CN105886387B - One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle - Google Patents
One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle Download PDFInfo
- Publication number
- CN105886387B CN105886387B CN201610369624.XA CN201610369624A CN105886387B CN 105886387 B CN105886387 B CN 105886387B CN 201610369624 A CN201610369624 A CN 201610369624A CN 105886387 B CN105886387 B CN 105886387B
- Authority
- CN
- China
- Prior art keywords
- reaction
- reagent
- reaction tube
- diagnostic
- diagnostic reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M1/00—Apparatus for enzymology or microbiology
- C12M1/24—Apparatus for enzymology or microbiology tube or bottle type
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M1/00—Apparatus for enzymology or microbiology
- C12M1/34—Measuring or testing with condition measuring or sensing means, e.g. colony counters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Sustainable Development (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The invention discloses an a kind of pipe packing methods of diagnostic reagent and a pipeization to pack diagnostic reagent bottle.Packing method of the present invention includes the following steps：The diagnostic reagent includes at least two reaction reagents, is not chemically reacted in each described reaction reagent, and carrying out reaction after the reaction reagent mixing realizes diagnostic purpose；Each described reaction reagent is individually packed, and realizes the mixing between the reaction reagent by way of puncturing, centrifuge or heating external force.The present invention is preserved by keeping apart two parts of diagnostic reagent or more portion of reagent, it is bonded them together when reaction the modes such as puncturing, centrifuge or heat by external force, it fails so as to avoid diagnostic reagent caused by the mixing of two parts before reaction or more portion of reagent or destroys the stabilization of a certain ingredient, while enormously simplifying operating procedure.
Description
Technical field
The present invention relates to an a kind of pipe packing methods of diagnostic reagent and a pipeization to pack diagnostic reagent bottle.
Background technology
Existing diagnostic reagent reaction system is more complicated, and such as diagnostic nucleic acid reagent, being needed before use first will be therein slow
It rushes the substances such as system, enzyme, primer and fluorescence probe and separately holds preservation, enzyme, primer and fluorescence probe especially therein need
It is positioned in -20 DEG C of low temperature environment and preserves.It is very not square system could to be prepared by each material mixing, therefore when use when in use
Just, there is an urgent need to provide a kind of packing method of the diagnostic reagent of simplicity.
Invention content
The object of the present invention is to provide an a kind of pipe packing methods of diagnostic reagent and a pipeization to pack diagnostic reagent bottle,
The present invention is preserved by keeping apart two parts of diagnostic reagent or more portion of reagent, when reaction punctured by external force again,
The modes such as centrifugation or heating are partially bonded together more by two parts or, so as to avoid two parts before reaction or more portion of reagent
Mixing caused by diagnostic reagent failure or destroy the stabilization of a certain ingredient, while enormously simplifying operating procedure.
Present invention firstly provides an a kind of pipe packing methods of diagnostic reagent, include the following steps：
The diagnostic reagent includes at least two reaction reagents, is not chemically reacted in each described reaction reagent,
Reaction, which is carried out, after the reaction reagent mixing realizes diagnostic purpose；
Each described reaction reagent is individually packed, and realizes institute by way of puncturing, centrifuge or heating external force
State the mixing between reaction reagent.
In an above-mentioned pipe packing method, two or more described reaction reagents can be liquid reactions reagent simultaneously, same
When for solid reaction reagent or a kind of liquid reactions reagent and a kind of solid reaction reagent.
In an above-mentioned pipe packing method, by the way of individually packing as follows：
The reaction reagent is contained in same container, the reaction reagent is isolated with isolation film.
In an above-mentioned pipe packing method, the isolation film can be that film or paraffin are pierced when using film by external force
Broken mode realizes the mixing between the reaction reagent, and when using paraffin, melting point of paraffin wax is 50 DEG C or so, therefore can be passed through
The mode of heating realizes the mixing between the reaction reagent.
In an above-mentioned pipe packing method, when at least one reaction reagent is the reagent for needing Cord blood, use
Following 1) -3) any mode handles the reaction reagent in：
1) vitrifying is carried out to the reaction reagent；
2) reaction reagent is freeze-dried；
3) gel preservation is carried out to the reaction reagent；
Low temperature in the Cord blood refers to the temperature less than 4 DEG C；
By making the reaction reagent for needing Cord blood that can be preserved with room temperature after above-mentioned processing.
The vitrifying refers to being in " glass transition temperature (the glass less than or equal to the substance when Cucumber
transition temperature；Glass (glasses) will be formed when Tg) ", at this point, because of molecule almost non-activity and expansion
It dissipates, therefore permanent stabilization can be kept at normal temperatures.Since substance does not crystallize in During Vitrification in vitro, but formed a kind of very viscous stagnant
" super freezing (super cooled) " liquid.At this point, the molecular disorder that remain as fluid characteristics of carrying on as before, therefore glass
Referred to as " amorphous solid (amorphous solid) ", and real solid is different from this.For needing Cord blood at present
With the reagent of low-temperature transport, cost is not only considerably increased, but also also add risk, if any link of cold chain is asked
Topic, the reliability of reagent just cannot be guaranteed, therefore the reaction reagent is carried out vitrifying, obtained glass by method for vitrification
Compound can be realized as room temperature preservation and room temperature transport, and the vitreous liquid does not have any influence to the reaction reagent.
In an above-mentioned pipe packing method, conventional vitreous liquid can be selected and carry out the vitrifying, it such as can at glass carrier
Using saccharide, such as Ficoll 400 and/or melezitose, heat shock protein and/or dehydrated protein class etc. can be used in protective agent.
In an above-mentioned pipe packing method, the freeze-drying, also known as lyophilization are that water-containing materials are chilled to ice
Then ice is changed into steam and the drying means that removes hereinafter, water is made to be changed into ice by point under high vacuum.Material can first exist
Freezing in refrigerating plant, then be dried；But it also can be directly in hothouse through being evacuated and freezing rapidly.What distillation generated
Vapor is removed by means of condenser, and heat of vaporization needed for sublimation process is generally supplied with heat radiation.
In an above-mentioned pipe packing method, the gelation preserves the phenomenon that referring to using solution gels, to institute
The gel that reaction reagent is formed through gelation is stated to be preserved.Gelation refers to cold-water-soluble and insoluble in the hot water
Substance, when temperature improves, gel can occur for the aqueous solution of the substance, such as cellulose ether compound such as methylcellulose and its spread out
Biology, i.e. methocel solution are increased with temperature, and viscosity first continuously decreases, when reaching a certain temperature, solution viscosity drastically on
It rises and is gelled.
In an above-mentioned pipe packing method, the diagnostic reagent is diagnostic nucleic acid reagent, as based on PCR is (including common
PCR and quantitative fluorescent PCR) diagnostic nucleic acid reagent, based on constant-temperature amplification (the constant-temperature amplifications side such as including LAMP, RPA, PSR, CPA
Method) diagnostic nucleic acid reagent etc..Such as archaeal dna polymerase, primer and dNTP are contained in a container, PCR reaction systems are contained
It is put in another independent container, such as Tris-HCl, KCl, (NH4)2SO4、MgSO4, Tween20 and Betaine (glycine betaine).
Invention further provides the packaging diagnosis examinations of a pipeization of the pipe packing method for realizing above-mentioned diagnostic reagent
Agent bottle, it includes the first reaction tube of an open at both ends, and a sealing cover is fastenedly connected in one end of first reaction tube；Institute
The other end for stating the first reaction tube is removably disposed one second reaction tube, the second reaction tube open at one end one end closing and
Open end is connect with the other end of first reaction tube；A diaphragm is set in first reaction tube.
In above-mentioned pipeization packaging diagnostic reagent bottle, a groove is set in the sealing cover, for holding the glass
Compound.
In above-mentioned pipeization packaging diagnostic reagent bottle, in the outer tube wall of first reaction tube and second reaction tube
It is upper to be nested with a damping ring respectively, it can be to avoid the membrane ruptures when being collided with by external force；
The diaphragm uses film or paraffin.
In above-mentioned pipeization packaging diagnostic reagent bottle, first reaction tube, second reaction tube and the sealing
Lid is all made of plastic material and is made.
Application of the above-mentioned pipeization packaging diagnostic reagent bottle in packing diagnostic reagent also belongs to protection scope of the present invention.
The present invention is preserved by keeping apart two parts of diagnostic reagent or more portion of reagent, by outer when reaction
Power the modes such as punctures, centrifuges or heats and bonds them together, so as to avoid two parts before reaction or more portion of reagent
Diagnostic reagent fails or destroys the stabilization of a certain ingredient caused by mixing, while enormously simplifying operating procedure.This hair
It is bright to additionally provide the pipeization packaging diagnostic reagent bottle for realizing above-mentioned packing method, using film or paraffin by two kinds of reaction reagents
Keep apart, and the reaction reagent after vitrifying can be positioned in the groove in sealing cover, is convenient for the Sheng of solid reaction reagent
It puts；And it is nested with a damping ring respectively on the outer tube wall of the first reaction tube and the second reaction tube, therefore can be to avoid by outer
Membrane ruptures when power is collided with.
Description of the drawings
Fig. 1 is the result schematic diagram that a pipeization of the invention packs diagnostic reagent bottle.
It is respectively marked in figure as follows：
1 first reaction tube, 2 sealing covers, 3 second reaction tubes, 4 diaphragms.
Fig. 2 is the reaction result of pipeization packaging and non-pipeization packaging in the embodiment of the present invention 2.
Fig. 3 is Shigella sensitivity results in the embodiment of the present invention 3, wherein Fig. 3 (A) detects for a pipe pack
The sensitivity of Shigella, that curve 1 indicates is a concentration of 4.5ng/ul of sample nucleic acid, and what curve 2 indicated is that sample nucleic acid is dense
Degree is 2.450pg/ul, and that curve 3 indicates is a concentration of 3.45pg/ul of sample nucleic acid, and what curve 4 indicated is sample nucleic acid concentration
For 4.4.5pg/ul, that curve 5 indicates is a concentration of 5.450fg/ul of sample nucleic acid, and what curve 6 indicated is sample nucleic acid concentration
For 6.45fg/ul；Fig. 3 (B) is regular-PCR method electrophoresis result, wherein what band M was indicated is DNA marker 2000, band 1
That indicate is a concentration of 4.5ng/ul of sample nucleic acid, and what band 2 indicated is a concentration of 2.450pg/ul of sample nucleic acid, 3 table of band
That show is a concentration of 3.45pg/ul of sample nucleic acid, and that band 4 indicates is a concentration of 4.5pg/ul of sample nucleic acid, and band 5 is feminine gender
Control.
Fig. 4 is Salmeterol fluticasone propionate kit specificity experiments result in the embodiment of the present invention 4, wherein what curve 1 indicated
It is salmonella, what curve 2 indicated is vibrio parahemolyticus, and what curve 3 indicated is staphylococcus aureus, what curve 4 indicated
It is escherichia coli O157, what curve 5 indicated is shigella dysenteriae, and what curve 6 indicated is Listeria monocytogenes, 7 table of curve
What is shown is Shigella sonnei, and what curve 8 indicated is escherichia coli, and what curve 9 indicated is shigella flexneri, 10 table of curve
What is shown is pseudomonas aeruginosa, and what curve 11 indicated is clostridium botulinum, and what curve 12 indicated is stenotrophomonas maltophilia, curve
13 expressions are distilled water negative controls.
Specific implementation mode
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1, a pipeization pack diagnostic reagent bottle
As shown in Figure 1, pipeization packaging diagnostic reagent bottle of the invention includes the first reaction tube 1 of an open at both ends, the
One end of one reaction tube 1 is fastenedly connected a sealing cover 2, and a groove 21 for holding solid reactants is arranged in sealing cover 2.
The other end of one reaction tube 1 is removably disposed one second reaction tube 3, the closing of 3 open at one end one end of the second reaction tube, and opening
End is connect with the other end of the first reaction tube 1.Be fastenedly connected in the first reaction tube 1 one with surrounding inner tubal wall it is vertically arranged every
Film 4.Diaphragm 4 is used to stop that the reactant of reactant and the second reaction tube 3 in the first reaction tube 1 to connect in a non-operative state
It touches.
In above-described embodiment, film or paraffin can be used in diaphragm 4.
In above-described embodiment, transparent plastic material system can be used in the first reaction tube 1, the second reaction tube 3 and sealing cover 2
At.
In above-described embodiment, a damping ring 5 can be nested with respectively on the outer tube wall of the first reaction tube 1 and the second reaction tube 3,
For avoiding the present apparatus from causing the rupture of diaphragm 4 that reactant is made to react in a non-operative state when being collided with by external force.
Embodiment 2, a pipeization of diagnostic nucleic acid reagent packaging
Diagnostic nucleic acid reagent：
Reaction reagent A：Need the reagent of (- 20 DEG C to 4 DEG C) transports of low temperature, Bst archaeal dna polymerases, four kinds of dNTP and primer
(F3：CGCTGACAATCGCTTCTCAT；B3：GTTCTTCGCTTTGGCAATGT；FIP：CTGTCACCGAGTGCAACCACTT-
AACCACACGATCTGGAGCA；BIP：GCATCACAATGGCGCTTCCC-ACCGTTGGAGAAGTGACCTA；LF：
CTGCATTGCTGCGTCGT；LB：TAACCCGAACAGCTGGTTCT)；
Reaction reagent B：Can room temperature transport liquid reactions reagent, Tris-HCl, KCl, (NH4)2SO4、MgSO4、
Tween20 and Betaine (glycine betaine).
Reaction reagent A is subjected to vitrifying：Vitreous liquid is made of two parts：A part is into glass carrier, belongs to saccharide；
Another part is protective agent, belongs to heat shock protein and dehydrated protein class, by reaction reagent A and vitreous liquid according to 10：1 volume
Ratio mixes, and is placed on 10 hours in 50 DEG C of ventilated environment, that is, completes vitreous process.
Vitreous object obtained above is positioned over the groove in 1 one pipeization of embodiment packaging diagnostic reagent bottle in sealing cover 2
In 21, reaction reagent B is contained in the second reaction tube 3 in 1 one pipeization of embodiment packaging diagnostic reagent bottle, by the first reaction
Pipe 1 is coordinated with the second reaction tube 3, and paraffin is used in combination to be isolated, and then sealing cover 2 is used to seal the first reaction tube 1, so far,
It is achieved that the pipeization packaging to diagnostic nucleic acid reagent.
Storage and transport will be carried out under above-mentioned packaged diagnostic nucleic acid reagent room temperature, in use, by the way that sample is added dropwise
On nucleic acid to vitreous object, dissolve vitreous object after get rid of to tube bottom, then by way of heating by reaction reagent A and reaction reagent B into
Row mixing, obtained mixed liquor is placed in real-time transmissometer, 65 DEG C of reaction 60min, by recording the extinction at 650nm wavelength
Value monitors the turbidity of reaction tube per 6s, and is depicted as curve in real time, as shown in Fig. 2, it can be seen from this figure that a pipeization is packed
Reaction reagent and non-pipeization packaging reaction reagent it is almost the same on reaction time and amplification efficiency, it is apparent poor to have no
Not, it was demonstrated that after the method for the present invention preserves, do not influence the validity and stability of diagnostic reagent.
Embodiment 3, a pipeization of bacillus dysenteriae diagnostic reagent packaging
Diagnostic nucleic acid reagent：
Reaction reagent A：Need the reagent of (- 20 DEG C to 4 DEG C) transports of low temperature, Bst archaeal dna polymerases, four kinds of dNTP and primer
(F3：AAGTCTACCTGGCCTTCCA；B3：CCGTACGCTTCAGTACAGC；FIP：CCGACACGCCATAGAAACGCAT-
CCATGCTCGCAGAGAAACT；BIP：CAAATGACCTCCGCACTGCCG-CCAGAGGGAGAACCAGTCC；LF：
CGGCAGTGGAGAGCTGA；LB：AAGCTATGGTCAGAAGCCGT)；
Reaction reagent B：Can room temperature transport liquid reactions reagent, Tris-HCl, KCl, (NH4)2SO4、MgSO4、
Tween20 and Betaine (glycine betaine).
Reaction reagent A is subjected to vitrifying, detailed process is identical in embodiment 2.
Vitreous object obtained above is positioned over the groove in 1 one pipeization of embodiment packaging diagnostic reagent bottle in sealing cover 2
In 21, reaction reagent B is contained in the second reaction tube 3 in 1 one pipeization of embodiment packaging diagnostic reagent bottle, by the first reaction
Pipe 1 is coordinated with the second reaction tube 3, and paraffin is used in combination to be isolated, and then sealing cover 2 is used to seal the first reaction tube 1, so far,
It is achieved that the pipeization packaging to diagnostic nucleic acid reagent.
Storage and transport will be carried out under above-mentioned packaged diagnostic nucleic acid reagent room temperature, in use, by the way that sample is added dropwise
On nucleic acid to vitreous object, dissolve vitreous object after get rid of to tube bottom, then by way of heating by reaction reagent A and reaction reagent B into
Row mixing, obtained mixed liquor is placed in real-time transmissometer, 65 DEG C of reaction 60min, by recording the extinction at 650nm wavelength
Value monitors the turbidity of reaction tube per 6s, and is depicted as curve in real time, as shown in figure 3, the detection kit of pipeization packaging is quick
It is perceptually 100 times of regular-PCR, demonstrates again that pipeization packaging does not influence the validity and stability of diagnostic reagent.
Embodiment 4, a pipeization of salmonella diagnostic reagent packaging
Diagnostic nucleic acid reagent：
Reaction reagent A：Need the reagent of (- 20 DEG C to 4 DEG C) transports of low temperature, Bst archaeal dna polymerases, four kinds of dNTP and primer
(F3：GGCGATATTGGTGTTTATGGGG；B3：AACGATAAACTGGACCACGG；FIP：GACGACTGGTACTGATCGAT-
AGTTTTTCAACGTTTCCTGCGG；BIP：CCGGTGAAATTATCGCCAC-ACAAAACCCACCGCCAGG；LF：
GACGAAAGAGCGTGGTAATTAAC；LB：GGGCAATTCGTTATTGGCGATAG)；
Reaction reagent B：Can room temperature transport liquid reactions reagent, Tris-HCl, KCl, (NH4)2SO4、MgSO4、
Tween20 and Betaine (glycine betaine).
Reaction reagent A is subjected to vitrifying, detailed process is the same as embodiment 2.
Vitreous object obtained above is positioned over the groove in 1 one pipeization of embodiment packaging diagnostic reagent bottle in sealing cover 2
In 21, reaction reagent B is contained in the second reaction tube 3 in 1 one pipeization of embodiment packaging diagnostic reagent bottle, by the first reaction
Pipe 1 is coordinated with the second reaction tube 3, and paraffin is used in combination to be isolated, and then sealing cover 2 is used to seal the first reaction tube 1, so far,
It is achieved that the pipeization packaging to diagnostic nucleic acid reagent.
Storage and transport will be carried out under above-mentioned packaged diagnostic nucleic acid reagent room temperature, in use, by the way that sample is added dropwise
On nucleic acid to vitreous object, dissolve vitreous object after get rid of to tube bottom, then by way of heating by reaction reagent A and reaction reagent B into
Row mixing, obtained mixed liquor is placed in real-time transmissometer, 65 DEG C of reaction 60min, by recording the extinction at 650nm wavelength
Value monitors the turbidity of reaction tube per 6s, and is depicted as curve in real time, as shown in figure 4, it can be seen from this figure that by a pipe
The salmonella diagnostic reagent of packaging is also shown in specificity good as a result, only the positive has occurred instead in salmonella
Answer, positive reaction does not occur for other bacterium, it was demonstrated that after the method for the present invention preserves, do not influence diagnostic reagent validity and
Stability.
Claims (3)
1. a pipe packing method of diagnostic reagent, includes the following steps：
One pipeization packaging diagnostic reagent bottle includes the first reaction tube of an open at both ends, is fastened in one end of first reaction tube
Connect a sealing cover；It is removably disposed one second reaction tube, second reaction tube in the other end of first reaction tube
Open at one end one end is closed and open end is connect with the other end of first reaction tube；It is arranged one in first reaction tube
Diaphragm；
One groove is set in the sealing cover；
It is nested with a damping ring respectively on the outer tube wall of first reaction tube and second reaction tube；
The diaphragm uses paraffin；
The diagnostic reagent includes two kinds of reaction reagents, is not chemically reacted in each described reaction reagent, the reaction
Reaction, which is carried out, after reagent mixing realizes diagnostic purpose；
By two kinds of reaction reagents be individually packaged in the pipeization pack diagnostic reagent bottle the first reaction tube and
Second reaction tube, and realize mixing between the reaction reagent by way of external force heating；
When at least one reaction reagent is the reagent for needing Cord blood, using following 1) -3) in any mode to described
Reaction reagent is handled：
1) vitrifying is carried out to the reaction reagent；
2) reaction reagent is freeze-dried；
3) gel preservation is carried out to the reaction reagent；
The low temperature refers to the temperature less than 4 DEG C.
2. pipe packing method according to claim 1, it is characterised in that：The diagnostic reagent tries for diagnostic nucleic acid
Agent.
3. a pipeization packs application of the diagnostic reagent bottle in packing diagnostic reagent；
The one pipeization packaging diagnostic reagent bottle includes the first reaction tube of an open at both ends, in one end of first reaction tube
It is fastenedly connected a sealing cover；It is removably disposed one second reaction tube in the other end of first reaction tube, described second is anti-
Should pipe open at one end one end closing and open end connect with the other end of first reaction tube；It is set in first reaction tube
Set a diaphragm；
One groove is set in the sealing cover；
It is nested with a damping ring respectively on the outer tube wall of first reaction tube and second reaction tube；
The diaphragm uses paraffin.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610369624.XA CN105886387B (en) | 2016-05-30 | 2016-05-30 | One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle |
| PCT/CN2016/085076 WO2017206194A1 (en) | 2016-05-30 | 2016-06-07 | One-tube packaging method for diagnostic reagent and bottle for one-tube packaged diagnostic reagent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610369624.XA CN105886387B (en) | 2016-05-30 | 2016-05-30 | One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105886387A CN105886387A (en) | 2016-08-24 |
| CN105886387B true CN105886387B (en) | 2018-08-07 |
Family
ID=56709156
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610369624.XA Active CN105886387B (en) | 2016-05-30 | 2016-05-30 | One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN105886387B (en) |
| WO (1) | WO2017206194A1 (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108531377A (en) * | 2018-06-26 | 2018-09-14 | 广东省第二人民医院（广东省卫生应急医院） | It is a kind of can pre-filled reagent diaphragm type nucleic acid amplification airtight reactor tube |
| CN109355405B (en) * | 2018-08-30 | 2022-10-25 | 华南理工大学 | Primer, kit and method for detecting vibrio parahaemolyticus by PSR isothermal amplification reaction |
| CN109355407B (en) * | 2018-09-26 | 2021-09-21 | 华南理工大学 | Primer, kit and method for detecting pseudomonas aeruginosa through PSR isothermal amplification reaction |
| CN112516092A (en) * | 2020-12-14 | 2021-03-19 | 上海简逸生物科技有限公司 | Freeze-dried preparation manufacturing process with co-existing redissolution and freeze-dried spheres and freeze-dried preparation |
| CN114657236A (en) * | 2020-12-23 | 2022-06-24 | 广州达安基因股份有限公司 | Method for separating nucleic acid amplification system and separating agent |
| CN112535478B (en) * | 2020-12-29 | 2022-11-25 | 江西金域医学检验实验室有限公司 | Multifunctional vacuum blood collection tube |
| CN113736868B (en) * | 2021-09-16 | 2023-01-24 | 广州生凌医疗科技有限公司 | RNA nucleic acid detection reagent storage method, kit and use method |
| CN117025379B (en) * | 2023-10-09 | 2023-12-15 | 迪飞医学科技(南京)有限公司 | RAPID isothermal amplification nucleic acid detection device and detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6197574B1 (en) * | 1996-11-07 | 2001-03-06 | Srl, Inc. | Bacterium detector |
| WO2004092358A1 (en) * | 2003-04-15 | 2004-10-28 | Kabushiki Kaisha Kitazato Supply | Implement and method for freezing and storing egg |
| JP2014143950A (en) * | 2013-01-29 | 2014-08-14 | Akita Prefecture | Vitrification-preserving and embryo-containing straw for transplantation, and production method thereof |
| CN205741038U (en) * | 2016-05-30 | 2016-11-30 | 北京安洁优科技有限公司 | One pipeization packaging diagnostic reagent bottle |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE2844841A1 (en) * | 1978-10-14 | 1980-04-24 | Paul Dr Med Boettger | Sampling tube for medical application - has stiff top and bottom sections with deformable central wall portion |
| EP0558473A1 (en) * | 1989-11-08 | 1993-09-08 | Fmc Corporation | Combined centrifuge tube and porous selection means for separation and recovery of biological materials |
| WO2004080597A2 (en) * | 2003-02-05 | 2004-09-23 | Iquum, Inc. | Sample processing tubule |
| ATE553846T1 (en) * | 2003-11-19 | 2012-05-15 | Michael O'donovan | REAGENT CUVETTE |
| CN101314757B (en) * | 2008-07-15 | 2012-04-18 | 四川大学华西第二医院 | Aculeus type tissue slice glassivation refrigeration carrier and refrigeration method for ovary tissue |
| CN203794879U (en) * | 2012-08-16 | 2014-08-27 | 刘占良 | Portable microbial culture apparatus for culture before use |
| US9039993B2 (en) * | 2013-03-14 | 2015-05-26 | Formulatrix, Inc. | Microfluidic device |
| CN203904340U (en) * | 2014-05-28 | 2014-10-29 | 中国农业科学院兰州畜牧与兽药研究所 | Protective pipe for safe transportation of bacterial strain freeze-drying pipe |
-
2016
- 2016-05-30 CN CN201610369624.XA patent/CN105886387B/en active Active
- 2016-06-07 WO PCT/CN2016/085076 patent/WO2017206194A1/en active Application Filing
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6197574B1 (en) * | 1996-11-07 | 2001-03-06 | Srl, Inc. | Bacterium detector |
| WO2004092358A1 (en) * | 2003-04-15 | 2004-10-28 | Kabushiki Kaisha Kitazato Supply | Implement and method for freezing and storing egg |
| JP2014143950A (en) * | 2013-01-29 | 2014-08-14 | Akita Prefecture | Vitrification-preserving and embryo-containing straw for transplantation, and production method thereof |
| CN205741038U (en) * | 2016-05-30 | 2016-11-30 | 北京安洁优科技有限公司 | One pipeization packaging diagnostic reagent bottle |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105886387A (en) | 2016-08-24 |
| WO2017206194A1 (en) | 2017-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105886387B (en) | One pipe packing method of diagnostic reagent and a pipeization pack diagnostic reagent bottle | |
| JP5785266B2 (en) | Biological sterilization indicator and method of use thereof | |
| US8148115B2 (en) | Device and method for extraction and analysis of nucleic acids from biological samples | |
| US5320804A (en) | Process and apparatus for controlled microwave heating under pressure | |
| BR112012001409A2 (en) | biological sterilization indicator and method for testing the lethality of a sterilization process | |
| US20170176372A1 (en) | Inline sensor arrangement and method for commissioning same | |
| CN113278492B (en) | Integrated totally-enclosed detection reaction tube | |
| BR9801509A (en) | Reaction vessel, test strip, processes for conducting a nucleic acid amplification reaction and for transferring a liquid into a reaction vessel and nucleic acid amplicating station for a test strip. | |
| US5108701A (en) | Process for rapid sterilization of biological media | |
| KR20180103945A (en) | The dried amplification composition | |
| JP2010500009A5 (en) | Completely sealed target nucleic acid amplification product high-speed inspection device | |
| WO2006013360A1 (en) | Freeze-drying apparatus | |
| US20180214879A1 (en) | Nucleic acid amplification | |
| JP2017538447A (en) | Defrosting method and apparatus | |
| Adams | Freeze-drying of biological materials | |
| CN101665816A (en) | Mixed paraffin, preservation method of PCR reagent and reagent box | |
| US20120115212A1 (en) | Assay Tube | |
| CN205741038U (en) | One pipeization packaging diagnostic reagent bottle | |
| Stephen | Freeze-drying and cryopreservation of bacteria | |
| EP2729068B1 (en) | Coagulation controlling agents and devices comprising the same | |
| US6060266A (en) | Self-contained incubator for growth of microorganism | |
| CN106386786A (en) | Freezing preservation container for low-temperature-sensitive biological sample | |
| CN102533555B (en) | inoculum and preparation method thereof | |
| Prado et al. | Lyophilization of molecular biology reactions: a review | |
| CN108956965B (en) | Embedded sensor device and method for producing and debugging embedded sensor device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220704 Address after: 102445 1st floor, unit 101, building 4, zone 2, yard 6, Shagang street, Fangshan District, Beijing Patentee after: Beijing Baifang Yisheng Biotechnology Co.,Ltd. Address before: Room 501-589, Development Zone office building, No. 8, Xingsheng South Road, Miyun Economic Development Zone, Beijing 101500 Patentee before: BEIJING ANJIEYOU TECHNOLOGY Co.,Ltd. |