CS227013B2 - Method of preparing vectors for transferring deoxyribonucleic acid - Google Patents

Description

The invention relates to a method for producing a DNA transfer vector, in particular to isolate a specific nucleotide sequence comprising a genetic information code for a specific protein, to synthesize DNA comprising the specific nucleotide sequence, and to transfer the DNA to a microorganism in which the DNA can be propagated. The invention further relates to the isolation of the growth hormone gene, the purification of these substances, their transfer and their multiplication in a microbial host, and the detection of their properties. A number of new products can be produced by the process of the invention. These products also include a recombinant plasmid containing a specific nucleotide sequence derived from a higher organism and a novel microorganism containing, as part of its genetic grouping, a specific nucleotide sequence derived from a higher organism.

The following abbreviations are used during the application:

DNA - desoxyribonucleic acid

RNA - ribonucleic acid cDNA - complementary DNA (enzymatically synthesized from a sequence of mRNAj mRNA - RNA involved in messenger RNA) tRNA - transferred RNA (transfer RNA) dATP - desoxyadanosine triphosphate dGTP - desoxyguanosine triphosphate dCTP - desoxycytidine triphosphate

A - adenine

T-thymine

G - guanine

C - cytosine

Tris-2-amino-2-hydroxyethyl-1,3-propanediol

EDTA - ethylenediaminetetraacetic acids ATP - adenosine triphosphate TTP - thymidine triphosphate

The biological importance of the basic DNA sequence is that it stores genetic information. It is known that the base sequence in DNA is used as a code that determines the amino acid sequence in all proteins that a cell produces. In addition, part of this sequence is used for regulatory purposes, in particular to control the time and amount of production of individual proteins. The nature of these proceedings has so far been only partially clarified. Finally, the base sequence in each strand is used as a basis for DNA renewal as well as for DNA multiplication that accompanies each cell division.

The way in which basic sequence information in DNA is used to determine the sequence of amino acids in proteins is a fundamental process that is broadly universal for all living organisms. It has been shown that each amino acid found in proteins is determined by one or more sequences of trinucleotides. It follows that for each protein it is possible to detect a corresponding DNA segment that contains a triplet sequence that corresponds to the amino acid sequence of the protein. The genetic code is shown in the following table.

The biological way of converting the nucleotide sequence as information into the amino acid sequence in the first step is that the local DNA segment with the sequence that determines the structure of the protein to be produced is first transformed into its copy by RNA. RNA is a polynucleotide which is similar to DNA except that ribose is replaced by desoxyribose and uracil is used instead of thymine. RNA bases can get into the same relationships as in DNA. As a result, it is possible to create a complement in the RNA to the DNA nucleotide sequence. This modified RNA is called mRNA because it is an intermediate link between the genetic system and the protein synthesis system in the cell.

The cell uses mRNA in complex processes, including enzymes and organelles, to synthesize a specific sequence of amino acids. This method is called mRNA translation.

In many cases, additional steps are required to convert the synthesized amino acid sequence into functional proteins. Insulin will be exemplified. Genetic code phenylalanine (Phe) TTK leucine (Leu) XTY isoleucine (Ile) ATM methionine (Met) ATG valine (Val) GTL serine (Ser) ORS proline (Pro) CCL threonine (Thr) ACL alanine (Ala) GCL tyr osine ( Tyr) TAK termination signal TAJ termination signal TGA histidine (His) CAK glutamine (Gln) CAJ asparagine (Asn) AAK lysine (Lys) AAJ aspartic acid (Asp) CAK glutamic acid (Glu) CAJ cysteine (Cys) TGK tryptophan (Try) TGG arginine (Arg) WGZ glycine (Gly) GGL

Key:

Each group of three letters represents a DNA trinucleotide with 5 ‘on the left and 3‘ on the right. Individual letters mean purine or pyrimidine bases that form a sequence of nucleotides,

A = adenine

G = guanine

C-cytisone

T = thymine

X = T or C when Y or G

X = C when Y is C or T

Y = A, G, C or T when X is C

Y = A or G when X is T

W = C or A when Z is A or G

W = C when Z is C or T

Z = A, G, C or T when W is C

Z - A or C when W is A

QR = TC when S is A, G, C or T

QR = AG if S is T or C

S = A, G, C or T if QR is TC

S = T or C when QR AG

J = A or G

Κ = T or C

L = A, T, C or G

M = A, C or T

Alu I treatment site - sequence AG ¹ CT, specifically cleaved at the arrow site by Alu I endonuclease

Bam HI treatment sites - G * GATCC sequence, specifically cleaved at the arrow site by Bam HI endonuclease.

Bgl I treatment site - sequence GCCNNNN ⁴ NGGG, specifically cleaved at the arrow site by Bgl I endonuclease (N means any nuclide).

.....

Eco R1 site - G t AATTC sequence, specifically cleaved at the arrow site by Eco RL endonuclease

Eco RII endonuclease treatment site - sequence ¹ CCAGG or ¹ CCTGG, specifically cleaved at the arrow site by Eco RII endonuclease.

Hae II endonuclease treatment site - sequence of AGCGC ⁴ T or AGCGC ⁴ C or GGCGT ¹ T or GGCGC i C, specifically cleaved at the arrow site by Hae II endonuclease.

Hinc II Endonuclease Treatment Site - GTTAAC or GTCAAG or GTCGAC sequence, specifically cleaved by Hinc II endonuclease.

Pst I endonuclease site - CTGCA ⁴ G sequence, specifically cleaved at the arrow site by Pst I endonuclease

Sal I endonuclease site - Gt TCGAC sequence, specifically cleaved at the arrow site by Sal I endonuclease

Sst I endonuclease site - GAGCT ⁴ C sequence, specifically cleaved at the arrow site by Sst I endonuclease

In the cells of higher organisms, such as vertebrates, many proteinaceous proteins of medical or research interest can be found. These include, for example, the hormone insulin, other hormones of a peptide nature, such as growth hormone, proteins that act to control blood pressure, and various types of enzymes of industrial, medical or research interest. It is often very difficult to obtain these proteins in usable amounts by extraction from organisms, this problem is particularly burdensome in the case of human proteins. It is therefore necessary to find a way in which these proteins can be obtained in sufficient quantities outside the original organism. In some cases, appropriate cell lines can be obtained and maintained as tissue cultures. However, cell growth in tissue cultures is slow, the growth environment is very expensive, the growing conditions must be accurately maintained and yields are relatively low. Often it is very difficult to maintain a cell line with the desired properties.

In contrast, microorganisms such as bacteria can be easily grown in chemically defined nutrient media. The fermentation processes are highly sophisticated and can be well controlled. The growth of organisms is rapid and high yields can be obtained. In addition, some organisms are precisely genetically defined and are actually one of the best defined organisms ever.

For these reasons, it is highly desirable to have a genetic code transfer for proteins of medical importance from the organism in which the protein is normally produced to the microorganism in question. In this way, it would be possible for said protein to be produced by microorganism-treated growth conditions so that it could be obtained in the desired amount. It is also possible in this way to substantially reduce the cost of producing this protein. In addition, the possibility of isolating and transferring the genetic sequence that determines the production of a protein to a microorganism with a well-defined genetic structure would be of great value for research into the way the protein is synthesized and for post-synthesis behavior of that protein. In addition, the isolated genetic sequence could be converted to code for different proteins with altered therapeutic or functional properties.

The method according to the invention achieves this objective. The method of the invention. it involves a variety of reactions, including enzymatically catalyzed reactions. The nature of these enzymatic reactions, if known, is always described at the same time.

Reverse transcriptase catalyzes DNA synthesis in the presence of modified RNA, oligodesoxynucleotide and four desoxynucleoside triphosphate, dATP, dGTP, dCTP, and TTP. The reaction begins with the non-covalent binding of the olidodesoxynucleotide, which binds to the 3 ‘mRNA position, then sequentially binds the corresponding desoxynucleotides, as determined by the nucleotide sequence of the mRNA, to the 3‘ position of the growing chain. The resulting molecule contains the original RNA together with complementary DNA that is bound by a single DNA loop. Reverse transcriptase can also catalyze a similar reaction using modified DNA, in which case the resulting product is a compound with two DNA strands joined together by a single DNA strand loop. These procedures have been described in Aviv H. and Leder P., Proc. Nati. Acad. Sci. USA 69, 1408 (1972) and Efstratiadis A., Kafotos, F. C., Maxam A. F., and Maniatis T., Cell 7, 279, (1979).

Restriction endonucleases are enzymes that are capable of hydrolyzing phosphodiester bonds in the double strand of DNA, thereby breaking the continuity of the DNA strand. When the DNA is in the form of a closed loop, it turns into a linear structure. An essential characteristic of this type of enzyme is that the hydrolytic action occurs only at the site where the specific nucleotide sequence is located. This site is essential for the action of the resitrative endonuclease. Enzymes of this type have been isolated from various sources and have been characterized by their site of action in the nucleotide chain.

Some restriction endonucleases hydrolyze phosphodiester linkages in both chains at the same site, other enzymes of this type catalyze the hydrolysis of bonds that are separated by only a few nucleotides, leaving free portions of the individual chains that are cleaved from the parent molecule. The terminal portions of these strands may be complementary and may be used to rebuild the hydrolyzed DNA. Since each DNA that can be subjected to digestion with this enzyme must contain a site of its action, the same terminal portions are formed so that heterologous DNA strands released by the above-mentioned enzyme can be joined in this way. These procedures have been described in Roberts, R. J., Crit. Roar. Biochem. 4, 123 (1976). The sites at which the enzymes may act naturally occur relatively rarely, but the usefulness of these enzymes has been increased by chemical synthesis of the double-stranded oligonucleotides carrying the enzyme-appropriate sites. In this way, almost any segment of DNA can be joined to another segment by simply linking another nucleotide with a restriction endonuclease site at either end of the molecule and then subjecting the product to hydrolysis with the appropriate restriction endonuclease to produce the corresponding end as described in Heyneker Η. B., Shrne J., Goodman Η. M., Boyer HW, Rosengerb J.,

Dickerson, R. E., Narang, S. A., Itakurs, K., Lin, S., and Riggs, A. D., Nature 263, 748 [1976] and Scheller, R., Dickerson, R., Voyer, H., Riggs, A., and Itakura, K., Science 196, 177 (1977).

S1-endonuclease is an enzyme that highly specifically hydrolyzes foafodiester bonds in single-stranded DNA or single-stranded DNA that otherwise contains two strands, as described in Vogt, V. M., Eur. J. Biochem. 33, 192 (1973).

DNA ligase is an enzyme that is able to catalyze the formation of phosphodiester linkage between two DNA segments with 5 ‘phosphate and 3‘ hydroxyl groups, as they can be formed from two DNA fragments. The normal function of this enzyme is to attach a single strand or part of a strand in a double stranded DNA molecule. However, under appropriate conditions, the DNA ligase can catalyze the joining of the free ends in a covalent manner as described by Sgaramella V, Van de Sande H. J., and Khorana H. G., Proc. Netl. Acad. Sci. USA 67 1468 (1970).

Alkaline phosphatase is an enzyme whose general ability is to either hydrolyze phosphate esters including 5‘-terminal phosphate DNA.

The next step to be described is to incorporate a specific DNA fragment into a DNA vector, such as a plasmid. Plasmid is a term called autonomous DNA replication unit, as found in a microbial cell, distinct from the genome of the host cell itself. The plasmid is not genetically linked to the host cell chromosome. The DNA plasmid exists as a double-stranded circular molecule with a molecular weight of the order of several million, although the weight of some molecules is greater than 10 ⁸ , molecules of this type usually make up only a small proportion of the total DNA of the cell. The DNA plasmid can usually be separated from the host cell DNA due to the large size difference of the molecule. Plasmids may proliferate independently of the cell division rate of the host cells, and in some cases their proliferation may be controlled by changes in growth conditions. Although the plasmid exists in the form of a closed ring, it is possible to artificially introduce a DNA segment into the plasmid so that a larger molecule recombinant plasmid is formed without affecting the reproductive capacity of the plasmid or its other ability. The plasmid therefore serves as a suitable vector for transferring a DNA segment into a host cell. The plasmids used to produce recombinant DNA typically contain genes that may be suitable for selection purposes, for example, genes for resistance to certain substances.

The ability to obtain DNA with a specific sequence that is also the genetic code for a specific protein makes it possible to modify the nucleotide sequence chemically or biologically so that the specific protein produced is also modified. In this way, for example, it is possible to produce modified insulin for certain medical purposes. The genetic ability to produce any amino acid chain suitable for incorporation into the insulin chain or having the essential functional properties of Insulin may be transferred to a microorganism. Similar conditions can be provided for growth hormone.

The ability to transfer the genetic code for a specific protein necessary for the normal metabolism of a particular higher organism to a microorganism, such as a bacterium, opens up the possibility of culturing that protein in the form of a conventional culture. It is also open to the possibility of obtaining more of these proteins and gradually replacing them with proteins produced by microorganisms in any case where the ability of a higher organism to produce these proteins normally fails. In this way, for example, it would also be possible to establish symbiotic relationships between the microorganisms modified by the method of the invention with humans with acute or chronic disease, whereby the genetically determined microorganism could be implanted or otherwise associated with the human organism to compensate for the pathological metabolic state of the sick person.

Accordingly, the invention relates to a method of isolating a specific nucleotide sequence comprising genetic information, synthesizing DNA with a specific nucleotide sequence, and transferring the DNA to a host microorganism.

Accordingly, the present invention provides a method for producing a DNA transfer vector having a nucleotide sequence encoding growth hormone by isolating cells containing growth hormone-encoding mRNA, extracting and purifying the mRNA therefrom, The mRNA synthesizes a growth hormone-encoded nucleotide sequence cDNA, and the cDNA is reacted with a DNA transfer vector to produce a growth hormone-encoded DNA sequence vector, characterized in that the mRNA is extracted of cells containing growth hormone-encoding mRNA by homogenizing cells in the presence of a ribonuclease inhibitor containing guanidinium thiocyanate and (3-mercaptoethanol at pH 5.0 to 8.0 to prevent degradation of mRNA by rlonuclease and cDNA is reported in reaction with a DNA transfer vector by first enzymatically hydrolyzing the DNA transfer vector with a restriction endonuclease from the Hind III, Hsu I or Eco R1 group to form to a DNA transfer vector having reactive ends capable of binding to each other or to a cDNA having a nucleotide sequence coding for growth hormone and then enzymatically linking said DNA transfer vector to a cDNA having a nucleotide sequence coding for growth hormone DNA ligases in the presence of ATP to form a DNA transfer vector with a nucleotide sequence coding for growth hormone.

It is understood that the method of the invention could be adapted to transfer any desired DNA sequence from a higher organism, for example a vertebrate, to any microorganism. A higher organism in this case is defined as a eukaryotic organism with differentiated tissues, that is, for example, insects, molluscs, plants, vertebrates, including mammals, such as cattle, pigs, primates and humans. Micro-organism means any micro-organism, whether profcaryotic or eukaryotic, including bacteria, protozoa, algae and fungi, including yeast. In carrying out the method of the invention, a selected cell population is first isolated in an improved manner. Intact mRNA is extracted from these cells in a new manner, which simultaneously suppresses all ribonuclease activity. Intact mRNA is purified from the exit extract by column chromatography and then treated with the enzyme reverse transcryptase, which acts in the presence of the four desoxynucleoside triphosphates required to synthesize the cDNA complementary strand. The product of the first reaction using reverse transcriptase is then processed so _? by ss selectively removing the ribonucleotide sequence. The remaining sequence of desoxynucleotides, which is complementary to the original mRNA, is incubated during the second reaction using reverse transcriptase or DNA polymerase in the presence of four desoxynucleoside triphosphates. The resulting product is a double cDNA structure whose complementary strands are linked together at one end by a single strand loop. This product is then reacted with a specific nuclease that cleaves the loop. The resulting double-stranded cDNA is then set up at both ends by binding specific DNA that contains sites where a restriction enzyme can act. This addition is catalyzed by the enzyme DNA ligase. The resulting product is then treated with a restriction endonuclease to produce free-ended chains that can complement each other.

The same enzyme is treated with a DNA plasmid that contains sites suitable for the same restriction endonuclease to cleave down the nucleotide chain and produce similar free ends capable of binding to the 5 'terminal end. The 5‘-phosphate groups are removed so that the plasmid cannot form an annular structure that would alter the host cell. Then, the above-prepared cDNA and DNA plasmid are incubated together in the presence of DNA ligase. Under the reaction conditions described above, viable closed circles of the DNA plasmid will only be formed if cDNA with the appropriate free ends is present.

The altered plasmid is then inserted into a suitable host cell that has received the altered viable plasmid by the formation of colonies with altered properties, e.g., resistance to certain chemicals. Pure bacterial strains that contain the recombinant plasmid are then grown and the recombinant plasmid isolated again. In this way, large quantities of the recombinant plasmid can be prepared, and thus the specific sequence of cDNA can be isolated again by digestion with the appropriate restriction enzyme.

Any desired sequence of nucleotides derived from a higher organism, including humans, can be isolated and transferred to the host microorganism by the basic method of the invention. The method is suitable for transferring the genetic code for a specific protein of medical or industrial importance and for the microbiological synthesis of such a protein.

In a similar manner, the nucleotide sequence for rat growth hormone was isolated and this sequence was also transferred and expanded in bacteria. The method of the invention may also be applied to the transfer of a nucleotide sequence isolated from a human, including human insulin, growth hormone and other hormones of a polypeptide nature.

The method of the invention envisages a method of isolating a DNA molecule having a specific nucleotide sequence, transferring this material to a microorganism, and consequently multiplying the nucleotide sequence in said microorganism.

The sequence of steps encompassed by the process of the invention can be described in four basic groups.

1. Isolation of the desired cell coupling from a higher organism

There are two potential sources of genetic code for a specific protein. It is a DNA organism and, moreover, a modified RNA of that organism. According to the usual safety regulations adopted by the National Institutes of Health, human genes of any kind can be processed into recombinant DNA and then transferred to bacteria only if the genes have been thoroughly purified on a designated device before. (Federal Register, Vol. 41, No. 131, July 7, 1967, pages 27 902 to 27 943.) This means that for any method that could be used to produce human proteins, it is preferable to isolate specific nucleotide sequence mRNAs. , which is the genetic code for the desired protein. This procedure has the additional advantage that mRNA is easier to purify than DNA extracted directly from cells. In particular, it is advantageous to use the fact that in differentiated organisms, such as vertebrates, a specific population of cells can be found at a specific location in the organism, the essential function of all these cells being the production of the desired protein. It may also occur that said cell population exists only for a transient developmental period of the organism. In these cell populations, a large portion of the mRNA isolated from the cell will have the desired nucleotide sequence. it is therefore possible to choose a preferred cell population and a preferred method of isolation in terms of the initial purity of the isolated mRNA.

In most tissues, glands and other organs, cells are usually associated with a fibrous connective tissue network, which essentially consists of collagen, but may contain other substances, such as proteins, polysaccharides or inorganic substances, depending on the type of tissue. Isolation of cells from a given tissue requires a technique that releases cells from the connective tissue matrix. Thus, the isolation and purification of a specifically differentiated cell type consists of two main steps, namely the separation of cells from connective tissue and the separation of cells of the desired type from other cells of the tissue. By the method of the invention, different cell types can be isolated from different tissue types. An example is the isolation of Langerhans islets from the pancreas, which is necessary for the isolation of insulin mRNA.

Insulin-producing cells can be obtained from other sources, such as the immature pancreas of the calf or from a tissue culture of the tumors of these cells. Isolation of pure islet cells is much easier in these cases, especially in the case of tissue culture. Thus, it will not always be necessary to isolate cells directly from the pancreas, but in some cases this is advantageous.

It can often be shown that the proportion of the desired mRNA can be increased by external influences. For example, hormone treatment may result in increased production of the desired mRNA. Other methods are, for example, growing at a certain temperature, supplying a certain nutrient or other chemical. In the isolation of rat growth hormone mRNA, it was possible to substantially increase the desired proportion of growth hormone mRNA by treating rat pituitary cells grown in tissue culture simultaneously with thyroid hormone and glucocorticoids.

2. Extraction of mRNA

An important object of the method according to the invention is, as far as possible, to completely eliminate ribonuclease activity in the cell extract. Indeed, it is necessary to extract mRNA with a single polynucleotide strand without the additional complementary strand. This implies that hydrolytic cleavage of a single phosphodiester bond in the chain would render the entire molecule unusable for transferring the intact genetic sequence to the microorganism. As noted, the ribonuclease enzyme is widespread, potent and exceptionally stable. It can be applied to the skin, it can withstand the usual washing-up procedures without damage and is often a pollutant for stored organic chemical compounds. The difficulties are particularly evident when it comes to extracting cells from the pancreas, since this gland is a source of digestive enzymes and is therefore rich in ribonuclease. However, the problem of this enzyme is associated with all tissues, and therefore a method of removing the ribonuclease activity of the invention is also applicable to all tissues. The exceptional efficacy of this method will be demonstrated in the successful isolation of intact Langerhas islet cell mRNA.

In the method of the invention, a protein-free combination of chaotropic anion, chaotropic cation and an agent disrupting disulfide bonds is used during cell disruption and during all procedures required for RNA isolation. The efficacy of the simultaneous action of all of the above agents has been demonstrated by their use to isolate intact mRNA in good yield from isolated islets of rat Langerhans islets.

The choice of suitable chaatropic ions is based on their solubility in aqueous media and their availability. Suitable chaotropic cations are, for example, guanidine ions, carbamoylanidine, guanylguanidine, lithium and the like. Suitable chaotropic anions are, for example, the anionic ion, perchlorate, thiocyanate, diodosalicylate, and the like. For example, lithium diodsalicylate is more effective than guanidinium thiocyanate, but its solubility is only 0.1 N and, moreover, is relatively expensive. Guanidinium thiocyanate is the preferred combination of cations and anions because it is readily available and highly soluble in aqueous media up to a concentration of 5 M.

Thiol compounds, such as β-mercaptoethanol, are known to disrupt intramolecular disulfide bonds in proteins by double-swapping. A variety of thiol compounds are known to be effective in this regard, for example .beta.-mercaptoethanol, dithiotreitol, cysteine, propanoldimercaptan and the like. Substances must be water soluble because they need to be used in large excess relative to the number of intramolecular disulfide bonds to double substitution can be completed. The most preferred substance in this sense is (S-mercaptoethanol, because it is readily available and relatively very cheap).

In inhibiting ribonuclease during RNA extraction from cells or tissues, the efficacy of a given chaotropic salt is directly dependent on its concentration. Therefore, the most preferred concentration is at the same time the highest available con227013 centration. The success of the method of the invention in maintaining intact mRNA during extraction depends on the rate at which the denaturing ribonuclease is managed and, moreover, the degree of denaturation. This appears to give the advantage of using guanidinium thiocyanate over hydrochloride, although otherwise hydrochloride is only slightly less effective as a denaturing agent. The efficiency of a denaturing agent is defined as the threshold concentration to be achieved to completely denature the protein. On the other hand, the degree of denaturation of many proteins depends on the concentration of the denaturant, which sometimes needs to be increased 5 to 10 times. These relationships have been described in Tanford C.A., Adv., Prot. Chem. 23, 121 (1968). Qualitatively, this relationship states that a denaturing agent that is only slightly more effective than guanidinium hydrochloride can denature a protein several times faster at the same concentration. The relationships between kinetics of ribonuclease denaturation and mRNA preservation during cell extraction have not been identified or exploited. If the above relationships are correct, this means that the preferred denaturant is a low threshold concentration and high water solubility. For this reason, guanidium thiocyanate is preferable to lithium diodsalicylate, yet the latter is a far more effective denaturing agent because the solubility of guanidinium thiocyanate is much higher and therefore can be used at a concentration that allows for faster inactivation of ribonuclease. The above analysis of the effect of each agent also provides an answer to why guanidinium thicyanate is preferable to relatively equally soluble hydrochloride, the reason being that the former is a slightly stronger denaturant.

An agent that disrupts disulfide bonds is used in admixture with a denaturing agent because it has a potentiating effect on the denaturation of the ribonuclease. The thiol compound prevents rapid denaturation, which can occur if the intramulecular disulfide bonds remain intact. Furthermore, it is achieved that any additional ribonuclease remaining in the isolated RNA would remain ineffective even in the absence of the denaturant. Disulfide-disrupting thiol compounds are effective at any concentration, although it is preferable to use a large excess of thiol groups relative to intramolecular disulfide bonds to ensure a successful intramolecular cleavage reaction. On the other hand, it has to be considered that many thiol compounds have an unpleasant odor, especially at higher concentrations, so that in practice there is an upper limit of their concentration. When using β-mercaptoethanol, effective concentrations are in the range of 0.05 to 1.0 M, the optimal concentration for isolation of intact rat pancreas RNA is 0.2 M.

The medium in which the mRNA is extracted from the cells should have a pH in the range of 5.0 to 8.0.

After cell disruption, RNA is separated from DNA and other cellular proteins. A number of methods have been developed for this purpose, all of which are useful and described in the literature. A common method is ethanol precipitation, where RNA is selectively precipitated. A preferred method for use in the process of the invention is to omit the precipitation step and layer the homogenate directly onto a 5.7 M cesium chloride solution in a centrifuge tube followed by centrifugation as described by Clisin, V., Crkvenjakov R. and Byus C., Biochemistry. 13, 2633 (1974). This method is most advantageous because it maintains a ribonuclease unfavorable environment and thus yields high yield RNA free of DNA and protein.

The above method can be used to obtain purified RNA from a cell homogenate. Only part of this RNA is the desired mRNA. In order to further purify the desired fraction, it is advantageous to take advantage of the fact that in the cells of higher organisms, mRNA is further expanded by the cell by polyadenylic acid binding upon its formation. This portion of the mRNA containing the polyadenylic acid sequence can be selectively isolated by column chromatography of the cellulose to which the oligochymidylate is bound, as described in Aviv H. and Leder P., supra. The above procedures are sufficient to obtain pure, intact mRNA from ribonuclease-rich sources. Further purification of this portion and other in vitro procedures can be performed essentially the same for any type of mRNA regardless of source.

In certain circumstances, for example, where the source of mRNA is a tissue culture, ribonuclease contamination may be so low that it is not necessary to use the above-described method of ribonuclease inhibition. In these cases, conventional methods used to reduce ribonuclease activity are sufficient.

3. Generation of cDNA

FIG. 1 schematically illustrates a process relating to the remaining steps of the process of the invention. The first step is to generate a sequence of complementary DNA to the purified mRNA. The enzyme used for this reaction is usually reverse transcriptase, although in principle any enzyme can be used to generate a complementary DNA strand using mRNA as a support. The reaction can be carried out under conditions described in the known literature using mRNA and a mixture of four desoxynucleoside triphosphates as a precursor of the DNA strand. It is preferred that one of the desoxynucleoside triphosphates in the ³² P-labeled form be used to monitor the progress of the reaction and isolate the product in time after separation of the ballasts, for example by chromatography or electrophoresis. Radioactive phosphorus labeling is also advantageous for quantitative determination of yield as described in Efstratiadis A., et al., Supra.

As further shown in Fig. 1, the reaction product and the use of reverse transcriptase is a double stranded hairpin structure with a non-covalent bond between the RNA strand and the DNA strand.

The reaction product using reverse transcriptase is removed from the reaction mixture by conventional means. It has been found advantageous to use a combination of phenol extraction, Sephadex S-100 chromatography (Pharmacia Inc, Uppsala, Sweden) and ethanol precipitation.

Once enzymatic cDNA synthesis has occurred, the base RNA can be removed. A variety of methods for selectively degrading RNA in the presence of DNA are known in the literature. The preferred method is alkaline hydrolysis, which is highly selective and can be easily controlled by adjusting the pH.

Optionally, after alkaline hydrolysis followed by neutralization, ³² P-labeled cDNA can be concentrated by ethanol precipitation.

Hairpin-shaped double-stranded cDNA synthesis is accomplished using an appropriate enzyme, such as DNA polymerase or reverse transcriptase. Reaction conditions similar to those described above, including the use of nucleoside triphosphate labeled in the radioactive phosphorus position, are used. Reverse transcriptase can be obtained from a variety of sources. A suitable and common source is avian myeloblastosis virus. This virus can be obtained from Dr. Beard, Life Sciences Incorporated; St. Petersburg, Florida, where the virus is produced in collaboration with the National Institutes of Health.

After formation of the hairpin cDNA, it may be. desirable to obtain purified DNA from the reaction mixture. As mentioned above, it is preferred to use phenol extraction, Sephadex G-100 column chromatography and ethanol precipitation to obtain purified protein-free DNA.

The hairpin-like structure can be converted to a conventional double-stranded DNA structure by removing a single loop that connects the two ends of the complementary strands.

A variety of enzymes that are capable of hydrolytically cleaving single DNA strands can be used for this purpose. A suitable enzyme of this use is SI nuclease isolated from Aspergillus cryzae. This enzyme is available from Miles Research Products, Wlkhart, Indiana. By treatment with SI nuclease p and the PNA hairpin-like structure, a cDNA molecule with the corresponding ending is obtained in high yield. Extraction by chromatography and ethanol precipitation as described above gave the purified product. The use of reverse transcriptase and SI nuclease in the synthesis of double-stranded cDNA as a structure corresponding to mRNA has been described in Efstratiadis et al., Supra.

If desired, the proportion of the corresponding end-cDNA molecule can be increased using E. coli DNA polymerase I in the presence of four desoxynucleoside triphosphates. The combination of the exonuclease and polymerase activity of this enzyme results in the 3 3 free ends being removed and binding at all 5 zakon ends. This ensures maximum participation of the cDNA molecule in subsequent binding reactions.

A further step of the method of the invention is to treat the end of the cDNA so obtained in order to obtain sequences which contain sites of appropriate restriction endonuclease action. The choice of the DNA fragment that binds to these ends depends on the reaction possibilities. The sequence to be attached to these ends is selected according to the restriction endonuclease chosen, and the choice of this enzyme further depends on the choice of the DNA vector to be recombined for cDNA. The selected plasmid should contain at least one site at which a restriction endonuclease may act. For example, plasmid pMB9 contains one site in which the restriction enzyme Hind III can act. Hind III was isolated from Hemophilus influenzae and purified according to the method of Smith H. O. and Wilcox.

K. W., J. Mol. Biol. 51, 379 (1970). A similar Hae III enzyme from Hemophilus aegypticus is purified as described by Middleton J. H., Edgell N. H. and Hutchison III.

C.A., J. Virol. 10, 42 (1972J.) The enzyme from Hemophilus suis, designated Hsu I, catalyzes specifically by hydrolysis at the same site as Hind III.These two enzymes are therefore interchangeable in function.

It is preferred to use a chemically synthesized double stranded decanucleotide that contains a site in which Hind III can act and bind the strand to the ends of the cDNA. The double stranded decanucleotide has the sequence shown in Figure 1 and has been described by Heyneker H. L. et al. With Scheller R. H. et al. A variety of similar sequences are available which contain a site where the restriction enzyme can act so that the double stranded DNA ends can be occupied so that the resulting substance is sensitive to any restriction endonuclease selected.

Coupling of the above sequences with restriction endonuclease sensitive sites to the ends of the cDNA can be accomplished by any known method. A highly preferred method is catalyzed by the DNA ligand 227013 purified according to the method described in Patent A et al. Biochamistry 12, 5045 (1973). The binding reaction was described in Sgarellell, supra. The product of this reaction between the cDNA and the large molar excess of the double-stranded decanucleotide containing the sites suitable for Hind III restriction endonuclease is cDNA with said strands at each end. When treated with Hind III, this reaction product cleaves at the above sites to form a single 5 5 chain that can complement each other as shown in Figure 1.

4. Construction of vector for recombinant DNA transfer

In principle, large amounts of virus and plasmid DNA can be used to generate recombinant cDNAs prepared as described above. Essential requirements are that the selected DNA transfer vector can be incorporated into the host cell, be multiplied within the host cell, and that the vector contains a genetic determinant to separate those host cells that contain the vector. From a safety point of view, it is necessary to limit the choice of these vectors so that the vectors meet the requirements of the National Institutes of Health (NIH). The list of permitted DNA transfer vectors is continually expanded with the discovery of new vectors and subject to approval by the NIH Recombinant DNA Safety Committee, and the invention contemplates the possible use of any DNA of viral or plasmid origin with the necessary capabilities, including those that will only be allowed later. Suitable vectors that are already allowed include a variety of lambda bacteriophage derivatives (Blattner, F. H., Williams B. G., Blechl A. E., Denniston-Thompson, K., Faber, E., Furlong.

L.A., Grunwald D.J., Kiefar D.O., Hoore

D. D., Schumm, J. W., Sheldon, E. L. and Smithies, O., Science 19B, 161 (1977), and col E1 plasmid derivatives, as described, for example, in Rodrigeuez R. L., Bolivar S., Goodmen. M. Boyer II. W. and Betlach Μ. N. ICN-UCLA Symposium on Molecular Mechanism In The Control of Price Expression, DF Nierlich, WJ Rutter, CF Fox, Eds (Academic Press, NY, 1976), pp. 471-477. Col E1 derived plasmids are relatively small their molecular weight is of the order of several million and has the property that the copy number of plasmid DNA in a single host cell can be increased from the conventional 20 to 40 to 1000 or more by treating the host cell with chloramphenicol. The ability to increase the amount of gene in a host cell allows, under certain conditions, to force the host cell to produce primary proteins, the codes of which are carried by the genes contained in the plasmids. These col E1 derivatives are therefore preferred vectors for use in carrying out the process of the invention. Suitable col E1 derivatives are, for example, plasmids pMB9 carrying a tetracycline resistance gene and plasmids mPR-313, pBR-315, pBR-316, pBR-317 and pBR-322, which contain, in addition to the tetracycline resistance gene, a resistance gene ampicillin. The presence of resistance genes is an advantageous feature for recognizing cells that have been successfully infected with the plasmid, since colonies of such cells will grow in the presence of the substance, whereas cells that do not contain the plasmid will die. In the experiments described above and in the examples below, a plasmid derived from col E1 was used, which contained, in addition to the gene for resistance to a particular substance, a Hind III site.

As with plasmid selection, the host cell can be selected from a relatively wide range of options, but this has been narrowed for safety reasons.

Plasmid pBR-322 was similarly described in Bolivar F. et al., Gene, 2, 95 (1977), which describes the synthesis and properties of this plasmid. Plasmid pBR-322 has a molecular weight of 2.7 X 10 ⁶ daltons (controlled, Bolivar F. Gene, 4, 121 (1978)) and carries the ampicillin resistance (Ap ^R ) gene and the tetracycline resistance (Tc ^R ) gene. . It carries a single restriction endonuclease Pst I site in the Aβ ^R gene. It carries a single endonuclease site for Hind III, Dal I and Bam HI in the Tc ^R gene region. In addition, plasmid pBR-322 carries a single Eco RI site, two Hinc II sites, five Eco RII sites, three Bgl I sites, twelve AIu I sites, twelve Hae II sites, and seventeen seats for Hae III. A detailed description of these sites in pBR-322 is given on page 103 of the first reference. When the pBR-322 plasmids are cleaved, the Aβ ^R gene is lost, and DNA can be inserted into the Pst I restriction endonuclease site. Similarly, when the plasmid pBR-322 is digested with the restriction endonuclease Hind III or Sal I or Bam HI with the insertion of DNA, the Tc ^R gene is lost. When DNA is incorporated into the Pst I site, recombinant molecules can be found in selection for ampicillin (Ap ^s ) sensitive colonies having I'c ^R. Similarly, when DNA is inserted into a Hind III, Dal I or Bam HI site, recombinant molecules can be found in the selection of colonies that are Aβ ^R and Tc ^s . A vector containing foreign DNA inserted at any of the four sites can be characterized with respect to antibiotic resistance such as Aβ ^with Tc ^R or Aβ ^{R with} Tc ^s . The vector can be further characterized by removal of the incorporated DMA and determination of the molecular weight of both 227013 products compared to the molecular weight of the starting materials. Further characterization can be accomplished by constructing a complete restriction endonuclease site map in this vector. It is also possible to determine the sequence of the inserted DNA.

Also plasmid pBR-313 has been described in detail. The synthesis and properties of this plasmid have been described by Bolivar F. et al., Gene 2, 75 (1977). Plasmid pBR-313 has a molecular weight of 5.8 X 10 ⁶ daltons and contains an ampicillin resistance gene (Ap ^R J and a tetracycline resistance gene (Tc ^R J). This plasmid contains a single Hind III restriction endonuclease site, Sal I and Bam HI in the region of the Tc ^R gene. A full analysis of the plasmid pBR-313 was performed and a map of restriction endonuclease sites was constructed as shown on page 84. Incorporating foreign DNA into any Hind III site Sal I or Bam HI results in the loss of Tc ^R. Thus, recombinant molecules can be found in the selection of strains with Aβ ^R and Tc ^s . The vector can be characterized by antibiotic resistance, DNA sequence and molecular weight.

The third plasmid described in detail is pMB 9. This plasmid can be prepared according to Rodriguez, RL et al., Supra, and Bolivar F. et al., Gene 2, 75 (1977). Plasmid pMB 9 has a molecular weight of 3.5 X 10® Daltons and contains a gene for resistance to tetracycline Tc ^R. It has a single site for action of each of the EcoRI, Hind III, Dal I, or Bam HI endonucleases. The site of action of the last three endonucleases is found in the Tc ^R gene. When foreign DNA is inserted into the Hind III, Sal I or Bam HI treatment site, Tc is lost. A vector containing foreign DNA at one of these sites can be characterized by this property. This vector can also be characterized by analyzing the DNA sequence of the inserted portion, comparing the molecular weight, and analyzing the sites for action of endonucleases.

Plasmid pSCIO1 has also been described in detail. Cohen SH et al. Nat. Acad. Sci. USA, 70, 1293 (1973) describes the synthesis and properties of this plasmid. Additional plasmid properties can be found in Cohe, SN, and others Proc. Nat. Acad. Sci. USA, 70, 3240 (1973), Boyer, JW et al., Recombinant Molecules, Beers, RF and Basset, EG, Eds, Raven Press, New York on page 13 (1977) and Cohen SN et al., Recombinant Molecules, et al. The plasmid pSCIO1 has a molecular weight of 5.8 XX10 ⁶ daltons and contains a gene for resistance to tetracycline Tc ^R. In the region of this gene it contains a single site for action of each of the endonucleases Hind III, Sal I and Bam HI. In addition, it contains a single Eco Rl site, one Hpa I site, one Sr I site, and four Hinc II sites. When this plasmid is digested with Hind III, the Tc ^R is lost. The same applies to cleavage at the Sal I or Bam HI site, when the DNA is inserted at any of these sites, can be found in the selection of the recombinant molecule. A vector containing foreign DNA at any of these sites may be characterized by a loss of antibiotic resistance. The vector may be further characterized by (a) removing the inserted DNA and determining and comparing the molecular weight, (b) constructing a map of endonuclease sites and (cj determining the sequence of the inserted DNA).

For example, the phage for vectors contain derivatives of a lambda tag called Charon, particularly Charon 3A, Charon 4A, and Charon 16A. These tags have been described in detail. Blatner et al., Supra, describe the synthesis and properties of these phages. These tags were also mapped, including endonuclease sites, as shown on page 161 of the abovementioned publication. The genotype of each tag is shown on page 164 together with the result of cleavage at different sites. For example, incorporating foreign DNA into the Eco R1 site of the Charon 16A tag causes loss of the lac 5 gene. Growth of the recombinant tag on lac bacteria results in the formation of colorless colonies. That is, a vector containing foreign DNA at a particular site can be characterized by genetic properties, for example, colorless spots on lac bacteria. The vector can be further characterized by removal of the inserted DNA and determination of the molecular weight of both products from a simultaneous comparison with the molecular weight of the starting products. Further characterization can be accomplished by constructing a map of endonuclease sites in the vector. It is also possible to detect the sequence of the inserted DNA.

AgtWES has been described as well. ΛΒ, a bacteriophage lambda derivative. The synthesis and basic properties of this tag have been described in Tremeier D. et al., Nature 263,

526 (1976). Other features of this tag have been described in Leder P., et al., Science, 196, 175 (1977). The genotype of this tag has been identified in both publications. The second publication also identifies the placement of both Eco Rl and Sst I restriction endonuclease sites. This phage contains four Bam HI sites to yield 5.4 X 10 ³ , 19.3 X 10 ³ , 3 fragments. , 8 X 10 ³ and 11.4 X 10 ³ base pairs. The analysis of restriction endonuclease sites is shown on page

527 of the aforementioned publication. The lambda B fragment is removed with Eco R1 and digested with Sst I. This can prevent recombination with the lambda B fragment. It is also possible to incorporate the Eco RI digestion DNA into a pha 227013gu site at the Eco R1 cleavage site. Phages can be colonized by in situ hybridization as described by Benton W. D. and Davis R. W., Science, 19S, 189 (1977). The vector may be characterized by (a) removing the inserted DNA and determining and comparing molecular weights, (b) analyzing restriction endonuclease sites, and (c) determining the sequence of the inserted DNA.

An E. coli strain, designated X-1776, was developed, and NIH approval was obtained for the use of this strain and using the P2 apparatus as described by Curtiss, III, R., Ann. Roar. Microbiol., 30, 507 (1976). E. coli PR-1 is suitable when a P3 type device can be used. As in the case of plasmids, it is understood that any host cell strain is contemplated in the delivery of the method of the invention if the strain is capable of transmitting the selected vector, including non-bacterial hosts such as yeast, if such strains NIH will be allowed in the future.

Recombinant plasmids are produced by mixing plasmids with DNA that has been treated with restriction endonuclease and cDNA and appropriately treated end groups. In order to minimize cDNA binding to each other, the plasmid is added in a large molar excess. In the previously described methods, the addition of the plasmids in large excess usually resulted in the binding of the plasmid chains to the ring without simultaneously incorporating the cDNA fragment. The cells so treated usually contained predominantly plas22 mid without recombinant cDNA. As a result, the process was very time consuming. Attempts have therefore been made to obtain DNA vectors with a restriction endonuclease site in the middle of the gene of choice, so that incorporation of the recombinants divides the gene, thereby causing a loss of function encoded by said gene.

Preferably, a method is used to reduce the number of colonies to be monitored when a recombinant plasmid is used. The method consists in treating the plasmid which is first treated with a restriction endonuclease with an alkaline phosphatase which is available from several sources, for example Worthington Biochemical Corporation, Freehoid, New Jersey. Alkaline phosphatase removes the 5'-terminal phosphate groups from the ends of the plasmids after endonuclease treatment, thereby preventing the terminal portions of the plasmid DNA from binding together. As a result, ring formation depends on the incorporation of a DNA fragment containing S 2 terminal phosphate groups. In the above manner, the relative frequency of transformation without recombination can be reduced to less than 1 to ICH ⁴ .

The invention is based on the fact that the reaction catalyzed by DNA ligase is made between 5 ^l DNA -phosphates end group and the 3'-hydroxyl end groups of the DNA. If the terminal 5'-phosphate groups are removed, the reaction does not occur. When double-stranded DNA binds, three types of situations can occur as shown in Table I.

Table I

Case Reagent Product after use of ligase

AND 3 ‘ OH 5 * H2O3PO HIM 3 ‘ 3 ‘ 0 — P — 0 0 — P — 0 5 ‘ 5 ‘ + 2 H2O 3 ‘ OPO3H2 5 ‘ + II 3 ‘ 5 ‘ 3 ‘ 5 ‘ OH H2O3P — O 0 — P — 0 + + H2O OH HIM OH OH 5 * 3 ‘ 5 ‘ 3 ‘ Iíl 3 ‘ 5 ‘ OH HIM + 0 reaction OH 5 ‘ 3 ‘

In Table I, the double-stranded DNA is schematically represented by solid parallel lines, the corresponding 5‘- and 3‘-end groups being labeled with a hydroxyl or phosphate residue according to their nature. In case of I, 5 fosf-phosphate is present at both ends, resulting in covalent bonding of both chains. In case II, only one chain has a terminal 5‘-phosphate group, so that after covalent bonding the discontinuity remains on the other chain. A chain that is not covalently bonded remains linked to the bound molecule by hydrogen bonds that occur between the two chains, as is known in the literature. In case of III, there is no binding at any of the termini, since they do not contain a 5‘-phosphate group.

Undesirable binding reactions can be avoided by removing 5‘-phosphate groups from the non-bonded termini. Any method for removing 5 způsobu-phosphate groups can be used for this purpose as long as the DNA structure is not disrupted. A preferred procedure is an alkaline phosphatase catalyzed hydrolysis.

Similarly, the cDNA code for rat growth hormone was isolated, recombined with the plasmid, and transferred to E. coli cells. In this way, it was possible to re-isolate a nucleotide sequence of approximately 800 nucleotides after the sequence contained all of the code for rat growth hormone, including portions of the peptide precursor and a portion of the 5 'region that was not transferred.

In general, the above method can be used to isolate and purify any gene from a higher organism, including human genes, and to transmit and multiply these genes in the cells of microorganisms. The novel recombinant plasmids contain all or part of the isolated gene as described above. New microorganisms, as yet unknown, have also been described whose genetic system has been altered to include genes from a higher organism. Specific examples will be described below in which each step of the method of the invention will be described in detail regarding the isolation, purification and transfer of the rat insulin insulin gene into cells.

E. coli, thereby clarifying the applicability of the method of the invention. The following examples also characterize recombinant plasmids that comprise a portion of the rat insulin gene, the rat growth hormone gene, the human insulin gene, and the human growth hormone gene.

The invention will be illustrated by the following examples.

Example 1

The described procedures illustrate the extraction and isolation of rat insulin insulin mRNA, the synthesis of complementary DNA and the description of the properties of the Complementary DNA. Purified rat islets of Langerhans is obtainable by infusing the pancreas of anesthetized rats with Hanks' solution to expand in E. coli cells by retrograde infusion through the gland duct. Hanks' solution is a standard salt mixture, known and available from a number of manufacturers, for example, the Grand Island Biological Supply Company, Grand Island, New York. The pancreas is then removed, crushed in Hanks' solution at 0 ° C and digested with collagenase and soybean trypsin. All procedures are performed at 0-4 ° C unless otherwise noted. In particular, it is necessary to maintain these conditions when digesting the gland. Two rat pancreas in 8 ml Hanks medium are placed in a 30 ml glass tube. All glass tubes were pretreated with silicone. Siliclad (Clyy-Edams Division, Becton-Dickinson Inc., Persippany, New Jersey) was used for this purpose. and Howes EL, J. Clin. Invest. 32, 1323 (1943), used type CLS IV (Torthington Biochemical Corporation, Freehold, New Jersey) and 1 mg soybean trypsin inhibitor, (Sigma Chemical Company, St. Louis, Incubation should be carried out at 37 ° C for 25 minutes with continuous shaking at 90 oscillations per minute, and the mixture should be observed at all times to ensure that collagenase digestion is at optimal levels. too short, it does not completely release the islets of Langerhans islets, on the other hand, if the incubation is too long, the cells are disrupted. The supernatant is decanted and the segment is washed with Hanks' solution and the procedure is repeated 5 times. After the final centrifugation, the sediment is suspended in 15 ml of Ficoll (Pharmacie Chemical Company, Uppsala, Sweden) at a density of 1.085, then a 1.080 density Fixoll layer and a 1.0 ml of Ficoll 1.060 layer are added and the tube is centrifuged. As a result, the acine cells remain at the bottom of the tube and the cells form a layer between the two upper layers of the preparation.The islet cell belt still contains ganglion cells, lymphatic cells and connective tissue cells. The cells thus obtained are placed under a microscope under which visible contaminants can be removed manually using a micropipette, then the cells are diluted with Hanks' solution and centrifuged again, and the supernatant is decanted and the sediment is stored in liquid nitrogen,

Islet cells from 200 rats are co-homogenized in 4 N guanidinium thiocyanate (Tridom, Fluka AB Chemische Fabrik, Buchs, Switzerland) containing 1 M (3-mercaptoethanol and buffer which maintains a pH of 5.0 at 4 ° C). The homogenate is layered on 1,2 ml of 5.7 M cesium chloride solution containing 100 mM ADTA and the solution is centrifuged at 37,000 rpm for 18 hours.

50.1 rotor of an ultra-centrifuge at a temperature of 15 degrees Celsius. (Beckman Ultracentrifuge Instrument Company, Fullerton, Calif.) When centrifuged, RNA reaches the bottom of the tube.

RNA with polyadenylate groups is isolated by chromatography of all RNA on oligo- (dT) -cellulose as described in Aviv H., and Leder, supra.

F.

Reverse transcriptase from avian mycloblastosis virus (DJ Beard, Life Science Inc., St. Petersburg, Florida) is then used to transfer the entire islet polyadenylate RNA structure from rat islets to cDNA. The reaction is performed in 50 mM hydrochloric acid tris buffer, pH 8.3 containing 9 mM MgCl 2, 30 mM NaCl, 20 mM β-mercaptoethanol, 1 mM each of 3 nonradioactive desoxyribonucleoside triphosphates, 250 fourth labeled and radioactive labeled desoxynucleoside triphosphates. phosphorus with a specific activity of 50 to 200 curie per mole, 20 µg / ml oligo-dTi ₂ -18 (Collaborative Research, Waltham, Massachusetts), 100 µ%! / ml polyadenylated RNA and 200 units / ml reverse transcriptase. The mixture was incubated for 15 minutes at 45 ° C. Sodium ethylenediaminetetraacetic acid is then added to a concentration of 25 mM and the solution is extracted with an equal volume of water-saturated phenol, then the aqueous phase is chromatographed on a 0.3 X 10 centimeter column containing Sephadex G-100 in 10 mM Tris buffer. hydrochloric acid pH 9.0 containing 100 mM NaCl and 2 mM EDTA. The nucleic acid is precipitated with ethanol after addition of ammonium acetate at pH 0.0 to a concentration of 0.25 M. The precipitate is collected by centrifugation, the sediment is dissolved in 50 μl of freshly prepared 0.1 N sodium hydroxide solution and incubated at 70 ° C for 20 minutes for RNA hydrolysis. The mixture was then neutralized by addition of 1 M sodium acetate at pH 4.5 and ³² P-cDNA was precipitated with ethanol and redissolved in water. Single chain cDNA fractions were analyzed on polyacrylamide gel as described by Dingman CW and Peacock AC, Biochemistry 7, 659 (1968). The gel was dried and ³² P-cDNA was detected by autoradiography on a Kodak No-Screen NS-2T film (Hustman Kodat Corporation, Rochester, New York). The material was heterodisperse as judged by electrophoresis. It contained at least one major species of 450 nucleotides cDNA, as evidenced by comparison with a known standard. Example 2

In this example, the synthesis and properties of the double-stranded cDNA containing the sequence of rat insulin as described above will be described. The single strand cDNA and Example 1 were treated with reverse transcriptase to synthesize the complementary strand. The reaction mixture contains 50 mM hydrochloric acid tris buffer, pH 8.3, 9 mM MgCl 2, 10 mM dithiothreitol, 50 mM each of the three unlabeled desoxyribonucleoside triphosphates, 1 mM radio-phosphorus labeled nucleoside triphosphate at a specific activity of 1 to 10 curie per mM, 50 µg / ml cDNA and 220 units / ml reverse transcriptase. The reaction mixture was incubated at 45 ° C for 120 minutes. The reaction is stopped by adding 25 mM sodium EDTA, the mixture is extracted with phenol and chromatographed on Sephadex G-100 and then precipitated with ethanol. The reaction product fraction of 500-1000 cpm was analyzed by gel electrophoresis as described in Example 1. A heterodiaporous band of 450 nucleotides was detected by comparison with standard samples. The differences in the DNA reaction products of Example 1 and Example 2 were then independently digested with excess Hae III restriction endonuclease and analyzed by gel electrophoresis. Both products were cleaved by said endonuclease so that two radioactive bands were observed during gel electrophoresis. The band resulting from the cleavage of the double stranded cDNA had approximately the products of this length as the band that resulted from the cleavage of the single strand cDNA.

Example 3

In this example, the binding of decanucleotide chains after Hind III treatment to double-stranded rat and cDNA islets as described in Example 2. The reaction product of Example 2, double-stranded at a concentration of 2-5 µg / ml is reported in reaction with 30 units of S1 nuclease with activity of 1200 units / ml (miles Laboratories, Elkhart, Indiana) in 0.03 M sodium acetate at pH

4.6 to 0.3 M sodium chloride and 4.5 mM zinc chloride at 22 ° C for 30 minutes, then the mixture is further incubated for 15 minutes at 10 ° C. The reaction was constructed by adding tris-buffer to a concentration of 0.1 M, EDTA to a concentration of 25 mM and tRNA from E. coli, prepared according to the method of Ehrenstein G., Methods in Enzycology, SP Colowick and NO Kaplan, Eds. , St. 12A, p. 588 (1967J to 40 (Wg / ml). The reaction mixture is extracted with phenol, chromatographed on

Sephadex G-100 and substantial ³² P-cDNA are precipitated with ethanol. In this way, the paired-ended cDNA molecules required to bind chemically synthesized decanucleotides are obtained in high yield. Hind III decamers were prepared as described by Scheller RH, Dickerson RE, Boyer HW, Riggs AD, and Itakura K., Science 196, 177 (1977). The binding of Hind III decamers to cDNA is carried out by incubation at 14 ° C in 60 mM Tris-buffered saline pH 7.6 in the presence of 6.6 mM magnesium chloride, 1 mM ATP, 10 mM dithiothreitol, 3 mM Hind III decamer ⁵⁰⁰ cpm / pmol and T4 DNA ligase at about 500 units / ml for 1 hour. The reaction mixture is then heated to 65 ° C for 5 minutes to inactivate the ligase. Potassium chloride was added to a concentration of 50 mmol, β-mercaptoethanol to a concentration of 1 mM and EDTA to a concentration of 0.1 mM, and the mixture was digested with 150 units / ml Hsu I or Hind III endonuclease for 2 hours at 37 ° C. Hind III and Hae III endonucleases are commercially available (New England Bio] Labs, Beverly, Masschusetts). The reaction product was analyzed by gel electrophoresis in the same manner as in Example 1, which showed a peak corresponding to a sequence of approximately 450 nucleotides and, in addition, fragments of the Hind III digested decamers. Example 4

In this example, the formation of the plasmid recombinant and the properties of the recombinant after propagation will be described. The plasmid pMB 9 DNA was prepared according to the method of Rodriguez R. L., Bolivar F., Goodman. M., Boyer HW and Betlach M., in ICN-UCLA, Symposium on Moecular and Cellular Biology, DP Wierlich, WJ Rutter, and CF Fox, Eds., (Academic Press, New York 1976), pp. 471-477, at treatment with Hind III using Hsu I endonuclease followed by BAPF-type alkaline phosphatase (Worthington Biochemical Corporation, Freehold, New Jersey) The enzyme is present in the reaction mixture at 0.1 unit / microgram DNA, Incubate in 25 mM Tris buffer with pH 8 hydrochloric acid for 30 minutes at 65 ° C and then extract with phenol to remove phosphatase, and after ethanol precipitation, the plasmid DNA thus obtained is added to cDNA containing Hind III ends at a molar ratio. 3 mole of plasmid per mole of cDNA, incubated in 66 mM Tris buffer at pH 7.6, the mixture further containing 6.6 mM magnesium chloride, 10 mM dithiothreitol and 1 mM ATP for one hour at 14 ° C. C for present 50 units / ml T4 DNA ligase.

The resulting mixture was added directly to a suspension of E. coli X-1776 cells prepared as follows: Cells were grown to a density of 2 x 10 ⁸ cells / ml in a 50 ml medium containing 10 g / liter of Trypton, 5 g / ml. liter of yeast extract, 10 g / liter of sodium chloride, 2 mM sodium hydroxide, 100 µg / ml diaminopimelic acid and 40 (µg / ml thymine at 37 ° C.) Cells were harvested by centrifugation for 5 minutes at 5000 g at 5 ° C. C, then resuspended in 20 ml cold 10 mM sodium chloride, centrifuged again, and resuspended in 20 ml buffer containing 75 mM calcium chloride, 140 mM sodium chloride and 10 mM tris buffer pH 7.5, after which the cells were allowed to stand on ice for 5 minutes, then centrifuged and resuspended in 0.5 ml of the same buffer, transformed by mixing 100 .mu.l of the cell suspension and 50 .mu.l. DNA recombinants at a concentration of 1 µg / ml at 0 ° C for 15 minutes, then at 25 ° C for 4 minutes and at 0 ° C for 30 minutes. The cells are then transferred to agar plates for further growth.

Study of recombinant plasmids is performed at a tetracycline concentration of 5 µg / ml, the selected recombinant, designated pAU-1, is isolated and the crude plasmid with 2-5 µg of DNA isolated from pAU-1 is digested with excess Hsu I endonuclease. EDTA salt to a concentration of 10 mM and 10% sucrose (w / v%) and the mixture is separated on an 8% polyacrylamide gel. The DNA has approximately 410 base pairs. In a similar experiment, plasmid pBR322 was used. All conditions corresponded to the above conditions except that the final selection of recombinant clones was performed on plates containing ampicillin at a concentration of 20 µg / ml. Example 5

The DNA of pAU-1 of Example 4 was further purified by 6% polyacrylamide gel electrophoresis. After elution from the gel, the DNA is labeled by incubation with gamma- ³² P-ATP and polynucleotide kinase enzyme under the conditions described in Maxama and Gilbert, supra. The enzyme catalyzes the activity of the above-mentioned group of radioactive phosphate to 5% ^. - DNA termination. The enzyme is obtained from E. coli as described in Panet A. et al. Biochemistry 12, 5045 (1973). The labeled DNA was digested with Hae III endonuclease as described in Example 2, and the two labeled fragments containing 265 and 135 bases were separated on a polyacrylamide gel under the conditions described in Example 1. The thus isolated fragments were subjected to specific digestion and base sequence analysis as described. Maxam and Gilbert, supra. The sequence shown in Table 1 below is based on the results of the above experiments and on the result of 227013 similar experiments using cDNA and col E1 derived vectors, for example pMB 9 and pBR322. Regarding the 5'-terminus sequence remains undetermined length of about 50 to 120 nucleotides and poly-dA segment at the ^3! -the ending has different length. This sequence is the most detailed information available so far, it goes without saying that in the course of future experiments some minor changes may be necessary or other parts of the chain will be clarified. The corresponding amino acid sequence of rat proinsulin I starts at the triplet indicated by 1 and ends at the triplet indicated by 86. The uncertainties remain in the region of the sequence that is underlined by the dashed line.

Example 7

This example will describe the isolation and purification of DNA with the full-length rat growth hormone gene, along with the synthesis of a vector that also contains the full-length structure of the gene and a modification of the microorganism strain to contain the rat growth hormone gene as part of its genetic system .

In the case of genes of non-human origin, cDNA isolation of the same high purity as human cDNA is not required by mandatory safety measures. For this reason, it was possible to isolate cDNAs containing the complete structure of the rat growth hormone gene by electrophoretic isolation of DNA of the expected distance, i.e., about 800 base pairs, a known length of the amino acid chain of the rat growth hormone. Source. Rat growth hormone mRNA was a culture of rat pituitary cells and a subclone of the GH-1 cell line (ATCC) as described by Tashjian AH, and other Endocrinologs 82, 342 (1968). hormone and its mRNA contained only in an amount of 1 to 3% of the total amount of poly-A-RNA. However, it was possible to increase the proportion of the desired mRNA and the vigorous action of the thyroid hormone and glucocorticoids. RNA was obtained from 5X10 ⁸ cells in culture suspension and growth hormone production was induced by adding 1 mM dexamethasone and 10 nM 1-triiodotryonine to the culture medium four days prior to cell isolation. Polyadenylated RNA was isolated from the cytoplasmic membrane fraction, for example according to the method of Martial

JA, Baxter, JD, Goodman Η. M. and Seeburg P.

H., Why. Nat. Acad. Sci. USA 74, 1816 (1977) and Baneroft F. C., Wu G and Zuhay C., Proc. Nat. Acad. Sci. USA, 70, 3646 (1973). The mRNA thus obtained was further purified and its structure transferred to double stranded cDNA as described in Examples 1, 2 and 3. A weak but distinct band corresponding to 800 bases DNA was detected by gel electrophoresis.

The cDNA thus obtained from the mRNA was digested with ITha I to obtain two larger DNA fragments after electrophoresis, containing approximately 320 nucleotides for fragment A and 240 nucleotides for fragment B, respectively. The nucleotide sequence and its analysis for fragments A and B were described in Example 5 and showed that these fragments are in fact part of the coding region for rat growth hormone, as judged by the amino acid sequence and compared to the sequences of other known growth hormones that have been described, for example, by Wellis M. and Davies RVN, Crowth Hormone and Related Peptides (Eds., Copecila, A. and Muller E., ej, pp. 1-14 (Elsevier, New York, 1976) and Dayhoff MO, Atlas of Protein Sequence and Structure, 5, Vol 2, pp 120-121 (National Biomedical Research Foundation, Washington, DC, (1976)) When double stranded and 800 base pair electrophoretically isolated cDNA was treated with Hha endonuclease I, the main products of this cleavage were two fragments, the length of which corresponded to the lengths of fragments A and B.

Since this approximately 800 base pair product was not purified to be directly exposed to restriction endonuclease, it was necessary to treat the DNA to remove the unpaired end. Practically this was done by removing the unpaired ends before electrophoresis in a solution of 25 μΐ 60 mM hydrochloric acid tris buffer pH 7.5 with 8 mM magnesium chloride, 10 mM; 3-mercaptoethanol, 1 mM ATP and 200 μΜ. each of the dATP, dTTP, dGTP, and dCTP policies. The mixture was incubated with one unit of E. coli DNA polymerase I at 10 ° C for 10 minutes, as a result of which the 3‘-end was exonucleolytically removed and the 5‘-end was filled in. DNA polymerase I is commercially available (Boehringer-Mannheim Biochemicals, Indianapolis, Indiana).

The rat growth hormone cDNA of approximately 800 base pairs was further processed with the chemically synthesized Hind III chain-linked Hind III as described in Example 3. Plasmid pBR-322, which contains the ampicillin resistance gene and a single Hind III site, located in the middle of the tetracycline resistance genes, it is first treated with Hind III endonuclease and alkaline phosphatase as described in Example 4. The treated plasmid is then ligated to 800 bp rat growth hormone cDNA by DNA βase in the manner described in Example 3. This The reaction was used to convert a suspension of bu227013 into some E. coli X-1776, which was processed as described in Example 3. Recombinant colonies were distinguished by growth on ampicillin-containing plates and inability to grow on plates containing 20 µg / ml tetracycline. 10 colonies were obtained, all of which contained a plasmid with 800 base pairs, as released after digestion with Hind III.

The 800 bp rat growth hormone DNA was isolated in preparative amount from clone pRGI-I-1 (a clone containing growth hormone recombinant) and the nucleotide sequence was determined as described in Example 5. In this case, the nucleotide sequence contained a 5 'portion non-transferred regions of rat growth hormone and, in addition, a sequence of 26 amino acids that occurs in a protein that is a precursor of growth hormone prior to its secretion. The sequence of mRNA that can be derived from the uTa leader gene sequence is shown in Table 2. This sequence is in good agreement with the predicted amino acid result except for positions 1 and 8. The amino acid sequence in rat growth hormone as described was used as a basis in Wallis and David, supra, the sequence comprises residues 1 to 43, 65 to 69, 108 to 113, 133 to 143 and 150 to 190.

Table 2 shows the sequence of nucleotides in one of the DNA strands, which strand contains the complete code for the growth hormone. Corresponding amino acids and their position relative to the terminal at which the free amino group is located are also shown. Negative number amino acids are amino acids that belong to the growth hormone precursor sequence. The corresponding mRNA sequence is the same except that in mRNA, T is replaced by U.

bulka 1

-GTGGACAGATCACTGAGTGGCG -26 Met ATG Trp TGC Leu CTC Leu CTG Thr ACC Phe TTC Ser AGC Leu CTG Glu GAG Ala GCT Gly GGT Ais GCT 1 Leu TTA For CCT Ais CCC Ala GCT Asn AAT Ala GCT Wall GTG Leu CTC Arg CGA Ala CCC Ala GCT Asp GAC Thr ACC Tyr TRAY Lys AAA Glu GAG Phe TTC 40 Gly Gin GGA CAG Arg CCC Tyr MELT Ser TCC Ile ATT Gin CAG Phe TTC Ser TCA Glu GAG Thr ACC 60 Ile Pro ATG CCA Ais CCC Gin CAG Gin CAG Arg AGA Thr ACT Asp GAC Met ATG Glu GAA Leu CTG Ile ATC Gin GAC Ser TCA Trp TGG Leu CTG Gly GGG Ile ATG Phe TTT Thr ACC Asn AAC 100 ALIGN! Ser Leu AGC CTG Met ATG Tyr MELT Glu GAG Lys AAA Leu CTG Lys AAG Asp GAC Leu CTG Met ATG Gin CAG Gin CAG Leu CTG Glu GAA Asp GAG Gly GGC

Ais Ala Asp Ser Gin Thr For GCT GCA GAC T.CT CAG ACT CCC Leu Cys Leu Leu Trp For Gin CTG TGC CTG CTG TGG CCT CAA Met For Leu Ser Ser Leu Phe ATG 'CCC TTG TCC AGT GUG TTT

Gin CAG His CAC Leu CTG His CAC Gin CAG Leu CTG Ala GCT Glu CAG Arg CGT Ala GCG Tyr TRAY Ile ATT For CCC Glu GAG Asn AAT Ais CCC Gin CAG Ala GCT Ala GCT Phe TTC Cys TCC For CCC Thr ACC Gly GGC Lys AAG Glu GAG Glu GAG Ala CCC

Leu Leu Arg Phe Ser Leu Leu TTG CTT CGC TTC TCG CTG CTG For Wall Gin Phe Leu Ser Arg CCC GTC CAC TTT CTC AGC ACG Phe Gly Thr Ser Asp Arg Wall TTT GGT ACC TCG GAC CCC GTC

120

Glu Glu Gly Ile Gin Ala Leu GAA GAG GGC ATC CAG GCT GTG Ser For Arg Ile Gly Gin Ile AGC CCC CGT ATT GGG CAG ATC

140

Leu CTC Lys AAG Gin Thr Tyr MELT Asp GAC Lys AAG Phe TTT Asp GAC Ala GCC Asn Met Arg CGC Ser AGC CAA ACC AAC ATG Asp Asp Ala Leu Leu Lys Asn Tyr 160 Gly Leu Leu Ser Cys Phe GAT GAC GCT CTG CTG AAA AAC MELT GGG CTG CTG TCC TGC TTC

Lys Lys Asp Lys Asp Leu His Lys Ala Glu Thr Tyr Leu Arg AAG AAG AAG AAG GAG CTGCAG AAG GCA GAG ACC TAG CTG CGG 180 Val Met Lys Cys Arg Arg Phe Ala Glu Ser Ser Cys Ala Phe GTC ATG AAG TGT CGC CGC TTT GCG GAA ACC ACC TGT GCT TTC

TAG GCACACACTGGTGTCTCTGCGGCACTCCGCCCGTTACCCCCTGTACTCTGGCAACTGCCA CCCCTACA

CTTTGTCCTAATAAAATTAATGATGCATCATATC poles (A) —-3 ‘

Example 8

This example described the isolation and purification of the full-length code of the human growth hormone gene, the synthesis of the plasmid recombinant, which also contains the full structure of the growth hormone gene, and modification of microorganisms to contain the full structure of the human growth hormone gene as part of its genetic system.

The isolation of human growth hormone mRNA is carried out essentially as described in Example 7, except that the biological source of the material is a human pituitary tumor. Five benign human pituitary tumors were used, which were rapidly frozen in liquid nitrogen after surgical removal, the tumor weight was 0.4-1.5 g after thawing, the tumors were homogenized in 4 M guanidinium thiocyanate containing 1 M mercaptoethanol in the presence of a buffer of pH 5 At 0 ° C. The homogenate was layered on

1.2 ml of 5.7 M cesium chloride containing 100 mM ADTA and centrifuged for 18 hours at 37,000 rpm in a SW 50.1 ultra centrifuge rotor (Beckman Instrument Company, Fullerton, Calif.) At 15 ° C. The RNA settles on the bottom Further purification using an oligo-dTa sucrose column was carried out as described in Examples 1, 2 and 3. Approximately 10% of the RNA thus isolated contained a code for growth hormone as evidenced by incorporating a radiolabeled amino acid precursor into the a cell-free system obtained from wheat germ containing a growth hormone counteractant as described by Roberts, E. and Patterson, M., Proc. Natl Acad. Sci. Human growth hormone cDNA was performed as in Example 7 by gel fractionation by gel electrophoresis with the material migrating to a position corresponding to a length of 800 nuclei The selected fraction was treated with DNA polymerase I as described in Example 6, followed by ligating containing sites suitable for Hind III. The cDNA is then recombined with plasmid pBR-322, pretreated with alkaline phosphatase, using DNA ligase. Recombinant DNA is then transformed with E. coli X-1776 and the strain containing DNA for human growth hormone is isolated by selection.

The strain containing this DNA is further grown, the DNA for human growth hormone is isolated from the strain and the nucleotide sequence determined. The cloned DNA for human growth hormone contains the code for the complete amino acid sequence in human growth hormone. The first 23 amino acids of human growth hormone form a sequence

HzN-Phe-Th-Thr-Ile-Th-Leu-Ser-Arg-Leu-Phe-Asp20

-Asn-Ala-Met-Leu-Arg-Ala-His-Arg-Leu-His-Gln-Leu-.

The rest of this sequence is shown in Table 3.

Table 3 shows the nucleotide sequence of a single strand of human growth hormone DNA. The numbering corresponds to the amino acid sequence in human growth hormone, numbered from the end at which the free amino acid is located. The DNA sequence corresponds to the human growth hormone mRNA sequence except that T is replaced by U in the mRNA.

34

Table 2

5 ‘—- G Ala Phe GCC TTT Asp Thr GAC ACC Tyr Gin TAC CAS Glu Phe Gag TTT Glu Glu GAA Ala Tyr GCC TAT Ile ATC For CCA Lys AAG Glu GAA 40 GIN LYS CAG AAG 43 Tyr Ser TAT TCA Phe TTC Leu CTG Gin GAG Asn AAC For CCC Gin CAG Thr ACC Ser TCC Leu CTC Cys TGR Phe RRC Ser TCA Glu GAG Ser TCT Ue ATT For CCG 60 Thr Pro ACA CCC Ser TCC Aan AAC Asg AGG Glu CAG Glu GAA Thr ACA Cln GAA Hall CAC Lys AAA Ser TCC Asn AAC Leu CTA Glu GAG Leu CTG Leu ctc Arg CCC Ile ATC Ser TCC 80 Leu Leu CTG CTG Leu CTC Ile ATC Gin CAG Ser TCG Trp TGG Leu CTG Glu CAG For CCC Wall GTG Gin GAG Phe TIC Leu CTC Arg AGG Ser AGT Wall GTC Phe TTC Ala GCC Asn AAC 100 ALIGN! Asn Leu AAC CTG Wall CTG Tyr TRAY ., Gly GGG Ala GCC Ser TGT Asp CAC Ser AGC Asn AAC Wall GTC Tyr MELT Asp GAC Leu CTC Leu CTA Lys AAC Asp GAC Leu CTA Glu GAG Glu CAA

120

Gly GCC Ile ATC Gin CAA Thr ACC Leu CTG Met ATG Gly GGG Arg AGG Leu CTG Glu CAA Asp CAC Gly GGC Ser AGC For CCC Arg Thr Gly Gla Ile Phe 140 Lys Gin Thr Tyr Ser Lys Phe Asp CGG AGT GGG CAG ATG TIC AAG CAG ACC TRAY AGC AAG TIC GAC

160

Thr ACA Asn AAC Ser TCA His CAC Asn His AAC GAT Asp GAC Ala GCA Leu CTA Leu CTC Lys AAG Asn AAC Tyr TRAY Gly GGG Leu CTG Leu CTG Tyr TAG Cys TGC Phe Arg TIC AGG Lys AAG Asp GAC Met ATG Asp GAC Lye AAC Wall GTC Glu GAG Thr ACA Phe TTC Leu CTG Arg CGC Ile AND IT 180 Val Gin CTG CAG Cys TGC Arg CGC Ser TCT Wall CTG Glu GAG Gly GGG Ser AGC Cys TGT

191

Gly Phe GGC TTC

TAG CTCCCCGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGG - -3 ‘

Example 1a

The method of Example 1 is repeated, a however, the β-mercaptoethanol concentration varies when islet cells are homogenized. The concentrations of β-mercaptoethanol used were 0.05 M, 0.2 M, 0.6 M and 0.8 M, respectively.

Example 1b

The procedure of Examples 1 and 1a is repeated, but the pH of guanidinium thiocyanate and β-mercaptoethanol is changed at. homogenization of islet cells. PH 6.0, 7.0 and 8.0 were used. At all these values, the same results were achieved, that is, it was possible to prevent mRNA degradation by ribonuclease,

Example 3a

Eco RI site decanucleotides bind to the cDNA of Example 2 as described in Example 3. Eco RI site decamers are prepared as described in Scheller et al., Supra, and have the sequence 5'-CCGAATTCGG-3 ^. . After coupling, the product is treated with Eco RI under the same reaction conditions as described for Hsu I or Hind III. Eco RI is commercially available (New England Biolabs). The reaction product was analyzed by gel electrophoresis in the same manner as in Example 1 and a peak corresponding to a sequence of approximately 450 nucleotides was observed, except for the fragments of the cleaved decamer.

Example 4a

i) The procedure of Example 4 was repeated using plasmids pBR322, prepared according to Bolivar et al., Gene 2, 95, (1977J) instead of plasmid pMB 9 DNA.

All conditions were maintained except for the final selection of recombinant clones, which was carried out on plates containing 20 µg / ml tetracycline. The incorporated portion was removed as described above to yield 410 base pair DNA of the sequence shown in Table 1.

ii) The method of Example 4 was repeated using plasmid pBR322 DNA prepared according to Bolivar et al., Gene 2, 75 (1977) instead of plasmid pMB 9 DNA. All conditions are retained except for the final selection of recombinant clones, as described above, to obtain 410 bp DNA with the sequence shown in Table 1.

iii) The procedure of Example 4 was repeated using the plasmid pSCIO1 DNA prepared by the method of Cohen et al., Proc. Nat. Acad. Sci. USA, 70, 1293 (1973) instead of plasmid pMB 9 DNA. All conditions are maintained including selection of recombinant clones. The insert is removed as described above to obtain 410 bp DNA with the sequence shown in Table 1.

Example 4b

The procedure of Examples 4 and 4a was repeated except that E. coli RR1 or E. coli HB101 was used instead of E. coli X-1776. All conditions are otherwise maintained and the same results have been achieved.

Example 4c

i) Charon 15A DNA prepared as described in the above-mentioned Blattoer publication is used as the transfer vector. The terminations were combined by incubation at 42 ° C for minutes in 0.1 M tris-HCl, pH 8.0 and 10 mM magnesium chloride. The vector was digested with Eco RI at the site of treatment and then treated with alkaline phosphatase as in Example 4. After ethanol precipitation, the phosphatase treated cDNA vector was added to the cDNA containing the Eco RI digestion at a 2 molar ratio of 2 moles of vector per 1 mol cDNA. The mixture was ligated with T4 DNA ligase as in Example 4. The mixture was directly added to the E. coli X-1776 cell suspension prepared as described in Example 4 and transformed also as described in Example 4. Recombinant phages were isolated and grown to lac Of bacteria on plates containing 80 ₍ g / ml of 5-chloro-4-bromo-3-indolyl- [beta] -D-galactoside (X6), recombinant phages containing cDNA inserted into the Eco treatment site were isolated RI of Charon 16A and give rise to colorless plaques The recombinant after selection is isolated and treated with an excess of Eco RI endonuclease and the mixture analyzed according to Example 4 and

5. The 410 bp DNA was obtained with the sequence shown in Table 1. The mixture can also be used to generate recombinant phages in vitro as described by Sternberg N. et al., Gene 1, 255 (1977). Recombinant phage properties can also be demonstrated by in situ hybridization as described by Benton W. D. and Davis R. W., Science 198: 180 (1977).

ii) Charon 3A DNA, prepared according to the above Blattner publication, is used as a vector instead of Charon 16A DNA. Otherwise, the conditions described for Charon 16A DNA are retained.

Recombinant phage selection is performed by culturing phage on lac + bacteria on X6-containing plates with colorless plaque isolation and then hybridizing or restriction endonuclease treatment as also described in the above-mentioned Blattner publication. The incorporated portion was removed as described above to obtain 410 bp DNA with the sequences shown in Table 1.

(iii) gtWES. B DNA, prepared as described in Tiemier et al., Is used as a vector instead of Charon 16A. All conditions are otherwise the same as Charon 16A. Selection of recombinant phages is performed by hybridization according to Benton and Davis, supra. The insert is removed to give 410 bp DNA with the sequence shown in Table 1.

Example 4d

The procedure of Example 4c is repeated, but using E. coli RRI, E. coli HB101,

An E. coli DP50 or E. coli DP50SupF site

E. coli X-1776. All conditions are otherwise the same and the same results are obtained.

Example 6

Disclosed is the isolation and purification of DNA with a nucleotide sequence coding for human insulin and the synthesis of a vector containing DNA as well as the generation of a microorganism strain that contains this DNA as part of its genetic information.

Islet cells are isolated from human pancreas by the method of Example 1. This tissue is obtained from deceased humans or from insulinomas. Islet cells mixed from several pancreas are homogenized in 4 M guanidinium thiocyanate and containing 0.2 M / N-mercaptoethanol at pH 5.0 as described in Example 1. Polyadenylated RNA is isolated by chromatography as described above by Aviva and Leder. Single stranded cDNA was then prepared using reverse transcriptase and hydrolyzed cDNA according to Example 1. Double stranded cDNA was prepared according to Example 2 and digested with nuclease S1 according to Example 3. According to the same example, human insulin cDNA was added to the cDNA. allowing binding to the Hind III digestion. The product was treated with Hind III or Hsu I and analyzed as described in Example 3. A peak corresponding to the 450 nucleotide sequence was observed, except for the fragments of the cleaved decamers at the Hind III site. Then, human insulin cDNA containing the Hind III-binding sites were inserted into plasmid pMB9. This procedure was carried out according to Example 4 as well as transformation of E. coli X-1776 and selection of recombinant plasmids. The insert is removed by Hsu I and analyzed as described in Example 4. _t A DNA of 450 nucleotides. Cloned human insulin can be detected which contains nucleotides that code for the entire amino acid sequence of human Insulin.

The amino acid sequence of chain A is as follows:

10 Gly-Ile-Val-Glu-Cys-Cys-Thr-Ser-Ile-Cys

-Ser-Leu-Tyr-Flu-Leu-Glu-Asn-Tyr-Cys-Asn.

The amino acids in chain B have the following sequence:

Phe-Val-Asn-Glu-His-Leu-Cys-Gly-Ser-His-Leu

Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu30

- Arg - Gly - Phe - Tyr - Thr - Pro - Lys - Thr.

The amino acid sequence is numbered from the end at which the free amino group is located.

Example 6a

i) Example 6 was repeated except that plasmid pBR322 was used instead of plasmid pMB 9 DNA. All conditions are otherwise identical to those in Example 4a (i). The insert is removed to obtain 450 nucleotide DNA with the sequence described in Example 6.

The procedure of Example 6 was repeated except that plasmid BR313 DNA was used instead of plasmid pMB 9 DNA. All conditions are the same as in Example 4a (iij. The insert is removed to give 450 nucleotide DNA with the sequence described in Example 6).

iiij The procedure of Example 6 was repeated using plasmid pSCIO1 DNA instead of plasmid pMB 9 DNA. All conditions are otherwise the same as in Example 4a (iiij. The insertion portion is removed to yield 450 nucleotide DNA with the sequence described in Example 6.

Example 6b

The procedure of Examples 6 and 6a was repeated except that E. coli RRI or E. coli HB101 was used instead of E. coli X-1776. All conditions are identical and the results obtained are identical.

Example 6c

Using the method of Example 6, human insulin cDNA was prepared and treated with chemically synthesized chains bound at the Eco RI site of Example 3a.

Incorporation of Eco RI treated human insulin cDNA into the Eco RI treatment site of Charon 16A according to Example 4c (i). Recombinant phages were isolated and the incorporated portion removed as in Example 4x (i). DNA of 450 nucleotides was obtained with the sequence described in Example 6.

ii) Incorporation of human insulin cDNA with Eco RI-binding sites into the Charon 3A vector of Example 4c (ii). Recombinant phages were isolated and analyzed according to Example 4c (ii) to obtain 450 nucleotide DNA with the sequence described in Example 6.

iiij Plasmid gtWES. B is used as a vector for the transfer of human insulin cDNA after Eco RI treatment according to Example 4c (iiij). Recombinant phages are isolated and analyzed. The insert is removed to obtain 450 nucleotide DNA with the sequence described in Example 6.

Example 6d

Example 6c is repeated, using E. coli RRI,

E. coli HB101, E. coli DP50 or E. coli DP50SupF instead of E. coli X-1776. The same conditions are used and the same results are obtained.

Example 7a

i) The procedure of Example 7 was repeated using plasmid pMB 9 DNA prepared by the method of Rodrigez et al., supra. All conditions are otherwise the same except for the selection and analysis performed according to the method of Example 4. The insert is removed to obtain 800 base pair DNA with the sequence shown in Table 2.

ii) The procedure of Example 7 was repeated except that plasmid pSC101 DNA prepared according to Cohen et al., Proc. Nati. Acad. Sci. USA 70, 1293 (1973) instead of plasmid pBR322 DNA. Otherwise, all conditions are identical, including selection and analysis. The insert is removed to obtain 800 base pair DNA with the sequence shown in Table 2.

iiij The procedure of Example 7 was repeated except that plasmid pBR313 DNA prepared according to Bolivar et al., Gene 2, 75 (1977) was used instead of plasmid pBR322 DNA. All conditions including final selection are identical. The insert is removed to obtain 800 bp DNA with the sequence shown in Table 2.

Example 7b

Examples 7 and 7a are repeated, but E. coli RRI and E. coli HB101 are used instead of E. coli X-1776. All conditions are identical and the same results are obtained.

Example 7c

The RGH-cDNA prepared according to Example 7 was treated with chemically obtained sequences at the Eco RI site as described in Example 3a.

i) Charon 16A DNA prepared according to the above Blattner publication is used as a vector. The Eco RI-treated RGH-cDNA was inserted into the Eco RI treatment site at Charon 16A by the method of Example 4c (ij. Recombinant phages were isolated and analyzed according to Example 4c (i). to obtain DNA of approximately 800 base pairs with the sequence shown in Table 2.

ii) Charon 3A DNA prepared according to the above Blattner publication is used as a vector. RGH-cDNA is treated with Eco RI into Charon 3A, recombinant phages are isolated and analyzed, and the insert is removed according to Example 4c (ii).

DNA of 800 base pairs was obtained with the sequence shown in Table 2.

(iii) AgtWES. The λ B DNA prepared according to the above-mentioned Tiemier publication is used as a vector. Eco RI-treated RGH-cDNA was incorporated into the vector, recombinant phages were isolated and analyzed, and the insert was removed as in Example 4c (i). DNA of approximately 800 base pairs was isolated with the sequence shown in Table II.

Example 7d

Example 7c is repeated, but instead of E. coli X-1776, E. coli RRI, E. coli HB101, E. coli DP50 or E. coli DO50SupF is used. Otherwise, the conditions are identical and identical results are also obtained.

Example 8a

i) Example 8 is repeated using plasmid pMB 9 DNA prepared according to the above-mentioned Rodriguez site of plasmid pBR322. All conditions are otherwise identical except for the final selection and analysis according to Example 4. The insert is isolated to obtain 800 bp DNA with the sequence described in Example 8.

The procedure of Example 8 was repeated except that the plasmid pSCIO1 DNA prepared according to Cohen et al., Proc. Nati. Acad. Sci. USA 70, 1293 (1973) instead of plasmid pBR322 DNA. All conditions were otherwise the same as for plasmid pMB 9. The insert was removed to yield 800 bp DNA with the sequence described in Example 8.

iii) The procedure of Example 8 was repeated using plasmid pBR313 DNA prepared by the method of Bolivar et al., Gene 2, 75 (1977) instead of plasmid pBR322 DNA. All conditions are otherwise identical. The incorporated portion is removed as described above. 800 bp DNA was obtained with the sequence described in the example

8.

Example 8b

The procedure of Examples 8 and 8a was repeated except that E. coli RRI or E. coli HB101 was used instead of E. coli X-1776. All conditions are otherwise identical and identical results are also obtained.

Example 8c

The HGH-cDNA prepared according to Example 8 was treated with the chemically synthesized strands at the Eco RI site of Example 3a.

(i) Eco RI-treated HGH-cDNA was inserted into Charon 16A DNA by the method of Example 7c (ij. Recombinant phages were isolated and analyzed according to Example 7c (i). 800 base pairs with the sequence described in Example 8.

The HGH-cDNA was treated with Eco

The RI is inserted into Charon 3A DNA as described in Example 7c (ii). Recombinant phages were isolated and analyzed, and the insert was removed as described in Example 7c (ii) to obtain 800 base pair DNA with the sequence described in Example 8.

iii] HGH-cDNA treated with Eco R1 was incorporated into λ gtWES. λ B DNA as described in Example 7c (iii). Recombinant phages according to Example 7c (iii) were isolated and analyzed. The insert was removed as in Example 7c (iiiJ) to obtain 800 base pair DNA with the sequence described in Example 8.

Example 8d

The method of Example 8c is repeated, but using E. coli RRI, E. coli HB101, E. coli DP50 or E. coli DP50SupF instead of F. coli X-1776. Otherwise, the conditions are identical and the results obtained are identical.

Claims (5)

1. A method for producing a DNA transfer vector with a nucleotide sequence coding for growth hormone. By isolating cells containing a miRNA containing the code for growth hormone, the mRNA is extracted and purified from these cells, and synthesized from the mRNA. Growth hormone-coding DNA cDNA, and said cDNA is reacted with a DNA transfer vector to produce a growth hormone-encoding DNA sequence, characterized in that the mRNA is extracted from the cells which contain mRNAs encoding growth hormone by homogenizing these cells in the presence of a ribonuclease inhibitor containing guanidinium thiocyanate and β-mercaptoethanol at pH 5.0 to 8.0 to prevent the degradation of the mRNA by ribonuclease and cDNA is reacted with a DNA transfer vector by first enzymatically hydrolyzing the DNA transfer vector with a restriction endonuclease from the Hind III, Hsu I or Eco R1 group to form a vector for p transfer of DNA with reactive ends capable of binding to each other or cDNA sequence of nucleotides coding for growth hormone and then enzymatically joining said DNA transfer vector with cDNA with sleynAleza dem nucleotides coding for growth hormone by DNA ligase the presence of ATP to produce a DNA transfer vector with a nucleotide sequence that encodes growth hormone. 2. The method of item 1 for producing a DNA transfer vector having a nucleotide sequence coding for growth hormone, characterized in that after the first step of processing a further step is provided in which any 5 is enzymatically hydrolyzed ^; a phosphate end-group of a DNA-transferring vector with reactive ends to form a pre-processed DNA-transferring vector with terminations that are incapable of associating with cDNA with a nucleotide sequence coding for growth hormone. 3. The method of claim 1 wherein the ribonuclease inhibitor comprises 4 N guanidinium thiocyanates and 0.05 to 1.0 M / 3-mercaptoethanol. 4. The method of claim 3, wherein the inhibitor comprises 0.2 M / S-mercaptoethanol. 5. The process according to claim 2, wherein the enzymatic hydrolysis is carried out by alkaline phosphatase.