a learning s e t i m that includes use molecules nuclear acid according to any of the claims 20 to 40, wherein se on basis Binding studies identify a potential therapeutic agent. A method of identifying an agent capable of positively or negatively regulating the transcription of Egr-1, comprising preparing a nucleic acid molecule according to any one of claims 20 to 40 (e.g., as compared to a molecule comprising GW SEQ shown in Figure 7) and determining whether these changes affect the potency of Egr-1 transcription. 51. A reagent characterized in that it has been identified by the method of claim 49 or 50. 52. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a nucleic acid molecule according to any one of claims 20 to 41, a vector according to claim 42, or a cell according to claim 43. 53. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and Egr-1 produced using a nucleic acid molecule according to any one of claims 20 to 41, a vector according to claim 42, or a cell according to claim 43.