MXPA00011726A - Gene therapy method - Google Patents

Abstract

The invention relates to the use of an Egr-1 transcription factor polypeptide or a biologically active fragment thereof, and to nucleic acid molecules encoding such polypeptides, in the manufacture of a medicament for the treatment of wounds in a mammal, including human. In addition, it relates to a sequence that is believed to include important regions involved in the transcription of the transcription factor Egr-1 in humans and in the regulation thereof. This sequence can be used to design appropriate nucleic acid molecules and vectors that can be used in the treatment of wounds, as well as in other treatment.

Description

Genetic Therapy Method This invention relates to the use of genetic therapy techniques and wound healing and associated conditions. More particularly, it relates to the new use of polynucleotides encoding the transcription factor of the response 1 of premature growth (Egr-1) in the treatment of wounds. Wound healing and conditions, such as in the treatment of dermal ulcers arising from ischemia and neuropathy associated with diabetes, peripheral arterial occlusive disease, deep vein thrombosis, chronic venous insufficiency and pressure ulcers, post-scar reduction operations associated with, for example, cataracts, skin grafting procedures, burns, psoriasis, acceleration of remodeling and tissue regeneration; repair of hard tissue, for example bone; soft tissue repair, eg, tendon, ligament, muscle, promotion of angiogenesis, re-endothelialization followed by percutaneous trans-luminal coronary angioplasty, inhibition of ventricular cardiac hypertrophy, modulation of calcification of the vessel wall and promotion of neurodegeneration.

REF .: 125445 Additional utilities could include the inhibition of fibrotic conditions, for example, pulmonary and hepatic fibrosis and the prevention of alopecia.

The invention also relates to the transcription of Egr-1 and the regulation thereof.

The healing of the skin involves a wide range of cellular, molecular, physiological and biochemical cases. During the healing process the cells migrate to the injured sites where they proliferate and synthesize extracellular matrix components to reconstitute a tissue closely similar to the original undamaged tissue. This activity is regulated by mediators secreted from wounded edge cells, such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), transformation growth factor (TGF) beta and other cytokines. The beneficial effects of these agents on the cells have been demonstrated in vi t ro e in vi (reviewed by Moulin, Eur. J. Cell Biol. 68; 1-7, 1995), which include the benefit of administering PDGF in rat models of diabetes (Brown et al. J. Surg. Res. 56; 562-570, 1994).

During the last five years numerous growth factors have been shown to accelerate cell proliferation and to promote wound healing in animal models. TGF beta has received the most attention in the context of wound repair, since it promotes cell proliferation, differentiation and matrix production. TGF beta administered either topically or systemically accelerates the rate of skin wound repair in animal models. (Ashcroft et al., Nature Medicine, 3; 1209-1215, 1997; Sporn and Roberts, J. Cell Biol., 119; 1017-1021, 1997; Beck et al., J. Invest., 92: 2841-2849, 1993). It has also been reported to promote re-epithelialization and revascularization in ischemic tissue and diabetic animals (Uhl et al Langenbecks Archiv fur Chururgie - S upp 1 emen t -Kongressband 114; 705-708, 1997 and reviewed in Dirks and Bloemers Mol. Biol. Reports 22; 1-24, 1996).

The transcription factor Egr-1 is a potential regulator of approximately 30 genes and plays a role in growth, development and differentiation (reviewed in Liu et al Crit., Rev. Oncogenesis 7; 101-125, 1996; Khachigian and Collins Circ. Res. 81; 457-461, 1997). Egr-1 is induced due to vascular endothelial injury (eg Khachigian et al Science; 271, 1427-1431, 1996) and targets for transcriptional activation are numerous genes that include epidermal growth factor (EGF), platelet-derived growth factor A (PDGF-A), the basic fibroblast growth factor (bFGF), the induction of PDGF A, PDGF B, TGF beta, bFGF, uro-plasminogen activator (u-PA), factor of tissue and insulin-like growth factor 2 (IGF-2).

The transcription complex that regulates the induction of vascular endothelial growth factor (VEGF) is dependent on AP2 and not directly on Egr-1 (Gille et al EMBO J 16; 750-759, 1997). However the PDGF B directly over-regulates the expression of VEGF (Finkenzeller Oncogene 15; 669-676, 1997). Transcription of VEGF mRNA is enhanced by a number of factors, including PDGF B, bFGF, keratin growth factor (KGF), EGF, tumor necrosis factor (TNF) alpha and TGF beta 1. VEGF has been to promote re-endothelialization through a balloon in the damaged artery. The results obtained in rabbits showed a clear passivity activated by VEGF of metallic catheters that affect an inhibition of neo-intimal formation in the catheter, a decrease in the occurrence of thrombotic occlusion, an acceleration of the re-endothelialization of the prosthesis and an increase in vasomotor activity (van Belle, E. et al, Biochem Biophys, Res. Comm., 235; 311-316, 1997; van Belle, E. et al, J. Am. Coll, Cardiol., 29; 1371-1379, 1997; Asahara, T., et al, Circulation, 94; 3291-3302, 1997). The NIH approval for a pilot VEGF study to promote re-endothelialization in humans was granted in 1996. In addition, HGF has also been shown to promote re-endothelialization after balloon angioplasty in a rat model. of carotid artery injury (Nakamura et al, Abstract 1681, American Heart Association Meeting, Dallas, 1998). In animal models, the VEGF-activated passivity of metal catheters has been shown to inhibit neo-intimal formation, accelerate re-endotialisation and increase vasomotor activity (Asahara et al Circulation; 94, 3291-3302 ).

Expression of VEGF has been reported in wound healing and psoriatic skin, both conditions in which TGF alpha and its ligand EGF receptor (EGFr) are over-regulated. Expression of EGF induces Egr-1 (Iwami et al Am. J. Physiol., 270; H2100-2107, 1996; Fang et al Calcified Tissue International 57; 450-455, 1995; J. Neuroscience Res. 36; 58-65, 1993). There is present evidence from the anecdote that Eg rl could activate the expression of inter-cellular adhesion molecule 1 (ICAM-1) in B lymphocytes stimulated by phorbol ester (Maltzman et al., Cell. Biol. 16; 2283-2294, 1996) and could activate the expression of TNF alpha by virtue of the presence of an Egr-1 binding site in the TNF alpha promoter (Kramer et al Biochim, Biophys, Acta 1219, 413-421, 1994). Finally, Egr-1 eliminates mice that are infertile and deficiency of luteinizing hormone (LH) (Lee et al, Science 273; 1219-1221, 1996) which employs the LH promoter could also be a target for activation of Egr-1 Pressure on bone, mechanical stress and fluid flow of MC3T3E1 cells induces Egr-1 (Dolce et al Arch = Oral Biol. 41; 1101-1118, 1996; Ogata J. Cell Physiol., 170; 27-34 , 1997) with the concomitant activation of growth factors. The expression of Egr-1 predominates in the cartilage and bone of the developed mouse (McMahon et al Development 108; 281-287) and has been implicated in the regulation of the growth and differentiation of osteoblastic cells (Chaudhary et al. Biochem 156; 69-77, 1996). Egr-1 and Wilm's type 1 tumor (WT1) of the closely related zinc finger transcription factor have been implicated in the regulation of osteoclastogenesis (Kukita et al Endocrinology 138; 4384-4389, 1997) and prostacyclin E2 (PGE2) and EGF are induced by Egrl (Fang et al Calcified Tissue International 57; 450-455, 1995; Fang et al Prostaglandins, Leukotrienes and Essential Fatty Acids 54; 109-114, 1996). Vascular calcification is an actively regulated process similar to bone formation that involves cells and other known factors that are important in the regulation of bone metabolism (reviewed in Dermer et al Trends Cardiovasc, Med.4,45-49, 1994). The regulators of osteogenesis and / or osteoclastogenesis could modulate the degree of calcification of the vessel wall.

The hypertrophic stimulus such as hemodynamic pressure and angiotensin II could be used to activate the production of the feedback of egr-1 under the control of a specific myocyte promoter and have application in the treatment of heart failure.

Egr-1 is essential for the cellular expression of Schwann of the nerve growth factor receptor p75 (NGF) (Nikam et al 1. Mol.Cell. Neurosciences 6; 337-348, 1995). NGF induces the expression of Egr-1 with the concomitant activation of growth factors (Kendall et al Brain Research, Molecular Brain Research 25; 73-79, 1994; Kujubu et al Jornal of Neuroscience Research 36; 58-65, 1993). ).

It has now been found that the administration of a polynucleotide encoding the transcription factor Egr-1 at a wound site and the subsequent expression thereof, promotes accelerated healing.

Thus, according to a first aspect of the present invention, there is provided the use of a nucleic acid molecule comprising a sequence encoding a polypeptide of the transcription factor Egr-1 or a biologically active fragment thereof in the preparation of a medicament for the treatment of wounds in a mammal, including the human.

For the avoidance of doubt, the reference to a polynucleotide is equivalent to any reference to a nucleic acid molecule.

According to a second aspect of the present invention, there is provided a method of treating wounds in a mammal, including the human, the method comprising administering to the mammal a nucleic acid molecule comprising a sequence encoding a factor polypeptide of transcription Egr-1 or a biologically active fragment thereof.

According to a third aspect, the invention provides a nucleic acid molecule comprising a sequence encoding a polypeptide of transcription factor Egr-1 or a biologically active fragment thereof for use in the treatment of wounds.

According to a fourth aspect, the invention provides a pharmaceutical composition comprising a sequence encoding Egr-1 or a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers thereof.

Thus, the present invention relates to the therapeutic use in the treatment of wounds of polynucleotides that encode a transcription factor Egr-1. The invention also relates to the therapeutic use in the treatment of wounds of a transcription factor of Egr-1 itself, as described in greater detail below.

The invention relates to the use of Egr-1 polypeptides and nucleic acid sequences encoding Egr-1 of any origin or species. Protein sequences are highly conserved between species, for example with 98% homology between the rat and the mouse. The DNA sequence of murine Egr-1 is known (Ce l 1. 53 37-43 (1998)). The deduced amino acid sequence shows a long open reading frame with a stop codon (TAA) at position 1858. The deduced amino acid sequence predicts a 533 amino acid polypeptide with a molecular weight of 56,596. Corresponding sequences of other species could be obtained by methods known in the art, for example by screening the genomic or DNA libraries using oligonucleotide sequences based on or derived from the murine Egr-1 sequence as probes. Human Egr-1 is known to be located on chromosome 5, more precisely at 5q23-31 (Ce l l 53, 37-43). The sequence of the human Egr-1 cDNA is described in Nu cl eic Aci ds R es ea 18 p4283, 1990. The similarity between the mouse and human sequences is 87% and 94% at the nucleoside and protein levels , respectively.

References to the Egr-1 polypeptides and polynucleotides described below are generally applicable to sequences of any origin, including murine Egr-1 DNA and corresponding amino acid sequences as published in Ce ll, 53, 37- 43 (1988) and the human sequence as published in Nu cl eic Aci ds Res ea rch 18 p4283, 1990 and to the sequences of other species. As will be described later, the term Egr-1 also includes variants, fragments and analogs of Egr-1. More preferably, the human sequence is used.

The following illustrative explanations are provided to facilitate the understanding of certain terms used here. The explanations are provided as a convenience and are not to limit the invention.

"Wound treatment" includes the treatment of conditions associated with wounds, wound healing and associated conditions and therapy that promotes, increases or accelerates tissue healing and includes the treatment of leg ulcers in diabetes and arterial occlusive disease peripheral, post-operative scarring, burns, psoriasis, acceleration of tissue remodeling and bone repair and the promotion of angiogenesis, re-endothelialization followed by percutaneous trans-luminal coronary angioplasty, inhibition of left ventricular hypertrophy, modulation of calcification of the vessel wall and the promotion of neuroregeneration. It also includes the inhibition of fibrotic conditions, for example, pulmonary and hepatic fibrosis and the prevention of alopecia.

A "biologically active fragment" of Egr-1 as referred to herein is a fragment having an activity of Egr-1, which includes the wound healing properties according to the present invention.

"Genetic element" generally means a polynucleotide comprising a region encoding a polynucleotide, or a polynucleotide region that regulates replication, transcription or translation or other processes important for the expression of the polypeptide in a host cell, or a polypeptide that it comprises a region encoding a polypeptide and a region operably linked thereto, which regulates expression. The genetic elements could be comprised within a vector that replicates as an episomal element; that is, as a molecule physically independent of the genome of the host cell. They could also be included within the plasmids. The genetic elements could also be comprised within a host cell genome; not in its natural state, but instead, after manipulation such as isolation, cloning and introduction into a host cell in the form of purified DNA or in a vector, among others.

A "host cell" is a cell that has been transformed or transferred, or is capable of transformation or transfection by an exogenous polynucleotide sequence.

"Identity", as known in the art, is the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence related between the polypeptide or polynucleotide sequences, as might be the case, as determined by the equality between the strands of such sequences. Identity can be easily calculated (Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988, Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993). Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994, Sequence Analysis in Molecular Biology, von Heir.je, G., Press, 1987; and Sequence Analysys Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991). While there are a number of methods for measuring the identity between two polynucleotide sequences or two polypeptide sequences, the term is well known to those skilled in the art (Seguence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Mat., 48: 1073 (1988 The methods commonly employed to determine the identity among the sequences include, but are not limited to, those described in Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Preferred to determine identity are designed to give the greatest equalization among the sequences tested.The methods for determining identity are encoded in computer programs.The preferred computer program methods for determining the identity between two sequences include, but are not limited to, GCG program package (Devereux, J., et al., Nu clic Aci ds Res ea rch 12 (1): 387 (1984)), BLASTP, BLASTN and FASTA (Atschul, SF et al., J. Molecular Bi. 215: 403 (1990)).

The "isolated" media altered "by the hand of man" from its natural state; i.e. which, if it occurs in nature, has been changed or removed from its original environment or both. For example, a naturally occurring polynucleotide or a polypeptide that occurs naturally in a living organism in its natural state is not "isolated", but the same polynucleotide or polypeptide separated from the co-existing materials of its natural state is "isolated" ", as the term is used here. As part of or following the isolation, such polynucleotides can be linked to other polynucleotides, such as DNA, for mutagenesis, to form the fusion proteins, and for example for propagation or expression in a host. Isolated polynucleotides, alone or linked to other polynucleotide sequences such as in the form of vectors, can be introduced into host cells, into culture organisms or into whole. Introduced into host cells in culture or whole organisms, such DNAs would still be isolated, according to the term used here, because they would not be in their naturally occurring form or environment, which are not naturally occurring compositions and, the isolated polynucleotides or polypeptides remain within the meaning of the term as used herein.

Polynucleotide (s) in general refers to any polynucleotide or polydeoxyribonucleotide that can not be modified by RNA or DNA or modified by RNA or DNA or cDNA. Thus, for example, polynucleotides as used herein refer to, inter alia, single or double stranded DNA, DNA which is a mixture of single or double stranded regions, hybrid molecules comprising DNA and RNA which could be single-strand or more typically, double strand or triple strand or a mixture of single and double strand regions. In addition, the polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions could be from the same molecule or from different molecules. Regions could include all of one or more of the molecules, but more typically they involve only one region of some of the molecules. One of the molecules of a triple helix region is often an oligonucleotide. As used herein, the term "polynucleotide" includes DNAs or RNAs as described above that contain one or more modified bases. In this way, DNAs or RNAs with structures modified for stability or for other reasons are "polynucleotides" as the term is intended herein. In addition, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as trilated bases, to name but two examples, are polynucleotides as the term is used herein. It will be appreciated that a variety of modifications have been made to DNA and RNA that serve many purposes known to those skilled in the art. The term "polynucleotide" as used herein encompasses such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia. Polynucleotides encompass short polynucleotides often referred to as oligonucleotides.

The polypeptides, as used herein, include all polypeptides as described below. The basic structure of the polypeptides is well known and has been described in countless textbooks and other publications in the art. In this context, the term is used herein to refer to any peptide or protein comprising two or more amino acids linked to each other in a linear chain by peptide bonds. As used herein, the term refers to short chains, which are also commonly referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which are generally referred to in the art as "proteins"., of which there are many types. It will be appreciated that polypeptides frequently contain amino acids other than the 20 amino acids commonly referred to as the naturally occurring 20 amino acids, and that many amino acids, including terminal amino acids, could be modified in a given polypeptide, either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques that are well known in the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exclusively here, but are also well described in the basic texts and in more detailed monographs, as well as in the voluminous research literature, and are also well known to experts in art.

Among the known modifications that could be present in the polypeptides for use in the present invention are, to name a few illustrative ones, acetylation, acylation, ADP-ribosylation, amidation, covalent bonding of flavin, covalent bonding of a heme radical, linkage covalent of a nucleotide or nucleotide derivative, covalent linkage of a lipid or lipid derivative, covalent linkage of phosphotidyl idiositol, cross-linking, cyclization, disulfide bond formation, dimethylation, formation of covalent cross-links, cystine formation, of amorphous pyroglyph, formylation, gamma carboxylation, glycosylation, GPI-support formation, hi-oxylation, iodination, methylation, myristoylation, oxidation, protolytic processing, phosphorylation, phenylation, racemization, selenoylation, sulfation, addition mediated by transfer of RNA from amino acids to proteins, such as arginilation and ubi quit ination. Such modifications are well known to the experts and have been described in greater detail in the scientific literature. Several particularly known modifications, for example glycosylation, lipid binding, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP ribosylation, are described in most basic texts, such as, for example, PROTEINS STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., TE Creighton, W.H. Freeman and Company, New York (1993). Many detailed reviews are available in this area, such as, for example, those provided by Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects. pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York (1983); Seifter et al. , Meth. Enzymol. 182: 626-646 (1990) and Rattan et al. , Protein Synthesis: Posttranslational Modifications and Aging. Ann. N.Y. Acad. Sci. 663: 48-62 (1992). It will be appreciated, as is well known and as noted above, that the polypeptides are not always entirely linear. For example, polypeptides could in general, as a result of post-translational cases, which include the case of natural processing and cases carried out by human manipulation that do not naturally occur. The circular, branched and circular branched polypeptides could be synthesized by natural non-translational processes and as well as by completely synthetic methods. Modifications can occur anywhere in a polypeptide, which include the structure of the polypeptide, the side chains of amino acids and the amino or carboxyl terminus. In fact, blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification, is common is the synthetic polypeptides that occur naturally and such modifications could be present in polypeptides of the present invention. For example, the amino terminal residue of the polypeptides made in E. col i or other cells, before proteolytic processing, almost invariably will be N-formylmet ionin. During the post-t-transduction modification of the peptide, a methionine residue in the NH2 terminus could be removed. Therefore, this invention contemplates the use of methionine-containing amino-terminal variants that do not contain methionine of the protein of the invention. Modifications that occur in a polypeptide will often be a function of how they are made. For polypeptides made by expressing a cloned gene in a host, for example, the nature and extent of the modifications will largely be determined by the ability of post-translational modification in the host cell and the modification signals present in the amino acid sequence of the polypeptide. For example, as is well known, glycosylation often does not occur in bacterial hosts, such as, for example, E. coli. Thus, when glycosylation is desired, a polypeptide should be expressed in a glycosylation host, in general, a eukaryotic cell. Insect cells often carry the same post-transduction glycosylations as mammalian cells and, for this reason, the expression systems of insect cells have been developed to efficiently express proteins in mammals that have native patterns of glycosylation, inter alia. Similar considerations apply to other modifications. It will be appreciated that the same type of modification could be present in the same or varying degree at several sites in a given polypeptide. Also, a given polypeptide could contain many types of modifications. In general, as used herein, the term polypeptide encompasses all these modifications, particularly, those that are present in recombinantly synthesized polypeptides expressing a polynucleotide in a host cell "Variants" of polypeptide polynucleotides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively. Variants in this regard are described later and elsewhere in the present description in greater detail. (1) A polynucleotide that differs in the nucleotide sequence from another, reference polynucleotide. In general, the differences are limited, so that the reference nucleotide sequences and the variant are closely, in general similar and, in many regions, identical. As seen later, changes in the nucleotide sequence of the variant could be slight. That is, they could not alter the amino acids encoded by the polynucleotide. When the alterations are limited to slight changes of this type, a polynucleotide variant will encode a polypeptide with the same amino acid sequence as the reference. Also, as noted below, changes in the nucleotide sequence of the variant polynucleotide could alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleotide changes could result in substitutions, additions, deletions, fusions and truncations of amino acids in the polypeptide encoded by the reference sequence, as discussed below. (2) A polypeptide that differs in the amino acid sequence of the other, reference polypeptide. In general, the differences are limited, so that the reference sequences and the variant are closely, in general similar and, in many regions, identical. A reference variant and polypeptide could differ in the amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which could be present in any combination.

"Treatment / Therapy" includes any regimen that may benefit a human or non-human animal. The treatment could be with respect to an existing condition or it could be prophylactic (preventive treatment).

"Understand / Have" covers anything consistent with a specified feature / character, as well as anything with such a feature / feature, but which also has one or more features / characteristics. ^^^^ ¿¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡? : identical Thus, in the case of a nucleic acid / protein sequence comprising / having a given sequence, the sequence itself is covered, as are longer sequences.

"Homolog" is used to cover any variant of a biologically active molecule that has one or more biological activities of such a molecule.

The invention relates to therapeutic uses of nucleic acid molecules comprising a sequence encoding an Egr-1 polypeptide. The invention also relates to the therapeutic uses of fragments of the polynucleotide sequence encoding the biologically active fragments of an Egr-1 or variants of the polynucleotide sequence which, by virtue of the degeneracy of the genetic code, encode the functional fragments, ie biologically active Egr-1, and to functionally equivalent allelic variants and related sequences modified by simple or multiple substitution, addition and / or basic elimination that encode the polypeptides having Egr-1 activity.

These could be obtained by standard cloning procedures known to those skilled in the art.

The polynucleotides encoding the transcription factor Egr-1 could be in the form of DNA, cDNA or RNA, such as mRNA obtained by cloning or produced by chemical synthesis techniques. The DNA could be single or double stranded. The single-stranded DNA could be the coding or sense strand, or it could be the non-coding or antisense strand. For therapeutic use, the polynucleotide is in a form capable of being expressed for a functional Egr-1 transcription factor at the wound site in the subject to be treated. The polynucleotides could also be used for the in vitro production of the Egr-1 polypeptide for administration in a further therapeutic aspect of the invention, as described in detail below.

The polynucleotides of the present invention that encode a polypeptide of the transcription factor of Egr-1 could include, but are not limited to, the coding sequence for the Egr-1 polypeptide or the biologically active fragments thereof. In this manner, the polynucleotide could be provided in conjunction with additional non-coding sequences, including, for example, but not limited to, non-coding 5 'and 3' sequences, such as the transcribed, untranslated sequences that play a role in transcription (including, for example, termination signals), ribosomal binding, mRNA stability elements, and additional coding sequence encoding additional amino acids, such as those that provide additional functionalities. The polynucleotides of the invention also include, but are not limited to, polynucleotides that comprise a structural gene for Egr-1 and its naturally associated genetic elements.

Accordingly, the term "polynucleotide encoding a polypeptide" as used herein encompasses polynucleotides that include a sequence encoding a polypeptide of the transcription factor of Egr-1. The term encompasses polynucleotides that include a single continuous region or discontinuous regions that encode the polypeptide (eg, interrupted by the integrated phage or the insertion or editing sequence) together with additional regions, which could also contain the coding sequences. and / or no coding The present invention also relates to variants of the polynucleotides described herein above that encode fragments, analogs or derivatives of the polypeptide. A variant of the polynucleotide could be a naturally occurring variant, such as an allelic variant that occurs naturally or could be a variant that is not known to occur naturally. Such variants that do not occur naturally of the polynucleotide could be made by mutagenesis techniques, including those applied to the polynucleotides, cells or organism.

Among the variants in this regard are the variants that differ from the polynucleotides mentioned above by the substitutions, deletions or additions of nucleotides. Substitutions, deletions or additions may involve one or more nucleotides. The variants could be altered in the coding or non-coding regions or both. Alterations in the coding regions could result in conservative or non-conservative substitutions, deletions or additions Preferred additional embodiments of the invention are polynucleotides that are at least 70% identical over their total length with respect to a polynucleotide that encodes a polypeptide having the amino acid sequence set forth in Ce ll 53 37-43 (1988) (the sequence of mouse), more preferably at least 70% identical over the total length with respect to a polynucleotide encoding the cDNA sequence of human and the complementary polynucleotides thereof (human sequence) in Nu cl ei c A ci ds R es ea rch 18 4283, 1990 and the polynucleotides that are complementary to such polynucleotides. Alternatively, polynucleotides comprising a region that is at least 80% identical over the total length with respect to a polynucleotide encoding a polypeptide of the present invention are more preferred. In this regard, at least 90% identical polynucleotides over their total length with respect to it, are particularly preferred, and among these polynucleotides with at least 95% are particularly preferred. In addition, polynucleotides with at least 97% are highly preferred among those with at least 95% and among these those of at least 98% and at least 99% are particularly highly preferred, with at least 99% being more preferred.

Preferred embodiments in this regard, furthermore, are polynucleotides that encode polypeptides that substantially maintain the same biological function or activity as the mature Egr-1 polypeptide encoded by the murine DNA sequence in Ce ll 53 37-43 (1988), more preferably, which is encoded by the human sequence in Nu cl eic Aci ds Res ea rch 18 4283, 1990.

The present invention also relates to polynucleotides that hybridize to the sequences described above. In this regard, the present invention relates especially to polynucleotides that hybridize under severe conditions to the polynucleotides described above > here . As used herein, the term "stringent conditions" means that hybridization will occur if there is at least 95% and preferably at least 97% identity between the sequences. Preferably, the sequences that hybridize in the same manner to the sequence of the invention encode a polypeptide having the biological activity of Egr-1 The polynucleotides could encode a polypeptide that is the mature protein plus additional carboxy terminal amino acids or amino acids. Such additional sequences could play a role for example, they could lengthen or shorten the half-life of the protein or they could facilitate the manipulation of a protein for testing or production, among other things. As is generally the case in vi, the additional amino acids could be processed away from the mature protein by cellular enzymes.

Polynucleotides for use in the gene therapy aspect of the invention could be provided alone or as part of a vector, such as an expression vector, examples of which are well known in the art.

A polynucleotide encoding Egr-1 could be used therapeutically in the method of the invention as a gene therapy, in which the polynucleotide is administered to an injured site or to other tissues in need of healing, in a form in which it is capable of to direct the production of Egr-1, or a biologically active fragment thereof, in situ. It is believed that Egr-1 acts to promote wound healing by the activation of genes involved in wound healing, such as the genes for VEGF, PDGF, EGF, TGF beta, basic fibroblast growth factor, UPA and the tissue factor.

Preferably in gene therapy, the polynucleotide is administered so that it is expressed in the subject to be treated, for example in the form of a recombinant DNA molecule comprising a polynucleotide encoding Egr-1 operably linked to the nucleic acid sequence which controls the expression, such as in an expression vector. In this way, such a vector will include appropriate transcriptional control signals that include a promoter region capable of expressing the coding sequence, the promoter is operable in the subject to be treated. Thus, for human gene therapy, the promoter, this term includes not only the sequence necessary to direct the RNA polymerase to the transcriptional start site, but also, if appropriate, other sequences of operation or control that include enhancers. , is preferably a human promoter sequence of a human gene, or a gene that is typically expressed in humans, such as the human cytomegalovirus (CMV) promoter. Among the known eukaryotic promoters suitable in this regard are the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the retroviral LTR promoters, such as those of the Rous sarcoma virus ("RSV"). ) and the promoters of methotle-ionein, such as the mouse ionein-I metalot promoter.

As discussed in greater detail below, the native Egr-1 promoter could be used. The present inventors have found that the published sequence provided for the human Egr-1 promoter is not correct, and a new sequence with several differences of the published sequence has been provided.

A polynucleotide sequence and the transcriptional control sequence could be provided cloned into a replicable plasmid vector, based on commercially available plasmids, such as pBR322, or they could be constructed from the available plasmids by the routine application of well-known published methods.

The vector could also include the transcriptional control signals, located at 31 with respect to the Egr-1 coding sequence, and also the polyadenylation signals, recognizable in the subject to be treated, such as, for example, the corresponding sequences of viruses, such as, for treatment in humans, the SV40 virus. Other transcriptional control sequences that are well known in the art could be used.

The expression vectors could also include selected markers, such as for antibiotic resistance, which allow the vectors to propagate.

Expression vectors capable of synthesizing i n s i t u Egr-1, could be introduced into the injured site directly by physical methods. Examples of these include the topical application of the 'naked' nucleic acid vector in an appropriate vehicle, for example in solution in a pharmaceutically acceptable excipient, such as phosphate buffered saline (PBS) or the administration of the vector by physical methods, such as like particle bombardment, also known as 'gene bombardment' technology such as gold beads coated with the vector are accelerated at enough velocities to allow them to penetrate the surface into the wounded site eg skin cells, by discharge under high pressure of a projection device. (Particles coated with a nucleic acid molecule of the present invention are within the scope of the present invention, as are the devices comprising such particles).

Other physical methods for the delivery of DNA directly to the recipient include ultrasound, electrical stimulation, electroporation and microsembration.

Particularly preferred is the microsembration release form which is a system for the delivery of the genetic material in cells i n s i t u in a patient. This method is described in U.S. Pat. No. 5, 697, 901.

The nucleic acid sequence encoding Egr-1 for use in the therapy of the invention, could also be administered by the means of delivery vectors. These include viral delivery vectors, such as adenovirus and retroviral release vectors known in the art.

Other non-viral delivery vectors include lipid delivery vectors, including liposome delivery vehicles, known in the art.

A nucleic acid sequence encoding Egr-1 could also be administered to the injured site via the transformed host cells. Such cells include the cells harvested from the subject, in which the nucleic acid sequence is introduced by genetic transfer methods known in the art, followed by the growth of the transformed cells in the culture and grafting to the subject.

Expression constructions, such as those described above, could be used in a variety of ways in the therapy of the present invention. In this way, they could be administered directly to the injured site in the subject, or they could be used to prepare the recombinant transcription factor Egr-1 itself, which can then be administered to the injured site as discussed in more detail below. The invention also relates to host cells that are genetically engineered with constructs comprising the Egr-1 polynucleotide or polynucleotides of the present invention, or genetic elements defined above, and to the uses of these vectors and cells in the therapeutic methods of the invention . These constructs could be used per se in the therapeutic methods of the invention or could be used to prepare an Egr-1 polypeptide for use in the therapeutic methods of the invention described in greater detail below.

The vector, for example, could be a plasmid vector, a single or double-stranded phage vector, a single or double stranded RNA or DNA viral vector, depending on whether the vector is to be administered directly to the injured site (ie for the in situ synthesis of Egr-1), or to be used for the synthesis of recombinant Egr-1. The initiation plasmids described herein are either commercially available, publicly available, or can be constructed from the plasmids available by the routine application of well-known published methods. Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those skilled in the art.

In general, vectors for expressing an Egr-1 polypeptide for use in the invention comprise cis-acting control regions effective for expression in a host operably linked to the polynucleotide to be expressed. Appropriate trans action factors are supplied by the host, supplied by a vector complementary or supplied by the vector itself at introduction into the host.

In certain embodiments in this regard, the vectors provide the specific expression. For the production of recombinant Egr-1, such specific expression could be of inducible expression or only expression in certain cell types or inducible and cell-specific. Particularly preferred inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives. A variety of vectors suitable in this aspect of the invention, including inducible and constitutive expression vectors for use in prokaryotic and eukaryotic hosts, are well known and routinely employed by those skilled in the art.

A wide variety of expression vectors can be used to express Egr-1 for use in the invention. Such vectors include, among others, chromosomal, episomal and virus-derived vectors, eg, vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from chromosomal elements of yeast, from viruses such as baculovirus, papovavirus virus, such as SV40, vaccinia virus, adenovirus, poultry poxvirus, pseudorabies virus and vectors derived from combinations thereof, such as those derived from the plasmid and bacteriophage genetic elements, such as cosmids and phagemids, all could be used for expression in accordance with this aspect of the present invention. In general, any vector suitable for maintaining, propagating or expressing the polynucleotides to express a polypeptide in a host could be used for expression in this regard.

The appropriate DNA sequence could be inserted into the vector by any of a variety of routine and well-known techniques, such as, for example, those set forth in Sambrook et al. , MOLECULAR CLONING, A LABORATORY MANUAL 2nd Ed .; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).

The nucleic acid sequence in the expression vector is operably linked to the appropriate expression control sequence, which includes, for example, a promoter to direct transcription of mRNA. Representative promoters include, but are not limited to, the PL promoter of lambda phage, the lac, trp and tac promoters of E. coli, for recombinant expression, and the SV40 early and late promoters of retroviral LTRs for the expression i n s i t u.

In general, the expression constructs will contain sites for the initiation and termination of transcription, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will include an AUG of translation initiation at the beginning and a terminator codon appropriately positioned at the end of the polypeptide to be translated.

In addition, the constructions could contain the control regions that they regulate, as well as the generated expression. In general, according to many commonly practiced procedures, such regions will operate by controlling transcription, such as transcription factors, repressor binding sites and termination, among others.

Vectors for propagation and expression, in general, will include selectable markers and regions of amplification, such as, for example, those set forth in Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL 2nd Ed .; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).

Representative examples of appropriate hosts for the recombinant expression of Egr-1 include bacterial cells, such as streptococci, staphylococci, E. coli, streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sfl9 cells; animal cells, such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells; and plant cells.

The following vectors, which are commercially available, are provided by way of example. Among the preferred vectors for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pl, Hl8A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia, and pBR322 (ATCC 37017). Among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors that can be used for recombinant expression and for insitu expression are listed exclusively by way of illustration of the many commercially available and well-known vectors that are available to those skilled in the art for use in accordance with this aspect of the present invention. invention. It will be appreciated that other suitable plasmids or vectors could be used in this aspect of the invention for, for example, the introduction, maintenance, propagation or expression of a polynucleotide or polypeptide for use in the therapy of the invention in a host that could be used in this aspect of the invention.

Examples of vectors for use in this aspect of the invention include expression vectors in which the Egr-1 cDNA sequence is inserted into a plasmid, whereby gene expression is activated from the immediate early cytomegalovirus enhancer promoter. of human (Foecking and Hofstetter, Ce ll, 45, 101-105, 1986). Such expression plasmids could contain the SV40 RNA processing signals, such as the polyadenylation and termination signals. Expression constructs that use the CMV promoter and are commercially available are pCDM8, pcDNAl and derivatives, pcDNA3 and derivatives (Invitrogen). Other available expression vectors that could be used are pSVK3 and pSVL containing the SV40 promoter and the mRNA cutting site and the SV40 polyadenylation signals (pSVK3) and the SV40 VPl processing signals (pSVL; Pharmacia vectors).

Promoter regions can be selected from any desired gene using vectors containing a reporter transcription unit that lacks a promoter region, such as a transcription unit of chloramphenicol acetyl transferase ("CAT"), downstream of the site or restriction sites to introduce a fragment of the candidate promoter; i.e., a fragment that could contain a promoter. As is well known, the introduction into the vector of a fragment containing the promoter at the restriction site upstream of the generated production of the CAT gene of CAT activity, which can be detected by standard CAT tests. Vectors suitable for this purpose are well known and readily available, such as pKK232-8 and pCM7. Promoters for the expression of polynucleotides for use in the therapy of the present invention include not only well-known and readily available promoters, but also promoters that could be readily obtained by the prior art, using a reporter gene; for the expression i n s i t u, such a promoter should desirably be recognized in the subject to be treated.

Among the known prokaryotic promoters suitable for the expression of polynucleotides and polypeptides according to the therapy of the present invention are the lacl and LacZ promoters of E. coli, the T3 and T7 promoters, the gpt promoter, the PR promoters, PL lambda and the trp promoter.

Recombinant expression vectors will include, for example, origins of replication, a promoter derived preferably from a gene highly expressed to direct the transcription of a downstream structural sequence and a selectable marker to allow isolation of the cells containing the vector after the exposure to the vector.

The polynucleotides for use in the therapy of the invention, which encode the heterologous structural sequence of a polypeptide of the invention, in general, will be introduced into the vector using standard techniques, so that it is operably linked to the promoter for expression. . The polynucleotide will be positioned so that the transcription initiation site is located appropriately 5 'to a ribosome binding site. The ribosome binding site will be 5 'to the AUG that initiates the translation of the polypeptide to be expressed.

In general, there will be no other open reading frames that start with an initiation codon, usually AUG, and fall within the ribosome binding site and the initiation codon. Also, there will be a translation stop codon at the end of the polypeptide and there will be a polyadenylation signal in the constructs for use in eukaryotic hosts. The transcription termination signal appropriately disposed at the 3 'end of the transcribed region could also be included in the construction of the polynucleotide.

For the secretion of the translated protein in the lumen of the endoplasmic reticulum, in the periplasmic space or in the extracellular environment, appropriate secretion signals could be incorporated into the expressed polypeptide when recombinantly synthesized. These signals could be endogenous with respect to the polypeptide or they could be heterologous signals.

The polypeptide could be expressed in a modified form, such as a fusion protein, and could include not only the secretion signals, but also the additional heterologous functional regions. Thus, for example, a region of additional amino acids, particularly charged amino acids, could be added to the N or C terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during handling and subsequent storage. Also, the region could be added to the polypeptide to facilitate purification. Such regions could be removed before the final preparation of the polypeptide. The addition of the peptide radicals to the polypeptides to engender the secretion or excretion, to improve the stability or to facilitate the purification, among others, are familiar and routine techniques in the art. A preferred fusion protein comprises a heterologous immunoglobulin region that is useful for solubilizing or purifying polypeptides. The cells are then typically harvested by centrifugation, cut by physical or chemical means and the resulting crude product extract remains for further purification.

The microbial cells employed in the expression of proteins can be cut by any convenient method, including freeze-thaw side cyclization, sonication, mechanical cutting or the use of cell lysate agents, such methods are well known to those skilled in the art.

Mammalian expression vectors could comprise an origin of replication, a promoter and an appropriate enhancer, and also any necessary ribosome binding site, polyadenylation regions, donor and acceptor cleavage sites, transcriptional terminography sequences and sequences of flanking not transcribed 5 'that are necessary for expression.

To prepare Egr-1 polypeptides for use in the invention, host cells designed generically could be used. The introduction of a polynucleotide into the host cell can be affected by calcium phosphate transfection, DEAE-dextran-mediated transfection, transvection, micro-injection, lipid-mediated cationic transfection, electroporation, transduction, scraping charge, ballistic introduction, infection or other methods. Such methods are described in many laboratory manuals, such as Davis et al. , BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook et al. , MOLECULAR CLONING, A LABORATORY MANUAL 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).

Mature proteins can be expressed in host cells including mammalian cells, such as CHO cells, yeast, bacteria or other cells under the control of appropriate promoters. Cell-free translation systems can also be used to produce such proteins that use RNAs derived from the DNA constructs of the present invention. Suitable cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al. , MOLECULAR CLONING, A LABORATORY MANUAL 2nd Ed .; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).

The polypeptide can be recovered and purified from the recombinant cell cultures by well-known methods including ammonium sulfate precipitation and ethanol, acid extraction, anionic or cation exchange chromatography, phosphorylated phosphorylation chromatography, hydrophobic interaction chromatography, affinity chromatography , hydroxylapatite chromatography and lectin chromatography. More preferably, high performance liquid chromatography is used for purification. Well-known techniques for re-folding the protein could be employed to regenerate the active conformation when the polypeptide is denatured during isolation and / or purification.

For therapy, a polynucleotide encoding Egr-1 e.g., in the form of a recombinant vector, could be purified by techniques known in the art, such as by means of column chromatography as described in Sambrook et al. , MOLECULAR CLONING, A LABORATORY MANUAL 2nd Ed .; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).

As indicated above, Egr-1 could be administered to the wound site either as a nucleic acid encoding Egr-1 that is transcribed to Egr-1 at the site of the wound itself in a form of gene therapy, or the The same transcription factor could be administered directly.

Thus, according to a fifth aspect of the invention, there is provided the use of a polypeptide of the 'Erg-1 transcription factor or a biologically active fragment thereof in the manufacture of a medicament for the treatment of wounds in a mammal, including the human.

According to a sixth aspect of the invention, there is provided a method for the treatment of wounds in a mammal, including the human, which comprises administering to the mammal a therapeutically effective amount of a polypeptide of the transcription factor of Egr-1 or a biologically active fragment thereof.

In a seventh aspect, the invention provides the use of a transcription factor of Egr-1 or a biologically active fragment thereof for use in the treatment of wounds and in wound healing.

In an eighth aspect, the invention provides a pharmaceutical composition comprising the transcription factor of Egr-1 or a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers thereof.

As used herein, the term "polypeptide of the Egr-1 transcription factor" includes the naturally-occurring and recombinantly produced Egr-1 transcription factor, the analogs, variants or derivatives of natural, synthetic and biologically active polypeptides thereof or the biologically active fragments thereof and the variants, derivatives and analogues of these fragments.

The Egr-1 transcription factor protein products that include biologically active fragments of the transcription factor of Egr-1 could be generated and / or isolated by the general techniques known in the art.

Egr-1 and the above-mentioned fragments and derivatives thereof for use in the therapy of the invention, could be extracted from natural sources by methods known in the art. Such methods include purification by means of affinity chromatography of sequence-specific DNA using methods, such as those described in Briggs et al.

Science 234, 47-52, 1986, using a DNA-binding oligonucleotide that recognizes Egr-1. The polypeptide could also be prepared by the methods of recombinant DNA technology known in the art as described above, i.e. by expression in the host cells of the constructions described. Alternatively, the polypeptides of the invention can be produced synthetically by conventional peptide synthesizers.

The invention also relates to the uses of Egr-1 fragments, analogs and derivatives. The terms "fragment", "derivative" and "analogue" mean a polypeptide that maintains essentially the same function or biological activity as such a polypeptide. In this manner, the analog includes a pro-protein that can be activated by cutting the pro-protein portion to produce a mature active polypeptide.

The fragment, derivative or analogue of the polypeptide could be (i) one in which one or more of the amino acid residues is substituted with a conserved or non-conserved amino acid residue (preferably, a conserved amino acid residue) and such an amino acid residue substituted may or may not be encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused to another compound, such as a compound for increasing the half-life of the polypeptide (eg, polyethylene glycol) or (iv) one in which additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence used for purification of the mature polypeptide or a pro-protein sequence. Such fragments, derivatives and the like are considered to be within the scope of those skilled in the art of teaching here.

Among the preferred variants are those that vary from Egr-1 which occurs naturally by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide for another amino acid of similar characteristics. Typically, replacements, one for another, between the aliphatic amino acids Ala, Val, Leu e lie, are observed as conservative substitutions; the exchange of the hydroxyl residues Ser and Thr, the exchange of the acid residues Asp and Glu, the substitution between the amide residues Asn and Gln, the exchange of the basic residues Lys and Arg and the replacements between the aromatic residues Phe, Tyr .

In addition, variants, analogs, derivatives and fragments and variants, analogs and derivatives of the fragments, which have the amino acid sequence of the polypeptide in which, several, a few, 5 to 10, 1 to 5, 1 to 3, 2, what without amino acid residues, are replaced, eliminated or added in any combination. Especially preferred among these are gentle substitutions, additions or deletions, which do not alter the properties and activities of the polypeptide of the present invention. Also, conservative substitutions are especially preferred in this aspect.

Particularly preferred fragments are biologically active fragments i.e. fragments that maintain the healing properties of the mother polypeptide wound.

The polypeptides and polynucleotides useful in the present invention are preferably provided in an isolated form, and are preferably purified to homogeneity.

The Egr-1 polypeptides for use in the present invention include the Egr-1 polypeptide as well as the polypeptides having at least 70% identity, preferably at least 80% identity and more preferably at least 90% more identity and yet more preferably at least 95% similarity (even more preferably at least 99% identity) with respect to the murine polypeptide sequence, as set forth in Cel l 53 37-43 (1988) and with respect to the polypeptides encoded by the human sequence, and also include portions of such polypeptides with such a portion of the polypeptide, which generally contains at least 30 amino acids and more preferably at least 50 amino acids.

Fragments or portions of the polypeptides useful in the therapy of the present invention, could be employed to produce the corresponding total length polypeptide by peptide synthesis; therefore, the fragments could be used as intermediates to produce the full-length polypeptides. The fragments or portions of the polynucleotides useful in the present invention could be used to synthesize the full length polynucleotides useful in the present invention.

The invention also relates to the use of fragments of an Egr-1 polypeptide defined above and the fragments and variants and derivatives thereof.

In this aspect, a fragment is a polypeptide having an amino acid sequence that is completely the same as a part, but not the entire amino acid sequence of the Egr-1 polypeptides and variants and derivatives thereof.

Such fragments could be "non-permanent", i.e., not part of or fused to other amino acids or polypeptides or they could be comprised within a higher polypeptide of which they form a part or region. As far as they are comprised within a higher polypeptide, the fragments discussed today more preferably form a single continuous region. However, several fragments could be comprised within a single higher polypeptide. For example, certain preferred embodiments refer to a fragment of a polypeptide of the present invention comprised within a precursor polypeptide designed for expression in a host and having heterologous pre and pro-peptidic regions fused to the amino terminus of the fragment and, an additional region fused to the carboxyl terminus of the fragment. Therefore, the fragments in one aspect of the meaning intended herein, refer to the portion or portions of a fusion polypeptide or fusion protein derived from a polypeptide of the present invention.

Fragments characterized by structural or functional attributes of the polypeptide useful in the therapy of the present invention are also preferred in this aspect of the invention. Preferred embodiments of the invention in this regard include the fragments comprising the alpha helix and the alpha helix formation regions, beta sheet and beta sheet formation regions, spinning and spinning, rolling regions and forming regions. rolling, hydrophilic regions, hydrophobic regions, alpha antipatic regions, beta antipatic regions, flexible regions, surface formation regions, substrate binding region and high antigenic index regions of the polypeptide of the present invention, and combinations of such fragments.

Preferred regions are those that regulate the activities of the polypeptide of the present invention. In this regard, fragments having a chemical, biological or other activity of the polypeptide of the present invention, including those with similar activity or an improved activity or with a decreased undesirable activity, are more preferred. In addition, additional preferred polypeptide fragments are what comprise or contain antigenic or immunogenic determinants in an animal, especially in a human.

It will be appreciated that the invention also relates to, inter alia, polynucleotides that encode the above-mentioned fragments, the polynucleotides hybridize to the polynucleotides encoding the fragments, particularly those that hybridize under moderate conditions and the polynucleotides, such as PCR primers, to amplify the polynucleotides encoding the fragments. In this regard, the preferred polynucleotides are those corresponding to the preferred fragments as discussed above.

Additional embodiments of this aspect of the invention include the variants, analogs or derivatives thereof or fragments thereof that are biological, prophylactic, clinically or therapeutically useful, including fragments of the variants, analogs and derivatives and compositions comprising the same. . Variants, analogs or biologically active fragments are included within the scope of the present invention.

The invention also relates to compositions comprising the polynucleotides or polypeptides discussed above. Therefore, the polynucleotides and polypeptides of the present invention could be used in combination with a pharmaceutically acceptable carrier or vehicles.

Such vehicles could include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations of the same.

The polypeptides and polynucleotides that could be employed in the present invention could be alone or in combination with other compounds, such as therapeutic compounds.

The pharmaceutical compositions could be administered in any convenient manner, effective to target the injured sites, including, for example, routes of topical, intravenous, intramuscular, intranasal or intradermal administration among others. In general, the compositions will be applied locally to the wound or associated condition.

In therapy or as a prophylactic, the active agent could be administered to an individual as an injectable composition, for example as a sterile, preferably isotonic, aqueous dispersion.

Alternatively, the composition could be formulated for topical application, for example in the form of ointments, creams, lotions, eye ointments, eye drops, eardrops, mouthwash, impregnated bandages and sutures and aerosols and could contain the conventional additives appropriate, including, for example, preservatives, solvents to aid penetration of the drug and emollients in ointments and creams. Such topical formulations could also contain compatible conventional carriers, for example cream or ointment bases and ethanol or oleyl alcohol for lotions. Such vehicles could constitute from about 1% to about 98% by weight of the formulation, more usually they will constitute up to about 80% by weight of the formulation.

For administration to mammals, and particularly humans, it is expected that the daily dosage level of the active agent will be from 0.01 mg / kg to 10 mg / kg, typically around 1 mg / kg. The doctor in any case will determine the current dosage that will be most appropriate for an individual and will vary with the age, weight and response of the particular individual. The above dosages are exemplary of the average case. Of course, they can be individual cases, where the higher or lower dosage ranges are judged, and such are within the scope of this invention.

As a ninth aspect, there is provided a pharmaceutical composition comprising the transcription factor of Egr-1 or a nucleic acid molecule comprising a sequence encoding Egr-1 together with one or more pharmaceutically acceptable carriers of the same.

The therapeutic advantage for using transcription factors in accelerated wound healing is in the activation of multiple target genes that promote accelerated healing. Egr-1 is naturally activated in response to the wound and the increase in natural response is also an advantage. The treatment is based on DNA and provides a reliable and reproducible release system.

When the Egr-1 polynucleotide is used in the therapeutic method of the invention, the polynucleotide could be used as part of an expression construct e.g. in the form of an expression vector. In such a method, the construction is introduced into the wound site where Egr-1 is produced i n s i t u. The constructs used could be standard vectors and / or gene delivery systems, such as liposomes, receptor-mediated delivery systems and viral vectors.

The present invention is suitable for all aspects of wound healing including leg ulcers in diabetes and peripheral arterial occlusive disease, post-operative scarring, burns and psoriasis.

As described above, the Egr-1 polypeptides or nucleic acids of the present invention could be administered locally to the site of the damaged tissue by any convenient method e.g. by topical administration. One method of releasing the nucleic acid products is to use the technology of bombardment of genes, wherein the nucleic acid molecule isolated from Egr-1 e.g. in the form of cDNA or in an expression vector it is immobilized in gold particles and bombarded directly at the site of the wound. Thus, as a preferred aspect of the present invention, there is provided the use of a nucleic acid molecule comprising a sequence encoding Egr-1 in a gene for the treatment of wounds. In addition, an appropriate composition is provided for gene bombardment therapy comprising a transcription factor of Egr-1 encoding the sequence and gold particles.

However, the preferred release of the nucleic acid or polypeptide of the invention is by microsembration as described in US 5,697,901.

As mentioned previously, the polynucleotide comprising a sequence encoding Egr-1 or a biologically active fragment thereof, could be under the control of at least a portion of a native Egr-1 promoter, preferably the Egr-1 promoter. of human.

The murine Egr-1 promoter has been isolated and sequenced (Morris, Nu cl and i c Aci d Re s ea rch, 16: 8835-3346). Potential regulatory sequences include an AAATA element (a similar 'TATA' homology) at position -26 to -22; a CCAAT box in positions - 337 to -333; five elements of serum response (SREs) in positions -110 to -91, -342 to -324, -358 to -339, -374 to -355 and -412 to -393; two Api sites in positions -610 to -603 and -867 to -860; four Spl sites at positions -285 to -280, -649 to -644, -700 to -695 and -719 to -714; and two cAMP response elements at positions -138 to -131 and -631 to -624. Egr-1 has been shown to bind to the murine Egr-1 promoter and sub regulates transcription in its own expression. The sequence of this promoter is provided in Figure 9 of the accompanying drawings.

Less is understood about the regulation of the human Egr-1 promoter. An intended human Egr-1 sequence has been provided. The 695 nucleotides of the upstream sequence have been identified relative to the start site of mRNA in +1. This upstream sequence comprises an AAATA element (a similar 'TATA' homology) at position -26 to -22 and numerous potential regulatory elements that include two Spl sites at positions -505 to -499 and -647 to -642; two cyclic AMP response elements at positions -134 to -127 and -630 to -623, five serum response elements (SREs) at positions -108 to -89, -344 to -326, -359 to -340 , -376 to -357 and -410 to -394; an Egr-1 binding site (EBS) at position -597 to -589 and a response element of tet ra-decanoyl phorbol acetate (TPA) (binding site Api) at position -609 to -602. It is known that the TPA binding site is functional as TPA stimulates the expression of a plasmid expressing the chloramphenicol acetyl transferase gene. SREs 3 and 4 have been shown to regulate the response of the Egr-1 promoter to the shear stress and can confer the shear stress response on the SV40 promoter. The elimination of EBS from the human promoter element leads to an increase in the shear stress response of this promoter, arguing a role of Egr-1 in the sub-regulation activity of the human promoter.

The present inventors have found that the published sequence that provides the human Egr-1 promoter is not correct and have provided a new sequence with several differences of the published sequence. These sequence differences could not have been predicted in advance and at least some of these are considered to be functionally significant. In addition, the present inventors have provided a complete sequence, whereas the reported human Egr-1 promoter sequence includes several spaces.

In this manner, the nucleic acid molecule comprising a sequence encoding Egr-1 or a biologically active fragment thereof could be operably linked to a nucleic acid sequence which: a) has a strand comprising the sequence provided in Figure 7 for SEC GW; or b) has a strand comprising one or more deletions, insertions and / or substitutions relative to SEC GW, but which does not comprise the sequence shown in Figure 7 as SEC ON and which also does not comprise the sequence shown in Figure 9 According to a tenth aspect of the present invention, there is provided a nucleic acid molecule which: a) has a strand comprising the sequence provided in Figure 7 for SEC GW; b) has a strand comprising one or more deletions, insertions and / or substitutions relative to the SEC GW, but which does not comprise the sequence shown in FIG 7 as the SEC ON and which also does not comprise the sequence shown in Figure 9; or c) has a strand that hybridizes with a strand as described in a) or b) above.

The molecules within the scope of a), b) or c) above will now be described in more detail: a) A nucleic acid molecule having the sequence provided in Figure 7 for the SEC GW It can be seen that the SEC GW shown in Figure 7 has several regions of frames. It is believed that these are functionally significant. Without being related by theory, the intended functions and the various regions of tables shown in Figure 7 are described below: Spl (two regions) Spl represents a sequence to link the transcription factor Spl and the homologs. cAMP RE (two regions) cAMP RE represents a sequence for the binding of the transcription factor ATF and the homologs. This is induced by cAMP and the sequence is therefore referred to as a cAMP response element.

TPA RE TPA RE represents a sequence for the binding of the transcription factor API and the homologs. This is induced, for example, by the phorbol ester TPA and the sequence is therefore referred to as a TPA response element.

EBS EBS represents a sequence for the binding of the transcription factor Egr-1 and the homologs.

SRE (SRE5, SRE4, SRE3, SRE2, SRE1) SRE represents a sequence that provides the serum response (i.e. a serum response element). Together with the serum response elements of the associated Ets binding sites (specific transformation E26) such as SRF, Elk-1 and / or F-ACT1, as well as homologs thereof.

TATA The TATA box is believed to be required for the assembly of the transcription complex, which comprises many transcription factors required for the initiation of transcription. It is not necessary to include the exact sequence "TATA", since this is a consensus sequence, and a certain degree of variation may occur.

SEC GW has several sequence differences in relation to the published human Egr-1 sequence (designated here as the "SEC ON"). The differences will now be discussed with respect to an alignment of the SEC GW and SEC ON sequences shown in Figure 7.

As can be seen from Figure 7, SEC GW has five nucleotides that are loaded with the specific nucleotides provided in the corresponding positions for SEC ON. These can be considered as substitutions relative to SEC ON. Two of these are present in the regions that are in boxes. These two substitutions are the replacement of a G with a T and the substitution of a G with C. They are present in the first cAMP RE table and in the SRE3 table respectively.

SEC GW also has several additional nucleotides related to SEC ON (i.e. nucleotides that are not specifically identified in SEC ON). These can be considered as insertions in relation to SEC ON. Four of these are present in the SRE5 chart. (Three of these are insertions of an A and one is an insertion of a C).

¡¡¡¡Jg &g The SEC GW has an elimination in relation to the SEC ON. It is the elimination of a G. This is not a region in the box. It is located between the second Spl box and the SRE5 box.

Molecules within the scope of a) above, of course have additional upstream and / or downstream sequences relative to SEC GW. For example, one or more regions involved in the transcription / translation or in the regulation thereof could be provided. A coding region could also be provided (preferably encoding Egr-1 or a biologically active fragment thereof). The additional regions are discussed in greater detail later. b) A nucleic acid molecule having a strand comprising one or more deletions, insertions v / or substitutions relative to SEC GW, but which does not comprise the sequence shown in Figure 7 as SEC ON and which also does not comprise sequence shown in Figure 9.

Changes in the nucleotide sequence can be made in relation to a molecule comprising SEC GW to provide other molecules that are still useful.

Such changes are within the scope of the present invention. These include allelic and non-allelic variants.

Preferred variants within the scope of b) above will usually comprise one or more regulatory regions having a function corresponding to the function of one or more regions of the tables shown for SEC GW (even if such function is over or under-regulated with relationship to one or more regions of tables shown in SEC GW). More preferably, such molecules will have one or more regions having the same sequences as one or more of the regions of squares shown in SEC GW.

Desirably, variants within the scope of b) above will have substantial sequence identity with all or part of the SEC GW over the length of the SEC GW or part thereof.

If a variant has one or more regions corresponding to one or more of the regions of tables shown in Figure 7 for the SEC GW, it is preferred that there are no differences in relation to the regions of tables or only a few such differences ( eg, in general, it could be preferred to have a maximum of only 1, 2 or 3 differences with respect to a given frame region). There could be more changes to the sequences outside the regions of frames. In this way, the variants could have relatively low degrees of sequence identity with the corresponding part of the SEC GW, with respect to the regions that are not in the table in Figure 7. Instead, some variants could not have one or more regions corresponding to one or more regions outside the regions of the tables with respect to SEC GW.

Preferred nucleic acid molecules, the tenth aspect of the present invention, will include one or more regulatory regions capable of altering the level of Egr-1 transcription in mammals (more preferably in humans) in response to the viral conditions. In this way, such nucleic acid molecules could be administered to mammals to provide Egr-1, in a manner that allows their expression to be regulated at the level of transcription (therefore, these nucleic acid molecules, in general, will include a region which encodes a substance that has Egr-1 activity).

One or more serum response elements (SREs) could be present. Desirably, one or more of these will share cutting effort response elements (SSREs). These are regions that confer response of the shear stress on transcription.

A plurality of SSREs could cooperate to facilitate the response of the shear stress. Desirably, these could be associated with / include one or more Ets sites. However, in some cases, it is possible that only one SSRE needs to be present (preferably together with an Ets site) to provide a degree of shear response.

A preferred SSRE is indicated in Figure 7 as SRE5 for "SEC GW". The present inventors have shown that this is functional, while the sequence SRE5 shown with respect to SEC ON is not functional. SRE5 itself, as well as the SRE5 variants capable of providing shear stress response are within the scope of the present invention.

Such variants preferably include at least one of the nucleotide differences present in SRE5 of SEC GW in relation to SRE5 of SEC ON.

Other preferred SSREs are SRE3 and SRE4 as shown in Figure 7 for the SEC GW, as well as variants thereof capable of providing the shear stress response.

More preferably, SRE3, SRE4 and SRE5 (or variants thereof capable of providing the shear stress response) are present.

Regardless of whether or not SREs are present, a nucleic acid molecule of the tenth aspect of the present invention will desirably include a TATA box (which will not necessarily include the "TATA" consensus sequence). It will also usually include a TATA chart (which will not necessarily include the consensus sequence "CCAAT").

Usually at least one, and preferably two, linking regions Spl, will be present. The binding regions Spl could be one or both of the Spl binding sequences shown in Figure 7 for the SEC GW A cAMP response region could be present. Such preferred regions comprise the sequences shown in Figure 7 having the designation cAMP RE with respect to SEC G. More preferred is the first cAMP RE shown in Figure 7 for SEC GW. These may allow the regulation of transcription by cAMP.

An Egr-1 (EBS) binding site could be present. This is believed to have an important role in transcription of down-regulation of Egr-1 once the levels of Egr-1 exceed a certain threshold. In this way, Egr-1 can limit its own expression after the stimulation of the shear stress. An EBS in general will be included if you wish to limit Egr-1 levels in this way. EBS could have the sequence shown in Figure 7 for SEC GW as EBS. The nucleotide changes can be made for a given EBS to provide the variants thereof. For example, variants can be provided with reduced affinity for Egr-1 relative to the EBS shown in Figure 7 for SEC GW. One such variant is the EBS shown in FIG. 8. In some & .

In some cases, a functional EBS could not be present and therefore, the regulation by Egr-1 can be completely abolished (e.g. a complete elimination of an EBS could be done). Nucleotide changes could also be made with respect to an EBS to provide increased affinity for Egr-1. This is useful if one wishes to have increased self-regulation of Egr-1 expression. c) A nucleic acid molecule having a strand that hybridizes to a strand as described in a) or b) above Nucleic acid molecules that can hybridize to one or more nucleic acid molecules discussed above are also covered by the tenth aspect of the present invention. Such nucleic acid molecules are referred to herein as "hybridized" nucleic acid molecules. Desirably, the hybridized molecules of the present invention are at least 10 nucleotides in length and preferably are at least 25, at least 50, at least 100, or at least 200 nucleotides in length.

A hybridized nucleic acid molecule of the present invention could have a high degree of sequence identity along its length with a nucleic acid molecule complementary to a nucleic acid within the scope of a) or b) above (eg at least 50%, at least 75%, at least 95% or at least 98% identity), although this is not essential. The greater degree of sequence identity that a given single-stranded nucleic acid molecule has with another single-stranded nucleic acid molecule, the greater the probability of hybridizing to a single-stranded nucleic acid molecule that is complementary to the other molecule of single-stranded nucleic acid under the appropriate conditions.

Preferred hybridized molecules hybridize under moderate to high severity conditions. Hybridization conditions are discussed in detail at pp.1101-1.110 and 11.45-11.61 by Sambrook et al. (Mol e cu l a r cl on i n g, 2nd Edition, Cold Spring Harbor Laboratory Press (1989)). An example of the hybridization conditions that can be used involves using a 5 X SSC pre-wash solution, 0.5% SDS, 1.0 mM EDTA (pH 8.0) and attempting overnight hybridization at 55 ° C using 5 X SSC. However, there are many other possibilities. Some of these are listed in Table 1 of W098 / 45435, for example (see especially the conditions set under A-F of such a table and, less preferably, are listed under G to L or M to R).

Another method is to determine the Tm for a given perfect duplicate (ie without mismatch) of a certain length under given conditions and then perform the attempted hybridization with a single strand of the duplicate under these conditions, but at a sufficiently lower temperature of Tm to allow the formation of a range of stable hybrids at an acceptable rate, while a reasonable degree of hybridization specificity is still required. The Tm for such a duplicate can be determined empirically by providing the duplicate and gradually increasing the temperature until the Tm is achieved. The Tm can also be estimated e.g. using: Tm = 81.5 + 16.6 (log10 [Na +]) + 0.41 (fraction G + C) - (600 / N), where N is the length of the chain (this formula is reasonably accurate for Na + concentrations of 1M or less and for polynucleotide lengths of 14 to 70, but is less accurate when these parameters are satisfied). For nucleic acid molecules larger than 200 nucleotides in length, for example, the hybridization could be carried out at 15 to 25 ° C below the Tm of a perfect hybrid (i.e. without mismatch) under the given conditions. However, as the length decreases, the Tm is decreased, so that it is sometimes inconvenient to carry out the hybridization at Tm -25 ° C. Hybridization with shorter nucleic acid molecules, therefore, is often carried out only 5 to 10 ° C below the Tm. Moderate or high stringency conditions will usually only allow a small proportion of mismatches. As a finger rule, for every 1% of mismatches, there is a reduction of Tm by 1-1.5 ° C. Preferably, the hybridization conditions are chosen to allow less than 25% mismatches, more preferably to allow less than 10% or less than 5% mismatch. Hybridization can be followed by washes of increased astringency. In this way, the initial washings could be under conditions of low astringency, but these can be followed with high stringent washes, until the astringency of the conditions under which the hybridization takes place.

The above discussion of hybridization conditions is provided for general guidance, but is not intended to be limiting. This is because one skilled in the art will be able to vary the parameters as appropriate to provide the appropriate hybridization conditions, and such variables as the length of the polynucleotide, the basic composition, the nature of the duplicate (ie DNA) can be taken into account. / DNA, RNA / RNA or DNA / RNA), the type of ion present, etc.

More preferably, the hybridized nucleic acid molecules of the tenth aspect of the present invention hybridize to a DNA molecule having the sequence shown in Figures 7 for the SEC GW or for one or more of the regions in the table shown in Figure 7. .

Hybridized nucleic acid molecules can be useful as for example probes or primers.

The probes can be used to purify and / or identify the nucleic acids. They could also be used in the diagnosis. For example, the probes could be used to determine whether or not an individual has defects in their genome that could affect the transcription of Egr-1 or the regulation of such transcription. Such defects could make the individual prone to various conditions that could be treated using the treatments of the present invention. For example, wound healing could be imparted by mutations in one or more of the SREs. Such mutations could be identified using probes that hybridize with a greater degree of specificity to one or more SREs mapped for SEC GW than for the corresponding mutant SREs (or vice versa).

Desirably, the hybridization molecules of the tenth aspect of the present invention hybridize more finely to a DNA molecule having the sequence shown in Figure 7 for the SEC GW or to one or more of the regions of the same chart than to a DNA molecule having the sequence shown in Figure 7 for the SEC ON, or to one or more of the regions of the same table. For example, hybridized molecules can be designed with a high degree of specificity for one or more of the SREs, SRE5 and cAMP regions for the SEC GW in Figure 7 (all these regions have sequence differences of the corresponding regions of the SEC ON).

Hybridized nucleic acid molecules within the scope of the tenth aspect of the present invention include primers. The primers are useful in the amplification of nucleic acids or parts thereof, e.g. by PCR techniques.

In addition to being useful as probes or primers, the hybridized nucleic acid molecules of the tenth aspect of the present invention can be used as antisense molecules to alter expression. This technique can be used in antisense therapy. Antisense molecules can be used, for example, to block or reduce the expression of Egr-1 by preventing or reducing the level of transcription. Alternatively, they could be used to prevent or reduce the regulation of Egr-1 transcription by a given regulator by binding to a region to which the regulator would normally bind.

It is important to note that nucleic acid molecules for use in the present invention include not only classical DNA or RNA structures, but also variants with modified structures (non-phosphodiester), e.g. morpholino derivatives and peptide nucleic acids (PNAs), which contain a structure of pseudopeptide based on N- (2-aminoethyl) glycine (see Nielsen, PE, Annual. Rev. of Bi ophyssi cs &Bi omol ecu ar S tru ct ure, 24 167-83 (1995)). Nucleic acid variants with modified structures can have increased stability relative to unmodified nucleic acids and are particularly useful when high period hybridization (e.g., in antisense therapy) is desired.

From the above discussion, it will be appreciated that a large number of nucleic acids are within the scope of the tenth aspect of the present invention. Unless the context indicates otherwise, the nucleic acid molecules of the tenth aspect of the present invention, therefore, could have one or more of the following characteristics: 1) They could be in the form of DNA or RNA (including the variants of naturally occurring DNA or RNA structures, which have bases that do not occur naturally and / or structures that do not occur naturally). 2) They could be single-stranded or double-stranded (a given thread and its complement are included, whether or not they are associated). 3) They could be provided recombinantly i.e. linked covalently to a heterologous 5 * and / or 3 'side sequence, to provide a chimeric molecule (e.g., a vector) that does not occur naturally. 4) They could be provided without 5 'and / or 3"side sequences which normally occur naturally.

) They could be provided in a substantially pure form (e.g., in isolation). This can be done for example using probes to isolate cloned molecules having a desired target sequence or using chemical synthesis techniques. In this way, the nucleic acids could be provided in a way that is substantially free of contamination of proteins and / or other nucleic acids. 6) They could be provided with introns (e.g., as a full-length gene) or without introns.

Various uses of the tenth aspect of the present invention will now be discussed in more detail.

Nucleic acid molecules of the tenth aspect of the present invention could contain any desired coding sequence. For example, one or more serum response elements could be operably linked to a coding sequence that is not normally associated with such elements. This may be useful for example in wound healing if it is desired to provide serum response to a given therapeutic agent encoded by the coding sequence that does not normally demonstrate serum response.

However, it is preferred that nucleic acid molecules of the tenth aspect of the present invention contain a coding sequence for Egr-1 or a biologically active fragment thereof.

Desirably, the nucleic acid molecules of the tenth aspect of the present invention include a promoter region and can be used to provide Egr-1, allowing the transcription of Erg-1 mRNA. This can be translated by ribosomes present in a host. Thus, nucleic acid molecules could be administered to a subject (preferably a human or other mammal) so that additional Egr-1 can be synthesized in the subject, or (less preferably) could be used to prepare the same Egr-1 , which could then be administered to a subject.

The nucleic acid molecules of the tenth aspect of the present invention for administration to a subject can be transcribed in such a way that the transcription can be regulated by one or more factors that regulate the transcription of Egr-1 in the subject.

For example, one or more SSREs could be provided (as discussed above) to provide the Egr-1 transcript with response to shear stresses. This is particularly advantageous when the nucleic acid molecules of the tenth aspect of the present invention are administered to a patient (rather than administering the same Egr-1). The response to shear stress is beneficial when nucleic acid molecules of the tenth aspect of the present invention are used in vi ve in the treatment of wounds. This is because the shear stress at wound sites can result in SSRE binding factors that can stimulate increased transcription of Egr-1. The resulting increased levels of Egr-1 can accelerate wound healing.

In some cases, it might be desirable to reduce the level of response to shear stress, for example, it might be desirable to decrease the treatment of wounds by this route (possibly to reduce the scar mark). Alternatively it may be desirable to reduce the risk of cardiovascular problems associated with the response to shear stress.

The tenth aspect of the present invention is also useful here. It provides for the first time the total sequences of five SREs of human associated with the regulation of human Egr-1 transcription. One or more of these could be mutated to reduce the level of response to the shear stress with respect to that obtained using one or more of the SREs shown in Figure 7 for the SEC GW.

In other cases, one might wish to increase the level of response to shear stress by providing mutations in one or more of the five SREs, as well as to increase the level of response to shear stress with respect to that obtained using the SREs shown for the SEC GW in Figure 7. Such mutations could be used for example to accelerate the treatment of wounds.

The nucleic acid molecules of the tenth aspect of the present invention could be in the form of vectors, although this is not essential. They could be administered to a patient by physical methods. Such methods include topical application of the "naked" nucleic acid vector in an appropriate vehicle - for example in solution in a pharmaceutically acceptable excipient, such as phosphate buffered saline (PBS). Such methods include particle bombardment (which is also referred to as 'gene bombing' technology and is described in US-5371015. Here, inert particles such as gold beads coated with nucleic acid are accelerated at sufficient rates to allow them to penetrate the surface at the site of the wound (eg skin) by means of high pressure discharge from a projection device (particles covered with a nucleic acid molecule of the present invention are within the scope of the present invention, which are the devices containing such particles.) Other physical methods for administering DNA directly to a receptor include ultrasound, electrical stimulation, electroporation and microsembration Microseaming is the particularly preferred method of release This is described in US Pat. No. 5697901.

The nucleic acid molecules of the tenth aspect of the invention could also be administered by means of specialized delivery vectors.

Any suitable vector can be used for gene therapy. Methods of gene therapy are discussed, for example, by Verna et al in 389: 239-242. Both viral and non-viral systems can be used.

Virus-based systems include systems based on retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, and vaccinia viruses.

Systems based on non-virals include indirect administration of nucleic acids and systems based on liposomes.

A nucleic acid sequence of the tenth aspect of the present invention could still be administered by means of transformed host cells. Such cells include cells harvested from a subject. The nucleic acid molecules of the present invention can be introduced into such cells in vitro, and the transformed cells can then be returned to the subject. Nucleic acid molecules do not need to be introduced as vectors since nucleic acid molecules that are not in vectors can be introduced. Some such molecules could be integrated into the nucleic acid already present in the host cell by means of homologous recombination events.

The present invention also includes within its scope expression systems that can be used to provide polypeptides (e.g. Egr-1). Such polypeptides could then be used in therapy.

The preferred expression vectors are eukaryotic vectors. However, prokaryotic vectors can also be used. Suitable vectors will generally include a coding sequence operably linked to one or more regulatory sequences. Preferably, the coding sequences that encode Egr-1.

Many different expression systems are known and discussed, for example in Sambrook et al (Mol ecular Cloning, 2nd Edition, Cold Spring Harbor Laboratory Press (1989)).

It will be apparent from the foregoing discussion that the nucleic acids of the tenth aspect of the present invention (which could be presented in the form of vectors) can be used in various therapeutic applications, which can produce polypeptides using such nucleic acids. Therefore the present invention includes within its scope pharmaceutically acceptable compositions containing the nucleic acids or polypeptides, optionally in combination with a pharmaceutically acceptable carrier or vehicles.

Such vehicles could include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.

The polypeptides and nucleic acids could be employed in the present invention alone or in conjunction with other substances, such as therapeutic substances. For example, Egr-1 repressors (such as NAB1 and / or NAB2) could be administered under certain circumstances (eg if it is desired to minimize scar marking, inhibit resteriosis, modulate calcification of the vessel wall and / or inhibit cell proliferation (eg in cancers)). When two or more active agents are going to be administered this could be done as a combined preparation for simultaneous, separate or sequential use.

The pharmaceutical compositions of the present invention could be administered in any effective manner including, for example, administration by topical, intravenous, intramuscular, intranasal or intradermal routes among others. In general it is preferred that the compositions be applied locally - e.g. at or near a wound site or associated condition. However, systemic administration could be used.

An active agent could be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion. This is preferably substantially isotonic with a body fluid of the patient (e.g., with patient's blood).

Alternatively the composition could be formulated for topical application for example in the form of ointments, creams, lotions, ointments for the eyes, eye drops, eardrops, mouthwash, impregnated bandages and sutures and sprays. It could contain additives, which include, for example, preservatives, solvents to aid in the penetration of drugs, and emollients in ointments and creams. Such topical formulations may also contain compatible carriers, for example cream or ointment bases, and ethanol or oleyl alcohol for lotions. Such vehicles could constitute from about 1% to about 98% by weight of the formulation. More typically they will constitute up to about 80% by weight of the formulation.

More preferably, the pharmaceutical compositions containing nucleic acids of the present invention are adapted for administration by "gene bombardment" technology. Thus nucleic acids could be associated with particles (e.g., gold beads) that can be used as projectiles.

For administration to mammals, and particularly humans, it is expected that the daily dosage level of an active agent will be from 0.01 mg / kg to 10 mg / kg, typically around 1 mg / kg. In practice, a doctor will determine the actual dosage that will be most suitable for an individual and this could vary with the age, weight and condition of the particular individual. If you develop side effects, the dosage can be reduced according to good clinical practice.

In addition to the therapeutic uses, the present invention could also be used in diagnosis. As discussed above, the present invention provides probes that can be used in the diagnosis of various conditions. These could be provided as part of a diagnostic kit that could include other components - e.g. one or more washing liquids, means for detecting hybridization, instructions for use, etc. The probes could be labeled with a detectable label (e.g. fluorescent label or radio label).

The present invention could be used in screening. For example, a nucleic acid molecule of the tenth aspect of the present invention (such as a molecule containing the SEC GW shown in Figure 7 or part thereof) could be used to screen for substances that bind thereto. Such substances can be tested to see if they affect the transcription of Egr-1. In this way they could be useful to elaborate medicines for the treatments discussed before. Alternatively a nucleic acid molecule of the tenth aspect of the present invention could be used to screen a substance capable of blocking the binding of another substance to the nucleic acid molecule. If another substance is a regulator of Egr-1 transcription, substances that block the binding for the manufacture of drugs for use in one or more of the treatments discussed above may also be useful.

The present invention could be used in research. For example, nucleic acid molecules of the tenth aspect of the present invention could be used as a starting point in studies where one or more changes are made with respect to a given nucleic acid molecule. This can be done to determine which parts of it are important in the transcription of Egr-1 or are important in the regulation of such transcription. For example insertions / deletions / replacements could be made with respect to one or more framed regions shown in Figure 7 of the SEC GW and the effect of such insertions / deletions / replacements could be further investigated. The changes could be made to try to identify nucleic acid molecules capable of providing increased or reduced levels of Egr-1 transcription.

The preferred features of each aspect of the invention are as for each of the other aspects of many mutations. The prior art documents mentioned herein are incorporated to the fullest extent permitted by the law.

The present invention will now be described by way of example, only with reference to the accompanying figures, wherein: Figs la and b show the expression of Egr-1 of VEGF; Figure 1 and d show the expression of Egr-1 of TGF-B1; Figure le and f show the expression of Egr-1 of PDGF A; Figure 2a shows the effect of Egr-1 on contraction of the wound by excision in rat; Figure 2b shows the effect of the transfection of ogf DNA Egr-1 on the histology of wound healing by excision in rat; Figure 2c shows the effect of Egr-1 on the position of collagen in rat excision wounds; Figure 2d shows the effect of Egr-1 on the angiogenic profile in rat excision wounds using vWF immunostaining; Figure 3a shows the optimization of the ratio of lipid DPN (v / p) for transfection of the luciferase control plasmid pGL3 in the angiogenesis of the co-culture system using Mirus TransIT (Cambridge Bioseciences); Figure 3j > shows the effect of Egr-1 on angiogenesis; Figure 4a shows the bone load samples using western blot analysis; Figure 4b shows the western blot analysis of the Egr-1 protein in human TE85 bone cells exposed to loading; Figure 4c shows an ELISA analysis of PDGF BB produced from TE85 bone cells after loading exposure; Figure 4d shows the detection of VEGF and TGF-B1 after transfection of CMV-TGF-B1 in ROS cells; Figure 4e shows the detection of VEGF and TGF-B1 after transfection of CMV-TGF-Bl into MC3tEl cells; Figure 5 shows the effect of Egr-1 on levels of alkaline phosphatase in a rodent model of ectopic bone formation; Figure 6a shows the staining of the anti-Egr-1 antibody of human smooth muscle cells transfected with CMV Egr-1; Figure 6b shows staining of anti-Egr-1 antibody from porcine smooth muscle cells transfected with CMV DNA Egr-1; Figure 6c shows the optimization of transfection of luciferase pGL3 control in human SMC by means of Fugene; Figure 6d shows the optimization of transfection of luciferase pGL3 control in porcine SMC by means of Fugene; Figure 6e shows the activation of VEGF production / secretion by transfection of CMV-Egr-1 in human SMC; Figure 6f shows the activation of HGF production / secretion by transfection of CMV-Egr-1 into human SMC; Figure 6g shows the activation of PDGF production / secretion by transfection of CMV-Egr-1 in human SMC; Figure 6h shows the immunostaining of the Egr-1 protein in the vessel wall pre- and post-injury; Figure 7 shows a comparison of two inactivated nucleotide sequences as SEC GW and SEC ON respectively. SEC ON is the published early growth response-1 promoter (Sakamoto et al Oncogene 6; 867-871, 1991), and SEC GW is the sequence according to the invention, which contains a number of base insertions / deletions as it is shown and substitutions (bold-underlined).

Figure 8 shows a variant of the sequence shown in Figure 7, this variant has a Mutation in the EBS region modified at the Egr-1 binding site (EBS) shown in bold-underlined.

Figure 9 shows the sequence upstream 5 'of the mouse Egr-1 gene (Morris, Nu cli i Aci ds Research, 16: 8835-8846). The nucleotides are listed from the top site = +1. The putative elements TATA and CCAAT are framed. Potential regulatory elements are underlined and indicated in the figure. The dotted underline shows the position of 29-mer used for primer extension studies; Figure 10 shows the activation of SRE5 by transient transfection of pFA-MEK1.

Examples Examples 1 and 2 describe the bombardment of genes of the expression plasmid of β-galactosidase and Egr-1, complexed to gold particles, in the rodent skin. a) Preparation of the station's piping The pipe preparation equipment was placed in a sterile air laminar flow cabinet, and cleaned with cotton with 70% I.M.S. and dried with air in the cabin. The gas line pipe from the nitrogen cylinder to the pipe preparation equipment was autoclaved and bonded in line to a 0.2 μm Gelman filter. The pipe that was autoclaved was connected to the gas inlet of the preparation equipment by means of a lower closing connector, and the gas is allowed to flow through at 0.2 liters / minute to completely dry the pipe.

The particle discharge pipe was attached to the preparation equipment and the gas was allowed to flow through as before to completely dry the interior of the pipe. Any residual moisture in the pipeline will result in poor or uneven bonding of the gold particles to the walls of the pipe and could adversely affect the outcome of any experiment. b) Preparation of the gold microtransporter DNA account: 1.0 μm gold beads were obtained in Bio-Rad UK.

An aliquot of gold beads (53 mg) was weighed in a microcentrifuge tube, and 100 μl of 0.05 M spermidine was added and the tube vortexed gently. 100 μl of DNA solution containing 100-120 μg of plasmid DNA expressing either Egr-1 or β-galactosidase followed by 100 μl of 1M CaCl 2 added dropwise while vortexing was added. This mixture was allowed to stand for 10 minutes at room temperature, then centrifuged. The supernatant was removed and the gold pack was washed three times in absolute EtOH.

The gold particles were finally resuspended in absolute ethanol containing 0.1 mg / ml polyvinyl pyrrolidone (PVP).

Estimation of the efficiency of DNA coating to gold micro-transporters, and release in aqueous solution: All samples (initial material, post-precipitation supernatant followed by DNA / gold complex formation, and eluate) were tested for DNA in a "GeneQuant" (Pharmacia). Residual DNA from post-precipitation gave a measure of unbound material, and the ratio of bonded material: initial was considered to be coating efficiency. c) Loading of the DNA / microtransporter suspension in the gold discharge pipe: The suspension of gold particles in ethanol / PVP was then loaded into the discharge pipe using a syringe, and the suspension was allowed to stand for 3-5 minutes in the pipe. During this time the particles precipitated on the inner side of the pipe allowing the ethanol to be removed by means of the syringe. When the ethanol had been removed, the pipe was turned to distribute the gold particles evenly on the inner side of the pipe. After 2-3 minutes of rotation, nitrogen gas was passed through the pipe at a rate of 0.1 liters / minute to remove residual ethanol and the gold particles were allowed to adhere. After 10 minutes, the pipe was removed, cut into appropriate lengths using the provided cutter (Bio-Rad RU), and the cut pipe was loaded for gene bombardment.

The expression and activity of Egr-1 was determined using standard immunohistochemistry with commercially available antibody preparations for the detection of Egr-1 (Santa Cruz), and products of the Egr-1 white gene (Santa Cruz or R & D systems) and the Expression was monitored for 1-7 days. The negative control was without DNA.

E p p o r 1 Download Eor-1 DNA to rodent skin without injury 1. 1 Methods An expression plasmid containing the Egr-1 cDNA was activated by the human cytomegalovirus promoter (hCMV; Houston et al, Arterioscler, Thromb. Vasc. Biol., 19; 281-289, 1999) was discharged in the back of mice without wounds by means of particle discharges mediated by bombardment of genes. The gold / DNA complexes were prepared as described above and 0.5-1.0 μg of DNA was discharged per animal using a bombardment pressure of 24.13 bar (350 psi) genes and a gold particle size of 16 micras. The animals were sacrificed on day 0, 1, 2 and 6 days post DNA discharge and the skin was embedded in OCT and split freeze-dried in dry ice / hexane. The sections were prepared at 0.7 μm and the white growth factors of Egr-1 were examined by immunostaining using antibodies directed against VEGF, PDGF A, TGFβ and Egr-1. 1. 2 Results Immunohistochemical data are shown for activation of Egr-1 of VEGF (Figures la and Ib), TGFβ (Figures le and Id), PDGF A (Figures le and lf). The results show up-regulation of the VEGF protein on days 1 and 2, declining on day 6, the up-regulation of TGFβ on day 6 but not on days 1 and 2, and rapid up-regulation of PDGF A at 2 hrs Post-discharge of Egr-1 DNA (designated day 0). 1. 3 Conclusion These data confirm that Egr-1 can activate the expression of white growth factors i n vi, some of which are described here. These data illustrate that the activation of growth factors by Egr-1 is presented on a temporally separated time scale.

Having confirmed the activation of Egr-1 target genes using rodent skin without wounds (Example 1), the release by bombardment of Egr-1 and β-galactosidase genes in rat wounds by excision was performed to evaluate the effect of Egr-1. -1 in the speed of healing.

Example 2 Use of the Eor-1 transcription factor to promote wound repair in rodents 2.1 Methods 2.1.1 Plasmid constructions: The expression plasmids used in this study activated CMV by β-galactosidase and CMV activated by Egr-1 (Houston et al, Arterioscler, Thromb, Vasc, Biol., 19; 281-289, 1999). The plasmids were propagated in Escherichia coli XL-2 Blue MR and the DNA was prepared using Qiagen maxi kits. 2. 1.2 Gene Transfer Mediated by Particles Eighteen male Sprague Dawley rats weighing 250 g were anesthetized with isoflorane in a 2: 1 mixture of oxygen / nitrous oxide. Two transfection sites (8 cm from the skull, 1.5 cm on each side of the column) were prepared on the back of the rat, first clamping the skin, then shaving with a rake. Two transfections per wound site, separated by 8 mm, were performed by accelerating the plasmid / gold complexes of either Egr-1 or β-galactosidase in the skin at 24.13 bars (350 psi). The total amount of DNA was not less than 1.7 μg per transfection (equal to 3.4 μg per wound). 2. 1.3 Model of Healing of Excision Wounds: Twenty-four hours post-transfection the animals were anesthetized and two wounds were made by excision of the full thickness (8 mm diameter) using a biopsy knife at the exact transfection sites (see below). Immediately after making the wounds each wound was captured using camera / video equipment and the animals were allowed to recover from the anesthesia. At 2, 4 and 6 days after wounding, 6 animals were sacrificed and each wound was captured again using the same camera / video device. After the capture, the wounds were dissected and collected by means of routine histology and immunohistochemistry. 2. 1.4 Healing Analysis: i) Macroscopic evaluation The wound area was determined using image analysis and healing was expressed as an increase in the percent of the original wound area. The statistical significance of differences between treated groups and control were evaluated using a Mann-Whitney mating test. ii) Microscopic evaluation Histological Analysis: Each wound per time point after the dissection was bisected horizontally. A medium was placed in 4% paraformaldehyde for 24 hours and processed by wax histology. Sections of 5 μm of each wound were cut using a microtome and sections were stained with van Geison. Using this histological staining, the key wound healing markers were evaluated including re-epithelialization and collagen content, and comparisons were made between the treated and control sections.

Immunocytochemistry: Immunocytochemistry and image analysis was performed to quantify the differences seen using routine histology. Once frozen in OCT, the second half of each wound was sectioned at 7 μm using a cryostat. Two sections of each wound were fixed in ice-cold acetone and fluorescent immunostaining was performed with the elementals for collagen I and von Willebrand factor. (vWF) Immediately after immunostaining, each strip was placed in a fluorescent microscope and the area of the wound was captured using an x25 magnification. The image was integrated and a threshold was set to minimize the background. The area and intensity of the staining was measured using image analysis and plotted using a graph. Significant statistical differences between treated and control groups were evaluated using a non-parametric Man-Whitney test. 2. 2 Results 2.2.1 Effect of Egr-1 on wound healing by excision in rat (i) Wound contraction: The total thickness of dermal excision wounds in rat of 8 mm in diameter contracted marginally faster in response to the transfection of Egr-1, compared to the control (β-galactosidase) up to 6 days post wounds. Statistically significant contraction increases (p <0.05) were presented 6 days post-wounds where the wounds treated with Egr-1 contracted to an area 7% smaller than the control (Figures 2a). (ii) Histological Analysis: The sections of wounds stained with van Gieson showed marked differences in the histology of the wounds at 4 and 6 days post wounds. At 2 days post wounds there was little difference between wounds transfected with Egr-1 and β-galactosidase. Both treatments showed mononuclear cells at the site of the wound that indicated the early inflammatory response, with early scab formation, but without re-epithelialization. At 4 days post wounds the re-epithelialization had not yet started, however the wounds transfected with Egr-1 had more collagen at the site of the wound compared to ß-galactosidase. At 6 days after wounding, the Egr-1 treated wounds had more mature granulation tissue that showed markedly more collagen at the site of the wound compared to the β-galactosidase, to a degree where clear thick collagen fibers could be seen. The re-epithelialization was completed in 50% of the wounds treated with Egr-1 compared to 0% of β-galactosidase. Histologically, the wounds treated with Egr-1 showed accelerated healing when compared to β-galactosidase (Figure 2b). (iii) Quantification of the effect of Egr-1 on collagen deposition using immunohistochemistry and image analysis: The immunostaining of collagen I was performed in 7 μm critosections of Egr-1 or β-galactosidase treated wounds and the staining was quantified using image analysis. The wounds treated with ß-galactosidase had significantly more collagen at 2 days post wounds compared to Egr-1. At 4 and 6 days after wounding, wounds transfected with Egr-1 had more collagen deposition than the control (β-galactosidase), which confirms the findings seen using routine wax histology. Transfection with Egr-1 increased the amount of collagen deposition at 4 and 6 days after injury (Figures 2c). (iv) Quantification of the effect of Egr-1 on angiogenesis using immunohistochemistry and image analysis: Angiogenesis was quantified using the von Willebrand immunostaining factor in wound cryoses and image analysis to measure the positive staining area at the wound site. At 2 days after wounding, the wounds transfected with Egr-1 had significantly (p <0.01) more new blood vessels compared to the control (β-galactosidase). At 4 and 6 days after wounding, wounds transfected with both Egr-1 and β-galactosidase had similar levels of angiogenesis. Transfection of DNA expressing Egr-1 promoted angiogenesis 2 days before the control (Figure 2d). 2. 3 Conclusions Transfection with Egr-1 of rat excision wounds accelerated healing by increasing the rate of contraction, re-epithelialization and collagen deposition. Transfection with Egr-1 also promoted angiogenesis 2 days after injury.

Example 3 Use of the transcription factor of Egr-1 to promote angiogenesis 3.1 Methods Egr-1 under the control of the hCMV promoter (Houston et al, Arterioscler, Thromb, Vasc, Biol., 19; 281-289, 1999) was transfected into a human cell co-culture system designed to measure the angiogenesis in vitro. The angiogenesis kit (TCS Biologicals) was used as described according to the manufacturer's instructions using the VEGF protein (2 ng / ml) and suramin (20 μM) as positive and negative controls respectively for angiogenesis.

The optimization of the transfection in the co-culture system was performed using the luciferase control pGL3 (Promega) with 1.0 μg and 0.5 μg of CMV-βgal as a normalization plasmid for the control of transfection. Two relationships of lípidorDNA were used (v / p); 2: 1 and 4: 1 (Figure 3a). The Egr-1 DNA in CMV was transfected at 0.5, 1.0, 1.5 and 2.5 μg per well in triplicate in a 24-well microtiter plate, using the Mirus Transit reagent (Cambridge Biosciences) at a DNA ratio of 2: 1. v / p. The positive control of the VEGF protein and the negative control of suramin were added to wells in triplicate. After 11 days of co-culture the angiogenesis was determined by staining cells for the endothelial cell marker PECAM-1 and visualized using BCIP / NBT substrate.

Representative images of tubule formation using the four doses of the Egr-1 expression plasmid together with VEGF (positive control) and suramin (negative control) were captured and processed by means of image analysis, using the Quantimet 600 image analyzer and associated programming elements. 3. 2 Results Angiogenesis as described by visible tubule formation under the light of the microscope was detectable after 11 days of co-culture. The angiogenic record was presented using image analysis as illustrated in the complete well and the results are presented as tubules per unit area against treatment (Figure 3b).

Reduced tubule formation (cells treated with suramin) and increased tubule formation (cells treated with VEGF protein) are shown. It was shown that Egr-1 promotes increased tubule formation in a reverse dose-dependent manner. 3. 3 Conclusions In the co-culture system, the expression of the transcription factor of Egr-1 is angiogenic. This is supported and supported by data from Example 1, by which it was shown that Egr-1 over regulates the expression of growth factor (eg VEGF) when it is downloaded by bombardment of genes in the mouse skin, and data from the Example 5, where it was shown that the transfection of Egr-1 increases the amount of VEGF produced in vascular smooth muscle cells of human. The inverse dose response of Egr-1 as a pro-angiogenic stimulus is consistent with the results obtained in Example 6 and with the notion that Egr-1 could sub regulate its own production (Cao, X. et al, J. Biol. Chem., 268; 16949-16957, 1993; Scwachtgen, J.-L. et al, J. Clin. Invest., 101, 254-2549, 1998).

Example 4 Use of the transcription factor of Eor-1 to promote osteogenesis i n vi tro A. l Bone load and determination of growth factors 4. 1.1 Methods r The cells used were TE85, a human osteosarcoma - cell line similar to an osteoblast derivative.

The sub-confluent cell layers were trypsinized and resuspended in DMEM containing 10% calf fetus (FCS) serum and 1% penicillin-streptomycin (PS) antibiotics. The cell suspension was seeded onto the loading substrate (18 x 18 mm square plastic treated with tissue culture). The cells were allowed to bind overnight. Once the loading and bound substrates were attached, the cells were transferred to flasks containing DMEM with 2% FCS and 1% PS for 24 hr more before loading stimulation.

There were four groups of conditions for each time point described in Figure 4a: [1]. Load (200 cycles of 2000 microtensors and 3232 microtenssions per second). [2]. Control (without load). [3] . Positive control (100 ng / ml of PMA for 1 hr). [4]. Control of solute.

For cell loading, the cells were transferred aseptically from standard tissue culture conditions in the loading chamber. The duration of charge in the cells inside the chamber was 4 minutes. After loading, the cells were returned to their previous culture conditions. The treated control cells were treated in exactly the same way, except that no charge was applied to the chamber.

The results were analyzed by means of two different methods. First, the presence of the Egr-1 transcription factor was determined by Western blot analysis of the cell packets collected after the loading experiments (Figure 4b). Second, the presence of secreted growth factors was determined by the ELISA test of the tissue culture medium (Figure 4c). 4. 1.2 Conclusions: These results show that under conditions of bone load the transcription factor of Egr-1 is produced in osteoblast-like cells derived from human osteosarcoma. The application of bone load to human TE85 cells stimulates the production and secretion of growth factors, an example of this is PDGF B. 4. 2 Transfection of CMV TGF-ßl in MC3T3E1 v ROS cells followed by TGF-ßl from human and ELISA tests for mouse VEGF from cell culture supernatants 4. 2.1 Materials: (i) Transfection Mouse Osteoblast cells (MC3T3E1) and rat Osteosarcoma cells (ROS17 / 2.8) were used seeded in 6-well plates.

MC3T3E1 cells were cultured in MEM-, minimal essential eagle, alpha modification (Sigma), 10% calf fetus serum (Life Technologies), 1% L-glutamine (Life Technologies), 1% streptomycin penicillin ( Life Technologies).

ROS cells were cultured in F12 HAM, F-12 HAM with glutamine (Life Technologies), 10% calf fetus serum (Life Technologies), 1% penicillin-streptomycin (Life Technologies).

The cells were transfected using Fugene (Boehringer Mannheim) with a plasmid expressing CMV TGF-β1 as described (Benn, S. I. et al, J. Clin.

Invest., 98; 2894-2902, 1996). Transfection into cells was carried out as described: 1) A six well plate was prepared with 2xl05 cells per well and left overnight, until 50-70% conflued. 2) The next day, 94 μl of Serum without medium (SFM) and 6 μl of Fugene were added to each of the 6 eppendorf tubes and left at room temperature for 5 min. 3) To 6 separate tubes, DNA was not added to 2 tubes, while 4 μg of CMV-TGF-ßl DNA was added to the remaining 4 tubes. 4) The Fugene / SFM mixture from step 2) was added dropwise to the tubes of step 3), the tubes were oscillated several times and then incubated for 15 min at room temperature.

) Fugene / SFM / DNA transfection mixtures were added dropwise to their respective wells, while rotating the 6-well plate, the plate was incubated at 37 ° C for 48 hrs. 6) Cell culture supernatants were taken in aliquots and stored at -20 ° C.

The previous protocol was performed for both MC3T3E1 cells and ROS cells. The presence of TGF-ßl in the cell culture supernatant was detected by ELISA (R &D Systems) using a color detection system based on streptavidin-HRP. 4. 2.2 Results: The production and detection of TGF-β1 and VEGF after Transfection of CMV-TGF-β1 is shown in ROS cells (Figure 3) and MC3T3E1 cells (Figure 4). These data show that a white gene of Egr-1, in this example TGFβ1, is active in the production of VEGF. 4. 3 Conclusion The expression of Egr-1 and the activation of white genes of Egr-1 could synergistically activate VEGF.

Example 5 Use of the transcription factor of Egr-1 to promote osteogenesis i n vi 5.1 Rat Ectopic Bone Formation Subcutaneous implantation of possible compounds that induce bone in rodents represents the most widely studied biological test system in common use (Wozney, J.M., Cell, Mol. Biol., 131-167, 1993). The use of a matrix vehicle increases the reproduction and sensitivity of the bone induction response. In this test system (Reddi, AH et al, Proc. Nati, Acad. Sci. USA, 69; 1601-1605, 1972; Sampath, TK, ibid, IB; 7599-7603, 1981) the matrix vehicle is derives from the diaphyseal portion of rat long bones that have been ground into particles of a particular size, subsequently demineralized and biological activity removed by guanidine extraction. The remaining vehicle consists mainly of bone collagen without osteoinductive capacity. The compound or substance to be tested is then deposited in the matrix by precipitation with alcohol, dialysis against water or lyophilization. This matrix combination is then implanted into the subcutaneous tissues of the rat for a number of days (12 days in this experiment). The implants were then histologically and biochemically tested for their ability to induce bone formation (Sampath, TK et al, Proc. Nati, Acad. Sci. USA, 80; 6591-6595, 1983; Sampath, TK et al, ibid. 84; 7109-7113, 1987; Wang, E. ibi d, 85; 9484-9488; Wang, E. et al, ibi d, 87; 2220-2224; Sampath, TK et al, J. Cell Biol., 98; 2192-2197, 1984). . 1.1 Experimental Methods: Twenty male Sprague Dawley Prep rats (age 42-49 days, weight 170-220 g) were randomized to receive two implants subcutaneously inserted into the thoracic thorax under halothane anesthesia. The implants comprised one of four treatments r • Negative control - Single vehicle (bone matrix extracted with demineralized guanidine DGBM) • CMV DNA of Egr-1; 500 ug in DGBM vehicle • CMV DNA from Egr-1; 500 ug plus recombinant bone morphogenetic protein (BMP) 4; 5 ug of DGBM vehicle, (BMP4 that was used for its chemotactic effects) • Recombinant BMP4 protein in DGBM vehicle.

The day of insertion was referred to as day 0 and on day 12 post-operatively all rats were sacrificed using a method approved by calendar 1, the implants were removed, cleaned of soft tissue and divided into equal halves. One half was placed in 10% formalin for histological examination and the other half was frozen and stored at -20 degrees centigrade. This sample was then tested for calcium content and alkaline phosphatase activity. . 1.2 Preparation of rat bone demineralizer The diaphyseal shafts of the femurs, tibias and humeri of the adult Sprague Dawley rats were removed, cut into strips of soft tissue and the bone marrow cavities were irrigated with normal saline. The bone was then degreased by shaking in 100 ml of Chloroform r Methanol (2: 1) for 30 min. This step was repeated once before drying with air in a drying oven. The bone shafts were then frozen in liquid nitrogen and pulverized in a micromolino CRC. The resulting powder was sieved to leave a discrete particle size of 75-425 μm and then demineralized in 0.5 HCl for 3 hours with constant stirring. The mixture was then centrifuged for 30 minutes at 19.0000 rpm (Kontron Centriks T124, Rotor A8.24) at 15 degrees centigrade. The package was resuspended in 100 ml of water, stirred for one hour and centrifuged. This step was repeated later. The pack was then resuspended in 100 ml of ethanol, stirred for one hour and centrifuged. The ethanol was evaporated and the sample was resuspended in 4 M guanidine hydrochloride / 50 mM Tris pH 7.4 and stirred overnight. Further centrifugation was carried out with the resuspended package in 50 ml of water, stirred for one hour and centrifuged.

This step was repeated twice more. The sample was then dried overnight in a drying oven. The DNA was added to the bone by mechanical mixing and lyophilization. . 2 Histological Examination After initial fixation in formalin, the samples were embedded in methyl methacrylate and sections of 1 μm were cut and stained with Von Kossa and Toluidine Blue. Three non-adjacent sections of each implant were then evaluated by means of a blind histopathological consultant for the test substance and the records were averaged.

A standard evaluation system for cartilage and bone was used; +/- tentative identification of bone or cartilage 1. > 10% each new section of cartilage or bone 2. > 25% each new section of cartilage or bone 3. > 50% each new section of cartilage or bone 4. > 75% each new section of cartilage or bone 5. > 80% each new section of cartilage or bone 5.3 Biochemical test The tissue was homogenized in 2 ml of ice cold 0.25M sucrose-3mM NaC0H3. The homogenates were centrifuged at 12,000 g for 15 min at 2 degrees centigrade and the supernatants were collected for enzyme tests. The alkaline phosphatase activity was determined using a co-thiometric test with p-nitrophenyl phosphate (PNP) as the substrate. After incubation of samples for PNP test at 37 degrees centigrade, the optical density was determined at 405 nm in a standard microtiter plate reader. . 4 Results The results are presented in Figure 5. The data was analyzed by treating the two implant sites for each rat as independent of one another. Median and interquartile ranges (IQR) are presented due to small numbers and skewed distribution of data. The Kruskal Wallis tests were performed on the above variables and it was found that alkaline phosphatase levels differ significantly from one another.

Bone formation was positive for an implant at five implanted sites and only one group (CMV DNA Egr-1 / BMP). The initial experiment used a simple time point for the 12-day test, which was chosen to give early predictive results. At this point in time the alkaline phosphatase activity levels rise significantly in groups of CMV Egr-1 DNA and CMV DNA Egr-1 / BMP4 on the controls. Such temporary increase in alkaline phosphatase activity is typically seen (as a precursor of bone formation) with substances such as BMP, which stimulate bone formation by increasing to a peak at 10-15 days and subsequently falling. This represents the elevation seen in the earliest phase of enchondral ossification. The calcium content does not show significant differences in the samples tested until now, although early calcification has been observed in a number of histological samples in the CMV-Egr-1 / BMP4 group. This could be explained by the time scale of the biopsy where calcification is only beginning. . 5 Conclusion Egr-1 increases alkaline phosphatase levels in a rodent model of ectopic bone formation and could promote localized bone formation.

Example 6 Use of the transcription factor of Egr-1 to promote re-endothelialization after percutaneous transluminal coronary angioplasty vi n 6.1 Methods The vascular smooth muscle cells of human or porcine (SMC, Clonetics) were thawed, kept in medium and passed until no more than passage 4, according to the manufacturer's instructions. SMC were transfected with an expression plasmid that contained Egr-1 cDNA expressed by the CMV promoter (Houston et al, Arterioscler, Thromb. Vasc. Biol., 19; 218-289, 1999) . DNA expressing Egr-1 was transfected into SMC using Fugene (Boehringer Mannheim), after optimization of SMC with the control of the luciferase reporter vector pGL3 (Promega) or Mirus Transit (Cambridge Biosciences), both transfection protocols used ß -galactosidase as a normalization plasmid for the control of transfection. 6. 2 Results The CMV Egr-1 DNA was transfected into human SMC and the Egr-1 protein was detected by immunohistochemistry using a polyclonal antibody (Santa Cruz) and peroxidase detection (Sigma and Vector Laboratories). SMC from human transfected with CMV DNA Egr-1 (right panel) or false transfectants (left panel) are shown in Figure 6a, and SMC from porcine transfected with CMV Egr-1 DNA (right panel) or false transfected (panel left) are shown in Figure 6b. The expression of the Egr-1 protein is detected as brown staining. The optimization of DNA transfection was obtained using Fugene 6 (for further characterization in vitro, Figure 6c) and Mirus Transit (for subsequent studies in vivo, Figure 6d). From these data, 4 μg of CMV Egr-1 DNA was routinely used for growth factor activation experiments using a 3: 1 lipid ADN ratio. A lipid: DNA ratio of 3: 1 was also used for in vivo release experiments.

The activation of Egr-1 by three growth factors was analyzed by the ELISA test of the cellular supernatants. The production of VEGF (Figure 6e), HGF (Figure gf) and PDGF-AB (Figure 6g) all increased as a consequence of the activation of Egr-1. There was an activation response to the dose and an inverse dose response over a certain DNA concentration [Egr-1], as previously shown in Example 3. 6. 3 Conclusion The Egr-1 protein was expressed in SMC after transfection of a CMV Egr-1 AClí. The Egr-1 Transfection increases the production / secretion of PDGF, HGF and VEGF derived from SMC.

Example 7 Promoting Sequence of EGR-1 The human Egr-1 promoter fragment extending nt. -674 to +12 was synthesized by PCR in a reaction containing 0.5 μg of human placental genomic DNA as a template, 0.4 mM of dATP, dCTP, dGTP and dTTP, 25 pmoJes of the following primer (5'-GGC CAC GCG TCG TCG GTT CCC TCT CAC GGT CCC-3 ', the Mlu I restriction site is underlined), 25 pmoles of the primer inverse 5 '-GCA GCT CGA GGC TGG ATC TCT CGC GAC TCC-3' (the Xho I site is underlined) and Vent DNA polymerase (NEB). The PCR fragment was cut with Mlu I and Xho I, purified on agarose gel and cloned between the Mlu I and Xho I sites at the multiple cloning site of the pGL3 basic vector (Promega).

The entire sequence has now been derived allowing the completion of 'intervals' in the published sequence. This is shown in Figure 7, where the complete sequence as derived by the inventors (SEC GW) is compared to the previously published sequence (SEC ON). This promoter sequence is functional and has been investigated in studies of shear stress and endothelial cells.

An important difference between the published sequence of the human Egr-1 promoter and the sequence that is described (Figure 8), falls into two SREs not previously recognized. While the sequence of SRE 5 and SRE 1 as published do not link the serum response factor (SRF) and are not functional (Nurrish SJ, Treisman R, Mol Cell Biol 1995, 15 (8) r 4076-85), it has been found that they are consistent with the consensus sequence of SRE (Figure 7).

It has concentrated on SRE5. The new SRE 5 with its associated transcription factor binding sites Ets were synthesized as a double-stranded oligonucleotide and inserted into the Nhe I site upstream of a SV40 minimal promoter vector (pSV40).

SRE5 has the AG sequence GTTGCGACCCGGAAATGCCATATAAGGAGCAGGAAGGATCCCCCCGCCGG CGACGCTGGGCCTTTACGGTATATTCCTCGTCCTTCCTAGGGGGGCGGCC GA The 2 Ets sites are in bold, the SRE is underlined. The projection AG is used to clone in the partially filled Nhe site of the pGLE promoter.

The resulting reporter plasmid pSVSRE5 was transiently transfected in HeLa cells together with plasmids pFA-dbd (construct encoding the GaI4 DNA that binds the domain (dbd)) or pFA-MEKl (construct encoding a DNA fusion protein of GaI4 that links the domain (dbd) and the kinase domain of the MAP MEK1 kinase). The GaI4-MEKl fusion protein is constitutively active phosphorylates Elkl and SRF, linked to SRE5.

The results shown in Figure 10 show that the isolated SRE5 sequence is activated 3 times by the presence of MEKl, whereas the SV40 promoter only shows minimal activation.

The results indicate that the new SRE5 is functional.

It is noted that in relation to this * date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Having described the invention as above, the content of the following claims is claimed as property.

Claims (53)

1. The use of a nucleic acid molecule containing a sequence encoding a polypeptide of the Egr-1 transcription factor or a biologically active fragment thereof in the manufacture of a medicament for the treatment of wounds in a mammal, including the human .

2. The use as claimed in claim 1, characterized in that the Egr-1 is human Egr-1.

3. The use as claimed in claim 1 or claim 2, characterized in that the nucleic acid molecule comprises the sequence encoding a polypeptide of the transcription factor of Egr-1 or a biologically active fragment thereof, is operably linked to a sequence of nucleic acid that controls expression.

4. The use as claimed in claim 3, characterized in that the nucleic acid sequence that controls the expression a) has a strand comprising the sequence provided in Figure 7 for SEC GW; or b) has a strand comprising one or more deletions, insertions and / or substitutions with respect to SEC GW, but which does not comprise the sequence shown in Figure 7 as SEC ON and which also does not comprise the sequence shown in Figure 9.

5. The use as claimed in any preceding claim, characterized in that the nucleic acid molecule is arranged for administration to the mammal by physical methods.

6. The use as claimed in claim 5, characterized in that the nucleic acid molecule is arranged for administration to the mammal by bombardment of particles.

7. The use as claimed in claim 6, characterized in that the nucleic acid molecule is immobilized in gold particles.

8. The use as claimed in claim 5, characterized in that the nucleic acid molecule is arranged for administration by microsembration.

9. The use as claimed in any preceding claim, characterized in that the nucleic acid molecule is in a vector.

10. The use as claimed in claim 9, characterized in that the nucleic acid molecule is in a cell.

11. A nucleic acid molecule, characterized in that it contains a sequence encoding a polypeptide of the Egr-1 transcription factor or a biologically active fragment thereof for use in the treatment of wounds.

12. A pharmaceutical composition, characterized in that it contains a nucleic acid molecule containing a sequence encoding the Egr-1 transcription factor polypeptide or a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers thereof.

13. A method of treating wounds in a mammal, including the human, characterized in that the method comprises administering to a mammal a nucleic acid molecule containing a sequence that encodes a polypeptide of the transcription factor of Egr-1 or a biologically active fragment thereof.

14. The use of a polypeptide of the Egr-1 transcription factor or a biologically active fragment thereof in the manufacture of a medicament for the treatment of wounds in a mammal, including the human.

15. The use as claimed in claim 14, characterized in that the Egr-1 or biologically active fragment thereof is produced naturally, synthetically or recombinantly.

16. The use as claimed in claim 14 or claim 15, characterized in that the Egr-1 is human Egr-1.

17. A polypeptide of the Egr-1 transcription factor or a biologically active fragment thereof for use in the treatment of wounds.

18. A method of treating wounds in a mammal, including the human, characterized in that the method comprises administering to the mammal a therapeutically effective amount of a polypeptide of the Egr-1 transcription factor or a biologically active fragment thereof.

19. A pharmaceutical composition, characterized in that it contains the transcription factor of Egr-1 or a biologically active fragment thereof together with one or more pharmaceutically acceptable carriers thereof.

20. A nucleic acid molecule, characterized in that a) has a strand comprising the sequence provided in Figure 7 for SEC GW; b) has a strand comprising one or more deletions, insertions and / or substitutions with respect to SEC GW, but which does not comprise the sequence shown in Figure 7 as SEC ON and which also does not comprise the sequence shown in Figure 9; or c) has a strand that hybridizes with a strand as described above in a) or b).

21. A nucleic acid molecule according to claim 20, characterized in that the molecule comprises one or more serum response elements (SRE).

22. A nucleic acid molecule according to claim 21, characterized in that the sequence is indicated in Figure 7 as SRE of SEC GW or a functional variant thereof.

23. A nucleic acid molecule according to claim 22, characterized in that the variant has at least one of the nucleotide differences present in the SRE 5 of the SEC GW with respect to the SRE 5 of the SEC ON shown in Figure 7.

24. A nucleic acid molecule according to any of claims 20 to 23, characterized in that it comprises the serum response elements indicated in Figure 7 as SRE3 and SRE4 or a functional variant thereof.

25. A nucleic acid molecule according to any of claims 20 to 24, characterized in that it comprises a TATA box.

26. A nucleic acid molecule according to claim 25, characterized in that the TATA box comprises the AAATA sequence.

27. A nucleic acid molecule according to any of claims 20 to 26, characterized in that it contains an Egr-1 (EBS) binding site.

28. A nucleic acid molecule according to claim 27, characterized in that the Egr-1 binding site has the sequence shown in the Figure 7 for the SEC GW as EBS or has a variant of the sequence.

29. A nucleic acid molecule according to any of claims 20 to 28, characterized in that the variant has reduced affinity for Egr-1 with respect to the sequence shown as EBS in Figure 7 for SEC GW.

30. A nucleic acid molecule according to claim 29, characterized in that the variant comprises the sequence shown in Figure 2 for EBS.

31. A nucleic acid molecule according to any of claims 20 to 26, characterized in that it does not have an Egr-1 binding site.

32. A nucleic acid molecule according to any of claims 20 to 31, characterized in that it contains a sequence capable of binding to Spl.

33. A nucleic acid molecule according to claim 32, characterized in that it contains two sequences capable of binding to Spl.

34. A nucleic acid molecule according to claim 32 or claim 33, characterized in that it contains one or both of the Spl binding sequences shown in Figure 7 for the SEC GW.

35. A nucleic acid molecule according to any of claims 20 to 34, characterized in that it contains a response element to cAMP.

36. A nucleic acid molecule according to claim 35, characterized in that it contains at least one of the cAMP response elements shown in Figure 7 for the SEC GW as cAMP RE.

37. A nucleic acid molecule according to claim 35 or claim 36, characterized in that it contains the first cAMP RE shown in Figure 7 for the SEC GW.

38. A nucleic acid molecule, characterized in that it contains all the framed sequences shown in Figure 7 for the SEC GW, with the optional exception of the EBS sequence.

39. A nucleic acid molecule, characterized in that it comprises a variant of the molecule indicated in Figure 7 for the SEC GW, this variant is capable of allowing an increased level of transcription of Egr-1 with respect to the molecule indicated in Figure 7 for the SEC GW.

40. A nucleic acid molecule, characterized in that it comprises a variant of the molecule indicated in Figure 7 for the SEC GW, this variant is capable of allowing a decreased level of transcription of Egr-1 with respect to the molecule indicated in Figure 7 for the SEC GW.

41. A nucleic acid molecule according to any of claims 20 to 40, characterized in that it contains a sequence encoding Egr-1.

42. A nucleic acid vector, characterized in that it contains a molecule according to any of claims 20 to 41.

43. A cell, characterized in that it contains a nucleic acid molecule according to any one of claims 20 to 41 or a vector according to claim 42.

44. A method for treating a patient, characterized in that it comprises administering to the patient a nucleic acid molecule according to any of claims 20 to 41, a vector according to claim 42 or a cell according to claim 43.

45. A method for treating a patient, characterized in that it comprises administering to the patient Egr-1 that has been produced using a nucleic acid molecule according to any of claims 20 to 41, using a vector according to claim 42 or using a cell in accordance with claim 43.

46. A method according to claim 44 or 45, characterized in that the treatment is the treatment of a wound (including wound healing and associated conditions, and therapy that promotes, increases or accelerates tissue healing and includes the treatment of ulcerations of limbus in diabetes and occlusive disease of peripheral arteries, marked by post operative scarring, burns, psoriasis, acceleration of tissue remodeling and bone repair, and the promotion of angiogenesis, re-endothelialization after percutaneous trans-luminal coronary angioplasty).

47. A method according to any of claims 44 to 46, characterized in that the nucleic acid molecule or Egr-1 is administered in or near a wound.

48. A diagnostic method, characterized in that it comprises using a nucleic acid molecule according to any of claims 20 to 40 as a probe to determine whether or not a genetic defect occurs.

49. A screening method, characterized in that it comprises using the nucleic acid molecule according to any of claims 20 to 40 to identify a potential therapeutic agent by binding studies.

50. A method for identifying an agent capable of over- or under-regulating the transcription of Egr-1, characterized in that it comprises providing a nucleic acid molecule with one or more nucleotide changes with respect to a nucleic acid molecule in accordance with any of claims 20 to 40 (e.g. with respect to a molecule containing the SEC GW shown in Figure 7) and determining whether or not the changes affect the transcription level of Egr-1.

51. An agent identified by means of a method according to claim 49 or claim 50.

52. A pharmaceutical composition, characterized in that it contains a pharmaceutically acceptable carrier and a nucleic acid molecule according to any of claims 20 to 41, a vector according to claim 42, or a cell according to claim 43.

53. A pharmaceutical composition, characterized in that it contains a pharmaceutically acceptable carrier and the Egr-1 produced using a nucleic acid molecule according to any of claims 20 to 41, a vector according to claim 42, or a cell according to claim 43