CN1300307C - Recombined T4 bacteriophage of expressing cholecystokinin gene - Google Patents

Recombined T4 bacteriophage of expressing cholecystokinin gene Download PDF

Info

Publication number
CN1300307C
CN1300307C CNB2005100115824A CN200510011582A CN1300307C CN 1300307 C CN1300307 C CN 1300307C CN B2005100115824 A CNB2005100115824 A CN B2005100115824A CN 200510011582 A CN200510011582 A CN 200510011582A CN 1300307 C CN1300307 C CN 1300307C
Authority
CN
China
Prior art keywords
cck
recombinant
bacteriophage
gene
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CNB2005100115824A
Other languages
Chinese (zh)
Other versions
CN1687407A (en
Inventor
曹永长
覃健萍
毕英佐
舒鼎铭
马静云
谢青梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Agricultural University
Original Assignee
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University filed Critical South China Agricultural University
Priority to CNB2005100115824A priority Critical patent/CN1300307C/en
Publication of CN1687407A publication Critical patent/CN1687407A/en
Application granted granted Critical
Publication of CN1300307C publication Critical patent/CN1300307C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a recombinant T4 bacteriophage expressing a cholecystokinin gene, which has chicken cholecystokinin 33 peptide genes or nucleotide sequences formed from serial 33 peptide genes. The present invention also provides chicken cholecystokinin 33 peptide genes or the nucleotide sequences formed from serial 33 peptide genes, a technique using the recombinant T4 bacteriophage to actively immunize animals, and applications of the chicken cholecystokinin 33 peptide genes or the nucleotide sequences formed from serial 33 peptide genes.

Description

Express the recombinant T 4 bacteriophage of cholecystokinin gene
Technical field
The present invention relates to express the feature and the application of the recombinant T 4 bacteriophage of cholecystokinin gene.The invention further relates to active immunity technology and the application thereof of recombinant T 4 bacteriophage to animals such as pig, rabbit, ox, chicken, duck, geese.
Background technology
(Cholecystokinin CCK) is a kind of efficiency factor of regulating animal feed intake to cholecystokinin.Cholecystokinin claims cholecystokinin or Pancreozymin again, is the peptide hormone by the I emiocytosis of mucous membrane of small intestine.The CCK precursor is 130 amino acid, progressively is decomposed into micromolecular CCK, and the CCK that finds has CCK-83, CCK-58, CCK-39, CCK-33, CCK-12, CCK-8 and CCK-4 at present.Its different sites is mainly at carboxyl terminal, but length extends in aminoterminal.Be mainly macromole CCK after the meal in the blood plasma, comprise CCK-58, CCK-39, CCK-33 and CCK-12.These macromole CCK all becomes the amino-acid residue of 8 peptides, i.e. CCK-8 behind trypsin hydrolyzing.CCK-8 has whole activity of CCK molecule, with the gastrin structural similitude of 8 peptides, all has identical N-terminal sequence Gly-Trp-Met-Asp-Phe-NH2, and it is necessary that this sequence is that CCK and gastrin are brought into play its biological activity.CCK is present in brain and the gi tract, is the more a kind of braingut petide of brain intensive amount (brain-gut peptide) class material.Then difference is very big for the content of CCK at each position.At gi tract, CCK has gall-bladder, stomach and the pyloric sphincter contracts of promotion; Promote far-end duodenum and jejunum wriggling; Promote the secretion of bile, hydrochloric acid in gastric juice, pancreatic juice; Strengthen the activity of pancreatin; Promote Regular Insulin The release of hyperglycemic-glycogenolytic factor, thyrocalcitonin; Regulate the release of pancreatic polypeptide in enteron aisle and pancreatic juice; Suppress functions such as stomach emptying.Cck receptor has two kinds: CCK-A acceptor and CCK-B acceptor, and wherein the CCK-A acceptor is very high at peripheral organ's content, and CCK-B acceptor content in central nervous system is very high.The CCK-A acceptor has two binding sites: high-affinity site and low-affinity site.Thereby the CCK that studies show that in recent years searches for food animal to stop in conjunction with making animal produce full sense with the low-affinity site of CCK-A.
CCK can reduce the food consumption of multiple animal.The CCK-A acceptor gene knocks out rat and shows as obesity, easily hungry, the increase of searching for food (Schwartz etc., 1999).No matter discover, in multiple animal, be exogenous CCK, or the endogenous CCK that body self generates can both make body produce full feel (Della Fera etc., 1979,1981; Gibbs etc., 1973; Mc Laughlin etc., 1980).Exogenous injection CCK also can reduce the food consumption of animal.Maincenter is introduced the effect that CCK has identical reduction food consumption with periphery, and CCK directly produces full sense as neurotransmitter in brain.Low dose of CCK just can suppress to search for food effectively, in multiple Mammals such as dog, mouse, rabbit, monkey and human experimentation research, find, stomach emptying activity (Doong etc., 1998) after no matter the CCK of physiological dose or pharmacology dosage can both suppress to take food, and then suppress animal and search for food.Plasma C CK concentration and gastric emptying rate are inverse relation.
Research to the CCK immunity has been carried out the long period, studies show that in early days, utilizes the immunoregulation technology can effectively regulate and control the secretion of hormone in vivo, thereby regulates production performance (Della etc., 1981 of animal; Lawrence etc., 1986; Pekas, 1991,1993; Schanbacher etc., 1994).At present, existing on pig and some ruminating animals is the research report that antigen carries out active immunity and passive immunization with CCK, and the result shows has certain regulating and controlling effect to breeding performonce fo animals.Jens etc. (1978) are with the independent immune rabbit of CCK-33, and behind booster immunization 3 times, the antiserum(antisera) of the very high anti-CCK-33 that obtained to tire illustrates that CCK has certain antigenicity, can be used for inoculating animal and make it to produce antibody.And domestic, Chen Junhui (1992) connects formation holoantigen immune rabbit with CCK-8 macromole and bovine serum albumin (BSA), has also obtained the anti-CCK-8 antiserum(antisera) of high titre behind the booster immunization.Though the CCK immunoregulation has certain effect on pig, sheep; but in order to use this technology aborning; must search out a kind of CCK immunogen; its immune consumption is few; immunologic process is convenient feasible; antibody is relatively stable, be easy to preserve and use, and can mass production antibody, meets the method for protection of animal rules again.
Do food consumption and the weightening finish that antigen active immunity animal can be improved animal with CCK.After Pekas and Trout (1990) use CCK immunity growing swine, its food consumption and weightening finish have improved 8.2% and 10.6% respectively, carcass weight improves 8.7%, body is long to increase by 2.4%, to the ratio of lean meat/fat and the not influence of ratio of protein/fat, but the trunk lean meat and the fat of CCK immune swine heavily increase.This shows that after the CCK immunity, the speed of growth increase of pig is because the trunk weightening finish increases, but trunk is formed not influence.Mclaughlin etc. (1985) find that treatment group has increased by 9% (P<0.04) than the food consumption of control group after with CCK active immunity mouse, and weightening finish has improved 17% (P<0.02).These results of study show that using CCK active immunity animal has certain promoter action for searching for food of animal, but conclusion also only limits to some Mammalss, are still waiting further experiment for the effect of other animal aspect and confirm.
More than research is all with chemosynthesis, or the CCK of separation and purification from animal tissues or its active part and macromolecular substance (as BSA etc.) coupling, immune animal then.But the report of phage expression CCK also of no use or its active part (as CCK-33 peptide, CCK-8 peptide).
Phage display technique (phage display) is a new biotechnology (Smith who grew up in the 1980's, 1985), it can be illustrated in phage surface with the form of fusion rotein with the allogenic polypeptide of expressing and protein, and keeps relatively independent space conformation and biological activity.The typical member of T4 Phagus A group A2 subgroup in tailed phages, its grown form structure is the directly about 95nm of head length, transverse diameter is about 65nm.T4 phage capsid must be formed by capsid protein by 3 kinds, major capsid protein gp23 and 2 less important capsid protein gp24, gp20.Wherein molecular weight is that the gp23 of 45kDa has 960 copies in each virion, and all the other 2 less important capsid protein copy numbers are less, and gp24 has 55 copies, and gp20 has only 12 copies.In addition, at the appearance bread of capsid by 2 kinds of nonessential coat protein: molecular weight is that SOC and the molecular weight of 9kDa is the HOC of 40kDa, and the two is distributed in phage icosahedron surface at a distance of 7nm with symmetric form.SOC and HOC only provide phage extra stabilizing power, just are assembled into the capsid surface after the assembling of phage capsid is finished, and their disappearance does not influence breeding and the infection of T4 phage.The SOC or the HOC albumen of foreign protein and T4 phage surface are formed fusion rotein, thereby can obtain to have the recombinant T 4 bacteriophage of foreign protein.Adopt such method, expression HIV (human immunodeficiency virus) (HIV) gp120 V3 peptide, poliovirus VP1 (Ren et al have been obtained, 1996), meningitis Salmonella PorA (Jiang et al how, 1997) antigen protein, infectious bursal disease virus VP2 (Cao Yongchang etc., 2003), the recombinant T 4 bacteriophage of bird flu H5 hypotype and H9 subtype HA protein (Lv Yingzi etc., 2002).
Summary of the invention
The objective of the invention is to obtain to express the recombinant T 4 bacteriophage of cholecystokinin gene, for active immunity cholecystokinin and cholecystokinin detection of antibodies provide a kind of new antigen.
Recombinant T 4 bacteriophage provided by the invention is to adopt the method for gene recombination to obtain.Its construction process is:
At first be to make up a series of recombinant plasmids that contain cholecystokinin 33 peptide gene excessive concatemers.These plasmids are to adopt gene engineering method to obtain, and concrete construction process is as follows:
(1) according to the base sequence and the intestinal bacteria high frequency codon of chicken cck gene, the synthetic cck-33 gene of design, gene order is: GGTTCTACTGGCCGCTTCTCTGTCCTTG GCAACCGTGTACAGAGCATTGATCCGACGCACCGTATTAATGACCGTGACTACATG GGCTGGATGGATTTT.
(2) the cck-33 gene is inserted the pRSETA plasmid, obtain recombinant plasmid pRSETA-1CCK, concrete operations are as follows:
According to the cck-33 gene design Auele Specific Primer of synthetic, adopt PCR method, be template with the cck-33 gene of synthetic, amplification cck-33 gene fragment.With 2% sepharose (contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product, observe the size about 120bp specific band.
At 37 ℃ of PCR product and plasmid pRSETA that digest the CCK-33 gene respectively, then under the effect of T4 ligase enzyme, connect the PCR product and the plasmid pRSETA of the cck-33 gene of digestion with Sac I and BamHI.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, the transformant of cck-33 gene has been inserted in acquisition.With Auele Specific Primer P1/P2 the transformant that contains the cck-33 gene is carried out the PCR screening then.With 2% sepharose (contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product, observe the size about 120bp specific band.
To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, and the extracting plasmid again through digestion with restriction enzyme and sequencing, obtains recombinant plasmid called after pRSETA-1CCK.
(3) according to BamHI and the BglII characteristic of isocaudarner each other, make up cck-33 gene 2 concatermers (being called for short 2cck), concrete operations are as follows:
Recombinant plasmid pRSETA-1CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamHI and HindlII, reclaims less fragment; Second group digests with BglII, HindIII and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, acquisition contains the recon of 2cck.With Auele Specific Primer P1/P2 the recon that contains 2cck is carried out the PCR screening then.(contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product is observed the specific band of about 230bp with 2% sepharose.
To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-2CCK of acquisition.
(4) 4 concatermers (being called for short 4cck) of structure cck-33 gene on the basis of pRSETA-2CCK, concrete operations are as follows:
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamHI and HindIII, reclaims less fragment; Second group digests with BglII, HindIII and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, acquisition contains the recon of 4cck gene.Use Auele Specific Primer P3 (5 '-GATAAGGATCGATGGGGATCC-3 ')/P4 (5 '-ATGGTACCAGCTGCAGATCT-3 ') that the recon that contains 4cck is carried out the PCR screening then.To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-4CCK of acquisition.
Adopt identical method, obtain to contain cck-33 gene 6 concatermers (being called for short 6cck), 8 concatermers (being called for short 8cck), correspondingly called after pRSETA-6CCK, pRSETA-8CCK respectively.
Contain on the basis of cck-33 gene excessive concatemer recombinant plasmid in acquisition, make up the integrated plasmid that contains cck-33 gene excessive concatemer.With the example that is configured to that contains the 4cck integrated plasmid its construction process is described below.
(1) adopts Auele Specific Primer Pup2 (5 '-ATTGAATTCTGATGACGATAAGGAT-3 ')/Pdn2 (5 '-ATCGAATTCCTACATGGTACCAGCTGC-3 '), with the PCR method 4cck gene that from plasmid pRSETA-4CCK, increases.(100 μ L) is composed as follows for the PCR reaction system: 10 * PCR buffer, 10 μ l, dNTPs 8 μ L, Taq enzyme 1 μ L, Pup2 1 μ L, Pdn2 1 μ L, pRSETA-4CCK 1 μ l, ddH20 78 μ L.The pcr amplification program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 64 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.(contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product with 1% sepharose.
(2) the 4cck gene is inserted in the pR plasmid (Ren et al, 1996), make up recombination and integration plasmid pR-4CCK, its operation steps is as follows:
At 37 ℃ of PCR product and plasmid pR that digest the 4cck gene respectively, then under the effect of T4 ligase enzyme, connect PCR product and the plasmid pR of the 4cck of digestion with EcoRI.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, the recon of 4cck gene has been inserted in acquisition.Use 1 couple of Auele Specific Primer SOC-S (5 '-GAATCATATGGCTA GTCTCGCGG-3 ')/Pdn2 to carry out the PCR screening then.To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, and the extracting plasmid again through digestion with restriction enzyme and sequencing, obtains recombination and integration plasmid pR-4CCK.
Then, carry out homologous recombination with recombination and integration plasmid pR-4CCK and defective T4 phage T4-Z1 (Ren etal, 1996), obtain to express the recombinant T 4 bacteriophage of CCK-33 peptide 4 concatermer albumen (4CCK), its operation steps is as follows:
With integrated plasmid pR-4CCK transformed into escherichia coli E 2, the intestinal bacteria of acquisition are E-4CCK;
In the vessel of 500 μ L SC nutrient solutions of packing into, add 1 μ L acillin (Amp), add 10 μ L E-4CCK then, be cultured to optical density value OD at 37 ℃ 600Be approximately at 0.5 o'clock, add 50 μ L T4-Z1, be cultured to bacterial debris 35 ℃ of 200r/m joltings and occurred, the product of acquisition is unidentified recombinant T 4 bacteriophage;
In the vessel of 1 process sterilization, add and cultivate the intestinal bacteria E that surpasses 12h 2600 μ L do not add N,O-Diacetylmuramidase, will be placed in the microwave oven at the SC of 2~10 ℃ of storages top layer substratum to dissolve, and treat to get when the agar temperature drops to about 45 ℃ 2mL and pour into intestinal bacteria E is housed 2Vessel in, with the mixed solution mixing, be poured on immediately on the pre-configured SC bottom substratum plate, when the agar total condensation, on SC top layer substratum, put the unidentified recombinant T 4 bacteriophage of 10 μ L respectively, wait to absorb finish after, be placed on 37 ℃ and cultivate more than the 16h.If reorganization has taken place in plasmid among the E-4CCK and T4-Z1, successfully the 4cck gene is changed in the T4 phage, then on the plate that does not add N,O-Diacetylmuramidase, can grow plaque;
Contain E on the plate upper berth 2The SC top layer substratum of bacterium, is placed on 37 ℃ and cultivates more than the 12h the plaque that grows some plum blossom spot on SC top layer substratum with the sterilization toothpick, and well-grown plum blossom spot peels it with the blade that disinfects, and is immersed in 6h in the phosphoric acid buffer;
With the Auele Specific Primer Pup2/Pdn2 specific band that increases from plum blossom spot soak solution, then explanation has obtained to express the proteic recombinant T 4 bacteriophage of 4CCK, called after T4-4CCK.
The SC nutrient solution is prepared by following method: contain 10g Tryptone and 5g NaCl among every 1000mL, add distilled water and be settled to 1000mL, 15lpf/in 24 ℃ of preservations behind the autoclaving 20min.
SC bottom substratum is prepared by following method: contain 10g Tryptone among every 1000mL, and 5g NaCl and 12g agar powder, distilled water is settled to 1000mL, 15lpf/in 2Autoclaving 20min is cooled to 50 ℃, adds the 50mL 1mol/L Tris-Cl and the 10mL 25% Trisodium Citrate 2H of sterilization 2O solution, it is dull and stereotyped to shake up the back, 4 ℃ of preservations.
SC top layer substratum is prepared by following method: contain 10g Tryptone among every 1000mL, and 5g NaCl and 7g agar powder, distilled water is settled to 1000mL, 15 lpf/in 2Autoclaving 20min, 4 ℃ of preservations.The time spent heating for dissolving is cooled to 50 ℃, adds the 50mL 1mol/LTris-Cl and the 10mL 25% Trisodium Citrate .2H of sterilization 2O solution, it is standby to shake up the back.
Adopt similar method, the recombinant phage of construction expression CCK-33 peptide (1CCK) and CCK-33 peptide 8 concatermers (8CCK) is correspondingly with these recombinant phage called after T4-1CCK and T4-8CCK.
Being characterized as of the recombinant T 4 bacteriophage of expression CCK-33 peptide excessive concatemer:
(1) recombinant phage T4-1CCK provided by the invention, T4-4CCK and the T4-8CCK nucleotide sequence that all has sequence 1 in the sequence table, or the concatermer sequence of sequence 1.Sequence 1 is called the cck-33 gene again, is made up of 99 base pairs, is that base sequence and the intestinal bacteria high frequency codon according to chicken cck gene designs.The concatermer sequence of sequence 1, be with several bases with two cck-33 genes in end to end mode, several cck-33 genes are coupled together the sequence that forms.For the excessive concatemer of sequence 1 and sequence 1, adopt PCR method can amplify specific band, also can adopt the method for determined dna sequence to determine.
(2) expression product of recombinant plasmid provided by the invention has the aminoacid sequence of sequence 2 in the sequence table, or the concatermer sequence of sequence 2.Sequence 2 is called the CCK-33 peptide again, by sequence 1 coding.The concatermer sequence of sequence 2, be with several amino acid with two CCK-33 peptides in end to end mode, several CCK-33 peptides are coupled together the sequence that forms.Adopt the specific antibody of anti-CCK-33 peptide, the specific antibody of perhaps anti-CCK-8 peptide, perhaps the specific antibody of the CCK of anti-other form can detect this polypeptide product.
(3) recombinant plasmid provided by the invention also comprises having the plasmid that CCK is equal to sequence.CCK is equal to sequence, it is nucleotide sequence with the cck-33 gene, or the amino acid residue sequence of CCK-33 peptide is compared the difference that one or several Nucleotide or amino-acid residue are arranged, comprise the change, disappearance, interpolation of base or amino-acid residue or insert, or homology more than 75% is arranged with continuous 24 sections more than the base in the cck-33 gene order.
Recombinant phage provided by the invention has important use and is worth.One of use be with described recombinant phage as antigen, adopt the recombinant phage direct immunization or it is cooperated animals such as immune swine, ox, rabbit, chicken with adjuvant, can promote that animal searches for food, the raising production performance.
Second application of recombinant phage provided by the invention is to adopt the recombinant phage direct immunization or it is cooperated with adjuvant to make the vaccine immunity laying hen, by collecting the egg of immune chicken, can obtain the specific antibody of anti-CCK in a large number.
The Another application of recombinant phage provided by the invention, be with described recombinant phage as antigen, be applied to include but not limited to ELISA (enzyme linked immunosorbent assay), detect the CCK specific antibody in the animal serum.
The present invention has tangible advantage and effect.(1) the present invention adopts the recombinant phage of engineered method acquisition according to intestinal bacteria preference codon design gene order, and the expression amount height is easy to purifying, and cost is low.(2) the CCK-33 peptide excessive concatemer of the present invention's acquisition has good immunogenicity.CCK mainly exists with the form of amidated CCK-8 of hydroxyl terminal and CCK-33 in animal body.Because the molecular weight of CCK-33 and CCK-8 is too little, can not be directly as antigen-immunized animal, generally need be with them and macromolecular substance (as BSA) coupling.Recombinant T 4 bacteriophage provided by the invention is illustrated in the T4 phage surface after dexterously the soc protein of CCK-33 peptide or its excessive concatemer and T4 bacteriophage head being merged.Because the SOC site has 960 copies on T4 bacteriophage head surface, thus with the CCK-33 peptide of SOC amalgamation and expression or the copy number height of its excessive concatemer.Because CCK-33 peptide or its excessive concatemer are distributed in T4 bacteriophage head surface, thereby the T4 phage itself has served as the carrier of CCK-33 peptide or its excessive concatemer, when recombinant T 4 bacteriophage provided by the invention during as antigen, the immunogenicity of CCK-33 peptide or its excessive concatemer is stronger than the proteic immunogenicity of independent CCK.When using as the antigen of vaccine or as the antigen of immunodetection, than the CCK polypeptide of synthetic, even and other CCK polypeptide or its excessive concatemer of protein expression system expression compare, recombinant T 4 bacteriophage of the present invention has tangible advantage.
Below in conjunction with embodiment and accompanying drawing structure, the signature analysis of recombinant phage, application approach of expressing the recombinant phage of CCK-33 peptide excessive concatemer provided by the invention specified.
Description of drawings
Fig. 1 is that cck-33 gene and excessive concatemer thereof make up synoptic diagram.PRSET A is the cloned plasmids carrier, pRSETA-1CCK is the recombinant plasmid that has inserted the cck-33 gene, pRSETA-2CCK is for having inserted the recombinant plasmid of cck-33 gene 2 concatermers (2cck), pRSETA-4CCK is for having inserted the recombinant plasmid of cck-33 gene 4 concatermers (4cck), pRSETA-6CCK is for having inserted the recombinant plasmid of cck-33 gene 6 concatermers (6cck), and pRSETA-8CCK is for having inserted the recombinant plasmid of cck-33 gene 8 concatermers (8cck).BamH I, HindIII, Bgl II, Sac I are the restriction endonuclease sites on the plasmid.
Fig. 2 is the PCR qualification result figure of cck-33 gene and excessive concatemer thereof.Swimming lane the 1, the 2nd, the PCR product of cck-33 gene and excessive concatemer thereof, swimming lane M are dna molecular amount mark.A is a cck-33 gene PCR product, and B is cck-33 gene 4 concatermers (4cck) PCR product, and C is cck-33 gene 8 concatermers (8cck) PCR product.
Fig. 3 is for carrying out the electrophoresis evaluation figure of double digestion respectively to recombinant plasmid pRSETA-1CCK, pRSETA-2CCK, pRSETA-4CCK, pRSETA-6CCK and pRSETA-8CCK with restriction enzyme BamH I and HindIII.M is dna molecular amount standard DL2000; 1 swimming lane is a pRSETA-1CCK plasmid enzyme restriction product, and external source segment size is about 120bp; 2 swimming lanes are pRSETA-2CCK plasmid enzyme restriction product, and external source segment size is about 230bp; 3 swimming lanes are pRSETA-4CCK plasmid enzyme restriction product, and external source segment size is about 450bp; 4 swimming lanes are pRSETA-6CCK plasmid enzyme restriction product, and external source segment size is about 700bp; 5 swimming lanes are pRSETA-8CCK plasmid enzyme restriction product, and external source segment size is about 1100bp.
Fig. 4 is the structure synoptic diagram of reorganization integrated plasmid pR-CCK.1CCK represents the cck-33 gene, and 4CCK represents cck-33 gene 4 concatermers, and 8CCK represents cck-33 gene 8 concatermers.PR represents integrated plasmid, pR-1CCK has represented to insert the recombination and integration plasmid of cck-33 gene, pR-4CCK has represented to insert the recombination and integration plasmid of cck-33 gene 4 concatermers (4cck), and pR-8CCK has represented to insert the recombination and integration plasmid of cck-33 gene 8 concatermers (8cck).Amp rExpression acillin resistance, Kp rThe expression kalamycin resistance.E, soc, den V are the genes on the T4 phage.EcoR I, BamH I, Nde I, HindIII, Pst I, Pvu I are the restriction endonuclease sites on the plasmid.
Fig. 5 is that cck-33 gene 4 concatermers (4cck) are showed mode chart in recombinant T 4 bacteriophage SOC site.A is reorganization integrated plasmid pR-4CCK; B is defective type T4 phage Φ T4-Z1; C is for carrying the recombinant T 4 bacteriophage T4-4CCK of goal gene 4CCK after recombinating.
Fig. 6 is the PCR qualification result figure of recombinant phage T4-1CCK.Swimming lane 1~3rd contains the PCR product of the recombinant phage of cck gene, swimming lane 4 negative contrasts, and swimming lane M is a molecular weight marker.
Fig. 7 is the PCR qualification result figure of recombinant phage T4-4CCK.Swimming lane 1~9th contains the PCR product of the recombinant phage of 4cck gene, and swimming lane M is a molecular weight marker.
Fig. 8 is the PCR qualification result figure of recombinant phage T4-8CCK.Swimming lane 1 is the PCR product that contains the recombinant phage of 8cck gene, and swimming lane M is a molecular weight marker.
Fig. 9 is wild-type T4 phage and recombinant phage immuno-electron microscope collection of illustrative plates.A is a wild-type T4 phage.B is recombinant phage T4-4CCK.C is the recombinant phage T4-4CCK that reacts with the CCK positive serum.
The SDS-PAGE of Figure 10 recombinant phage and wild type phage (12%) detects figure.M is a protein molecular weight standard; 1 swimming lane is recombinant phage T4-4CCK; 2 swimming lanes are wild-type T4 phage.The arrow indication is the SOC-4CCK fusion rotein.
Embodiment
Embodiment 1. contains the construction of recombinant plasmid of cck-33 gene (1cck)
Base sequence and intestinal bacteria high frequency codon according to chicken cck gene, the synthetic cck-33 gene of design, gene order is: GGTTCTACTGGCCGCTTCTCTGTCCT TGGCAACCGTGTACAGAGCATTGATCCGACGCACCGTATTAATGACCGTGACTACA TGGGCTGGATGGATTTT.
According to the cck-33 gene design Auele Specific Primer P1 of synthetic (5 '-CATGGATCCGGTTCTACTGGCCGCT-3 ')/P2 (5 '-CATGAGCTCCCAAAATCCATCCAGCC-3 '), adopt PCR method, cck-33 gene with synthetic is a template, amplification cck-33 gene fragment.The PCR reaction system (200 μ L) of amplification cck-33 gene fragment is composed as follows: 20 μ L, 10 * PCR buffer, 16 μ L dNTPs, 2 μ L Taq enzymes, 1.5 μ L primer P1,1.5 μ L primer P2, the cck-33 gene template of 0.5 μ L synthetic adds water to cumulative volume at last and reaches 200 μ L.PCR temperature cycle program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 56 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.(contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product is observed specific band with 2% sepharose.
At 37 ℃ of PCR product and plasmid pRSETA that digest the cck-33 gene respectively, then under the effect of T4 ligase enzyme, connect the PCR product and the plasmid pRSETA of the cck-33 gene of digestion with Sac I and BamHI.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, the transformant of cck-33 gene has been inserted in acquisition.With Auele Specific Primer P1/P2 the transformant that contains the cck-33 gene is carried out the PCR screening then.The PCR reaction system (20 μ L) that detects the cck-33 gene fragment is composed as follows: 2 μ L, 10 * buffer, and 1.6 μ L dNTPs, 0.2 μ L Taq enzyme, 0.5 μ L primer P1,0.5 μ L primer P2,1 μ L bacterium liquid to be checked adds water to cumulative volume 20 μ L at last.Pcr amplification carries out on Mastercycler gradient PCR instrument (Eppendorf company), and the temperature cycle program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 56 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.(contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product is observed specific band (Fig. 2) with 2% sepharose.To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, and the extracting plasmid again through digestion with restriction enzyme and sequencing, obtains recombinant plasmid called after pRSETA-1CCK.
Embodiment 2. contains the construction of recombinant plasmid of cck-33 gene 2 concatermers (2cck)
Recombinant plasmid pRSETA-1CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamHI and HindIII, reclaims less fragment; Second group digests with BglII, HindIII and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, acquisition contains the recon of 2cck.With Auele Specific Primer P1/P2 the recon that contains the 2cck gene is carried out the PCR screening then.PCR method is with reference to " embodiment 1 ".To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-2CCK of acquisition.
Embodiment 3. contains the construction of recombinant plasmid of cck-33 gene 4 concatermers (4cck)
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamH I and HindIII, reclaims less fragment; Second group digests with BglII, HindIII and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to contain the recon of 4cck.Use Auele Specific Primer P3 (5 '-GATAAGGATCGATGGGGATCC-3 ')/P4 (5 '-ATGGTACCAGCTGCAGATCT-3 ') that the recon that contains 4cck is carried out the PCR screening then.PCR method is with reference to " embodiment 1 ".Electrophoresis detection PCR product is observed specific band (Fig. 2).To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-4CCK of acquisition.
Embodiment 4. contains the construction of recombinant plasmid of cck-33 gene 6 concatermers (6cck)
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with BamH I and HindIII: reclaim less fragment; Recombinant plasmid pRSETA-4CCK is carried out enzyme with BglII, HindIII and CIAP cut digestion, reclaim bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, acquisition contains the recon of 6cck.With Auele Specific Primer P3/P4 the recon that contains 6cck is carried out the PCR screening then.PCR method is with reference to " embodiment 1 ".To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-6CCK of acquisition.
Embodiment 5. contains the construction of recombinant plasmid of cck-33 gene 8 concatermers (8cck)
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with BamH I and HindIII, reclaim less fragment; Recombinant plasmid pRSETA-6CCK is carried out enzyme with BglII, HindIII and CIAP cut digestion, reclaim bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through Amp rResistance screening, acquisition contains the recon of 8cck.With Auele Specific Primer P3/P4 the recon that contains 8cck is carried out the PCR screening then.PCR method is with reference to " embodiment 1 ".Electrophoresis detection PCR product is observed specific band (Fig. 2).To PCR screening male bacterium, picking list colony inoculation is in the 3mLLA substratum, and 37 ℃, 16-20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-8CCK of acquisition.
Embodiment 6. contains the structure of the integrated plasmid of cck-33 gene 4 concatermers (4cck)
Adopt Auele Specific Primer Pup2 (5 '-ATTGAATTCTGATGACGATAAGGAT-3 ')/Pdn2 (5 '-ATCGAATTCCTACATGGTACCAGCTGC-3 '), with the PCR method 4cck gene that from plasmid pRSETA-4CCK, increases.(100 μ L) is composed as follows for the PCR reaction system: 10 * PCR buffer, 10 μ l, dNTPs 8 μ L, Taq enzyme 1 μ L, Pup2 1 μ L, Pdn2 1 μ L, pRSETA-4CCK 1 μ l, ddH20 78 μ L.Pcr amplification carries out on Mastercycler gradient PCR instrument (Eppendorf company), and program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 64 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.
At 37 ℃ of PCR product and plasmid pR that digest the 4CCK gene respectively, then under the effect of T4 ligase enzyme, connect PCR product and the plasmid pR of the 4cck of digestion with EcoR I.With connecting product transformed into escherichia coli DH5.Through Amp rResistance screening, the recon of 4cck gene has been inserted in acquisition.Use 1 couple of Auele Specific Primer SOC-S (5 '-GAATCATATGGCTAGTCTCGCGG-3 ')/Pdn2 to carry out the PCR screening then.To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, and the extracting plasmid again through digestion with restriction enzyme and sequencing, obtains recombination and integration plasmid pR-4CCK.
Embodiment 7. expresses the acquisition of the recombinant T 4 bacteriophage of CCK-33 peptide 4 concatermers (4CCK)
Carry out homologous recombination with recombination and integration plasmid pR-4CCK and defective T4 phage T4-Z1 (Ren et al, 1996), obtain to express the recombinant T 4 bacteriophage of 4CCK.
Earlier with integrated plasmid pR-4CCK transformed into escherichia coli E 2, the intestinal bacteria of acquisition are E-4CCK.Carry out following operation then:
In the test tube of 500 μ L SC nutrient solutions of packing into, add 1 μ L Amp, add 10 μ L E-4CCK then, be cultured to OD at 37 ℃ 600About 0.5 o'clock, add 50 μ L T4-Z1, continue to be cultured to bacterial debris and occur 35 ℃ of 200r/m joltings, the product of acquisition is unidentified recombinant T 4 bacteriophage;
In the vessel of 1 process sterilization, add to cultivate and surpass 12 hours intestinal bacteria E 2600 μ L do not add N,O-Diacetylmuramidase, will be placed in the microwave oven at the SC of 4 ℃ of storages top layer substratum to dissolve, and treat to get when the agar temperature drops to about 45 ℃ 2mL and pour into intestinal bacteria E is housed 2Vessel in, with mixed solution mixing on the vortex oscillator, be poured on immediately on the pre-configured SC bottom substratum plate.By the time during the agar total condensation, on SC top layer substratum, put the unidentified recombinant T 4 bacteriophage of 10 μ L respectively, after treating that absorption finishes, being placed on 37 ℃ cultivates more than the 16h, if reorganization has taken place in plasmid among the E-4CCK and T4-Z1, successfully the 4cck gene is changed in the T4 phage, then on the plate that does not add N,O-Diacetylmuramidase, can grow plaque;
Plate upper berth SC top layer substratum in sterilization, with the sterilization toothpick plaque that grows is put the plum blossom spot on SC top layer substratum then, be placed on 37 ℃ and cultivate more than the 12h, well-grown plum blossom spot peels it with the blade that disinfects, and is immersed in 6h in the phosphoric acid buffer;
Adopt PCR screening T4 phage transformant.The PCR reaction system that detects the 4cck gene is composed as follows: contain 2.5 μ L, 10 * PCR damping fluid in per 25 μ L reaction systems, 2 μ L dNTPs, 0.3 μ L Taq enzyme, 0.5 μ L Pup2,0.5 μ L Pdn2,1 μ L plum blossom spot soak solution and 18.2 μ L distilled waters.With the reaction mixture mixing, centrifugal after, in the circulation of the enterprising trip temperature of PCR instrument.The temperature cycle program is as follows: 94 ℃ of 3min at first; 94 ℃ of 40sec, 51 ℃ of 40sec, 72 ℃ of 90sec circulate 30 times altogether then; Last 72 ℃ of 10min.Adopt 1% sepharose (containing 0.5 μ g/mL ethidium bromide) electrophoresis that the PCR reaction product is detected.If observe specific band, then explanation has obtained the proteic recombinant T 4 bacteriophage of expression 4CCK, called after T4-4CCK.
The SC nutrient solution is prepared by following method: contain 10g Tryptone and 5g NaCl among every 1000mL, add distilled water and be settled to 1000mL, 15lpf/in 2Autoclaving 20min is cooled to 50 ℃, adds the 50mL 1mol/L Tris-Cl and the 10mL 25% Trisodium Citrate 2H of sterilization 2O solution is paved plate after shaking up, 4 ℃ of preservations.
SC bottom substratum is prepared by following method: contain 10g Tryptone among every 1000mL, and 5g NaCl and 12g agar powder, distilled water is settled to 1000mL, 15 lpf/in 2Autoclaving 20min is cooled to 50 ℃, adds the 50mL 1mol/L Tris-Cl and the 10mL25% Trisodium Citrate 2H of sterilization 2O solution is paved plate after shaking up, 4 ℃ of preservations.
SC top layer substratum is prepared by following method: contain 10g Tryptone among every 1000mL, and 5g NaCl and 7g agar powder, distilled water is settled to 1000mL, 15lpf/in 2Autoclaving 20min, 4 ℃ of preservations.The time spent heating for dissolving is cooled to 50 ℃, adds the 50mL 1mol/L Tris-Cl and the 10mL 25% Trisodium Citrate .2H of sterilization 2O solution, it is standby to shake up the back.
The immune electron microscopy of embodiment 8. recombinant T 4 bacteriophages
Get wild-type T4 phage, recombinant T 4 bacteriophage and 1/3 volume CCK positive serum respectively and mix, place after 1 hour direct smear for 37 ℃.Compare with the above-mentioned phage that does not add positive serum simultaneously.The phospho-wolframic acid negative staining, JEM-1010 type transmission electron microscope observing.The morphology of phages before and after relatively reacting with the CCK antiserum(antisera), the form of discovery wild-type T4 phage is not subjected to the influence of CCK positive serum; And the form of recombinant T 4 bacteriophage is influenced obviously by the CCK positive serum.The form with the recombinant T 4 bacteriophage of CCK positive serum reaction is not identical with the wild-type T4 morphology of phages, and head is white; And with the positive serum effect after the blackening of recombinant T 4 bacteriophage head.
The SDS-PAGE of embodiment 9. recombinant T 4 bacteriophages detects
A large amount of recombinant phage T4-4CCK that cultivate, centrifugal concentrating is when phage concentration reaches 10 11Individual/as during mL, to carry out SDS-PAGE and detect.The SDS-PAGE method is as follows: get each 100 μ L of recombinant phage T4-4CCK and T4 phage SOC disappearance strain T4-Z1, add 2 * sample-loading buffer, 100 μ L then, behind the mixing, sample is distinguished freeze thawing three times in-80 ℃ of refrigerators and 37 ℃ of baking ovens." protein handbook method prepares SDS-polyacrylamide gel (SDS-PAGE) with reference to volume such as Wang Jiazheng (2000).Spacer gel concentration is 5%, and resolving gel concentration is 12%.Sample to be checked is boiled 5min, get 30 μ L and add in the gel point sample hole, under electric field action, carry out electrophoresis.Electrophoretic buffer is the Tris-glycine.Voltage is 80v/cm, and voltage is elevated to 160v/cm when treating tetrabromophenol sulfonphthalein arrival spacer gel bottom.When treating tetrabromophenol sulfonphthalein, stop electrophoresis, take off gel, place the dyeing of 1% Xylene Brilliant Cyanine G solution to spend the night, decolour with destainer near the gel bottom.At the visible specific band in about 30kD place (Figure 10).
Embodiment 10. recombinant phages are to the immune effect of fryer
Recombinant phage T4-4CCK is made oil emulsion vaccine carry out the fryer immunization experiment, the content of T4-CCK is 10 in the vaccine 10Individual/mL.To be divided into 2 groups at random behind 360 beard feeding of broiler to 20 ages in days, every group of three repetitions, each repeats 60 chickens, and 1 group is control group, and 2 groups is the recombinant phage immune group.The immunity of 20 ages in days later on every immunity in 20 days once, is total to immunity 3 times for the first time.Feeding of broiler to 90 age in days finishes.When experiment finishes, weigh and add up feed consumption rate, calculate the average weight gain of full phase, average food consumption and feedstuff-meat ratio.The result shows the body weight gains of recombinant phage immune group and food consumption apparently higher than control group, and feedstuff-meat ratio also descends to some extent.
Table 1 recombinant phage T4-4CCK immunity is to the growth of meat chicken Effect on Performance
Group Body weight gains (g/ only) Food consumption (g/ only) Feedstuff-meat ratio
The control group immune group 808.64±12.80 847.96±24.20 3031.62±71.34 3087.38±95.82 3.75±0.03 3.64±0.01
When 35,55 and 90 day age, took a blood sample respectively, measure CCK antibody in the serum.
On 96 hole enzyme plates, every hole adds the 4CCK fusion rotein 100 μ L of the 0.2mg/mL escherichia coli expression of purifying, and 4 ℃ of bags are spent the night.Discard coating buffer, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds 5% skim-milk, 100 μ L confining liquids, 37 ℃ of sealing 2h.Discard confining liquid, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, pats dry cleaning buffer solution on gauze, and every hole adds the most anti-100 μ L of suitable weaker concn, 37 ℃ of reaction 1h.Discard one and resist, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds two anti-(the goat anti-rabbit igg antibody of horseradish peroxidase-labeled) 100 μ L with dilution in 1: 1000,37 ℃ of reaction 1h.Discard two and resist, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds colour developing damping fluid 100 μ L, and (about 10~30min) add 1mo l/L H when reaching the colour developing peak 2SO 4100 μ L termination reactions read OD on microplate reader 450Value.Represent antibody horizontal with P/N.The result that the blank group detects for 3 times is P/N<2, and three times results change amplitude is very little.And immune group detects P/N for 3 times all above 2, and the back two times result is higher than (table 2) for the first time.
The ELISA of CCK antibody detection (P/N) in the chicken serum after the table 2 recombinant phage T4-4CCK immunity
Group Age in days (my god)
35 55 90
The control group immune group 1.350±0.016 2.548±0.210 1.566±0.045 3.183±0.221 1.568±0.045 5.440±0.553
Sequence table
<110〉Agricultural University Of South China
<120〉recombinant T 4 bacteriophage of expression cholecystokinin gene
<140>
<141>
<160>2
<210>1
<211>99
<212>DNA
<213〉cholecystokinin-33 (Choleystokinin-33, CCK-33)
<220>
<221>cDNA
<222>(1)...(99)
<220>
<221>CDS
<222>
<400>1
ggt tct act ggc cgc ttc tct gtc ctt ggc aac cgt gta cag agc att 48
Gly Ser Thr Gly Arg Phe Ser Val Leu Gly Asn Arg Val Gln Ser Ile
1 5 10 15
gat ccg acg cac cgt att aat gac cgt gac tac atg ggc tgg atg gat 96
Asp Pro Thr His Arg Ile Asn Asp Arg Asp Tyr Met Gly Trp Met Asp
20 25 30
ttt 99
Phe
33
<210>2
<211>33
<212>PRT
<213〉cholecystokinin-33 (Choleystokinin-33, CCK-33)
<400>2
Gly Ser Thr Gly Arg Phe Ser Val Leu Gly Asn Arg Val Gln Ser Ile
1 5 10 15
Asp Pro Thr His Arg Ile Asn Asp Arg Asp Tyr Met Gly Trp Met Asp
20 25 30
Phe
33

Claims (8)

1. recombinant T 4 bacteriophage of expressing cholecystokinin gene, it contains the cholecystokinin encoding gene, and wherein encoding gene is the Nucleotide concatermer sequence of nucleotide sequence or the SEQ ID No.1 of SEQ ID No.1.
2. recombinant T 4 bacteriophage according to claim 1 is characterized in that encoding gene is selected from the Nucleotide excessive concatemer sequence of SEQ ID No.1.
3. recombinant T 4 bacteriophage according to claim 1 and 2 is characterized in that nucleotide sequence SEQ ID No.1 encoding amino acid sequence is the polypeptide of SEQ ID No.2.
4. method that makes up recombinant T 4 bacteriophage comprises step:
1). clone nucleotide sequence SEQ ID No.1, or, obtain the Nucleotide excessive concatemer sequence of SEQ ID No.1 according to BamH I and the BglII characteristic of isocaudarner each other;
2). the Nucleotide excessive concatemer sequence of nucleotide sequence SEQ ID No.1 or SEQ ID No.1 is inserted the corresponding recombination and integration plasmid of structure in the pR plasmid;
3). with 2) in the recombination and integration plasmid and the defective T4 phage T4-Z1 that obtain carry out homologous recombination, obtain the recombinant T 4 bacteriophage of expression CCK-33 peptide.
5. one kind is improved the also method of weightening finish of animal feed intake, and its vaccine that will comprise any one described recombinant T 4 bacteriophage of claim 1-3 is used for described animal.
6. according to the method for claim 5, it is characterized in that described animal is pig, ox, rabbit or chicken, duck, goose.
7. method for preparing the specific antibody of anti-CCK, comprise cooperating with adjuvant and make the vaccine immunity laying hen, and the egg of collecting immune chicken obtains the specific antibody of anti-CCK with any one described recombinant T 4 bacteriophage direct immunization of claim 1-3 or with it.
8. the application in the antigen of any one described recombinant T 4 bacteriophage CCK specific antibody in preparation detection animal serum among the claim 1-3.
CNB2005100115824A 2005-07-15 2005-07-15 Recombined T4 bacteriophage of expressing cholecystokinin gene Expired - Fee Related CN1300307C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2005100115824A CN1300307C (en) 2005-07-15 2005-07-15 Recombined T4 bacteriophage of expressing cholecystokinin gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2005100115824A CN1300307C (en) 2005-07-15 2005-07-15 Recombined T4 bacteriophage of expressing cholecystokinin gene

Publications (2)

Publication Number Publication Date
CN1687407A CN1687407A (en) 2005-10-26
CN1300307C true CN1300307C (en) 2007-02-14

Family

ID=35305449

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2005100115824A Expired - Fee Related CN1300307C (en) 2005-07-15 2005-07-15 Recombined T4 bacteriophage of expressing cholecystokinin gene

Country Status (1)

Country Link
CN (1) CN1300307C (en)

Also Published As

Publication number Publication date
CN1687407A (en) 2005-10-26

Similar Documents

Publication Publication Date Title
CN1185343C (en) New growth-differentiation factor of the TGF-beta family
CN102282165A (en) Splice variants of GDNF and uses thereof
WO2009051290A1 (en) Surface expression vector for fusion protein of myo-2 peptide multimer and myostatin, and microorganism transformed by thereof
CN108329394A (en) A kind of short beak runting syndrome vaccine of duck and preparation method thereof
CN1038559C (en) Vaccine against E. coli septicaemia in poultry
CN1300307C (en) Recombined T4 bacteriophage of expressing cholecystokinin gene
CN117431200A (en) Recombinant bacillus subtilis for displaying Newcastle disease virus HN protein on spore surface, construction method and application
CN1206351C (en) Preparing process and application of lysozyme protein
CN1277925C (en) Recombinant Baculovirus for expressing CTB and human insulin fusion protein and use thereof
CN1803846A (en) Hybrid protein of p53 protein epitope(SQAMDDLMLS) and filobactivirus gene 8 protein and application thereof
CN111454336B (en) Modified duck circovirus Cap protein, and preparation method and application thereof
CN1053642A (en) Infectious bronchitis virus vaccine
CN1687412A (en) Cascade expression of active fragment of cholecystokinin and application thereof
CN1191271C (en) Thymic peptide fusion protein as one new interferon and its prepn. and use
CN1974767A (en) Pig&#39;s epidermal growth factor gene and its application
CN107118275B (en) Fish IL-1 β -resistant egg yolk antibody and preparation method thereof
CN101481691B (en) Trichinella spiralis 70KDa heat shock protein and use thereof
CN1544630A (en) Method for preparing recombinant duck interleukin-2 protein and its application
CN1800376A (en) Recombinant T4 phage for displaying influenza virus non-structural protein NS1 and its uses
CN1309824C (en) Antibiotic peptide gene converted viscons bacillus engineering bacterium and its preparing method and use
CN1232532C (en) Fibroblast growth factor-2 analogue, producing process and application thereof
CN1116414C (en) Animal&#39;s castration vaccine gene and gene engineering body
CN1200101C (en) Universal farm animal castration vaccine gene and recombinant gene vector
CN1200102C (en) Livestock castration vaccine gene and recombinant gene vector
CN1200103C (en) Fowl castration vaccine gene and recombinant gene vector

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20070214

Termination date: 20110715