CN205741038U - One pipeization packaging diagnostic reagent bottle - Google Patents
One pipeization packaging diagnostic reagent bottle Download PDFInfo
- Publication number
- CN205741038U CN205741038U CN201620507069.8U CN201620507069U CN205741038U CN 205741038 U CN205741038 U CN 205741038U CN 201620507069 U CN201620507069 U CN 201620507069U CN 205741038 U CN205741038 U CN 205741038U
- Authority
- CN
- China
- Prior art keywords
- reaction tube
- pipeization
- reaction
- diagnostic reagent
- reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The utility model discloses an a kind of pipeization packaging diagnostic reagent bottle.It includes the first reaction tube of an open at both ends, is fastenedly connected a sealing lid in one end of the first reaction tube；The other end at the first reaction tube is removably disposed one second reaction tube, and second reaction tube open at one end one end is closed and the other end of opening end and the first reaction tube connects；One barrier film being fastenedly connected with surrounding inner tubal wall is set in the first reaction tube.This utility model is owing to arranging a barrier film being fastenedly connected with surrounding inner tubal wall in the first reaction tube, therefore reactant can be respectively put in the first reaction tube and the second reaction tube, prevent two reactant mixing in a non-operative state, it is to avoid diagnostic reagent lost efficacy or destroyed the stability of agent formulations.Barrier film of the present utility model is owing to using thin film or paraffin, the most rupturable by external force the most in use, it is simple to the reactant hybrid reaction in the first reaction tube and the second reaction tube.
Description
Technical field
This utility model relates to an a kind of pipeization packaging diagnostic reagent bottle.
Background technology
Existing diagnostic reagent reaction system is more complicated, such as diagnostic nucleic acid reagent, needs first by therein slow before using
Rushing the materials such as system, enzyme, primer and fluorescent probe and separately hold preservation, enzyme the most therein, primer and fluorescent probe need
It is positioned in the low temperature environment of-20 DEG C preservation.Each material could be mixed in use, preparation system the most not side when therefore using
Just, in the urgent need to providing the packing method of the diagnostic reagent of a kind of simplicity.
Utility model content
The purpose of this utility model is to provide an a kind of pipeization packaging diagnostic reagent bottle, and this utility model is by trying diagnosis
Two parts of agent or many portion of reagent are kept apart and are preserved, and are punctured by external force, the mode such as centrifugal or heating will during reaction again
Two parts or be partially bonded together, thus two parts or the mixing of many portion of reagent and the diagnosis that causes before avoiding reaction more
Reagent lost efficacy or destroyed stablizing of a certain composition, enormously simplify operating procedure simultaneously.
A pipeization provided by the utility model packs diagnostic reagent bottle, and it includes the first reaction tube of an open at both ends,
It is fastenedly connected a sealing lid in one end of described first reaction tube；The other end at described first reaction tube is removably disposed one
Second reaction tube, described second reaction tube open at one end one end is closed and the other end of opening end and described first reaction tube connects
Connect；In described first reaction tube, a barrier film is set.
In an above-mentioned pipeization packaging diagnostic reagent bottle, a groove is set in described sealing lid, is used for holding described glass
Compound.
In an above-mentioned pipeization packaging diagnostic reagent bottle, at described first reaction tube and the outer tube wall of described second reaction tube
Upper it is nested with a damping ring respectively, the described membrane ruptures when being collided with by external force can be avoided；
Described barrier film uses thin film or paraffin.
In an above-mentioned pipeization packaging diagnostic reagent bottle, described first reaction tube, described second reaction tube and described sealing
Lid all uses plastic material to make.
The application in packaging diagnostic reagent of the above-mentioned pipeization packaging diagnostic reagent bottle falls within protection of the present utility model
Scope.
This utility model is owing to taking above technical scheme, and it has the advantage that
1, this utility model owing to being fastenedly connected a sealing lid in one end of the first reaction tube, at another of the first reaction tube
End is removably disposed one second reaction tube, arranges a barrier film being fastenedly connected with surrounding inner tubal wall in the first reaction tube, because of
Reactant can be respectively put in the first reaction tube and the second reaction tube by this, prevents two reactant mixing in a non-operative state,
Avoid diagnostic reagent to lose efficacy or destroy the stability of agent formulations.
2, barrier film of the present utility model is owing to using thin film or paraffin, the most rupturable by external force the most in use, just
Reactant hybrid reaction in the first reaction tube and the second reaction tube.
3, this utility model is owing to being provided with groove in sealing lid, is therefore easy to holding of solid reactants.
4, this utility model is owing to being nested with a damping ring respectively on the outer tube wall of the first reaction tube and the second reaction tube, because of
This can be avoided the membrane ruptures when being collided with by external force.
Accompanying drawing explanation
Fig. 1 is the result schematic diagram of this utility model one pipeization packaging diagnostic reagent bottle.
In figure, each labelling is as follows:
1 first reaction tube, 2 sealing lid, 3 second reaction tubes, 4 barrier films.
Fig. 2 is the reaction result that in this utility model embodiment 2, a pipeization packaging is packed with a non-pipeization.
Fig. 3 is shigella sensitivity results in this utility model embodiment 3, and wherein, Fig. 3 (A) is a pipe pack
Detection shigella sensitivity, curve 1 represent be sample nucleic acid concentration be 4.5ng/ul, curve 2 represent be sample core
Acid concentration is 2.450pg/ul, curve 3 represent be sample nucleic acid concentration be 3.45pg/ul, curve 4 represent be sample nucleic acid
Concentration is 4.4.5pg/ul, curve 5 represent be sample nucleic acid concentration be 5.450fg/ul, curve 6 represent be sample nucleic acid
Concentration is 6.45fg/ul；Fig. 3 (B) is regular-PCR method electrophoresis result, and wherein, that band M represents is DNA marker 2000,
Band 1 represent be sample nucleic acid concentration be 4.5ng/ul, band 2 represent be sample nucleic acid concentration be 2.450pg/ul, bar
With 3 expressions be sample nucleic acid concentration be 3.45pg/ul, band 4 represent be sample nucleic acid concentration be 4.5pg/ul, band 5
For negative control.
Fig. 4 is Salmeterol fluticasone propionate test kit specificity experiments result in this utility model embodiment 4, wherein, and curve 1 table
Show is Salmonella, and what curve 2 represented is vibrio parahaemolyticus, and what curve 3 represented is staphylococcus aureus, curve 4 table
That show is escherichia coli O157, and what curve 5 represented is shigella dysenteriae, and what curve 6 represented is Listeria monocytogenes, curve
7 expressions are Shigella sonneis, and what curve 8 represented is escherichia coli, and what curve 9 represented is shigella flexneri, curve
10 expressions are Pseudomonas aeruginosas, and what curve 11 represented is bacillus botulinus, and what curve 12 represented is stenotrophomonas maltophilia,
What curve 13 represented is distilled water negative control.
Detailed description of the invention
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
Embodiment 1, one pipeization packaging diagnostic reagent bottle
As it is shown in figure 1, this utility model one pipeization packaging diagnostic reagent bottle includes the first reaction tube 1 of an open at both ends,
It is fastenedly connected a sealing lid 2 in one end of the first reaction tube 1, a groove 21 holding solid reactants is set in sealing lid 2.
The other end at the first reaction tube 1 is removably disposed one second reaction tube 3, and second reaction tube 3 open at one end one end is closed, and
The other end of opening end and the first reaction tube 1 connects.In the first reaction tube 1, it is fastenedly connected one be arranged vertically with surrounding inner tubal wall
Barrier film 4.Barrier film 4 is used for the reactant of the reactant in stop the first reaction tube 1 and the second reaction tube 3 in a non-operative state
Contact.
In above-described embodiment, barrier film 4 can use thin film or paraffin.
In above-described embodiment, first reaction tube the 1, second reaction tube 3 and sealing lid 2 can use transparent plastic material system
Become.
In above-described embodiment, the outer tube wall of the first reaction tube 1 and the second reaction tube 3 can be nested with a damping ring 5 respectively,
Reactant is made to react in a non-operative state for avoiding this device to cause barrier film 4 to rupture when being collided with by external force.
Embodiment 2, a pipeization packaging of diagnostic nucleic acid reagent
Diagnostic nucleic acid reagent:
Reaction reagent A: need the reagent that low temperature (-20 DEG C to 4 DEG C) transports, Bst archaeal dna polymerase, four kinds of dNTP and primer
(F3:CGCTGACAATCGCTTCTCAT；B3:GTTCTTCGCTTTGGCAATGT；FIP:CTGTCACCGAGTGCAACCACTT-
AACCACACGATCTGGAGCA；BIP:GCATCACAATGGCGCTTCCC-ACCGTTGGAGAAGTGACCTA；LF:
CTGCATTGCTGCGTCGT；LB:TAACCCGAACAGCTGGTTCT)；
Reaction reagent B: can room temperature transport liquid reactions reagent, Tris-HCl, KCl, (NH4)2SO4、MgSO4、
Tween20 and Betaine (glycine betaine).
Reaction reagent A is carried out vitrification: vitreous liquid is made up of two parts: a part is into glass carrier, belongs to saccharide；
Another part is protective agent, belongs to heat shock protein and dehydrated protein class, by reaction reagent A and vitreous liquid according to the volume of 10:1
Ratio mixes, and is placed in the ventilated environment of 50 DEG C 10 hours, i.e. completes vitreous process.
Vitreous thing obtained above is positioned in embodiment 1 one pipeization packaging diagnostic reagent bottle and seals the groove in lid 2
In 21, reaction reagent B is contained in the second reaction tube 3 in embodiment 1 one pipeization packaging diagnostic reagent bottle, reacts first
Pipe 1 coordinates with the second reaction tube 3, and isolates with paraffin, then with sealing lid 2 sealing the first reaction tube 1, so far,
It is achieved that the pipeization packaging to diagnostic nucleic acid reagent.
Storage and transport will be carried out, during use, by dropping sample under above-mentioned packaged diagnostic nucleic acid reagent room temperature
Nucleic acid on vitreous thing, gets rid of after dissolving vitreous thing at the bottom of pipe, then is entered by reaction reagent A and reaction reagent B by the way of heating
Row mixing, is placed in the mixed liquor obtained in real-time transmissometer, and 65 DEG C of reaction 60min, by the extinction at record 650nm wavelength
Value, every 6s monitors the turbidity of reaction tube in real time, and is depicted as curve, as in figure 2 it is shown, by this figure it can be seen that a pipeization is packed
Reaction reagent and non-one pipeization packaging reaction reagent basically identical on response time and amplification efficiency, it is the poorest to there is no
Not, it was demonstrated that after this utility model method preserves, do not affect effectiveness and the stability of diagnostic reagent.
Embodiment 3, a pipeization packaging of bacillus dysenteriae diagnostic reagent
Diagnostic nucleic acid reagent:
Reaction reagent A: need the reagent that low temperature (-20 DEG C to 4 DEG C) transports, Bst archaeal dna polymerase, four kinds of dNTP and primer
(F3:AAGTCTACCTGGCCTTCCA；B3:CCGTACGCTTCAGTACAGC；FIP:CCGACACGCCATAGAAACGCAT-
CCATGCTCGCAGAGAAACT；BIP:CAAATGACCTCCGCACTGCCG-CCAGAGGGAGAACCAGTCC；LF:
CGGCAGTGGAGAGCTGA；LB:AAGCTATGGTCAGAAGCCGT)；
Reaction reagent B: can room temperature transport liquid reactions reagent, Tris-HCl, KCl, (NH4)2SO4、MgSO4、
Tween20 and Betaine (glycine betaine).
Reaction reagent A is carried out vitrification, and detailed process is with identical in embodiment 2.
Vitreous thing obtained above is positioned in embodiment 1 one pipeization packaging diagnostic reagent bottle and seals the groove in lid 2
In 21, reaction reagent B is contained in the second reaction tube 3 in embodiment 1 one pipeization packaging diagnostic reagent bottle, reacts first
Pipe 1 coordinates with the second reaction tube 3, and isolates with paraffin, then with sealing lid 2 sealing the first reaction tube 1, so far,
It is achieved that the pipeization packaging to diagnostic nucleic acid reagent.
Storage and transport will be carried out, during use, by dropping sample under above-mentioned packaged diagnostic nucleic acid reagent room temperature
Nucleic acid on vitreous thing, gets rid of after dissolving vitreous thing at the bottom of pipe, then is entered by reaction reagent A and reaction reagent B by the way of heating
Row mixing, is placed in the mixed liquor obtained in real-time transmissometer, and 65 DEG C of reaction 60min, by the extinction at record 650nm wavelength
Value, every 6s monitors the turbidity of reaction tube in real time, and is depicted as curve, as it is shown on figure 3, the detection kit of a pipeization packaging is quick
It is perceptually 100 times of regular-PCR, demonstrates again that a pipeization packaging does not affect effectiveness and the stability of diagnostic reagent.
Embodiment 4, a pipeization packaging of Salmonella diagnostic reagent
Diagnostic nucleic acid reagent:
Reaction reagent A: need the reagent that low temperature (-20 DEG C to 4 DEG C) transports, Bst archaeal dna polymerase, four kinds of dNTP and primer
(F3:GGCGATATTGGTGTTTATGGGG；B3:AACGATAAACTGGACCACGG；FIP:GACGACTGGTACTGATCGAT-
AGTTTTTCAACGTTTCCTGCGG；BIP:CCGGTGAAATTATCGCCAC-ACAAAACCCACCGCCAGG；LF:
GACGAAAGAGCGTGGTAATTAAC；LB:GGGCAATTCGTTATTGGCGATAG)；
Reaction reagent B: can room temperature transport liquid reactions reagent, Tris-HCl, KCl, (NH4)2SO4、MgSO4、
Tween20 and Betaine (glycine betaine).
Reaction reagent A is carried out vitrification, and detailed process is with embodiment 2.
Vitreous thing obtained above is positioned in embodiment 1 one pipeization packaging diagnostic reagent bottle and seals the groove in lid 2
In 21, reaction reagent B is contained in the second reaction tube 3 in embodiment 1 one pipeization packaging diagnostic reagent bottle, reacts first
Pipe 1 coordinates with the second reaction tube 3, and isolates with paraffin, then with sealing lid 2 sealing the first reaction tube 1, so far,
It is achieved that the pipeization packaging to diagnostic nucleic acid reagent.
Storage and transport will be carried out, during use, by dropping sample under above-mentioned packaged diagnostic nucleic acid reagent room temperature
Nucleic acid on vitreous thing, gets rid of after dissolving vitreous thing at the bottom of pipe, then is entered by reaction reagent A and reaction reagent B by the way of heating
Row mixing, is placed in the mixed liquor obtained in real-time transmissometer, and 65 DEG C of reaction 60min, by the extinction at record 650nm wavelength
Value, every 6s monitors the turbidity of reaction tube in real time, and is depicted as curve, as shown in Figure 4, by this figure it can be seen that through a pipe
The Salmonella diagnostic reagent of packaging also show good result, only Salmonella on specificity and there occurs positive anti-
Should, all there is not positive reaction in other bacterium, it was demonstrated that after this utility model method preserves, does not affect the effective of diagnostic reagent
Property and stability.
Claims (5)
1. a pipeization packaging diagnostic reagent bottle, it is characterised in that: it includes the first reaction tube of an open at both ends, described first
One end of reaction tube is fastenedly connected a sealing lid；The other end at described first reaction tube is removably disposed one second reaction
Pipe, described second reaction tube open at one end one end closes and opening end is connected with the other end of described first reaction tube；Described
One barrier film is set in the first reaction tube.
A pipeization packaging diagnostic reagent bottle the most according to claim 1, it is characterised in that: in described sealing lid, arrange one
Groove.
A pipeization packaging diagnostic reagent bottle the most according to claim 1 and 2, it is characterised in that: at described first reaction tube
A damping ring it is nested with respectively with on the outer tube wall of described second reaction tube.
4. according to right ask described in 1 or 2 one pipeization packaging diagnostic reagent bottle, it is characterised in that: described barrier film use thin film or
Paraffin.
A pipeization packaging diagnostic reagent bottle the most according to claim 1 and 2, it is characterised in that: described first reaction tube, institute
State the second reaction tube and described sealing lid all uses plastic material to make.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201620507069.8U CN205741038U (en) | 2016-05-30 | 2016-05-30 | One pipeization packaging diagnostic reagent bottle |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201620507069.8U CN205741038U (en) | 2016-05-30 | 2016-05-30 | One pipeization packaging diagnostic reagent bottle |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN205741038U true CN205741038U (en) | 2016-11-30 |
Family
ID=57363422
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201620507069.8U Active CN205741038U (en) | 2016-05-30 | 2016-05-30 | One pipeization packaging diagnostic reagent bottle |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN205741038U (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105886387A (en) * | 2016-05-30 | 2016-08-24 | 北京安洁优科技有限公司 | Integral-tubing packaging method for diagnostic reagent and diagnostic reagent bottle subjected to integral-tubing packaging |
| US20200181682A1 (en) * | 2017-04-19 | 2020-06-11 | Yamato-Esulon Co., Ltd. | Pcr vessel, pcr vessel containing reagent, and reagent cassette |
| CN113736868A (en) * | 2021-09-16 | 2021-12-03 | 广州生凌医疗科技有限公司 | RNA nucleic acid detection reagent storage method, kit and use method |
-
2016
- 2016-05-30 CN CN201620507069.8U patent/CN205741038U/en active Active
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105886387A (en) * | 2016-05-30 | 2016-08-24 | 北京安洁优科技有限公司 | Integral-tubing packaging method for diagnostic reagent and diagnostic reagent bottle subjected to integral-tubing packaging |
| CN105886387B (en) * | 2016-05-30 | 2018-08-07 | 北京安洁优科技有限公司 | One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle |
| US20200181682A1 (en) * | 2017-04-19 | 2020-06-11 | Yamato-Esulon Co., Ltd. | Pcr vessel, pcr vessel containing reagent, and reagent cassette |
| US11746375B2 (en) * | 2017-04-19 | 2023-09-05 | Yamato-Esulon Co., Ltd. | PCR vessel, PCR vessel containing reagent, and reagent cassette |
| CN113736868A (en) * | 2021-09-16 | 2021-12-03 | 广州生凌医疗科技有限公司 | RNA nucleic acid detection reagent storage method, kit and use method |
| CN113736868B (en) * | 2021-09-16 | 2023-01-24 | 广州生凌医疗科技有限公司 | RNA nucleic acid detection reagent storage method, kit and use method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105886387B (en) | One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle | |
| CN205741038U (en) | One pipeization packaging diagnostic reagent bottle | |
| US10913060B2 (en) | Loading vials | |
| US20060216196A1 (en) | Narrow swab (access swab) for ATP Measurement | |
| US7485262B2 (en) | Apparatus for chemiluminescent assays | |
| US5827675A (en) | Test apparatus, system and method for the detection of test samples | |
| US5965453A (en) | Test apparatus, system and method for the detection of test samples | |
| US3446596A (en) | Analytical package and method | |
| US7993871B2 (en) | Sampling method and device | |
| EP3411499B1 (en) | Dried amplification compositions | |
| US5916802A (en) | Device for measuring ATP | |
| US20020001822A1 (en) | Apparatus and methods for chemiluminescent assays | |
| EP1220890A1 (en) | Devices and methods for microorganism detection | |
| US20060024818A1 (en) | Safety pouch for cryo-preservation of staminal cells or similar blood components | |
| US20010046687A1 (en) | Method for the enhancement of luminescence intensity from a reaction between adenosine triphosphate (ATP) and a luciferase/luciferin reactant system | |
| JP2021006065A (en) | Method for separating nucleic acid from specimen containing nucleic acid, and apparatus for the same | |
| JP2018533359A (en) | Nucleic acid amplification | |
| US20020018986A1 (en) | Method for the detection of the presence of chemical species known to inhibit a chemiluminescent reaction | |
| WO2013023198A2 (en) | Rapid and sensitive detection of bacteria in blood products, urine, and other fluids | |
| JP2006223168A (en) | Examination tool | |
| US5728542A (en) | Disposable test kit apparatus and method for bacteria | |
| JP2012132878A (en) | Vessel, system and method for detecting microorganism contaminant | |
| CN205397018U (en) | Binary packing diagnostic reagent bottle | |
| JP2006526404A (en) | One-touch type sample transport medium container | |
| US20220128555A1 (en) | Apparatuses for performing rapid diagnostic tests |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220712 Address after: 102445 1st floor, unit 101, building 4, zone 2, yard 6, Shagang street, Fangshan District, Beijing Patentee after: Beijing Baifang Yisheng Biotechnology Co.,Ltd. Address before: Room 501-589, Development Zone office building, No. 8, Xingsheng South Road, Miyun Economic Development Zone, Beijing 101500 Patentee before: BEIJING ANJIEYOU TECHNOLOGY Co.,Ltd. |