CN1974767A - Pig's epidermal growth factor gene and its application - Google Patents

Abstract

The present invention provides one kind of pig's epidermal growth factor gene with the nucleotide sequence shown in SEQ ID No. 1 of the sequence list. The present invention provides also the gene engineering bacterium C32 containing 14 copies of the gene, and the gene engineering bacterium has high pEGF expressing amount, simple purifying process and low production cost. The present invention makes it possible to produce pig's epidermal growth factor gene in industrial scale.

Description

Pig's epidermal growth factor gene and application thereof

Technical field

The present invention relates to the genetically engineered field, be specifically related to a kind of pig's epidermal growth factor gene, the invention still further relates to by this gene constructed expression vector and transformant thereof.

Background technology

Urogastron be the Cohen sixties (1962) just from the submaxillary gland of male mice separation and Extraction go out a kind ofly can make that the newborn rat eyelid is early opened, the protein of tooth premature eruption.From people's urine, be separated to the human epidermal growth factor in 1975 afterwards.The Urogastron of people and mouse can stimulate the propagation of epidermis and endotheliocyte, can be used for treating burn, corneal wound, gastroenteritic ulcer etc.Pig's epidermal growth factor gene was cloned in 1991, and in yeast, express, find that the pig's epidermal growth factor of expressing can promote DNA synthetic (Pascall JC, the Jones DS of kunming mice 3T3 cell, Doel SM, Clements JM, Hunter M, Fallon T, Edwards M, andBrown KD.Cloning and characterization of a gene encoding pigepidermal growth factor.J Mol Endocrinol, 1991,6:63-70).All detected mRNA (the Kim J G of pig's epidermal growth factor then at pig kidney and uterine endometrium, Vallet JL, Christenson R is of uterine epidermal growthfactor during early pregnancy in pigs.Domest Anim Endocrinol K.2001.Characterization, and 20 (4): 253-265).The same with mouse EGF (mEGF) with human epidermal growth factor (hEGF), pig's epidermal growth factor also is one not to be with glycosyl, to contain 53 amino acid whose single chain polypeptides, and intramolecularly contains three pairs of disulfide linkage, keeps its biological activity.About 6147.9 dalton of molecular weight, iso-electric point is 5.46.PEGF with and the amino acid sequence homology of human epidermal growth factor, M-EGF be respectively 85% and 75.5%, at Gly18, Tyr37, Gly39, Arg41, Leu47 and six cysteine residues is conservative region (Pascall et al., J MolEndocrinol, 1991,6:63-70).Pig's epidermal growth factor mainly is present in various tissues (kidney, pancreas, uterine endometrium) and the pig Ruzhong of pig.

Calendar year 2001, United States Patent (USP) 6300311B1 showed, pEGF has and promotes elementary female ovarian follicle of stationary phase to become the activation ovarian follicle, thereby quickens the discharge of ovum, therefore has the function that improves mammiferous nest litter size.The reorganization pEGF that studies show that escherichia coli expression of McGlone etc. (2003) can improve nest litter size 20.79% (McGlone J J, Anderson DL, Vaughan H is administration of porcine EpidermalGrowth Factor increases litter size.The Annual meeting of the SouthernSection L.2003.Prepubertal, American Society of Animal Science).At gi tract, but the growth in Urogastron stimulating gastrointestinal road and expression (the Jaeger L A that induces the small intestine digestive ferment, et al.Effect of orally administered epidermal growth factor on the jejunalmucosa of weaned pigs.American Journal of Veterinary Research, 1990,51:471-474; Black D D, Ellinas H.Apolipoprotein synthesis in ofdiarrhoea in newborn piglet intestinal explants.Pediatr.Res.1992,32:553-558; James P S, el al.Epidermal growth factor selectively increasesmaltase and sucrase activities in neonatal piglet intestine.Journal ofPhysiology, 1987,393:583-594; Xua R J, Wang F, Zhang S H.Postnatal adaptation of the gastrointestinal tract in neonatal pigs:apossible role of milk-borne growth factors.Livestock ProductionScience, 2000,66:95-107).In addition, add the reorganization pig's epidermal growth factor (1.5ppm) of Pichia anomala expression in early days in the feed of weanling pig, the average daily gain that can make early-weaned piglets 7 days time of feeding rises to 70.35g/d from the 24.39g/d of control group, and has a statistical significant difference (Lee D N, Kuo T Y, Chen M C, et al.Expression of porcine epidermal growth factor in Pichia pastoris and itsbiology activity in early-weaned piglets.Life Sci, 2006,78:649-654).

Because it is active and have good using value and application prospect in livestock industry is produced that pig's epidermal growth factor has various biological, therefore be necessary to develop the engineering bacteria that can efficiently express reorganization pEGF and the method for scale production reorganization pEGF.

For pig's epidermal growth factor at external expression study, Lee etc. (2006) express at Bichi yeast system with the original gene of pig's epidermal growth factor, expression amount 870mg/L (Lee DN, Kuo T Y, Chen M C, et al.Expression of porcine epidermal growthfactor in Pichia pastoris and its biology activity in early-weaned piglets.Life Sci, 2006,78:649-654), but do not set up the method for purifying expression product, expression product is not carried out purifying yet.Calendar year 2001 United States Patent (USP) 6300311B1 has reported the fusion rotein 6His-pEGF that contains 6 Histidines with escherichia coli expression at the C end, and with Ni-gel column purifying expression product from bacterium, but expression product contains 19 amino acid that derive from expression vector at the C-end.Pascall etc. (1991) S.cerevisiae has expressed the fusion rotein of pEGF in a small amount.Have only Australian Gropep company that commercial product (e. coli expression product) is arranged at present in the world, (325 U.S. dollars/1mg) are difficult to satisfy and produce needs but cost an arm and a leg.

Summary of the invention

First purpose of the present invention is to provide a kind of pig's epidermal growth factor pEGF gene;

Second purpose of the present invention is to provide a kind of recombinant vectors of the pEGF of containing gene;

The 3rd purpose of the present invention is to provide the genetic engineering bacterium that contains described carrier;

A further object of the present invention is to provide the method that makes up the said gene engineering bacteria.

Technical scheme of the present invention is: according to the codon-bias of pichia spp, and the synthetic pEGF gene of design, its nucleotide sequence is shown in SEQ ID NO.1, and the aminoacid sequence of its proteins encoded is shown in SEQ ID NO.2.

Introduce yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) α-factor signal coding sequence in the upstream of pEGF gene, make pEGF can be in pichia spp secreting, expressing; 6 Histidines (his) encoding sequences (making expression product be easy to purifying) and a termination codon TGA are introduced in the downstream, and recombinate with the pPIC9 carrier, obtain the pPIC9-pEGF expression vector, and its nucleotide sequence is shown in SEQ ID NO.3;

PPIC9-pEGF transforms pichia spp after using the linearizing of BglII single endonuclease digestion, screens transformant by MD, MM substratum, and further screens the transformant of high copy number.

The method of the high copy of screening transformant is, according to pEGF gene design probe and mark, selects the strong transformant of hybridization signal by dot hybridization.The present invention has filtered out the conversion bacterial strain that contains 14 pEGF gene copies, and its called after C32 (Pichia pastoris/pPIC9-pEGF) (has been preserved in China Committee for Culture Collection of Microorganisms common micro-organisms preservation center on September 30th, 2006, address: No. 13, North No.1 Row, Zhongguancun, Haidian District, Beijing City China institute of microbiology, classification name: pichia pastoris (pichia pastoris), preserving number CGMCC No.1826).

The present invention also provides the method for C32 fermentation culture, at first with on the C32 genetic engineering bacterium inoculation BMGY substratum, carry out enlarged culturing (cultivating 18h for 30 ℃), be inoculated in the growth medium then, 30 ℃ of cultivations, lasting dropping ammonia is kept pH5.4, dissolved oxygen 20%, stream glycerol adding to wet cell weight reaches 300mg/ml behind the 20h, and stream adds the abduction delivering that methyl alcohol carries out pEGF then.Product is centrifugal under 8000-10000 * g, collect supernatant, Ni-NTA affinity chromatographic purification process purifying is used in ultrafiltration under 1kD dams then.The stream of collecting the Ni-NTA affinity column takes off liquid and dialyses and get final product.

PEGF gene of the present invention is the preference codon used according to pichia spp and synthetic gene, and therefore the Pichia yeast engineering that makes up with its can be expressed efficiently; Making up recombinant expression vector, at first adopt secretion expression's carrier, secondly is the downstream at pEGF, introduces 6 Histidines, helps the purifying of expression product like this; The C32 genetic engineering bacterium that transformation and selection obtains contains the pEGF gene of 14 copy numbers in its karyomit(e), the pEGF expression amount of this genetic engineering bacterium is up to 2g/L, and purifying is simple, and production cost is low, for the suitability for industrialized production pig's epidermal growth factor provides may.

Description of drawings

Fig. 1 is expression vector pPIC9-pEGF;

Fig. 2 is the sequential structure figure of pPIC9-pEGF;

Fig. 3 is the Xho I of pPIC9-pEGF and the double digestion collection of illustrative plates of EcoR I, and wherein M represents molecular weight standard;

Fig. 4 is the scanning result of dot hybridization;

Fig. 5 is the SDS-PAGE analysis that the multi-copy integration transformant shakes bottle inducing culture supernatant, and wherein, M represents protein molecular weight standard, 1～5th, contain the different copy number bacterial strains of pEGF, and the 6th, C32, the 7th, GS115/His ⁺Mut ^SThe albumin bacterial strain, the 9th, pPIC9 carrier transformant;

Fig. 6 is that engineering bacteria C32 shakes bottle inducing culture supernatant SDS-PAGE behind the Ni-NTA purifying and analyzes, wherein 1～8th, and the effluent liquid under the concentration gradient.

Fig. 7 is that the SDS-PAGE of engineering bacteria C32 high density fermentation supernatant analyzes, and wherein M represents protein molecular weight standard, 1～8th, and the product under the different induction times.

Fig. 8 is that the Western blotting of C32 expression product analyzes, and wherein M represents pre-dsred protein molecular weight standard, and 1,2 swimming lanes are the expression product of purifying;

Fig. 9 is the purifying expression product pEGF-6His that measures with the CCK-8 biological activity to BALB/c 3T3.

Embodiment

Following embodiment is used for further specifying of the present invention, but is not used for limiting the scope of the invention.

The structure of embodiment 1 expression vector

According to the aminoacid sequence of pEGF and pichia spp preference, synthetic pEGF gene to codon.Its nucleotide sequence and amino acid sequence coded thereof are respectively shown in sequence table SEQ ID NO.1 and 2.Above sequence is synthetic by Shanghai Ying Jun company.With synthetic pEGF gene is template, design a pair of primer, make 5 ' end of upstream primer contain the sequence between Xho I to the SnaB I on the pPIC9 carrier, 5 ' end of downstream primer contains 6 Histidines of coding, TGA termination codon and EcoR I site, the upstream primer that adopts in the present embodiment is: 5 ' GCGCGCTCGAGAAAAGAGAGGCTGAAGCTAATTCTTACTCTGAATGTCCAC, downstream primer: 5 ' GGGCCGAATTCTCAATGATGATGATGATGATGTCTCAACTCCCACCATTTCAAG.Carry out pcr amplification with this a pair of primer.PCR product and pPIC9 carrier carry out double digestion with Xho I and EcoR I respectively, enzyme is cut product and reclaim the pEGF fragment of 210bp and the carrier strap of 8000bp with Qiaquick Gel Extraction test kit after agarose gel electrophoresis is separated, and carries out ligation then.Connect product Transformed E .coli DH5 α competent cell.With the plasmid of Qiaprep Spinminiprep test kit extraction positive transformant, carry out enzyme and cut the evaluation of identifying and check order.

Fig. 1 is pPIC9-pEGF for the recombinant expression vector that is made up by pPIC9 and pPEGF.The sequence of pPIC9-pEGF is shown in SEQ ID NO.1.The upstream of the PCR product (pEGF) that inserts is contained 5 ' AOX1 promotor and is included yeast saccharomyces cerevisiae (Saccharomycescerevisiae) α-factor signal coding sequence.

As shown in Figure 2, the base in Xho I upstream and EcoR I downstream is base sequence on the pPIC9 carrier among the figure.Contain synthetic pEGF sequence (159bp) in 210 bases between Xho I to the EcoR I, contain 24 bases (CTCGAGAAAAGAGAGGCTGAAGCT, the Leu Glu Lys-Arg in the coded signal peptide at the pEGF upstream region of gene ^*Glu Ala GluAla), the KEX2 signal peptide excisionase in the pichia spp can ^*Position excision signal peptide, the Glu Ala Glu Ala residue on the target protein is excised by the STE13 signal peptide excisionase in the pichia spp.If STE13 excision efficient height does not then have Glu Ala Glu Ala residue on the N end of target protein; The sequence and a termination codon (TGA) and the restriction enzyme site EcoR I that contain 6 Histidines of encoding in pEGF gene downstream.

Cut pPIC9-pEGF with Xho I and EcoR I enzyme, can see the segment that has the 210bp size in the restriction enzyme mapping behind the electrophoresis.Referring to Fig. 3.

The screening of preparation, conversion and the transformant phenotype of embodiment 2. competence host bacterium

Yeast expression system solution commonly used and substratum:

10 * D: take by weighing D-glucose 20g, add distilled water to 100mL, heat to dissolving after-filtration degerming or autoclaving fully, be stored in 4 ℃, preservation period is 1 year.

YPD substratum (Yeast Extract Peotone Dextrose Medium): take by weighing yeast extract 10g, Tryptones 20g is dissolved in the 900mL distilled water, and autoclaving 20min adds the sterilized 10 * D of 100mL again.

10 * YNB (13.4%Yeast Nitrogen Base with Ammonium Sulfatewithout Amino Acid): take by weighing yeast nitrogen base (YNB) 67g, add distilled water to 500mL, heat to dissolving the after-filtration degerming fully, be stored in 4 ℃, preservation period is 1 year.

500 * B (0.02%D-Biotin, D-vitamin H): take by weighing D-vitamin H 10mg, add distilled water to 50mL, heat to dissolving the after-filtration degerming fully, be stored in 4 ℃, preservation period is 1 year.

10 * M (10%Methanol, methyl alcohol): get methyl alcohol 10mL, add distilled water to 100mL, filtration sterilization is stored in 4 ℃, and preservation period is two months.

10 * GY (10%Glycerol, glycerine): get glycerine 10mL, add distilled water to 100mL, filtration sterilization or autoclaving are stored in 4 ℃, and preservation period is 1 year.

1M phosphoric acid buffer pH6.0 (1M Potassium Phosphate Buffer): the 1M K of measuring 33mL ₂HPO ₄1M KH with 217mL ₂PO ₄After the mixing, phosphoric acid or KOH regulate pH6.0, and filtration sterilization or autoclaving are stored in 4 ℃, and preservation period is 1 year.

The MD flat board: take by weighing the 1.5g agar powder, add distilled water 80mL dissolving, during autoclaving postcooling to 60 ℃, add 10mL10 * YNB fast, behind 10mL10 * D and the 200 μ L500 * B, a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices cools off back 4 ℃ of preservations fast.

The MM flat board: take by weighing the 1.5g agar powder, add distilled water 80mL dissolving, during autoclaving postcooling to 60 ℃, add 10mL10 * YNB fast, 10mL10 * M, behind 200 μ L500 * B, a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices cools off back 4 ℃ of preservations fast.

BMGY substratum (Buffered Glycerol-complex Medium): take by weighing yeast extract 10g, peptone 20g, be dissolved in the 700mL distilled water, behind the autoclaving 20min, be cooled to room temperature, add 100mL 1M phosphoric acid buffer (pH6.0), 10 * YNB, 10 * GY and the 2mL500 * B of degerming respectively.Place 4 ℃ of preservations, preservation period is two months.

BMMY substratum (Buffered Methanol-complex Medium): take by weighing yeast extract 10g, peptone 20g, be dissolved in the 700mL distilled water, behind the autoclaving 20min, be cooled to room temperature, add 100mL 1M phosphoric acid buffer (pH6.0), 10 * YNB, 10 * M and the 2mL 500 * B of degerming respectively.Place 4 ℃ of preservations, preservation period is two months.

BMM substratum (Buffered Minimal Methanol): behind 700mL distilled water autoclaving 20min, be cooled to room temperature, add 100mL 1M phosphoric acid buffer (pH6.0), 10 * YNB, 10 * M and the 2mL500 * B of degerming respectively.Place 4 ℃ of preservations, preservation period is two months.

Yeast lysis buffer: 0.01M Tris-Cl (pH7.6), 0.5M EDTA (pH8.0), beta-mercaptoethanol (1%V/V).

The preparation of pichia spp GS115 competence host bacterium:

Pichia spp GS115 (Invitrogen company), inoculation YPD plate is cultivated 2d for 30 ℃, picking list bacterium colony to 3mL YPD liquid nutrient medium, 30 ℃, the 300rpm overnight incubation; The nutrient solution that transferase 45 00 μ L spends the night to the fresh YPD liquid nutrient medium of 200mL, and in the culturing bottle of 1L, shake bacterium to OD600 be 1.2-1.3,4 ℃, centrifugal 5 minutes of 1500 * g, the collecting cell precipitation, resuspended with the aseptic deionized water that 200mL is freezing, centrifugal the same, remove supernatant.Resuspended with the aseptic deionized water that 100mL is freezing, centrifugal the same, remove supernatant.With the freezing 1mol/L Sorbitol Solution USP re-suspended cell precipitation of 20mL, centrifugal the same, remove supernatant.Add the freezing 1mol/L sorbyl alcohol of about 1mL, making final volume is that cell density is 1 * 10 about 1.5mL ¹⁰About.

Recombinant plasmid pPIC9-pEGF linearizing:

10.0 μ g recombinant plasmid pPIC9-pEGF BglII single endonuclease digestion linearizing.With linearizing completely enzyme cut product with phenol/the chloroform extracting once, with 1/10 volume 3mol/L sodium acetate and 2.5 times of volume dehydrated alcohol-20 ℃ precipitation 20min, 12000r/min is centrifugal, with drying after 70% the washing with alcohol, adds 20 μ L distilled waters dissolving linearizing product.-20 ℃ of preservations are standby.

The electricity of linearizing pPIC9-pEGF transforms:

After getting 80 μ L GS115 competent cells and the linearizing recombinant plasmid dna mixing of 10 μ g, it is changed in the electrotransfer cup of precooling over to ice bath 5min.The electrotransfer cup is put into the electrotransfer groove, the 1500V conversion of shocking by electricity.After the electric shock, add the sorbyl alcohol of 1mL precooling immediately, move to gently in the aseptic 1mL EP pipe.Get 500 μ L mixed solutions and evenly coat in the MD flat board, in 30 ℃ of constant incubators, cultivated 2 to 3 days, until growing tangible bacterium colony.

The Mut of transformant ⁺And Mut ^SScreening:

The single bacterium colony that grows in the MD plate is chosen with toothpick, be stained with in new MD plate, and the bacterium colony that will be stained with carries out mark, cultivated 2 to 3 days in 30 ℃ of constant incubators.The bacterium colony that grows in the new MD plate is chosen with toothpick again, be stained with in new MM plate, carry out identical mark, cultivate in 30 ℃ of constant incubators after 2 to 3 days, observe the speed of colony growth, determine the Mut phenotype: in the MD plate, all transformant growing states are similar, size does not have evident difference between the transformant, but in the MM plate, Mut ⁺The growth of (utilize methyl alcohol fast) type transformant is fast, and the clone is big; Mut ^SThe growth of (utilize methyl alcohol slow) type transformant is slower, clones less.In 200 transformants identifying, half is arranged is Mut ⁺(utilize methyl alcohol fast) type transformant.

Embodiment 3 dot hybridizations screening multi-copy integration transformant

Yeast lysis buffer: 0.01M Tris-Cl (pH7.6), 0.5M EDTA (pH8.0), beta-mercaptoethanol (1%V/V).

Dot hybridization liquid (1 *): 20 * SSC 250mL, 5%SDS 5mL, 10%Sarkosyl10mL, ddH ₂O 735mL, Blocking Reagent 5g.

Place every hole to contain 96 orifice plates of 100 μ l YPD substratum the transformant of determining phenotype, cultivate 48h for 30 ℃, get 10 μ l and inoculate in 96 orifice plates that every hole contains the fresh YPD substratum of 100 μ l, continue to cultivate 48h.The bacterium liquid of 50 μ l cultivation is got in the 2ml centrifuge tube in every then hole, centrifugal remove supernatant after, the yeast lysis buffer re-suspended cell precipitation that contains yeast lyase (lyticase) with 80 μ l, 37 ℃ of cracking 4h, behind 100 ℃ of effect 10min, immediately centrifuge tube is put into ice, and add isopyknic 20 * SSC, obtain lysate.Utilize the dot hybridization sample injector, the lysate for preparing is transferred on the nitrocellulose filter, 80 ℃ of baking 2h insert hybrid pipe after the sex change, add prehybridization solution prehybridization 4h.Amplifying length with primer (upstream primer AOX primer5 '-GACTGGTTCCAATTGACAAG-3 ', downstream primer pPSEGF primer5 '-CCTAGGGAATTCTC AATGATGA-3 ') from pPIC9-pEGF is the fragment that 535bp contains the pEGF gene.Return the PCR product with Qiaquick Gel Extraction test kit, be template, with Takara Random Primer DNA labeling test kit and [α- ³²P] dCTP carries out the isotope probe labeled reactant.The probe of mark is added in the pipe of prehybridization, and hybridization is spent the night.After washing film, take out nitrocellulose mould phosphorus plate 24h.This phosphorus plate is scanned screening multiple copied transformant on Bio-Rad FX scanner.

Referring to Fig. 4, D3, D4 are the pPIC9 transformant among the figure; D5, D6 are unconverted GS115; D7, D8 are the pPIC9-pEGF plasmid; Other are the pPIC9-pEGF transformant.The multi-copy integration transformant is the stronger transformant of signal, as A8, B2, B7, B8, C6, C7.Wherein the signal of C6 is the strongest, contains the 14pEGF gene copy number, and the pairing bacterial strain C32 of C6 is a genetic engineering bacterium.

The expression and purification of pEGF during embodiment 4 engineering bacteria shake-flask culture

Engineering bacteria C32 shakes bottle and induces: among the engineering bacteria C32 colony inoculation 40mL BMGY behind the enlarged culturing 16-18h, abduction delivering in 10mL BMMY (containing 1%Casamino Acid), respectively 0,24,48,72,96,120h gathers in the crops 100 μ L supernatants ,-20 ℃ are standby.Expression product carries out Tricine-SDS-PAGE and analyzes.

The result is referring to accompanying drawing 5, and the 1-5 swimming lane is the expression supernatant of inducing 72h of 5 different bacterial strains of copy number among the figure, and 6 swimming lanes are that the 72h that induces of genetic engineering bacterium C32 expresses supernatant; 7 is GS115/His ⁺Mut ^SAlbumin induces 72h to express supernatant; M, protein molecular weight standard; 9, the abduction delivering supernatant of pPIC9 carrier transformant.As can be seen from this figure, the expression of engineering bacteria C32 is very high.

Shake the purifying of bottle expressed protein: engineering bacteria is inoculated 400ml BMGY substratum, 30 ℃ of shake-flask culture 16-18h, centrifugal, remove supernatant, cell inoculation 100ml BMMY substratum continues shake-flask culture, with 1% methanol induction 96h; The supernatant of abduction delivering potassiumphosphate adjust pH to 7.8.Centrifugal cell and the fragment of going, centrifugal supernatant Ni-NTA affinity chromatography column purification is with elutriant (300mM NaCl, 50mM NaH ₂PO ₄, the 250mM imidazoles is with NaOH adjust pH to 8.0) and wash-out target product from the affinity column, effluent liquid installs to 2ml EP pipe by the 1ml volume integral.The effluent liquid of getting in each EP pipe is a small amount of, carries out Tricine-SDS-PAGE and analyzes, and will contain the phosphoric acid buffer dialysis 24h of target protein effluent liquid to 1L 10mM, and freeze-drying is preserved then.

The result is referring to accompanying drawing 6.The 1-8 swimming lane is the elutriant that the 1-8 centrifuge tube receives in the accompanying drawing 6, and M is a protein molecular weight standard.So express after supernatant crosses the Ni-NTA affinity column, target protein mainly concentrates in the 2nd, 3, the 4 pipe elutriants, to express after supernatant crosses the new and post of Ni-NTA, foreign protein is considerably less.

The purifying of embodiment 5 engineering bacteria high density fermentations and product

2 of C32 genetic engineering bacterium inoculations contain in the 2L triangular flask of BMGY substratum of 250ml, cultivate 18h for 30 ℃, be inoculated into then in the 5L fermentor tank (Shanghai Bao Xing company) that contains the 3L growth medium (high density fermentation cultivation), 30 ℃ of cultivations, lasting dropping ammonia is kept pH5.4, dissolved oxygen 20%, stream glycerol adding to wet cell weight reaches 300mg/ml behind the 20h, and stream adds the abduction delivering that methyl alcohol carries out pEGF then.During high density fermentation, get the expression supernatant, carry out SDS-PAGE with 15 μ l expression products and analyze at different induction times.

Growth medium:

H ₃PO ₄ 26.7ml

CaSO ₄·2H ₂O 0.9g

K ₂SO ₄ 18g

MgSO ₄ 15g

KOH 4.13g

Glycerine 40g

PTM1 salts solution 4.4ml

Add water to 1L

The result is referring to Fig. 7.M: protein molecular weight standard; 1: methanol induction 2h; 2: methanol induction 8h; 3: methanol induction 14h; 4: methanol induction 26h; 5: methanol induction 32h; 6: methanol induction 38h; 7: methanol induction 49h; 8: methanol induction 58h.As can be seen from this figure, induce 26h, expression product rolls up in the expression supernatant, and later on along with time lengthening, the content of expression product also increases.High expression level amount can reach 2g/L.

The purifying of marking protein: fermented liquid is centrifugal under 8000-10000 * g, collect supernatant, potassiumphosphate is transferred pH to 7.8.Ultrafiltration under 1kD dams, ultrafiltrated directly join with damping fluid (300mM NaCl, 50mM NaH ₂PO ₄, the 10mM imidazoles is with NaOH adjust pH to 8.0) and equilibrated Ni-NTA chromatography column, the control flow velocity is in the 0.8-1.2mL/min scope.Treat ultrafiltrated all by behind the chromatography column, with wash buffer (300mMNaCl, the 50mM NaH of 10 times of column volumes ₂PO ₄, the 20mM imidazoles is with NaOH adjust pH to 8.0) and the cleaning pillar.Use Elution buffer (300mM NaCl, the 50mMNaH of 5 times of column volumes then ₂PO ₄, the 250mM imidazoles is with NaOH adjust pH to 8.0) and wash-out target product from the affinity column.Expression product purity reaches more than 95%.

The evaluation of embodiment 6 expression products

Western bloting: Ni-NTA affinity column purified product is carried out the SDS-PAGE electrophoresis, through changeing pvdf membrane, sealing, use the anti-His-Tag monoclonal antibody (Novagen company) of mouse source property and the goat anti-mouse IgG of horseradish peroxidase-labeled to carry out immunoblotting reaction then again.The results are shown in Figure 8.1,2 swimming lanes at Fig. 8 are the expression product of purifying; M: pre-dsred protein molecular weight standard.

The order-checking of N terminal amino acid

The freeze dried purifying expression product that takes a morsel is used dissolved in distilled water, adds beta-mercaptoethanol (final concentration is 5%), and 100 ℃ of reaction 10min make the disulfide bond reduction in the molecule.Then sample is carried out the Tricine-SDS-PAGE electrophoresis and change pvdf membrane.The pvdf membrane that will contain the purpose band send Jikang Biotechnology Co Ltd, Shanghai to carry out the amino acid sequencing that N holds, and measures 15 amino-acid residues of N end.Contain 2 polypeptide in the results sample, the sequence of the fifteen amino acid residue of its N end is respectively NSYSECPPSHDGYCL and EANSYSECPPSHDGY, illustrate that detecting the polypeptide that obtains is pEGF-6His, also show that the proteolytic enzyme STE13 of host bacterium GS115 is incomplete to the N-terminal Glu-Ala excision of pEGF-6His simultaneously.

Embodiment 7 fusion rotein biological activity assay

Material and reagent:

BALB/c 3T3 cell is available from Shanghai school of life and health sciences cell resource center of the Chinese Academy of Sciences; DMEM basic medium, foetal calf serum, mycillin, Streptomycin sulphate, amine amide are available from GBICO company.Recombinant human epidermal growth factor (Recombinant Human EGF, hEGF), Britain PeproTech House company.Cell Counting Kit-8 (CCK-8), Dojindo Molecular Technologies company.

The BALB/c3T3 cell is diluted to 5 * 10 with the DMEM substratum (perfect medium) that the contains 10% calf serum cultivation of going down to posterity with perfect medium ⁴/ ml, join in the 96 porocyte culture plates with every hole 100 μ l, cultivated 24 hours for 37 ℃, cultivated 12 hours with the DMEM substratum (basic medium) that contains 1% calf serum is hungry, add the pEGF sample that contains purifying of serial dilution or the substratum of hEGF standard substance, 37 ℃ are continued to cultivate 48 hours, add the CCK-8 solution of 10 μ l, and the optical density value (OD) of 600nm wavelength is measured in 37 ℃ of effects after 2 hours.

The results are shown in accompanying drawing 9.From Fig. 9 as seen, the pEGF albumen of this research expression and purification has significant cell-proliferation activity (P＜0.01) to BALB/c 3T3 cell, compares with the cell-proliferation activity of recombinant human epidermal growth factor reference substance, and no statistics is learned difference (P＞0.05).

Sequence table

＜110〉Agricultural University Of South China

＜120〉pig's epidermal growth factor gene and application thereof

<130>

<160>3

<170>PatentIn?version?3.3

<210>1

<211>159

<212>DNA

＜213〉artificial sequence

<220>

<221>CDS

<222>(1)..(159)

<400>1

aat?tct?tac?tct?gaa?tgt?cca?cca?tcc?cac?gac?ggt?tac?tgt?ttg?cac 48

Asn?Ser?Tyr?Ser?Glu?Cys?Pro?Pro?Ser?His?Asp?Gly?Tyr?Cys?Leu?His

1 5 10 15

ggt?ggt?gtt?tgt?atg?tat?att?gaa?gcc?gtc?gac?tct?tat?gcc?tgt?aac 96

Gly?Gly?Val?Cys?Met?Tyr?Ile?Glu?Ala?Val?Asp?Ser?Tyr?Ala?Cys?Asn

20 25 30

tgt?gtt?ttt?ggt?tac?gtt?ggc?gag?aga?tgt?caa?cac?aga?gac?ttg?aaa 144

Cys?Val?Phe?Gly?Tyr?Val?Gly?Glu?Arg?Cys?Gln?His?Arg?Asp?Leu?Lys

35 40 45

tgg?tgg?gag?ttg?aga 159

Trp?Trp?Glu?Leu?Arg

50

<210>2

<211>53

<212>PRT

＜213〉artificial sequence

<400>2

Asn?Ser?Tyr?Ser?Glu?Cys?Pro?Pro?Ser?His?Asp?Gly?Tyr?Cys?Leu?His

1 5 10 15

Gly?Gly?Val?Cys?Met?Tyr?Ile?Glu?Ala?Val?Asp?Ser?Tyr?Ala?Cys?Asn

20 25 30

Cys?Val?Phe?Gly?Tyr?Val?Gly?Glu?Arg?Cys?Gln?His?Arg?Asp?Leu?Lys

35 40 45

Trp?Trp?Glu?Leu?Arg

50

<210>3

<211>236

<212>DNA

＜213〉recombinant plasmid

<400>3

aagaaggggt?atctctcgag?aaaagagagg?ctgaagctaa?ttcttactct?gaatgtccac 60

catcccacga?cggttactgt?ttgcacggtg?gtgtttgtat?gtatattgaa?gccgtcgact 120

cttatgcctg?taactgtgtt?tttggttacg?ttggcgagag?atgtcaacac?agagacttga 180

aatggtggga?gttgagacat?catcatcatc?atcattgaga?attccctagg?gcggcc 236

Claims (9)

1, a kind of pig's epidermal growth factor gene, it has the nucleotide sequence shown in the SEQ ID NO.1.

2, contain the described expression carrier of claim 1.

3, expression vector as claimed in claim 2, it has the nucleotide sequence shown in the SEQ ID NO.3.

4, the host of containing claim 2 or 3 described expression vectors.

5, host as claimed in claim 4, it is a pichia spp.

6, as claim 4 or 5 described hosts, it is by importing the preparation of pichia spp GS115 bacterial strain with claim 2 or 3 described expression vectors.

7, a kind of genetic engineering bacterium pichia pastoris (Pichia pastoris) C32 CGMCCNo.1826 is characterized in that, this bacterial strain contains 14 copies of the described gene of claim 1.

8, the pig's epidermal growth factor that obtains by the described bacterial strain of claim 7.

9, pig's epidermal growth factor as claimed in claim 8, it has the aminoacid sequence shown in the SEQ ID NO.2.

Images