CS227033B2 - Method of cultivating microorganisms with content and replication of vectors for dna transfer - Google Patents

Description

The invention relates to a method for growing a microorganism containing and replicating a DNA transfer vector. A number of new products can be produced by the process of the invention. These products also include a recombinant plasmid containing a specific nucleotide sequence derived from a higher organism and a novel microorganism containing, as part of its genetic grouping, a specific nucleotide sequence derived from a higher organism.

The following abbreviations are used during the application:

DNA - desoxyribonucleic acid

RNA - ribonucleic acid cDNA - complementary DNA (enzymatically synthesized from the mRNA sequence) mRNA - RNA involved in messenger RNA tRNA - transfer RNA dATP - desoxyadenosine triphosphate dGTP - desoxyguanosine triphosphate dCTP - desoxycytidine triphosphate A -

T-thymine

G - guanine

C - cytosine

Tris-2-amino-2-hydroxyethyl-1,3-propanediol

EDTA - ethylenediaminetetraacetic acid ATP - adenosine triphosphate TTP - trymidine triphosphate

The biological importance of the basic DNA sequence is that it stores genetic information. It is known that the base sequence in DNA is used as a code that determines the amino acid sequence in all proteins that a cell produces. In addition, part of this sequence is used for regulatory purposes, in particular to control the time and amount of production of individual proteins. The nature of these proceedings has so far been only partially clarified. Finally, the base sequence in each strand is used as a basis for DNA renewal as well as for DNA multiplication that accompanies each cell division.

The way that basic DNA sequence information is used to determine the amino acid sequence of proteins is a fundamental process that is broadly universal for all living organisms. It has been shown that each amino acid found in proteins is determined by one or more sequences of trinucleotides. It follows that for each protein it is possible to detect a corresponding DNA segment that contains a triplet sequence that corresponds to the amino acid sequence of the protein. The genetic code is shown in the following table.

The biological way of converting the nucleotide sequence as information into the amino acid sequence in the first step is that the local DNA segment with the sequence that determines the structure of the protein to be produced is first transformed into its copy by RNA. RNA is a polynucleotide that is similar to DNA except that ribose is replaced by desoxyribose and uracil is used instead of thymine. RNA bases can get into the same relationships as in DNA. As a result, it is possible to create a complement in the RNA to the DNA nucleotide sequence. This modified RNA is called mRNA because it is an intermediate link between the genetic system and the protein synthesis system in the cell.

The cell uses mRNA in complex processes, including enzymes and organelles, to synthesize a specific sequence of amino acids. This method is called mRNA translation.

In many cases, additional steps are required to convert the synthesized amino acid sequence into functional proteins. Insulin will be exemplified.

Y --- - A or G if X is T

W = C or A, if ZA or GW = C, if ZC or TZ = A, G, C or T, if WCZ - A or C, if WA QR = TC, if SA, G, C or T QR = AG, if ST or CS = A, G, C or T, if QR TC is S-T or C, is 11 QR AG J = A or GK = T, or CL = A, T, C, or GM = A, C, or T

Alu I treatment site - sequence AG 1 CT, specifically cleaved at the arrow site by Alu I endonuclease

Bam HI treatment site - G and GATCC sequence, specifically cleaved at the arrow site by Bam HI endonuclease.

Bgl I treatment site - sequence GCCNNNN 1 NGGC, specifically cleaved at the arrow site by Bgl I endonuclease (N stands for any nucleotide J.

Genetic code phenylalanine (Phej TTK Leucine (Leu) XTY Isoleucine (Ile) ATM methionine (Met) ATG valine (Val) GTL Serine (Ser) ORS proline (Pro) CCL Threonine (Thr) ACL a lani n (Ala) . GCL Tyrosine (Tyr) SO termination signal .. TAJ termination signal TGA histidine (His) CAK glutamine (Gin) • CAJ asparagine (Asn) AAK Lysine (Lys) AAJ aspartic acid (Asp) CAK glutamic acid (Glu) TEA cysteine (Cys) TGK Tryptophan (Try) TGG Arginine (Arg) WGZ glycine (Gly) GGL Key:

Each group of three letters represents a DNA trinucleotide with 5 ‘on the left and 3 'on the right. Single letters mean purine or pyrimidine bases that form a nucleotide sequence.

A = adenine

G = guanine

C = cytisone

T = thymine

X = T or C when Y and G

X = C when Y is C or T

Y = A, G, C or T when X is C

Eco R1 site - G and AATTC sequence specifically cleaved at the arrow site by Eco R1. . .

Eco RII Endonuclease Site - CCAGG sequence 1 was not CCTGG, specifically cleaved at the arrow site by Eco RII endonuclease.

ITae II endonuclease site - sequence AGCGC I T or AGCGC 1 C or GGCGC t T or GGCGG I C, specifically cleaved at the arrow site by Hae II endonuclease.

Hinc II Endonuclease Treatment Site - GTTAAC or GTCAAG or GTCGAC sequence, specifically cleaved by Hinc II endonuclease.

Pst I endonuclease site _and CTGCA and G sequence, specifically cleaved at the arrow site by Pst I endonuclease.

Sal I on endonuclease site - G and TCGAG sequence, specifically cleaved at the arrow site by Sal I endonuclease

Sst I endonuclease site - GAGCT and C sequence, specifically cleaved at the arrow site by Sst I endonuclease

In proteins of higher organisms, such as vertebrates, many proteins can be found that are of medical or research interest. These include, for example, insulin hormone, other peptide-like hormones, such as growth hormone, blood pressure-controlling proteins, and various enzymes of industrial, medical or research interest. It is often very difficult to obtain these proteins in a usable amount by extraction from organisms, this problem being particularly troublesome in the case of human proteins. It is therefore necessary to find a way in which these proteins can be obtained in sufficient quantities outside the original organism. In some cases, appropriate cell lines can be obtained and maintained as tissue cultures. However, cell growth in tissue cultures is slow, the growth environment is very expensive, the growing conditions must be accurately maintained and yields are relatively low. Often it is very difficult to maintain a cell line with the desired properties.

In contrast, microorganisms such as bacteria can be easily grown in chemically defined nutrient media. The fermentation processes are highly sophisticated and can be well controlled. The growth of organisms is rapid and high yields can be obtained. In addition, some organisms are precisely genetically defined and are actually one of the best defined organisms ever.

For these reasons, it is highly desirable to have a genetic code transfer for proteins of medical importance from the organism in which the protein is normally produced to the microorganism in question. In this way, it would be possible for said protein to be produced by the microorganism under controlled growth conditions so that it could be obtained in the desired amount. It is also possible in this way to substantially reduce the cost and production of this protein. In addition, the possibility of isolating and transferring the genetic sequence that determines the production of a protein to a microorganism with a well-defined genetic structure would be of great value for research into the way the protein is synthesized and for post-synthesis behavior of that protein. In addition, the isolated genetic sequence could be converted to code for different proteins with altered therapeutic or functional properties.

The method according to the invention achieves this objective. The process of the invention involves a variety of reactions, including enzymatically catalyzed reactions. The nature of these enzymatic reactions, if known, is always described at the same time.

Reverse transcriptase catalyzes DNA synthesis in the presence of modified RNA, oligodesoxynucleotide and four desoxynucleoside triphosphate, dATP, dGTP, dCTP, and TTP. The reaction begins with the non-covalent binding of an oligodesoxynucleotide that binds to the 3 ‘mRNA position, then sequentially binds the corresponding desoxynucleotides, as determined by the nucleotide sequence of the mRNA, to the 3‘ position of the growing chain. The resulting molecule contains the original RNA together with complementary DNA that is bound by a single DNA loop. The reverse transcriptase can also catalyze a similar reaction using modified DNA, in which case the resulting product is a compound with two strands of DNA joined together by a single DNA strand loop. These procedures have been described in Aviv H. and Leder P., Proc. Nati. Acad. Sci. USA 69, 1408 (1972) and Efetratiadis A., Kafotos, F. C., Maxam A. P. and Maniatis T., Cell 7, 279 (1979).

Restriction endonucleases are enzymes that are capable of hydrolyzing phosphodiester bonds in the double strand of DNA, thereby breaking the continuity of the DNA strand. When the DNA is in the form of a closed loop, it turns into a linear structure. An essential characteristic of this type of enzyme is that the hydrolytic action occurs only at the site where the specific nucleotide sequence is located. This site is essential for the action of a restriction endonuclease. Enzymes of this type have been isolated from various sources and have been characterized by their site of action in the nucleotide chain.

Some restriction endonucleases hydrolyze phosphodiester linkages in both chains at the same site, other enzymes of this type catalyze the hydrolysis of linkages that are separated by only a few nucleotides, leaving free strands of individual chains that are cleaved from the parent molecule. The terminal portions of these strands may be complementary and may be used to rebuild the hydrolyzed DNA. Since each DNA that can be subjected to digestion with this enzyme must contain a site of its action, the same terminal portions are formed so that heterologous DNA strands released by the above-mentioned enzyme can be joined in this way. These procedures have been described in Roberts, R.J., Crit. Roar. Biochem. 4, 123 (1976). The sites where these enzymes can act naturally occur relatively rarely, but the usefulness of these enzymes has been increased by chemical synthesis of the double-stranded oligonucleotides carrying the enzyme-appropriate sites. In this way, almost any DNA segment can be joined to another segment by simply linking another nucleotide with a restriction endonuclease site at either end of the molecule and then hydrolyzing the resulting product with the appropriate restriction endonuclease to produce the corresponding end as described in Heyneker Η. B., Shine J., Goodman Η. M., Boyer HW, Rosengerb J., Dickerson RE, Narang SA, Itakura K., Lin S. and Riggs AD, Nature 263, 748 (1976) and Scheller RH, Dickerson RE, Boyer HW, Riggs AD and Itakura K. Science 196: 177 (1977). S1-endonuclease is an enzyme that highly specifically hydrolyzes phosphodiester bonds in single-stranded DNA or single-stranded DNA that otherwise contains two strands, as described in Vogt, V. M., Eur. j. Biochem. 33, 192 (1973).

DNA ligase is an enzyme that is able to catalyze the formation of phosphodiester linkage between two DNA segments with 5 ‘phosphate and 3‘ hydroxyl groups, as they can be formed from two DNA fragments. The normal function of this enzyme is to attach a single strand or part of a strand in a double stranded DNA molecule. However, under appropriate conditions, DNA ligase can catalyze the joining of the free ends in a covalent manner as described by Sgaramella V, Van de Sande H. J., and Khorana H. G., Proc. Netl. Acad. Sci. USA 67 1468 (1970).

Alkaline phosphatase is an enzyme whose general ability is to either hydrolyze phosphate esters including 5‘-terminal phosphate DNA.

The next step to be described is to incorporate a specific DNA fragment into a DNA vector, such as a plasmid. A plasmid is a term called an autonomous DNA replication unit, as found in a microbial cell, distinct from the genome of the host cell itself. The plasmid is not genetically linked to the host cell chromosome. A DNA plasmid exists as a double-stranded circular molecule with a molecular weight of the order of several million, although the weight of some molecules is greater than 10 ⁸ , molecules of this type usually make up only a small proportion of the total DNA of a cell. The DNA plasmid can usually be separated from the host cell DNA due to the large size difference of the molecule. Plasmids may proliferate independently of the cell division rate of the host cells, and in some cases their proliferation may be controlled by changes in growth conditions. Although the plasmid exists in the form of a closed ring, it is possible to artificially introduce a DNA segment into the plasmid so that a larger molecule recombinant plasmid is formed without affecting the reproductive capacity of the plasmid or its other ability. The plasmid therefore serves as a suitable vector for transferring a DNA segment into a host cell. The plasmids used to produce recombinant DNA typically contain genes that may be suitable for selection purposes, for example, genes for resistance to certain substances.

The ability to obtain DNA with a specific sequence that is also the genetic code for a specific protein makes it possible to modify the nucleotide sequence chemically or biologically so that the specific protein produced is also modified. In this way, for example, it is possible to produce modified insulin for certain medical purposes. The genetic ability to produce any amino acid chain suitable for incorporation into the insulin chain or having the essential functional properties of insulin can be transferred to the microorganism. Similar conditions can be provided for growth hormone.

The ability to transfer the genetic code for a specific protein necessary for the normal metabolism of a particular higher organism to a microorganism, such as a bacterium, opens up the possibility of culturing that protein in the form of a conventional culture. This also opens up the possibility of obtaining a larger variety of these proteins and gradually replacing them with proteins produced by microorganisms in any case where the ability of a higher organism to produce these proteins normally fails. In this way, for example, it would also be possible to create symbiotic relationships between the microorganisms modified according to the invention with humans with acute or chronic disease, where the genetically determined microorganism could be implanted or otherwise associated with the human organism to compensate for the pathological metabolic state of the sick person.

The invention therefore relates to a method of isolating a specific nucleotide sequence comprising genetic information, synthesizing DNA with a specific nucleotide sequence, and transferring the DNA to a host microorganism.

Accordingly, the present invention provides a method of growing a microorganism ε by containing and replicating a DNA transfer vector with a nucleotide sequence encoding growth hormone by isolating cells containing growth hormone encoding mRNA, extracting and purifying the mRNA from the cells, cDNA is then introduced from the mRNA with a sequence of nucleotides coding for growth hormone and said cDNA is reacted with a DNA transfer vector to produce a DNA transfer vector with a nucleotide sequence coding for growth hormone followed by transformation of the microorganism DNA transfer vector, characterized in that mRNA is extracted from cells containing growth hormone-encoding mRNA by homogenizing said cells in the presence of a ribonuclease inhibitor containing guanidinium thiocyanate and β-mercaptoethanol at a pH of 5.0 to 8.0 to prevent degradation of mRNA by ribonuclease and cDNA is reacted with a DNA transfer vector by first e. nysmatically hydrolyzes a DNA transfer vector with a restriction endonuclease from the Hind III, Hsu I or Eco R1 group to form a DNA transfer vector with reactive ends capable of binding to each other or cDNA with a nucleotide sequence coding for growth hormone and then enzymatically linked said DNA transfer vector with a nucleotide sequence cDNA coding for growth hormone by DNA ligase treatment in the presence of ATP to form a DNA transfer vector with a nucleotide sequence coding for growth hormone.

It will be appreciated that the method of the invention could be adapted for transmission. any desired DNA sequence from a higher organism, for example a vertebrate to any microorganism. A higher organism in this case is defined as a eukaryotic organism with differentiated tissues, that is to say, for example, insects, molluscs, plants, vertebrates, including mammals, such as cattle, pigs, primates and humans. Micro-organism means any micro-organism, whether prokariotic or eukariotic, including bacteria, races and fungi, including yeast. In carrying out the method of the invention, a selected cell population is first isolated in an improved manner. Intact mRNA is extracted from these cells in a new manner, which simultaneously suppresses all ribonuclease activity. Intact mRNA is purified from the extract by column chromatography and then treated with the enzyme reverse transcriptase, which acts in the presence of the four desoxynucleoside triphosphates required to synthesize the cDNA complementary strand. The product of the first reaction using reverse transcriptase is then processed by selectively removing the ribonucleotide sequence. The remaining sequence of desoxynukeotides, which is complementary to the original mRNA, is incubated during the second reaction using reverse transcriptase or DNA polymerase in the presence of four desoxynucleotide triphosphates. The resulting product is a double cDNA structure whose complementary strands are linked together at one end by a single strand loop. This strand is then reacted with a specific nuclease that cleaves the loop. The resulting double-stranded cDNA is then set up at both ends by binding specific DNA that contains sites where a restriction enzyme can act. This addition is catalyzed by the enzyme DNA ligase. The resulting product is then treated with a restriction endonuclease to produce free-ended chains that can complement each other.

The same enzyme is treated with a DNA plasmid which contains sites suitable for the same restriction endonuclease to cleave the polynucleotide strand and produce similar free ends capable of binding to the terminal end of the 3 ', 5 ' -phosphate group. the plasmid could not create an annular structure that would change the host cell. Then, the above-prepared cDNA and DNA plasmid are incubated together in the presence of DNA ligase. Under the reaction conditions described above, viable closed DNA-plasmid species will only be produced if cDNA with the appropriate free ends is present.

The altered plasmid is then inserted into a suitable host cell that has received the altered viable plasmid to determine colony formation with altered properties, such as resistance to certain chemicals. Pure bacterial strains that contain the recombinant plasmid are then grown and the recombinant plasmid isolated again. In this way, large amounts of the recombinant plasmid can be prepared and thus the specific sequence of cDNA can be isolated again by digestion with the appropriate restriction enzyme.

Any desired sequence of nucleotides derived from a higher organism, including humans, can be isolated and transferred to the host microorganism by the basic method of the invention. The method is suitable for transferring the genetic code for a specific protein of medical or industrial importance and for microgiological synthesis of such a protein.

In a similar manner, the nucleotide sequence for rat growth hormone was isolated and this sequence was also transferred and expanded in bacteria. The method of the invention may also be applied to the transfer of a nucleotide sequence isolated from a human, including human insulin, growth hormone and other hormones of a polypeptide nature.

The method of the invention envisages a method of isolating a DMA molecule with a specific sequence of nucleodites, transferring this material to a microorganism, and consequently multiplying the sequence of nuclides in said microorganism.

The sequence of steps involved in the process of the invention can be described in four basic groups.

1. Isolation of a desired cell population from a higher organism

There are two potential sources of genetic code for a specific protein. It is a DNA organism and, moreover, a modified RNA of that organism. According to the common safety regulations adopted by the National Institutes of Health, human genes of any kind can be processed into recombinant DNA and then transferred to bacteria only if the genes have been previously thoroughly purified on a designated device. (Federal Register, Vol. 41, No. 131, July 7, 1967, pp. 27 902-27 943.) This means that for any method that could be used to produce human proteins, it is preferable to isolate specific mRNA with a sequence of This procedure has the added advantage that mRNA is easier to purify than DNA extracted directly from cells, and in particular the fact that specific organisms such as vertebrates can be found to be specific the population of cells at a specific site in the body, with the essential function of all these cells being the production of the desired protein, and that the population of cells may only exist for a transient developmental period of the organism. It is therefore possible to select a preferred cell population and a preferred nucleotide sequence method of isolation in terms of initial purity of isolated mRNA.

In most tissues, glands and other organs, cells are usually associated with a fibrous connective tissue network, which essentially consists of collagen, but may contain other substances, such as proteins, polysaccharides or inorganic substances, depending on the type of tissue. Isolation of cells from a given tissue requires a technique that releases cells from the connective tissue matrix. Thus, the isolation and purification of a specifically differentiated cell type consists of two main steps, namely the separation of cells from connective tissue and the separation of cells of the desired type from other cells of the tissue. By the method of the invention, different cell types can be isolated from different tissue types. An example is the isolation of islets of Langerhans from the pancreas, which is necessary for isolation of insulin mRNA.

Insulin-producing cells can be obtained from other sources, such as the immature pancreas of the calf or from a tissue culture of the tumors of these cells. Isolation of pure islet cells is much easier in these cases, especially in the case of tissue culture. Thus, it will not always be necessary to isolate cells directly from the pancreas, but in some cases this is advantageous.

It can often be shown that the proportion of the desired mRNA can be increased by external influences. For example, hormone treatment may result in increased production of the desired mRNA. Other methods are, for example, growing at a certain temperature, supplying a certain nutrient or other chemical. In the isolation of rat growth hormone mRNA, it was possible to substantially increase the desired proportion of growth hormone mRNA by treating rat pituitary cells grown in tissue culture simultaneously with thyroid hormone and glucocorticoids.

2.Extraction of mRNA

An important object of the method according to the invention is, as far as possible, to completely eliminate ribonuclease activity in the cell extract. Indeed, it is necessary to extract mRNA with a single polynucleotide strand without the additional complementary strand. This implies that hydrolytic cleavage of a single phosphodiester bond in the chain would render the entire molecule unusable for transferring the intact genetic sequence to the microorganism. As already mentioned, the ribonuclease enzyme is widespread, potent and exceptionally stable. It can be applied to the skin, it can withstand the usual washing-up procedures without damage and is often a pollutant for stored organic chemical compounds. The difficulty is particularly evident if it is an extract of cells from the pancreas, since this gland is a source of digestive enzymes and is therefore rich in ribonuclease. However, the problem of this enzyme is associated with all tissues, and therefore a method of removing the ribonuclease activity of the invention is also applicable to all tissues. The exceptional efficacy of this method will be demonstrated in the successful isotation of intact Langerhans islet cell mRNA.

In the method of the invention, a protein-free combination of chaotropic anion, chaotropic cation, and disulfide bond disrupter is used during cell disruption and during all procedures required to isolate RNA. The efficacy of the simultaneous action of all of the above agents has been demonstrated in their use to isolate intact mRNA in good yield from isolated islets of rat Langerhons islets.

The choice of suitable chaotropic ions is based on their solubility in aqueous media and their availability. Suitable chaotropic cations are, for example, guanidine, carbamoylamidine, guanylguanidine, lithium and the like. Suitable chaotrolpic anions are iodide, perchlorate, thiocyanate, diodosalicylate, and the like. For example, lithium dioidsalicylate is more effective than guainidine thiocyanate, but its solubility is only 0.1 N and, moreover, is relatively expensive. Guanidinium thiocyanate is the preferred combination of cations and anions because it is readily available and highly soluble in aqueous media up to a concentration of 5 M.

Thiol compounds, for example, β-mercaptoethanol, are known to disrupt intramolecular disulfide bonds in proteins by double-swapping. A variety of thiol compounds are known to be effective in this sense, for example .beta.-mercaptoethanol, dithiotreitol, cysteine, propanoldimenkaptan, and the like. it was possible to complete a double substitution. The preferred embodiment in this sense, β-iinerikaptoethanol because it is easily available and ^one relatively inexpensive.

In inhibiting ribonuclease during RNA extraction from cells or tissues, the efficacy of a given chaotroipic salt is directly dependent on its concentration. Therefore, the most preferred concentration is at the same time the highest available concentration. The success of the method of the invention while maintaining intact mRNA during extraction depends on the rate at which the ribonuclease is denatured and, moreover, the degree of denaturation. This appears to give the advantage of using guanidinium thiocyanate over hydrochloride, although otherwise hydrochloride is only slightly less effective as a co-denaturing agent. The efficacy provides an answer to why guanidinium, thiocyanate is preferable to relatively equally soluble hydrochloride, the reason being that the former is a slightly stronger denaturant.

The disulfide-bonding agent is used in admixture with a denaturing agent because it has a potentiating effect on the riboniaclease turf. The thiol compound prevents rapid renaturation, which may occur if the intramolecular disulfide bonds remain intact. Furthermore, it is achieved that any additional ribonuclease remaining in the isolated RNA would remain ineffective even in the absence of the denaturant. Disulfide-disrupting thiol compounds are effective at any concentration, although it is preferable to use a large excess of thiol groups relative to the intramolecular disulfide linkages to ensure successful intramolecular cleavage. On the other hand, it has to be considered that many thiol compounds have an unpleasant odor, especially at higher concentrations, so that in practice there is an upper limit of their concentration. When using 3-mercaptoethanol, effective concentrations are in the range of 0.05 to 1.0 M, the optimal concentration for isolation of intact RNA from rat pancreas is 0.2 M.

The medium in which the mRNA is extracted from the cells should have a pH in the range of 5.0 to 8.0.

After cell disruption, RNA is separated from DNA and other cellular proteins. A number of methods have been developed for this purpose, all of which are useful and described in the literature. A common method is ethanol precipitation, where RNA is selectively precipitated. A preferred method for use in carrying out the process of the invention is to omit the precipitation step and to deposit the homogenate directly onto the solution

5.7 M Precium chloride in a centrifuge tube followed by centrifugation as described in Glisin. V., Grkvenjakov R., and Byus C., Biochemistry 13, 2633 (1974). This method is most advantageous because it maintains the environment that is unfavorable to the ribonuclease and maintains a high yield RNA, free of DNA and protein.

The above method can be used to obtain purified RNA from the cellular hernia, genate. Only part of this RNA is the desired mRNA. In order to further purify the desired fraction, it is advantageous to take advantage of the fact that, in the cells of higher organisms, the mRNA, upon its formation, is further assisted by the cell by polyadenyloic acid binding. This portion of the mRNA containing the polyadenylic acid sequence can be selectively isolated by ehromatography on a cellulose column bound to an oligothymidylate according to the method of Aviv R. and Leder P., supra. The above procedures are sufficient to obtain pure, intact mRNA from ribonuclease-rich sources. Further purification of this portion and other in vitro procedures can be performed essentially the same for any type of mRNA regardless of source.

In certain circumstances, for example, where the source of mRNA is a tissue culture, ribonuclease contamination may be so low that it is not necessary to use the above-described method of ribonuclease inhibition. In these cases, conventional methods used to reduce ribonuclease activity are sufficient.

3. Generation of cDNA

FIG. 1 schematically illustrates a process relating to the remaining steps of the process of the invention. The first step is to generate a sequence of complementary DNA to the purified mRNA. The enzyme used for this reaction is usually reverse transcriptase, although in principle any enzyme can be used to generate a complementary DNA strand using mRNA as a support. The reaction can be carried out under conditions described in the known literature using mRNA and a mixture of four desoxynucleoside triphosphates as a DNA chain precursor. It is preferred that one of the desoxynucleoside triphosphates be used in the ³² P-labeled form at the a position to monitor the progress of the reaction and isolate the product in time after separation of the ballasts, for example by ehromatography or electrophoresis. Radioactive phosphorus labeling is also advantageous for quantitative determination of yield as described in Efstratiadis A., et al., Supra.

As further shown in Fig. 1, the product of the reverse transcriptase reaction is a double stranded hairpin structure with a non-covalent bond between the RNA strand and the DNA strand.

The product of the reaction using reverse transcriptase is removed from the reaction mixture in a conventional manner. It has been found advantageous to use a combination of phenol extraction, Sephadex S-100 chromatography (Pharmacia Inc, Uppsala, Sweden) and ethanol precipitation.

Once enzymatic cDNA synthesis has taken place, the base RNA can be removed. A variety of methods for selectively degrading RNA in the presence of DNA are known in the literature. The preferred method is alkaline hydrolysis, which is highly selective and can be easily controlled by adjusting the pH.

Optionally, after alkaline hydrolysis followed by neutralization, ³² P-labeled cDNA can be concentrated by ethanol precipitation.

Hairpin-shaped double-stranded cDNA synthesis is accomplished using an appropriate enzyme, such as DNA polymerase or reverse transcriptase. Reaction conditions similar to those described above, including the use of labeled nucleoside triphosphate, in position and radioactive phosphate, are used. Reverse transcriptase can be obtained from a variety of sources. A suitable and common source is avian myeloblastosis virus. This virus can be obtained from Dr. Haard, Life Sciences Incorporated St. Petersburg, Florida, where the virus is proidulized in collaboration with the National Institutes of Health.

After formation of the hairpin cDNA, it may be desirable to recover purified DNA from the reaction mixture. As mentioned above, it is advantageous to use phenol extraction, Sephadex G-100 column chromatography and ethanol precipitation to obtain purified protein-free DNA.

The hairpin-like structure can be converted to a conventional double-stranded DNA structure by removing a single loop that connects the two ends of the complementary strands. A variety of enzymes that are capable of hydrolytically cleaving single DNA strands can be used for this purpose. A suitable enzyme of this use is SI nuclease isolated from Aspergillus oryzae. This enzyme is available from Miles Research Products, Elkhart, Indiana. Treatment of the hairpin-shaped DNA structure with SI nuclease in a high yield yields a cDNA molecule with the appropriate end. Extraction by chromatography and ethanol precipitation as described above gave the purified product. The use of reverse transcriptase and SI nuclease in the synthesis of double-stranded cDNA as a structure corresponding to mRNA has been described in Efstratiadis et al., Supra.

If desired, the proportion of the corresponding end-cDNA molecule can be increased using E. coli DNA polymerase in the presence of four desoxynucleoside triphosphates. The combination of the exonulklease and polymerase activity of this enzyme has the effect of removing the 3 vol free ends and binding at all 5 zakon ends. This ensures maximum participation of the cDNA molecule in subsequent binding reactions.

A further step of the method according to the invention is to treat the ends of the cDNA so obtained in order to obtain sequences having suitable restriction endonuclease sites. The choice of the DNA fragment that binds to these ends depends on the reaction possibilities. The sequence to be attached to these ends is selected according to the restriction endonuclease chosen, and the choice of this enzyme further depends on the choice of DNA-tagger, which is intended for the combination of cDNA. The selected plasmid should contain at least one site at which a restriction endonuclease may act. For example, plasmid pMB9 contains one site in which the restriction enzyme Hind III can act. Hind III was isolated from Hemophilus influenzae and purified according to the method of Smith H. O. and Wilcox K. W., J. Mol. White. 51, 379 (1970). A similar Hae III enzyme from Hemophilus aegypticus is purified as described in Middleton JH, Edgell NR and Rutchison III, CA, J. Virol. 10, 42 (1972). The enzyme from Hemophilus suis, designated Hau I , catalyzes epecifically by hydrolysis at the same site as Hind III, so these two enzymes can be interchanged as far as function is concerned.

It is preferred to use a chemically synthesized double stranded decanucleotide that contains a site where Hind III can act and to bind the strand to the ends of the cDNA. The double stranded decanucleotide has the sequence shown in Figure 1 and has been described by Heyneker H. L. et al. And Scheller R. N. et al. A variety of similar sequences are available which contain a site where the restriction enzyme can act so that the double stranded DNA ends can be occupied so that the resulting substance is sensitive to any restriction endonuclease selected.

Coupling of the above sequences with restriction endonuclease sensitive sites to the ends of the cDNA can be accomplished by any known method. A highly preferred method is a DNA ligase-catalyzed method purified by the method of Panet A. et al. Biochemistry 12, 5045 (1973). The binding reaction was described in Ggarellell, supra. The product of this reaction between the cDNA and the large molar excess of the double-stranded decanucleotide containing sites suitable for Hind III restriction endonuclease is cDNA with the indicated strands at each end. When treated with Hind III, this reaction product cleaves at the above sites to form a single 5 5 chain that can complement each other as shown in Figure 1.

4. Creation of vector for transfer of DNA recombinants

In principle, large amounts of virus and plasmid DNA can be used to generate recombinant cDNAs prepared as described above. The essential requirements are that the selected vector for DNA transfer can be incorporated into the host cell, so that it can be propagated in that cell, that the vector contains a genetic determinant, by means of which the host cells containing the vector can be separated. From a safety point of view, it is necessary to limit the choice of these vectors so that the vectors meet the requirements of the National Institutes of Health (NIH). The list of permitted DNA transfer vectors is continually expanded with the discovery of new vectors and subject to approval by the NIH Recombinat DNA Safety Committee, and the invention contemplates the possible use of any DNA of viral or plasmid origin with the necessary capabilities, including those that will only be allowed by the NIH. Suitable vectors that are already allowed include a variety of lambda bacteriophage derivatives (Blattner, FH, Williams DG, Blech! AN, Denniston-Thompson, K., Faber, N., Furlong LA, Grunwald DJ, Kiefiar DO, Hoore. DD, Schumm, JW, Sheldon, W, L., and Smithies, O., Science 19B, 161 (1977)) and col E1 plasmid derivatives, as described, for example, in Rodrigeuez RL, Bolivar S., Goodman. M., Boyer HW and Betlach Μ. N. ICN-UCLA Symposium on Molecular Mechanism In The Control of Gene Expression, DF Hierlich, WJ Rutter, OF Fox, Eds (Academic Press, NY, 1976), pp 471-477. Col E1 derived plasmids are relatively small their molecular weight is of the order of several million and has the property that the copy number of plasmid DNA in a single host cell can be increased from the usual 20 to 40 to 100 or more by treating the host cell with chtoramphenicol. The ability to increase the amount of gene in a host cell makes it possible, under certain conditions, to force the host cell to produce primary proteins whose codes are carried by the genes contained in the plasmid. These col E1 derivatives are therefore preferred vectors for use in practicing the method of the invention. Suitable col E1 derivatives are, for example, plasmids pMB9 carrying a tetracycline resistance gene and plasmids mPR-313, pBR-315, pBR-316, pBR-317 and pBR-322, which contain, in addition to the tetracycline resistance gene, a resistance gene ampicillin. The presence of resistance genes is an advantageous feature for recognizing cells that have been successfully infected with the plasmid, since colonies of such cells will grow in the presence of the substance, whereas cells that do not contain the plasmid will die. In the experiments described above and in the examples below, a plasmid derived from col E1 was used, which contained, in addition to the gene for resistance to a particular substance, a Hind III site.

As in the plasmid selection, the host cell can be selected from a relatively wide range of options, but this amount has to be narrowed for safety reasons.

Plasmid pBR322 was similarly described in Bolivar F. et al., Gene, 2, 95 (1977), which describes the synthesis and properties of this plasmid. Plasmid pBR322 has a molecular weight of 2.7 X 10 ^s daitons (controlled by Bolivar F. Gene, 4, 121 (1978)) and carries the ampicillin resistance gene (Ap ^R and the tetracycline resistance gene (Tc ^R ). restriction endonuclease site Pst I in the Ap ^R gene carries a single Hind III, Dal I and Bam HI endonuclease site in the Tc ^{R region} . In addition, plasmid pBR322 carries a single Eco RI site, two Hinc sites II, five Eco RII sites, three Bgl I sites, twelve Alu I sites, twelve Hae II sites, and seventeen Hae III sites. For a detailed description of these sites in plasmid pBR3I2, see page 103. If the pBR322 plasmid is cleaved, the Aβ ^R gene is lost, and the DNA can be inserted into the Pst I restriction endonuclease site. For example, with the restriction endonuclease Hind III or Sal I or Bam HI incorporating DNA, the Tc ^R gene is lost. When DNA is inserted into the Pst I site, recombinant molecules can be found in selection for ampicillin-sensitive colonies (Aβ ^with a Tc ^R. Similarly, when the DNA is inserted into a Hindi site III, Sal I or Bam HI, recombinant molecules can be found in the selection of colonies that are Aβ ^R and Tc ^s . The vector containing the foreign DNA inserted at any of the four sites can be characterized with respect to antibiotic resistance such as Aβ ^s. Tc ^R and Ap ^R Tc ^s. the vector can be further characterized by removing the DNA insert and determining the molecular weight of the starting materials. further characterization can be accomplished by constructing the complete map of sites for restriction endonucleases in the vector. it is also possible to determine the sequence of the DNA insert.

Plasmid pBR313 has also been described in detail. The synthesis and properties of this plasmid have been described in Bolivar F. et al., Gene 2, 75 (1977). Plasmid pBR313 has a molecular weight of 5.8 X 10® daitons and contains an ampicillin resistance gene (Ap ^R J and a tetracycline resistance gene (Tc ^R J). This plasmid contains a single site for the restriction endonuclease action of Hind III, Sal I and Bam HI in the Tc region A complete analysis of the plasmid pBR313 was performed and a map of restriction endonuclease sites was constructed as shown on page 84. Incorporating foreign DNA into any Hind III, Sal I or Bam HI site there is a loss of Tc ^R. it is therefore possible to find the recombinant molecules to select for strains having Ap ^R and Tc ^seconds. the vector may be characterized antibiotic resistance sequence with a molecular weight of DMA.

The third plasmid that has been described in detail is pMB9. This plasmid can be prepared according to Rodriguez RL et al., Supra, and Bolivar R. et al. Gene 2, 75 (1977). Plasmid pMB9 has a molecular weight of 3.5 X 10 ⁶ daitons and contains a gene for resistance to tetracycline Tc ^R. It has a single site for the action of each of the Eco RI, Hind III, Sal I or Bam HI endomeasases. The site of action of the last three endonucleases is found in the Tc ^R gene. When foreign DNA is inserted into the Hind III, Sal I or Bam HI treatment site, Tc ^R is lost. A vector containing foreign DNA in one of those sites can be characterized by this property. This vector can further be characterized by analyzing the DNA sequence of the incorporated portion, by comparing the molecular weight with the analysis of sites for action of endonucleases.

Plasmid pSCIO1 has also been described in detail in Cohen SH et al., Proc. Nat. Acad. Sci. USA, 70, 1293 (1973) describes the synthesis and properties of this plasmid. Additional properties of the plasmid can be found in Cobs, SN, et al., Proc. Nat. Acad. Sci. USA, 70, 3240 (1973), Boyer JW et al., Recombinant Molecules, Bears II. F. and Basset EG, Eds, Raven Press, New York on page 13 (1977) and Cohen SN et al., Recombinant Molecules, on page 91. The plasmid pSCIO1 has a molecular weight of 5.8 XX10 ^s daltons and contains the gene for resistance to tetracycline Tc ^R. In the region of this gene, it contains a single site for the treatment of each of the Hind III, Sal I and Bam HI endonucleases, plus a single Eco RI site, one Hpa I site, one Srna I site and four sites for Hinc II treatment. When this plasmid is digested with Hind III, Tc ^R is lost, and the same is true for Sal I or Bam HI cleavage when DNA is inserted into either of these sites. The vector containing the foreign DNA at any of these sites can be characterized by a loss of antibiotic resistance and the vector can be further characterized (with the removal of the inserted DNA and the determination and comparison of moiety). (b) constructing a map of sites for action of endonucleases; and (c) determining the sequence of the inserted DNA.

Phages for vectors contains! for example, lambda phage derivatives which are called Charon, in particular Charon 3A, Charon 4A and Charon 16A. These phages have been described in detail. Blatner et al., Supra, describe the synthesis and properties of these phages. These phages were also mapped, including endonuclease sites, as shown on page 161 of the above publication. The genotype of each phage is shown on page 164 together with the result of cleavage at different sites. For example, when incorporation of foreign DNA into the Eco RI Charon 16A, causes the loss of the gene lac 5th growth of recombinant phage on bacteria Lac ^- results in the formation of colorless colonies. This means that the vector containing the foreign DNA at the appropriate site can be characterized by genetic properties, such as colorless spots on the lac ^- bacteria. The vector can be further characterized by removal of the inserted DNA and determination of the molecular weight of both products from a simultaneous comparison with the molecular weight of the starting products. Further characterization can be accomplished by constructing a map of endonuclease sites in the vector. It is also possible to detect the sequence of the inserted DNA.

'AgtWES.AB, a derivative of lambda bacteriophage, has been described equally well. The synthesis and basic properties of this phage have been described in Tremaier D. et al., Nature 263, 526 (1976 J.). Further features of this phage have been described in Leder P. et al., Science, 196, 175 (1977). The second publication also identifies the placement of both Eco RI and Sst I restriction endonuclease sites. This phage contains four Bam HI sites to yield 5.4 X 10 ³ fragments,

19.3 X 10 ³ , 3.8 X 10 Cl ³ and 11.4 X 10 ³ base pairs. The analysis of restriction endonuclease sites is shown on page 527 of the above publication. The ambda B fragment is removed with Eco RI and digested with Sst I. This avoids recombination with lambda B. It is also possible to incorporate foreign DNA with Eco RI digestion sites into the phage at the Eco RI digestion site. Phages can be cloned by in situ hybridization as described by Benton WD and Davis HW, Science, 196, 180 (1977). The vector may be characterized by (a) removing the inserted DNA and determining and comparing molecular weights, (b) analyzing restriction endonuclease sites and (c) determining the sequence of the inserted DNA.

An E. coli strain, designated X-1776, has been developed and NIH approval has been obtained for use of that strain and using the P2 apparatus as described in Curtiss, III, R., Ann. Roar. Microbiol., 30, 507 (1976). E. coli RR-1 is suitable when a P3 type device can be used. As in the case of plasmids, it is understood that any host cell strain is contemplated in the delivery of the method of the invention if the strain is capable of transmitting the selected vector, including non-bacterial hosts such as yeast, if such strains NIH will be allowed in the future.

Recombinant plasmids are produced by mixing a plasmid DNA that has been treated with a restriction endonuclease with cDNA and appropriately treated end groups. In order to minimize cDNA binding to each other, the plasmid is added in a large molar excess. In the previously described methods, the addition of the plasmid in a large excess usually resulted in the binding of the plasmid chains to the ring without simultaneously incorporating the cDNA fragment. The cells so treated usually contained predominantly a plasmid without recombinant cDNA. As a result, the process was very time consuming. Attempts have therefore been made to obtain DNA vectors with a restriction endonuclease site in the middle of the gene of choice, thus incorporating the recombinants splits the gene, thereby causing a function coding for that gene to be lost.

Preferably, a method is used to reduce the number of colonies to be monitored when using a recombinant plasmid which is first treated with a restriction endonuclease and is treated with alkaline phosphatase, which is available from several sources, such as the Warthington Biochemical Corporation, Freehodl, New Jersey. Alkaline phosphatase removes 5'-terminal phosphate groups from the ends of the plasmids after endonuclease treatment, thereby preventing the end portions of the DNA plasmids from binding together. As a result, ring formation depends on the incorporation of a DNA fragment containing 5'-ter22 of the minimal phosphate groups. In the above manner, the relative frequency of transformation without recombination can be reduced to less than 1 to 10 ⁺⁴ .

The invention is based on the fact that the DNA ligase catalyzed reaction is carried out between the 5 'phosphate end group of the DNA and the 3' hydroxyl end groups of the DNA. The reaction does not occur if the terminal 5 odst-phosphate groups are removed. When double-stranded DNA binds, three types of situations can occur as shown in Table I.

Table I

Case Reactants AND 3 ‘ 5 ‘ OH H2O3PO + OPO3H2 HIM 5 ‘ 3 ‘ II 3 ‘ 5 ‘ OH HžOjP — 0 + OH OH 5 ‘ 3 * III 3 ‘ 5 ‘ OH HIM + OH HIM 5 ‘ 3 ‘

Product after use of ligase

3 ‘5‘

O — P — O + 2HzO

O — P — o

5 ‘5‘

5 ‘5‘

O — P — O + H ₂ O

OH HO

5 ‘3‘

About reaction

In Table I, the double-stranded DNA is schematically represented by solid parallel lines, corresponding to the 5‘- and 3 skupiny-end groups, and are labeled with a hydroxyl or phosphate residue according to their nature. In case of I, 5‘-phosphate is present at both ends, resulting in covalent bonding of both chains. In case II, only one chain has a terminal 5 ' -phosphate moiety, so that after covalent bonding the discontinuity remains on the other chain. A chain that is not covalently bound remains linked to the bound molecule by hydrogen bonds that occur between the two chains, as is known in the literature. In case III, there is no binding at any of the termini, since they do not contain a 5‘-phosphate group.

Undesirable binding reactions can be prevented by removing 5 ^: -phosphate groups from the non-terminal ends. Any method for removing 5'-phosphate groups can be used for this purpose as long as the DNA structure is not disrupted. A preferred procedure is an alkaline phosphatase catalyzed hydrolysis.

Similarly, the cDNA code for rat growth hormone was isolated, recombined with the plasmid, and transferred to E. coli cells. In this way it was possible to re-isolate a nucleotide sequence of approximately 800 nucleotides after successful propagation in E. coli cells, which sequence contained all of the code for rat growth hormone including portions of the peptide precursor and a portion of the 5‘-region that was not transferred.

In general, the above method can be used to isolate and purify any gene from a higher organism, including human genes, and to transmit and multiply these genes in the cells of microorganisms. The novel recombinant plasmids contain all or part of the isolated gene as described above. New microorganisms, which are still unnamed, have also been described, whose genetic system has been modified to include genes from a higher organism. Specific examples will now be described in which each step of the method of the invention will be described in detail with respect to the isolation, purification and transfer of the rat insulin gene to E. coli cells, thereby explaining in more detail the applicability of the method of the invention. The following examples also characterize recombinant plasmids that contain a portion of the rat insulin gene, the rat growth hormone gene, the human222233 insulin gene, and the human growth hormone gene.

The invention will be illustrated by the following examples.

Example 1

The described procedures illustrate the extraction and isolation of rat insulin insulin mRNA, the synthesis of complementary DNA and the description of the properties of complementary DNA. Purified rat islets of Langerhans can be obtained by infusing the pancreas of anesthetized rats with Hanks ' s solution by retrograde infusion through the gland duct. Hanks' solution is a standard salt mixture, known and available from a number of manufacturers, for example, the Grand Island Biological Supply Company, Grand Island, New York. The pancreas is then removed, crushed in Hanks' solution at 0 ° C and digested with collagenase and soybean trypsin. All procedures are performed at 0-4 ° C unless otherwise noted. In particular, it is necessary to maintain these conditions when digesting the gland. Two rat pancreas in 8 ml Hanks medium are placed in a 30 ml glass tube. All glass tubes were pretreated with silicone. Siliclad (Clyy-Edams Didision, Becton-Dickinson Inc., Persippany, New Jersey) was used for this purpose. The incubation mixture contained 12 mg of collagenase, an enzyme prepared from Clostridium histolyticum as described by Handl Y. , Mackennan JD and Howes EL, J. Clin Invest. 32, 1323 (1943), used type CLS IV (Torthington Biochemical Corporation, Freehold, New Jersey) and 1 mg soybean trypsin inhibitor, (Sigma Chemical Company, St. Incubation should be carried out at 37 ° C for 25 minutes with constant shaking at 90 oscillations per minute, and the mixture should be observed at all times to ensure that collagenase digestion is optimal. If the incubation is too short, Langerhans islet cells are not completely released, whereas if the incubation is too long, the cells are disrupted. Centrifuge at 200 g for 1 minute. Decant the supernatant and wash the segment with Hanks' solution and repeat the procedure 5 times. After the last centrifugation, the sediment is suspended in 15 ml of Ficoll (Pharmacie Chemical Company, Uppsala, Sweden) at a density of 1.085. A 1.080 Ficoll layer and a 1.060 Ficoll layer of 5 ml are then added, after which the tube is centrifuged for 5 minutes at 500 g and then for 5 minutes at 2000 g. As a result, the acine cells remain at the bottom of the tube and a layer between the two upper layers of the formulation. The islet cell band also contains genglion cells, lymphatic cells and connective tissue cells. However, large frag24 ments were removed. The cells thus obtained are placed under a microscope under which visible contaminants can be removed manually using a micropipette. The cells are then diluted with Hanks solution and centrifuged again. The supernatant is decanted and the sediment is stored in liquid nitrogen.

Islet cells from 200 rats are homogenized together in 4 N guanidinium thiocyanate (Tridom, Pluka AB Chemische Fabrik, Bachs, Switzerland) containing 1 M / S-mercaptoethanol and a buffer that maintains the pH of the solution at 5.0 at 4 ° C. . The homogenate is layered on 1.2 ml of 5.7 M cesium chloride solution containing 100 mM ADTA and the solution is centrifuged at 37,000 rpm for 18 hours in a SW 50.1 ultra-centrifuge solution at 15 ° C. (Beckman Ultracentrifugs Instrument Company, Fullerton, Calif.) When centrifuged, RNA reaches the bottom of the tube.

RNA with polyadenylate groups is isolated by chromatography of all RNA on oligo- (dT) -cellulose as described in Aviv H., and Leder, supra.

F.

Reverse transcriptase from avian myeloblastosis virus (D.J. Beard, Life Science Inc, Stt. Petersburg, Florida) is then used to transfer the entire islet polyadenylate RNA structure from rat islets to cDNA. The reaction is performed in 50 mM hydrochloric acid tris buffer, pH 6.3, containing 9 mM MgCl 2, 30 mM NaCl, 20 mM S-mercaptoethanol, 1 mM each of 3 nonradioactive desoxyribonucleoside triphosphates, 250 μΜ of the fourth labeled desoxynucleoside triphosphate. or radioactive phosphorus with a specific activity of 50 to 200 curie per mole, 20 µg / ml oligo-dT.i.2-18 (Collaborative Research, Waltham, Massachusetts), 100 µg / ml polyadenylated RNA with 200 units / ml reverse transcriptase. The mixture was incubated at 45 ° C for 15 minutes. Ethylenediaminetetraacetic acid sodium salt is then added to a concentration of 25 mM and the solution is extracted with an equal volume of water-saturated phenol, then the aqueous phase is chromatographed on a 0.3 X 10 cm column containing Sephadex G-100 in 10 mM tris buffer hydrochloric acid at pH 0.9 containing 100 mM NaCl and 2 mM EDTA. The nucleic acid is precipitated with ethanol after addition of ammonium oclaria at pH 6.0 to a concentration of 0.25

M. Collect the precipitate by centrifugation, dissolve the sediment in 50 μl of freshly prepared 0,1 N sodium hydroxide solution and incubate at 70 ° C for 20 minutes to hydrolyze RNA. The mixture was then neutralized by addition of 1 N sodium acetate at pH 4.5 and ³² P-cDNA was ethanol precipitated and redissolved in water. Single chain cDNA fractions were analyzed on polyacrylamide gel as described by Dingman CW and Pesopek AC, Biochemistry 7,

659 (1968). The gel was dried and ³² P-cDNA was detected by autoradiography on a Kodak Wo-Screen NS-2T film (Hustman Kodak Corporation, Rochester, New York). The material was heterodisperse as judged by electrophoresis. It contained at least one major species of 450 nucleotides cDNA, as evidenced by comparison with a known standard.

Example 2

In this example, the synthesis and properties of the double-stranded cDNA containing the sequence of rat insulin as described above will be described. The single strand cDNA of Example 1 is treated with reverse transcriptase to synthesize the complementary strand. The reaction mixture contains 50 mM hydrochloric acid tris buffer, pH 8.3, 9 mM MgCl 2, 10 mM dithiothreitol, 50 mM each of the three unlabeled desoxyribonucleoside triphosphates, 1 mM labeled nucleoside triphosphate and radioactive phosphorus at a specific activity of 1 to 10 curie per mM, 50 µg / ml cDNA and 220 units / ml reverse transcriptase. The reaction mixture was incubated at 45 ° C for 120 minutes. The reaction is adjusted by adding 25 mM aqueous EDTA salt, the mixture is extracted with phenol and chromatographed on Sephadex G-100, then precipitated with ethanol. The reaction product fraction of 500-1000 cpm was analyzed by gel electrophoresis as described in Example 1. A heterodiaporous band of 450 nucleotides was detected by comparison with standard samples. The differences in the DNA reaction products of Example 1 and Example 2 were then independently digested with excess Hae III restriction endonuclease and analyzed by gel electrophoresis. Both products were cleaved by said endonuclease so that two radioactive bands were observed during gel electrophoresis. The band resulting from the cleavage of the double stranded cDNA had approximately the products of this length as the band that resulted from the cleavage of the single strand cDNA.

•

Example 3 * In this example, the binding of decanucleotide chains after Hind III treatment to the double-stranded islet cDNA of Langerhans islets as described in Example 2. The reaction product of Example 2 was double-stranded at a concentration of 2-5 µg / ml. is reacted with 30 units of Si nuclease with an activity of 1200 units / ml (Miles Laboratories, Elkhart, Indiana in 0.03 M sodium acetate at pH

4.6 to 0.3 M sodium chloride and 4.5 mM zinc chloride at 22 ^° C for 30 minutes, then the mixture is further incubated for 15 minutes at 10 ° C. The reaction was constructed by adding tris-buffer to a concentration of 0.1 M, EDTA to a concentration of mM and tRNA from E. coli, prepared according to the method of Ehrenstein G., Methods in Enzymology, SP Colowick, and NO Kaplan, Eds. St. 12A, p. 588 (1967) to an amount of 40 µg / ml. The reaction mixture was extracted with phenol, chromatographed on Sephadex G-100, and the significant ^3Z P-cDNA was precipitated with ethanol. In this way, the paired-ended cDNA molecules required to bind chemically synthesized decanucleotides are obtained in high yield. Hind III decamers were prepared as described by Scheller RH, Dickerson RE, Boyer HW, Biggs AD, and Itakura E., Science 196, 177 (1977). The binding of Hind III decamers to cDNA is carried out by incubation at 14 ° C in 60 mM Tris-buffered saline pH 7.6 in the presence of 6.6 mM magnesium chloride, 1 mM ATP, 10 mM dithiothreitol, 3 mM Hind III decamer ⁵⁰⁰ cpm / pmol and T4 DNA ligase at approximately 500 units / ml for 1 hour reaction, then the mixture is heated at 65 ° C for 5 minutes to inactivate the ligase. Potassium chloride was added to a concentration of 50 mmol, β-mercaptoethanol to a concentration of 1 mM and EDTA to a concentration of 0.1 mM, after which the mixture was digested with 150 units / ml Hsu I or Hind III endonuclease for 2 hours at 37 ° C. Hind III and Hae III endonucleases are commercially available (New England Biol-Labs, Beverly, Massachusetts). The reaction product was analyzed by gel electrophoresis in the same manner as in Example 1, which showed a peak corresponding to a sequence of approximately 450 nucleotides and, in addition, fragments of the Hind III digested decamers.

Example 4

In this example, the formation of the plasmid recombinant and the properties of the recombinant after propagation will be described. The plasmid pMB9 DNA, prepared according to the method of Rodr ^; guez R.L ,, Bolivar F., Goodman Η. M., Boyer ΪΪ. W. and Betlach M., ICN-UCLA Symposium on Moecular and Cellular Biology, DP Wierlich, WJ Rutter, and CF Fox, Eds. (Academic Press, New York 1976) pp 471-477, at the Hind III site using Hau I endonucleases and then blending with a BAPF-type alkaline phosphatase (Worthinton Biochemical Corporation, Freehold, New Jersey). The enzyme is present in the reaction mixture in an amount of 0.1 unit / microgram of DNA, the reaction mixture is incubated in 25 mM Tris buffer with pH 8 hydrochloric acid for 30 minutes at 65 ° C and then extracted with phenol to remove phosphatase . After ethanol precipitation, the plasmid DNA thus obtained is added to a cDNA containing Hind III ends in a molar ratio of 3 moles of plasmid per mole of cDNA. The mixture is incubated in 227033 or 66 mM tris buffer at pH 7.6, the mixture further comprising

6.6 mM magnesium chloride, 10 mM dithiotbreitol and 1 mM ATP. Incubation is continued for one hour at 14 ° C in the presence of 50 units / ml T4 DNA ligase.

The resulting mixture is added directly to a suspension of E. coli X-1776 cells prepared as follows: Stones were grown from a density of 2 X 10 ³ cells / ml in 50 ml of medium containing 10 g / l Trypton, 5 g / ml. 1 liter of yeast extract, 10 g / liter sodium chloride, 2 mM sodium hydroxide, 100 (Ug / ml diaminopimelic acid and 40 (Ug / ml thymine) at 37 ° C. The cells were harvested by centrifugation at 5000 g at 5 ° C for 5 minutes. C, then resuspended in 20 ml cold 10 mM sodium chloride, centrifuged again, and resuspended in 20 ml buffer containing 75 mM calcium chloride, 140 mM sodium chloride and 10 mM pH buffer pH 7.5, after which the cells were allowed to stand on ice for 5 minutes, then centrifuged and resuspended in 0.5 ml of the same buffer, transformed by mixing 100 μΐ of said cell suspension and 50 μ \ of recombinant DNA Incubate at 1 μΐ / ml at 0 ° C for 15 minutes, then at 25 ° C for 4 minutes and at 0 ° C for 30 minutes. The cells are then transferred to agar plates for further growth.

Study of recombinant plasmids is performed at a concentration of tetracycline of 5 pg / ml, the selected recombinant, designated pAU-1, is isolated and the crude plasmid with 2 to 5 μ% DNA isolated from pAU-1 is digested with excess Hau I endonuclease. EDTA to a concentration of 10 mM and 10% sucrose (w / v) and the mixture is separated on an 8% polyacrylamide gel, the DNA having approximately 410 base pairs. In a similar experiment, pBasm32 pBR322 was used as the vector. All conditions corresponded to the above conditions except that the final selection of recombinant clones was performed on plates containing ampicillin at a concentration of 20 µg / ml.

Example 5

The DNA and pAU-1 of Example 4 were further purified by 6% polyacrylamide gel electrophoresis. After elution from the gel, the DNA is labeled by incubation with gamma- ³² P-ATP and the enzyme polynucleotide kinase under the conditions described in Maxama and Gilbert, supra. The enzyme catalyzes the activity of the above-mentioned group of radioactive phosphate at the 5'-end of the DNA. The enzyme is obtained from E. coli as described in Panet A. et al. Biochemistry 12, 5045 (1973). The labeled DNA was digested with Hae III endonuclease as described in Example 2, and the two labeled fragments containing 265 and 135 bases were separated on a polyacrylamide gel under the conditions described in Example 1. The thus isolated fragments were subjected to specific digestion and base sequence analysis as described. Maxam and Gilbert, supra. The sequence shown in Table 1 below is based on the results of the above experiments and the results of similar experiments performed using cDNA and col E1 derived vectors, for example pMB9 and pBR322. With respect to the 5'-end, an unspecified sequence of approximately 50 to 120 nucleotides remains, and the poly-dA segment at the 3'-end is of variable length. This sequence is the most detailed information available so far, it goes without saying that in the course of future experiments some minor changes may be necessary or other parts of the chain will be clarified. The corresponding amino acid sequence of rat preinsulin I starts at the triplet labeled 1 and ends at the triplet labeled 86. Uncertainties remain in the region of the sequence that is underlined by the dashed line.

Example 7

This example will describe the isolation and purification of the DNA with the full sequence of the rat growth hormone gene together with the synthesis of a vector that also contains the full structure of the gene and the modification of the microorganism strain to include the rat growth hormone gene as part of its genetic system .

In the case of genes of non-human origin, cDNA isolation of as high purity as human cDNA is not required under mandatory safety measures.

For this reason, it was possible to isolate cDNAs containing the full-length structure of the rat growth hormone gene by electrophorically isolating DNA of the expected length, i.e., about 800 base pairs, a known length of the amino acid chain of the rat growth hormone. The source of rat growth hormone mRNA was a culture of rat pituitary cells and after subclone of the GH-1 cell line (ATCC) as described in Tachjien A.

, and others Endocrinology 82, 342 (1968). In these cells, when grown under normal conditions, the growth hormone and its mRNA are present in only 1 to 3% of the total amount of poly-Δ-ΡΝΑ. However, it was possible to increase the proportion of the desired mRNA by the synergistic action of thyroid hormone and glucocorticoids. RNA was obtained from 5X10 ⁸ cells in culture suspension and growth hormone production was induced by adding 1 mM dexamethasone and 10 mM l-triiodotryonine to the culture medium four days prior to cell isolation. Polyadenylated RNA was isolated from the cytoplasmic membrane fraction, for example according to the method of Martial JA, Baxter). D., Goodman Η. M. and Saeburg Ρ. H., Why. Nat. Acad. Sci. USA 74, 1816 (1977) and Haneroft FC, Wu G and Zuhay C., Proc. Nat. Acad. Sci. USA 70, 3646 (1973). The mRNA thus obtained was further purified and its structure was transferred to double stranded cDNA as described in Examples 1, 2 and 3. Fractionation by gel electrophoresis showed a weak but distinct band corresponding to DNA of 800 bases in length.

The cDNA thus obtained with the structure transferred from the mRNA was digested with Hha I to obtain two larger DNA fragments after electrophoresis, containing approximately 320 nucleotides for fragment A and 240 nucleotides for fragment B, respectively. The nucleotide sequence and its analysis for fragments A and B were described in Example 5 and showed that these fragments are in fact part of the coding region for rat growth hormone, as judged by the amino acid sequence and compared to the sequences of other known growth hormones that See, for example, Wellis M, and Davies RVN, Crowth Hormone, and Related Peptides (Eds., Copecila, A., and Muller E., eJ, pp. 1-14 (Elsevier, New York, 1976) and Geyhoff MO, Atlas of Protein Sequence and Structure, 5, Vol 2, pp 120-121 (National Biomedical Research Foundation, Washington, DC, 1976) In the case of double stranded and 800 base pair electrophoretically isolated cDNA endonucleases Hha I, the main products of this cleavage were two fragments that corresponded to the lengths of fragments A and B in length

Since this approximately 800 base pair product was not purified to be directly exposed to restriction endonuclease, it was necessary to treat the DNA to remove the unpaired end. Practically this was done by removing the unpaired ends prior to electrophoresis in a solution of 25 μΐ 60 mM Tris-buffer with pH 7.5 and 8 mM magnesium chloride, 10 mM (3-mercaptoethanol, 1 mM ATP and _e 200 , µM of each of the dATP, dTTP, dGTP, and dCTP bases The mixture was incubated with one unit of DNA polymerase I and E. coli at 10 ° C for 10 minutes to exonucleolytically remove the 3'-end and fill DNA polymerase I is commercially available (Boehringen-Mannheim Biochemicals, Indianapolis, Indiana).

The rat growth hormone cDNA of approximately 800 base pairs was further processed with the chemically synthesized Hind III chain-linked Hind III as described in Example 3. Plasmid pBR322, which contains the ampicillin resistance gene and a single Hind III site located in the middle of the genes for tetracycline resistance, it was first treated with Hind III endonuclease and alkaline phosphatase as described in Example 4. The treated plasmid was then ligated to 800 bp rat growth hormone cDNA by DNA ligase as described in Example 3. This reaction was performed. is used to convert E. coli X-1776 cell suspension, which is processed as described in Example 3. Recombinant colonies are distinguished by growth on ampicillin-containing plates and inability to grow on 20 μξ / / ml tetracycline plates. 10 colonies were obtained, all containing a plasmid with 800 base pairs, as released after digestion with Hind. III.

800 base pair rat growth hormone DNA was isolated in preparative amount from pRSH-1 clone (a clone containing growth hormone recombinant) and the nucleotide sequence was determined as described in Example 5. In this case, the nucleotide sequence contained 5'-untranslated portions regions of rat growth hormone; and, in addition, a 26 amino acid sequence that occurs in a protein that is a precursor of growth hormone prior to secretion. The sequence of mRNA that can be derived from the sequence of said gene is shown in Table 2. This sequence is in good agreement with the predicted amino acid result except for positions 1 and 8. The amino acid sequence in rat growth hormone, as described in in Wallis and David, supra, the sequence comprises residues 1 to 43, 65 to 69, 108 to 113, 133 to 143 and 150 to 190.

Table 2 shows the sequence of nucleotides in one of the DNA strands, which strand contains the complete code for rat growth hormone. The corresponding amino acids and their position relative to the terminal at which the free amino groups are located are also shown. Negative number amino acids are amino acids that belong to the growth hormone precursor sequence. The corresponding mRNA sequence is the same except that in mRNA, T is replaced by U.

Table 2 -26

—GTGGACAGATCACTGAGTGGCG Met Ala ATG GCT Ala Asp Ser TGT Gin CAG GCA GAC Thr For Trp Leu Leu Thr Phe Ser Leu Leu Cys Leu ACT CCC TGG CTC CTG ACC TTC AGG CTG CTG TGC CTG Leu Trp For Gin Glu Ala Gly Ala 1 Leu For Ala Met CTG TGG CCT CAA GAG GCT GGT GGT TTA CCT CCC ATG For Leu Ser Ser Leu Phe Ala Asn Ala Wall Leu Arg GCG TTG TCC AGT GTG TTT GCT AAT GCT GTG CTC CGA

Ala CCC Gin CAG His CAC Leu CTG His CAC Gin CAG Leu CTG Ala GCT Ala Asp GCT GAC Thr AGC Tyr TRAY Lys Glu Phe Glu Arg Ala Tyr Ile Pro Glu 40 Gly Gin AAA GAG TTC CAG GGT GCC TRAY ATT COC CAG GGA CAG Arg Tyr Ser Ile Gin Asn Ala Gin Ala Ala Phe Cys CCC MELT TCC ATT CAG AAT CCC CAG GCT GCT TTC TGC Phe Ser Glu Thr 60 Ile For Ala For Thr Gly Lys Glu TTC TCA GAG ACC ATG CCA CCC CCC ACC GGC AAG GAG Glu Ala Gin Aln Arg Thr Asp Met Glu Leu 80 Leu Arg GAG CCC CAG CAG AGA ACT GAC ATG GAA TTG CTT CGC Phe Ser Leu Leu Leu Ile Gin Ser Trp Leu Gly For TTC TCG CTG CTG CTG ATC GAC TCA TGG CTG GGG CCC Wall Gin Phe Leu Ser Arg Ile Phe Thr Asn Ser 100 ALIGN! Leu GTC CAC TTT GTC ACC ACG ATG TTT ACC AAC AGC CTG Met Phe Gly Thr Ser Asp Arg Wall Tyr Glu Lys Leu ATG TTT GGT ACC TCG CAC CCC GTC TAT GAG AAA CTG Lys Asp Leu Glu Glu Gly Ile 120 Gin Ala Leu Met Gin AAG GAC CTG GAA GAG GGC ATC CAG GCT CTG ATG CAG Glu Leu Glu Asp Gly Ser For Arg Ile Gly Gin Ile CAG CTG GAA GAG GGC AGC CCC CGT ATT GGG CAG ATC Leu Lys Gin 140 Thr Tyr Asp Lys Phe Asp Ala Asn Met CTC AAG CAA ACC MELT GAC AAG TTT GAC CCC AAC ATG

160

Arg CGC Ser ACC Asp Asp GAT GAC Ala GCT Leu CTG Leu CTG Lys AAA Asn Tyr Gly GGG Leu CTG AAC MELT Leu Ser Cys Phe Lys Lys Asp Leu His Lys Ala Glu CTG TCC TGC TTC AAG AAG GAG CTG CAG AAC GCA GAG 180 Thr Tyr Leu Arg Wall Met Lys Cys Arg Arg Phe Ala ACC TRAY CTC CGG GTC ATG AAG TGT CGC CGC TTT GCG

Glu Ser Ser Cys Ala Phe

GAA ACC ACC TGT GCT TTC TAG GCACACACTGGTGTCTCTC CGGCACTCCCCCGTTACCCCCT GTACTCTGGCAACTGCCACCCC

Example 8

This example described the isolation and purification of the full-length code of the human growth hormone gene, the synthesis of the plasmid recombinant, which also contains the full structure of the growth hormone gene, and modification of microorganisms to contain the full structure of the human growth hormone gene as part of its genetic system.

The isolation of human growth hormone mRNA is carried out essentially as described in Example 7, except that the biological source of the material is a human pituitary tumor. Five benign human pituitary tumors were used which were rapidly frozen in liquid nitrogen after surgical removal, the tumor weight was 0.4 to 1.5 g, after thawing the tumors were homogenized in 4 M guanidinium thiocyanate containing 1 M mercaptoethanol in the presence of pH buffer 5.0 at 4 ° C. The homogenate was topped with 1.2 ml of 5.7 M cesium chloride containing 100 mM ADTA and centrifuged for 18 hours at 37,000 rpm in a SW 50.1 ultra centrifuge solution (Beckman Instrument Company, Fullerton, California) at 15 ° C. . RNA settles at the bottom of the tube. Further purification using an oligo-dT- and sucrose column was performed as described in Examples 1, 2 and 3. Approximately 10% of the RNA so isolated contained a code for growth hormone as evidenced by incorporating a radiolabeled amino acid precursor into the material in a cell-free system derived from wheat germ containing an anti-growth hormone agent as described in Roberts Β. E. and Patterson Β. M., Proc. Nat. Acad. Sci. USA 83, 2330 (1973). The human growth hormone cDNA preparation was carried out according to the method of Example 7 by gel electrophoresis fractionation and the migration of material to a position of 600 nucleotides in length, followed by selection for cloning. The selected fraction is treated with DNA polymerase I as described in Example 6, after which chains containing sites suitable for Hind III are ligated. The cDNA is then recombined with plasmid pBR322, pretreated with alkaline phosphatase, using DNA ligase. Recombinant DNA is then transformed with E. coli X-1776 and the strain containing DNA for human growth hormone is isolated by selection. The strain containing this DNA is further grown, the DNA for human growth hormone is isolated from the strain and the nucleotide sequence determined. The cloned DNA for human growth hormone contains the code for the complete amino acid sequence in human growth hormone. The first 23 amino acids of human growth hormone form a sequence

H N-Phe-Pro-Thr-Ile-Pro-Le-Ser-Arg-Leu20

Asp-Asn-Ala-Met-Leu-Arg-Ala-His-Arg-Leu-His-Gln-Leu-.

The rest of this sequence is shown in Table 3.

Table 3 shows the nucleotide sequence of a single strand of human growth hormone DNA. The numbering corresponds to the amino acid sequence in human growth hormone, numbered from the end at which the free amino acid is located. DNA sequence except that in mRNA T is replaced by U.

Table 3 24

5 ‘—- G Ala GCC Phe TTT Asp GAC Thr ACC Tyr TRAY Gin CAA Glu GAG Phe TTT Glu CAA Glu · GAA 34 Ala Tyr Ile For Lys Glu 40 Gin Lys Tyr 43 Ser Phe Leu GCC MELT ATG CCA AAG GAA CAG AAG MELT TCA TTC CTG Gin Asn For Gin Thr Ser Leu Cys Phe Ser Glu Ser CAG AAC CCC CAG ACC TCC CTC TGT TTC TCA GAG TCT Ile For 60 Thr For Ser Asn Arg Glu Glu Thr Gin Gin ATT CCG ACA CCC TCC AAC AGG CAG GAA ACA GAA CAC Lys Ser Asn Leu Glu Leu Leu Arg Ile Ser 80 Leu Leu AAA TCC AAC CTA GAG CTG CTC CCC ATC TCC CTG CTG Leu Ile Gin Ser Trp Leu Gin For Wall Gin Phe Leu GTC ATC CAG TGG TGG CTG CAG CCC CTG GAG TTC CTC Arg Ser Wall Phe Ala Asn 100 ALIGN! Asn Leu Wall Tyr Gly Ala AGG AGT GCT TTC GCC AAC AAC CTG CTG TRAY GGG GCC Ser Asp Ser Asn Wall Tyr Asp Leu Leu Lys Asp Leu TGT CAC AGC AAC GTC MELT GAC CTC CTA AAC GAC CTA Glu Glu 120 Gly Ile Gin Thr Leu Met Gly Arg Leu Glu GAG CAA GCC ATC CAA ACC CTG ATG GGG AGG CTG CAA Asp Gly Ser For Arg Thr Gly Gla Ile Phe 140 Lvs Gin CAC GGC AGC CCC CGG AGT 'CCG CAG ATG TTC AAG CAG Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn His ACC TRAY AGC AAG TTC GAC ACA AAC TCA GAC AAC GAT Asp Ala Leu Leu Lys Asn 160 Tyr Gly Leu Leu Tyr Cys GAC GCA CTA GTC AAG AAC TRAY GGG CTG CTG TAG TGC Phe Arg Lys Asp Met Asp Lys Wall Glu Thr Phe Leu TTC AGG AAG GAG ATG GAC AAC GTC GAG ACA TTC CTG Arg Ile 180 Wall Gin Cys Arg Ser Wall Glu Gly Ser Cys CGC ATC CTG CAG TGC CGC TCT CTG GAG GGG AGC TGT

191 Gly Phe GGC TTC

Example 1a

TAG CTCCCCCTGCCATCCCTGTGACCCCTCCCCAGTGCCTCTCC TGGG

Example 1b

3 ‘

The procedure of Example 1 is repeated, but the concentration of (3-mercaptoethanol varies with islet cell homogenization. The concentrations of (3-mercaptoethanol used are 0.05 M, 0.2 M, 0.6 M and 0.8 M, respectively). concentrations of β-mercaptoethanol gave the same results, i.e. degradation of the mRNA by ribonuclease was excluded.

The method of Examples 1 and 1a is repeated, but the pH of guanidinium thiocyanate and β-mercaptoethanol are altered when islet cells are homogenized. PH 6.0, 7.0 and 8.0 were used. At all these values, the same results were obtained, i.e., the degradation of the mRNA by the ribonuclease could be prevented.

3S

Example 3a 'Eco R1 site binding decanucleotides were ligated to the cDNA of Example 2 in the manner described in Example 3. Eco R1 site decamers were prepared as described in Scheller et al., Supra, and having sequence 5 CCGAATTCGC-3. ¹ . After binding, the product is treated with Eco R1 under the same reaction conditions as described for Hsu I or Hind III. Eco RI is commercially available (New England Biolabs). The reaction product was analyzed by gel electrophoresis in the same manner as in Example 1 and a peak corresponding to a sequence of approximately 450 nucleotides apart from the fragments of the cleaved decamer was observed.

Example 4a ij The procedure of Example 4 was repeated using plasmid p3R322, prepared according to Bolivar et al., Gene 2, 95, (1977) instead of plasmid pMB9 DNA. All conditions were maintained except for the final selection of the recombinant clones ktedá is done on plates containing 20 _l .mu.g / / ml tetracycline. The incorporated portion was removed as described above to yield 410 base pair DNA of the sequence shown in Table 1.

The method of Example 4 was repeated using plasmid pBR322 DNA prepared according to Bolivar et al., Gene 2, 75 (1977) instead of plasmid pMB9 DNA.

All conditions were retained except for the final selection of recombinant clones, which performed as described above, yielded 410 bp DNA with the sequence shown in Table 1.

The procedure of Example 4 was repeated using the plasmid pSCIO1 DNA prepared by the method of Cohen et al., Proc. Nat. Acad. Sci. USA, 70, 1293 (1977) instead of plasmid pMB9 DNA. All conditions are maintained including selection of recombinant clones. The insert is removed as described above to obtain 410 bp DNA with the sequence shown in Table 1.

Example 1 a d 4b

The procedure of Examples 4 and 4a was repeated except that E. coli RRI or E. coli HB101 was used instead of E. coli X-1776. All conditions are otherwise maintained and the same results have been achieved.

EXAMPLE 1 a d 4c

i) Charon 16A DNA prepared as described in the above-mentioned Blattner publication is used as the transfer vector. Terminations were combined by incubation at 42 ° C for minutes in 0.1 M tris-HCl, pH 8.0 and 10 mM magnesium chloride. The vector was digested with Eco R1 endonuclease at its site and then treated with alkaline phosphatase as in Example 4. After ethanol precipitation, the phosphatase treated cDNA vector was added to cDNA containing the Eco R1 digestion at a 2 molar ratio of 2 moles of vector to 1 mol cDNA. The mixture was ligated with T4 DNA ligase as in Example 4. The mixture was directly added to the E. coli X-1776 cell suspension prepared according to Example 4, and transformation was also performed according to Example 4. Recombinant phages were isolated and cultured on lac bacteria on plates containing 80 [mu] g / ml of 5-chloro-4-bromo-3-indolyl- [beta] -D-galactoside (X6J), recombinant phages containing cDNA were isolated, inserted into the Eco R1 Charon 16A treatment site The recombinant after selection is isolated and treated with an excess, endonuclease Eco R1, and the mixture is analyzed as in Example 4 and

5. The 410 base pair DNA was obtained with the sequence shown in Table 1. The mixture can also be used to generate recombinant phage in vitro as described by Sternberg N. et al., Gene 1, 255 (1977). Recombinant phage properties can also be demonstrated by in situ hybridization as described by Benton W. D. and David R. W., Science 196, 180 (1977).

ii) Charon 3A DNA, prepared as described in the above Blattner publication, is used as a vector instead of Charon 16A DNA. Otherwise, the conditions described for Charon 16A DNA are retained. Recombinant phage selection is performed by culturing phage on lac ⁺ bacteria on X6-containing plates with colorless plaque isolation and then hybridizing or restriction endonuclease treatment as also described in the above-mentioned Blattner publication. The incorporated portion was removed as described above to obtain 410 bp DNA with the sequence shown in Table 1.

(iii) AgtWES. AB DNA, prepared as described in Tiemier et al., Is used as a vector instead of Charon 16A. All conditions are otherwise the same as Charon 16A. Selection of recombinant phages is performed by hybridization according to Benton and Davis, supra. The insert is removed to give 410 bp DNA with the sequence shown in Table 1.

Example 4d

The procedure of Example 4c is repeated, but using E. coli RRI, E. coli HB101,

An E. coli DP50 or E. coli DP50SupF site

E. coli X-1776. All conditions are otherwise the same and the same results are obtained.

Example 6

Described is the isolation and purification of DNA with a sequence of nucleotides that encodes human insulin and the synthesis of a vector containing DNA as well as the generation of a microorganism strain that contains this DNA as part of its genetic information.

Islet cells are isolated from human pancreas tissue by the method of Example 1. This tissue is obtained from deceased humans or from insulinomas. Islet cells mixed from several pancreas are homogenized in 4 M guanidinium thiocyanate containing 0.2 M (3-mercaptoethanol at pH 5.0 as described in Example 1. Polyadenylated RNA is isolated by chromatography as described above by Aviva and Leder. single-stranded cDNA was prepared using reverse transcriptase and hydrolyzed cDNA according to Example 1. Double-stranded cDNA according to Example 2 was prepared and digested with nuclease S1 according to Example 3. According to the same example, human insulin double-stranded cDNAs were added. Hind III or Hsu I digestion and analyzed as described in Example 3. A peak corresponding to the 450 nucleotide sequence except for the Hind III cleaved decamer fragments was observed. Then, human insu cDNA was inserted into plasmid pMB9 The Hind III-containing end-linker was carried out according to Example 4 as well as transformation of E. coli X-1776 and selection of recombinant plasmids. The insert was removed with Hsu I and analyzed according to Example 4. DNA of 450 nucleotides was obtained. Cloned human insulin can be detected which contains nucleotides that code for the entire amino acid sequence of human insulin. The amino acid sequence of chain A is as follows:

10 Gly-Ile-Val-Glu-Cys-Cys-Thr-Ser-Ile-Cys

-Ser-Leu-Tyr-Glu-Leu-Gln-Asn-Tyr-Cys-Asn.

The amino acids in chain B have the following sequence:

10

Phe-Val-Asn-Glu-His-Leu

Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu30

- Arg - Gly - Phe - Tyr - Thr - Pro - Lys - Thr.

The amino acid sequence is numbered from the terminus on which the free amino group is located.

Example 6a

Example 6 was repeated except that plasmid pBR322 was used instead of plasmids pMB9 DNA. All conditions are otherwise identical to those in Example 4a (i). The insert is removed to obtain 450 nucleotide DNA with the sequence described in Example 6.

il) The procedure of Example 6 was repeated except that plasmid pBR313 DNA was used instead of plasmid pMB9 DNA. All conditions are the same as in Example 4a (ii). The insert is removed to give 450 nucleotide DNA with the sequence described in Example 6.

Lii) The procedure of Example 6 was repeated using plasmids pSCIO1 DNA instead of plasmid pMB9 DNA. All conditions are otherwise identical to Example 4a (iii). The insert is removed to give 450 nucleotide DNA with the sequence described in Example 6.

Example 1 a d 6b

The procedure of Examples 6 and 6a was repeated except that E. coli RRI or E. coli HB101 was used instead of E. coli X-1776. All conditions are identical and the results obtained are identical.

Example 1 a d 6c

Using the method of Example 6, human insulin cDNA was prepared and treated with chemically synthesized Eco Rl-linked chains according to Example 3a.

i) Incorporation of human insulin cDNA after treatment with Ecp R1 into the Eco Rl treatment site of Charon 16A according to Example 4c (i). Recombinant phages were isolated and the incorporated portion removed as in Example 4c (i). DNA of 450 nucleotides was obtained with the sequence described in Example 6. * ii) Incorporating human insulin cDNAs with Eco Rl site binding sites into the Charon 3A vector of Example 4c (ii). Recombinant phages were isolated and analyzed according to Example 4c (ii) to obtain 450 nucleotide DNA with the sequence described in Example 6.

iii) Plasmid AgtWES. AB was used as a vector for transfer of human insulin cDNA after Eco Rl treatment according to the method of Example 4c (iii). Recombinant phages were isolated and analyzed. The insert is removed to give 450 nucleotide DNA with the sequence described in Example 6.

Example 6d

Example 6c is repeated, using E. coli

RRI, E. coli HB101, E. coli DP50 or E. coli DP50SupF instead of E. coli X-1776. The same conditions are used and the same results are obtained.

Example 7a

i) The method of Example 7 was repeated using plasmid pMB9 DNA prepared by the method of Rodrigez et al., supra. Otherwise, all conditions are the same except for the selection and analysis performed according to the method of Example 4. The insert is removed to obtain 800 base pair DNA with the sequence shown in Table 2.

The method of Example 7 was repeated except that plasmid pSCIO1 DNA prepared according to Cohen et al., Proc. Nati. Acad. Sci. USA 70, 1293 (1973) instead of plasmid pBR322 DNA. Otherwise, all conditions are identical including selection and analysis. The insert is removed to obtain 800 base pair DNA with the sequence shown in Table 2.

iii) The procedure of Example 7 was repeated except that plasmid pBR313, DNA prepared according to Bolivar et al., Gene 2, 75 (1977), was used instead of plasmid pBR322 DNA. All conditions including final selection are identical. The insert is removed to obtain 800 bp DNA with the sequence shown in Table 2.

Example 7b

Examples 7 and 7a are repeated, but E. coli RRI and E. coli HB101 are used instead of E. coli X-1776. All conditions are identical and the same results are obtained.

Example 7c

The RGH-cDNA prepared according to Example 7 was treated with chemically obtained sequences at the Eco R1 site as described in Example 3a.

The Charon 16A DNA prepared according to the above-mentioned Blattner publication is used as a vector. The RGH-cDNA, after Eco RI treatment, was inserted into the Eco R1 treatment site at Charon 16A by the method of Example 4c (i). The recombinant phages were isolated and analyzed according to Example 4c (ij). The inserted portion was removed as in Example 4c (i) to obtain approximately 800 base pair DNA with the sequence shown in Table 2.

The Charon 3A DNA prepared according to the above-mentioned Blattner publication is used as a vector. The RGH-cDNA was treated with Eco R1 into Charon 3A, recombinant phages were isolated and analyzed, and the insert was removed according to Example 4c (ii). The 800 bp DNA was obtained with the sequence shown in Table 2.

(iii) AgtWES. DNA prepared according to the above-mentioned Tiemier publication is used as a vector. RGH-cDNA after treatment

The Eco R1 was incorporated into the vector, recombinant phages were isolated and analyzed, and the incorporated portion was removed as in Example 4c (i). DNA of approximately 800 base pairs was isolated with the sequence shown in Table 2.

Example 7d

Example 7c is repeated, but instead of E. coli X-1776, E. coli RRI, E. coli HB101, E. coli DP50 or E. coli DP50SupF is used. Otherwise, the conditions are identical and identical results are also obtained.

Example 8a ij Example 8 was repeated using plasmid pMB9 DNA prepared according to the above-mentioned Rodriguez site of plasmid pBR322. All conditions are otherwise identical except for the final selection and analysis according to the example

4. The insert is isolated and 800 bp DNA is obtained with the sequence described in Example 8.

ii] The method of Example 8 was repeated, but using the plasmid pDCIO1 DNA prepared according to Cohen et al., Proc. Nati. Acad. Sci. USA 70, 1293 (1973) instead of plasmid pBR322 DNA. All conditions were otherwise the same as for plasmid pMB9. The insert is removed to obtain 800 base pair DNA with the sequence described in Example 8.

iii) The procedure of Example 8 was repeated using plasmid pBR313 DNA prepared by the method of Bolivar et al., Gene 2, 75 (1977) instead of plasmid pBR322 DNA. All conditions are otherwise identical. The incorporated portion is removed as described above. 800 bp DNA was obtained with the sequence described in Example 8.

Example 8b

The procedure of Examples 8 and 8a was repeated except that E. coli RRI or E. coli HB101 was used instead of E. coli X-1776. All conditions are otherwise identical and identical results are also obtained.

Example 1 a d 8c

The RGH-cDNA prepared according to Example 8 was treated with the chemically synthesized strands at the Eco R1 site of Example 3a.

i) Eco Rl-treated RGH-cDNA was inserted into Charon 16A DNA by the method of Example 7c (i). Recombinant phages were isolated and analyzed according to Example 7c (i). The insert was removed as in Example 7c (i) to obtain 800 base pair DNA with the sequence described in Example 8.

The HGH-cDNA was treated with Eco

Ri was incorporated into Charon 3A DNA as described in Example 7c (ii). Recombinant phages were isolated and analyzed, and the incorporated portion removed as described in Example 7c (ii). 800 bp DNA was obtained with the sequence described in Example 8.

iii) HGH-cDNA treated with Eco RI was incorporated into AgtWES. DNA as described in Example 7c (iii). Recombinant phages according to Example 7c (iii) were isolated and analyzed. The insert is removed as in Example 7c (iii) to yield 800 base pair DNA with the sequence described in Example 7c (iii).

8.

Example 8d

The method of Example 8c was repeated, but using E. coli RRI, E. coli HB101, E. coli DP50 or E. coli DP50SupF instead of E. coli X-1776. Otherwise, the conditions are identical and the results obtained are identical.

Claims (5)

A method for growing a microorganism containing and replicating a DNA transfer vector with a nucleotide sequence encoding growth hormone by isolating cells containing growth hormone encoding mRNA, extracting and purifying the mRNA from the cells, and prepare from this mRNA a cDNA with a sequence of nucleotides coding for growth hormone and this cDNA is reacted with a DNA transfer vector to produce a DNA transfer vector with a nucleotide sequence coding for growth hormone followed by transformation of the microorganism with said vector for growth hormone DNA transfer, characterized in that mRNA is extracted from cells containing mRNA encoding growth hormone by homogenizing said cells in the presence of a ribonuclease inhibitor containing guanidinium thiocyanate and β-mercaptoethanol at pH 5.0 to 8.0 to prevent mRNA degradation ribonuclease and cDNA are reacted with a DNA transfer vector by first enzymatically hydrolyzing the vector for transferring DNA restriction by an endonuclease from the Hind III, Hsu I or Eco RI family to produce a DNA transfer vector with reactive ends capable of binding to each other or cDNA with a nucleotide sequence coding for growth hormone and then enzymatically joining said invention vector for transferring DNA with a nucleotide sequence cDNA encoding growth hormone by DNA ligase treatment in the presence of ATP to produce a DNA transfer vector having a nucleotide sequence encoding growth hormone. 2. The method of claim 1 for culturing a microorganism containing and replicating a DNA transfer vector with a nucleotide sequence coding for growth hormone, characterized in that an additional step is included after the first processing step in which any enzymatically hydrolyzed The phosphate end group of the DNA-transfer vector with reactive ends to form a preprocessed DNA transfer vector with termini which are not capable of reconnecting with each other but are capable of linking to a cDNA having a nucleotide sequence coding for growth hormone. 3. The method of claim 1 wherein the ribonuclease inhibitor comprises 4 N guanidinium thiocyanates and 0.05 to 1.0 M / 3-mercaptoethanol. 4. The method of claim 3, wherein the inhibitor comprises 0.2M .beta.-mercaptoethanol. 5. The process according to claim 2, wherein the enzymatic hydrolysis is carried out by alkaline phosphatase.