CN1962865A - Human SFRP1 gene, its coded protein and application - Google Patents
Human SFRP1 gene, its coded protein and application Download PDFInfo
- Publication number
- CN1962865A CN1962865A CNA2005101101176A CN200510110117A CN1962865A CN 1962865 A CN1962865 A CN 1962865A CN A2005101101176 A CNA2005101101176 A CN A2005101101176A CN 200510110117 A CN200510110117 A CN 200510110117A CN 1962865 A CN1962865 A CN 1962865A
- Authority
- CN
- China
- Prior art keywords
- protein
- sequence
- seq
- gene
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a human SFRP1 gene sequence and coding protein and application in the drug to inhibit tumour from growing, which is characterized by the following: treating or lessening the loss, non-functional or abnormal disease of human SFRP1 protein; making human SFRP2 gene express in the cancer cell through gene-transmitting technology or supplementing human SFRP1 protein in vitro; controlling cancer from breeding and killing cancer cell.
Description
Technical field
The present invention relates to a kind of new people's gene and albumen, relate in particular to nucleotide sequence, its proteins encoded of a kind of human SFRP 1 gene; In addition, the invention still further relates to the application of this gene coded protein.
Background technology
SFRP, secretor type Frz associated protein (secreted frizzled-related proteins), contain a structural domain (cysteine rich domain who is rich in halfcystine, CRD), but lack membrane-spanning domain seven times, it may (frizzled Frz) competes in conjunction with Wnt albumen, thereby suppresses the proteic overexpression of Wnt with FZ.Wnt is a class secretor type glycoprotein, the human normal cell has been bred adjusted promoter action.Experiment in the recent period finds, the gene SFRP that suppresses this protein effect takes place when unusual, and the proteinic function of Wnt can occur making cancer cells constantly breed unusually thereupon, cause taking place large bowel cancer.After normal SFRP gene is injected cancer cells, will control cancer cell propagation and kill cancer cell.
The Wnt signal pathway can cause (the β-catenin) accumulation of β-linkage protein in the born of the same parents.β-catenin is a kind of multi-functional protein, and it and cadherins interact in the cell junction, participate in forming self adhesive tape, and free β-catenin can enter nucleus, and regulatory gene is expressed.In animal development, the Wnt signal plays an important role, and its unconventionality expression or intensity of activation cause tumour.
Frz is the acceptor of Wnt, is 7 transmembrane proteins, and similar is in the G protein-conjugated receptor, and the outer N end of Frz born of the same parents has the CRD structural domain, can combine with Wnt.Frz acts on intracytoplasmic disheveled protein (Dishevelled, Dsh or Dvl), Dsh can cut off the degradation pathway of β-catenin, thereby β-catenin is accumulated in tenuigenin, and enter nucleus, with T cytokine (T cell factor/lymphoid enhancer factor, TCF/LEF) interact, regulate target gene expression, TCF/LEF is the transcription factor that a class has the two-ways regulation function, it combines suppressor gene with Groucho and transcribes, and combines with β-catenin then to promote genetic transcription.
Studies show that 90% PATIENTS WITH LARGE BOWEL is relevant with the SFRP gene unconventionality.
Before the present invention, the open report that human SFRP 1 albumen of the present invention suppresses the tumour purposes does not also appear relating to.
Summary of the invention
One of the technical problem to be solved in the present invention provides a kind of new human SFRP 1 gene.
Two of the technical problem to be solved in the present invention provides a kind of new human SFRP 1 albumen.
Three of the technical problem to be solved in the present invention provides a kind of pharmaceutical composition that suppresses growth of tumour cell.
Four of the technical problem to be solved in the present invention provides the application of human SFRP 1 albumen of the present invention in making the medicine that respectively suppresses tumor growth.
In order to solve the problems of the technologies described above, the present invention is achieved through the following technical solutions:
In one aspect of the invention, provide a kind of human SFRP 1 gene, it comprises one of following nucleotide sequences:
(1) dna sequence dna of SEQ ID NO.5 in the sequence table;
(2) polynucleotide of SEQ ID NO.6 protein sequence in the code sequence tabulation;
(3) with sequence table in the dna sequence dna of SEQ ID NO.5 have 70% above homology, and the identical function protein DNA sequence of encoding.
Preferably, described nucleotide sequence has the dna sequence dna of SEQ ID NO.5.More preferably, described sequence has among the SEQ ID NO.5 nucleotide sequence from Nucleotide 303-1247 position.
In another aspect of this invention, provide a kind of human SFRP 1 protein, it comprises: have the protein of SEQ ID NO.6 aminoacid sequence, or its conservative property variant protein matter or its active fragments, or its reactive derivative.
Preferably, this protein is selected from down a kind of of group:
(a) has the protein of SEQ ID NO.6 aminoacid sequence;
(b) SEQ ID NO.6 aminoacid sequence is passed through replacement, disappearance or the interpolation of one or several amino-acid residue and has identical with SEQ ID NO.6 aminoacid sequence active by (a) deutero-protein.
More preferably, described protein is the protein with SEQ ID NO.6 aminoacid sequence.
In another aspect of this invention, also provide a kind of carrier, it comprises above-mentioned human SFRP 1 gene.
In another aspect of this invention, also provide a kind of genetically engineered host cell that contains above-mentioned carrier.
In another aspect of this invention, also provide a kind of pharmaceutical composition that suppresses growth of tumour cell, said composition contains the described human SFRP 1 protein and the pharmaceutically acceptable carrier of safe and effective amount.
The present invention also provides the application of a kind of human SFRP 1 protein in the medicine of preparation inhibition tumor growth.
In the present invention, refer to encode has the nucleotide sequence of human SFRP 1 protein-active to term " coding SFRP1 protein sequence ", as 303-1247 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.5.This degenerate sequence is meant, is arranged in the encoder block 303-1247 position Nucleotide of SEQ ID NO.5 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.5 in 303-1247 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.6 of also encoding out.This term also comprise with SEQ ID NO.5 in from the homology of nucleotide sequence at least 70% of Nucleotide 303-1247 position, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.
This term also comprises encoding to have the variant form of open reading frame sequence among proteic, the SEQ ID NO.5 with the SFRP1 identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, term " SFRP1 albumen " refers to have the protein of the SEQ ID NO.6 sequence of SFRP1 protein-active.This term also comprises having and variant form SFRP1 protein identical function, SEQ ID NO.6 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of SFRP1 and reactive derivative.
The proteinic variant form of human SFRP 1 of the present invention comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low stringent condition can with coded albumen of the DNA of the DNA hybridization of SFRP1 and polypeptide or the albumen that utilizes the proteinic antiserum(antisera) of anti-SFRP1 to obtain.The present invention also provides other protein, as comprises SFRP1 protein or its segmental fusion rotein.Except whole length protein almost, the present invention also comprises the proteinic soluble fragments of SFRP1.Usually, this fragment have the SFRP1 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
In the present invention, " SFRP1 conservative property variant protein matter " refers to compare with the aminoacid sequence of SEQ ID NO.7, has 10 at the most, and preferably at the most 8, more preferably 5 amino acid is replaced by similar performance or close amino acid and formed protein at the most.The present invention also comprises the analogue of SFRP1 albumen or polypeptide.These analogues and the proteinic difference of natural SFRP1 can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps have both at the same time.These protein comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that protein of the present invention is not limited to the above-mentioned representational protein that exemplifies.
(the not changing primary structure usually) form of modification comprises: interior or external proteinic chemically derived form such as the acetylize or carboxylated of body.Modify and also to comprise glycosylation, as those in proteinic synthetic and processing or further carry out glycosylation modified and protein that produce in the procedure of processing.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the protein that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid, clay, phage, virus etc.When producing SFRP1 protein of the present invention, human SFRP 1 gene sequence of the present invention operationally can be connected in expression regulation sequence, form the SFRP1 protein expression vector.
In the present invention, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in proteinic secretion, signal peptide (secretion leader sequence) DNA operationally is connected in protein dna so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.
In the present invention, described pharmaceutical composition contains the human SFRP 1 protein and the pharmaceutically acceptable carrier of safe and effective amount, and this class carrier comprises (but being not limited to): thinner, vehicle such as water etc., weighting agent such as starch, sucrose etc.; Tackiness agent such as derivatived cellulose, alginate, gelatin and polyvinylpyrrolidone; Wetting agent such as glycerine; Disintegrating agent such as agar, lime carbonate and sodium bicarbonate; Absorption enhancer such as quaternary ammonium compound; Tensio-active agent such as cetyl alcohol; Absorption carrier such as kaolin and soap clay; Lubricant such as talcum powder, calcium stearate and magnesium, polyoxyethylene glycol etc.The method of application of pharmaceutical composition of the present invention can be oral, systemic administration (for example, see through skin, snuffing is gone into or use suppository) or parenteral administration (for example, intramuscular, intravenously or subcutaneous).Preferred method of application is oral, and it can be regulated according to disease degree.
Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 0.01 microgram/kg body weight-about 5 mg/kg body weight.In addition, human SFRP 1 protein of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that SFRP1 albumen or its agonist with safe and effective amount is applied to Mammals, wherein this safe and effective amount is usually at least about 0.01 microgram/kg body weight, and in most of the cases be no more than about 10 mg/kg body weight, preferably this dosage is about 0.01 microgram/kg body weight-about 100 micrograms/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Human SFRP 1 gene of the present invention also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because the proteic nothing of SFRP1 is expressed, the indeterminate growth of the cell due to the proteic expression of SFRP1 of unusual or non-activity.The gene therapy vector (as virus vector) of reorganization can be designed to overexpression human SFRP 1 albumen of the present invention, to replenish proteic disappearance of endogenic human SFRP 1 or deficiency.The human SFRP 1 gene of recombinating in addition can be packaged in the liposome, and then transfection is to cell.Human SFRP 1 gene of the present invention imports tissue or intracellular method comprises: directly be injected into the human SFRP 1 gene sequence in the in-vivo tissue, or external by carrier (as virus, phage or plasmid etc.) earlier with the gene order transfered cell in, again cell is transplanted in the body etc.Also can be by external additional human SFRP 1 protein factor of the present invention, to alleviate the illness that causes unusually because of human SFRP 1 is proteic, described human SFRP 1 protein factor can be produced by genetic engineering technique, and obtains by further separation, purification.
Human SFRP 1 albumen of the present invention can be applied to patient, with treatment or alleviate because of human SFRP 1 disappearance, no function or unusual cause related disorders arranged, also can inject cancer cells to normal human SFRP 1 gene of the present invention, with control cancer cell propagation and kill cancer cell by transgenic technology.
Description of drawings
Fig. 1 is the expression figure of human SFRP 1 gene of the present invention in human body normal hepatocytes and tire hepatic tissue;
Fig. 2 is the differential expression figure of human SFRP 1 gene of the present invention in people's liver cancer tissue and cancer beside organism;
Fig. 3 is that human SFRP 1 gene overexpression of the present invention suppresses the liver cancer cell growth graphic representation.
Embodiment
The present invention is further detailed explanation below in conjunction with drawings and Examples.
Following examples only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions among the embodiment, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
With demethylation medicine DAC (final concentration is 2000nM), handle 15 strain hepatoma cell strains after, the difference of gene expression dose finds that in 8 strain cell strains, SFRP1 genetic expression is raised before and after using gene chip to detect to handle.Wherein, gene chip experiment mainly comprises following four steps: chip preparation, specimen preparation, hybridization and signal detection and interpretation of result.
1. the present preparation of chip preparation chip is a carrier with sheet glass or silicon chip mainly.By the point sample method target gene is arranged on the carrier in order as probe, target gene can be divided into genomic dna, cDNA (or artificial-synthetic DNA).
2. the extraction steps of total RNA is as follows in the specimen preparation testing sample: take 15 strain hepatoma cell strains of demethylation medicine DAC processing and the hepatoma cell strain that 15 strains are handled without demethylation respectively, use TRIZol method extracted total RNA again.During extracting, per 5 * 10
6Cell adds 1ml TRIzol, mixing on the vortex oscillator; For tissue sample, every 100mg tissue can add 1ml TRIzol, fully smashes tissue block with liquid nitrogen grinding or employing electric homogenizer.The chloroform that adds about 1/5 volume again turned upside down abundant mixing about 1 minute, left standstill under the room temperature 5 minutes.Then, 4 ℃, 12000rpm carefully changes supernatant liquor over to new 1.5ml centrifuge tube after centrifugal 15 minutes, adds isopyknic Virahol, puts upside down mixing gently, and room temperature left standstill 5 minutes.4 ℃ again, 12000rpm removes supernatant after centrifugal 10 minutes, adds 70% ethanol of 2/5 volume in precipitation, and 4 ℃, 12000rpm centrifuge washing precipitation 15 minutes.Remove supernatant, the precipitation room temperature is dried the abundant dissolution precipitation of water that the back adds an amount of no RNA enzyme, measures A260 and A280 value.
The total RNA that extracts can be further used for the preparation of sample cDNA probe, and its process is as follows:
1) preparation of fluorescent probe (the cDNA first chain mark): from-70 ℃ of refrigerators, take out RNA, at room temperature thaw, in 0.2ml PCR pipe, prepare reaction soln then, if use the Cy3/Cy5 fluorescence labeling probe, then the reaction soln system of preparing in the PCR pipe is, total RNA 5～50 μ g, fluorescently-labeled primer 1 μ g, it is 10 μ l that the water X μ l that adds nuclease free again makes total reaction volume, if use biotinylated probe, then the reaction soln system of preparing in the PCR pipe is total RNA 5～50 μ g, biotin labeled primer 1 μ g, the water X μ l that adds nuclease free again forms the total reaction volume of 10 μ l, wherein, all fluorescently-labeled primers all adopt eight aggressiveness primers at random; Again 70 ℃ of pre-sex change 10 minutes, reaction of degeneration finishes back preparation cDNA first chain reaction system in the PCR pipe, the 5 x first-strand buffer (first chain synthesizes damping fluid) that in this system, add 4ul respectively, the 0.1MDTT of 2ul, 5mM Unlabeled dNTP mix (the unlabelled dNTP mixed solution of lul, then be changed to the 10mM dNTP mix that adds 1 μ l with biotin labeled situation for primer), the 1mM Cy3/Cy5dCTP of 1 μ l, the SuperScript II RNaseH reverse transcriptase (reversed transcriptive enzyme of the RNA inhibitor of 1 μ l and 1ul, 200U/ μ l), thus form the cumulative volume of 20 μ l; Then, 42 ℃ of insulations 2 hours, 70 ℃ of sex change 5 minutes.The NaOH hydrolysis RNA termination reaction that adds 2 μ l 2.5N in the PCR pipe, 37 ℃ are incubated 15 minutes, add 10 μ l, 2 N HEPES neutralization.
2) purifying of fluorescent probe: can use QIAquick Nucleotide Removal Kit and carry out purifying, at first, the probe that mark is good is transferred in the 1.5ml centrifuge tube, the PN damping fluid that adds about 10 times of volumes, mixing is gone into the QIAquick column sleeve in the 2ml centrifuge tube, and shifts probe to the QIAquick post, centrifugal 1 minute of 6000rpm discards filtered solution; The PE damping fluid that in post, adds 700～750 μ l again, centrifugal 1 minute of 6000rpm discards filtered solution; Centrifugal 1 minute again in 13000rpm, and the QIAquick pillar changed on the new 1.5mlEppendorf pipe, then, Xiang Zhuzhong adds the EB damping fluid of 100～150 μ l, centrifugal 1 minute of 13000rpm.
3) fluorescent probe is quantitative: will descend clear liquid to be transferred in the enzyme plate, and measure A260, A550, A650 respectively; Undertaken quantitatively by the calculation formula of Cy3-probe (pmol)=A550 * elution volume/0.15 and Cy5-probe (pmol)=A650 * elution volume/0.25 again; Probe quantitatively sucks back to the 1.5ml centrifuge tube, and heating is drained, and is stored in-20 ℃, waits to hybridize.
3. chip hybridization
1) preparation work: (1) washboard slide, cover glass is put into ddH20,95% ethanol, ddH20 successively, each 3min puts into exsiccant 50ml centrifuge tube 1000rpm at last, and centrifugal 3min removes residual water stainly, places stand-by; (2) preparation 10%PBS solution; (3) the balance hybrid heater is calibrated hybrid heater with water level gauge, the maintenance level; (4) be formulated as follows the liquid of developing a film: 20 * SSC solution, 10%SDS solution, washing lotion I (2 * SSC/0.5%SDS), washing lotion II (1 * SSC/0.1%SDS), the solution III (0.1 * SSC) of developing a film.
2) preparation of prehybridization prehybridization solution is in the cumulative volume of 30 μ l 20 * SSPE damping fluid of 9 μ l, 50 * Denhandts damping fluid and the 18 μ l ddH20 of 3 μ l to be arranged, from loft drier, take out chip again, an amount of prehybridization solution is dripped on chip, covered, then chip is put into the hybridizing box that is added with PBS, placed 42 ℃ of hybridization case prehybridizations about 1 hour.Prehybridization takes out chip after finishing and embathes a moment with ddH20, and it is centrifugal to treat after cover glass comes off chip to be put into the exsiccant centrifuge tube, removes residual water stainly, places stand-by.
3) probe through quantitative Cy3 and Cy5 mark is taken out in hybridization, each fully dissolves with 9～15 μ l ddH20 and is mixed in the 1.5ml centrifuge tube, preparing hybrid liquid then, the hybridization solution of Cy3/Cy5 fluorescence labeling probe is by 20 * SSPE damping fluid, 50 * Denhandts damping fluid is formed with the ddH20 that is dissolved with probe, and the hybridization solution of biotinylated probe is by 20 * SSPE damping fluid, 50 * Denhandts damping fluid, SA-Cy3/SA-Cy5 and the ddH20 that is dissolved with probe form, then, getting hybridization solution drips on chip, and covered, guarantee that simultaneously cover glass covers effective point sample zone of the chip that contains hybridization solution.At last, this hybridization hybrid chip is put into the hybridizing box that is added with PBS, place 42 ℃ of hybridization casees to hybridize 12～20 hours.
4. after washing, scanning and the reaction of data analysis chip hybridization finish, need carry out the chip washing.Earlier washing lotion I and washing lotion II are placed 42 ℃ of water-bath preheatings, take out slice, thin piece with tweezers again, immerse among the washing lotion I through 42 ℃ of preheatings, after cover glass breaks away from from chip, in 42 ℃ of washing lotion I, wash 8～20min again.Then slice, thin piece is being changed among the washing lotion II that immerses through 42 ℃ of preheatings, washing 8～12min behind the taking-up slice, thin piece, immerses slice, thin piece among the washing lotion III from washing lotion II again, washing 3～8min.At last slice, thin piece is washed 1～2min in ddH20, it is centrifugal to change clean centrifuge tube over to, to remove residual water droplet, through above-mentioned washing, chip can be put into chip cartridges, analysis to be scanned.
Scan such as the laser confocal scanning instrument by specific scanner, after the scanning image is converted into numerary signal, carry out data analysis and processing subsequently based on fluorescence intensity.The gained composite diagram must be divided into monochromatic fluoroscopic image through software, again image is imported image analysis software Imagene, through locating automatically and manually and arranging, determine the scope of hybridization point, filter background noise, extraction obtains the fluorescence signal intensity value of genetic expression, with tabular form output, is numerical value thereby finish the image Quantitative yield that scanning is obtained at last.The data of output need comprise parameters such as strength of signal, background, signal to noise ratio usually.
Because the imbalance of differences between samples, fluorescent label efficiency and recall rate needs that the original extraction signal is carried out equilibrium and could further analyze experimental data with revising, Normalization just is being based on this kind purpose.Data importing analysis software Genespring, with Background subtraction based on negativecontrols and perspot and per chip Intensity dependentnormalization (non-linear or LOWESSnormalization) methodological standardization, calculate ratio value (ratio of two kinds of fluorescence Cy3 and Cy5).It is generally acknowledged that there is not significant differential expression in the gene of ratio value in the 0.5-2.0 scope, gene outside this scope then is considered to express and occurs significantly changing, this domain value range can be adjusted to some extent according to concrete experiment condition, again by using genespring and cluster analysis software to carry out cluster analysis, set up various mathematical model, can obtain various statistic analysis result, determine the dependency of different genes on expressing, thereby find the unknown function of the function information or the known of unknown gene.Gene tree, experiment tree, K-means, SOM, methods such as PCA all can realize and displaying by Genespring.Can be by cluster software analysis result by treeview software with graphic presentation.
The RT-PCR experiment detects the expression of SFRP1 gene in liver organization.
1. separate tissue (Tissue isolation) experiment is with the tissue-derived and operation patients (RT-PCR confirm AFP in liver cancer all positive and cancer by negative) of expressing the primary hepatocarcinoma of alpha-fetoprotein positive in 72 routine HBV.The liver of excision cuts focus rapidly and reaches 5 centimeters outer cancer beside organisms on every side once exsomatizing, and puts into liquid nitrogen (80 ℃) and preserves.The other diagnosis of cancer and cancer is final foundation with pathological diagnosis all.In addition, also get 2 routine normal hepatocytes and tire hepatic tissue respectively and do same treatment, promptly put into liquid nitrogen (80 ℃) and preserve.
2. the extraction agent box extracting RNA reagent of total RNA adopts TRIzol reagent (GIBCO/BRL), and this reagent is based on that one step of acidic phenol extraction process produces.Being used for used vessel of extracting RNA and water all will not have the processing of RNA enzyme, to guarantee the environment of no RNA enzyme in the experiment.
3.RNA extraction steps will grind vessel such as pestle and homogenizer and do roasting 4h at 200 ℃, remove the RNA enzyme, cooling; Add precooling in the liquid nitrogen, will organize from liquid nitrogen and take out rapidly, be crushed into powder; With curet tissue is put into the homogenizer that adds TRIzol reagent in advance, homogenate number minute; Liquid after the homogenate is changed in the centrifuge tube of no RNA enzyme, behind the adding chloroform, 4 ℃ of centrifugal layerings; The upper strata water is changed in the centrifuge tube of a no RNA enzyme, behind the adding chloroform, 4 ℃ of centrifugal layerings; The upper strata water is changed in the centrifuge tube of a no RNA enzyme, add Virahol, 4 ℃ of centrifugation RNA; Precipitate 2 times with 75% washing with alcohol; Deionized water dissolving precipitation with no RNA enzyme.Extractive RNA quality evalution: ultraviolet spectrophotometer is measured 260/280 ratio (ratio is all 1.7～2.0); And observation has or not degraded in MOPS denaturing formaldehyde glue.
4.cDNA syntheticly get total RNA2 μ g, OligodT16 1 μ L, 70 ℃ of insulation 3min, sex change 5min on ice immediately.Add 5 * buffer, the reversed transcriptive enzyme of each 2 μ L of the dNTP of DTT and 50mg/L and 1 μ L, behind the abundant mixing, 42 ℃ of 2h.Template uses final concentration to be generally 1 μ g/100 μ L.
5.RT-PCR amplification
Beta-actin (F): the forward direction primer is 5 '-TCACCCACACTGTGCCCA TCTACGA-3 ' (SEQ ID NO:1);
Beta-actin (R): the back is 5 '-CAGCGGAACCGCTCATTGCCAATGG-3 ' (SEQ ID NO:2) to primer.
SFRP1(F)：5’-AAAGCAAGGGCCATTTAGATTAG-3’(SEQ?ID?NO：3)；
SFRP1(R)：5’-TTCTGGGCTTGACCTTAATTGTA-3’(SEQ?ID?NO：4)。
Make internal reference with β-actin, each composition is in the reaction mixture: β-actin (F), β-actin (R), SFRP1 (F), SFRP1 (R), 10 * Buffer, MgCl2, dNTP, Taq archaeal dna polymerase, cDNA template are respectively 0.2,0.2,0.4,0.4,1.0,1.0,0.2,0.1 and 5 μ LcDNA templates, and it is 10 μ L that additional at last ddH20 makes reaction system.The reaction conditions of PCR is 94 ℃ of sex change 5min; 94 ℃ of 30s of each circulation, 53 ℃ of 30s, 72 ℃ of 30s, totally 30 circulations then; Last 72 ℃ are extended 7min.The electrophoresis detection pcr amplification product.
6. experimental result shows, in normal hepatocytes and tire hepatic tissue, it is the specific amplified segment of the SFRP1 of 328bp that length is arranged, the length of confidential reference items β-actin is 300bp (Fig. 1), illustrate that SFRP1 gene of the present invention expresses in human body normal hepatocytes and tire hepatic tissue, among the figure, " NL1 " and " NL2 " represents " normal liver sample 1 " and " normal liver sample 2 " respectively, and " FL1 " and " FL2 " represents " tire liver sample 1 " and " tire liver sample 2 " respectively.In addition, shown by result shown in Figure 2 that in liver cancer tissue, SFRP1 expression of gene level is starkly lower than SFRP1 expression of gene level in the cancer beside organism, wherein, " N " refers to cancer beside organism, and " C " refers to liver cancer tissue.SFRP1 gene of the present invention is a cancer suppressor gene, and in liver cancer tissue, the SFRP1 expression of gene descends to making and originally is subjected to the gene overexpression of its inhibition, thereby causes the malignant proliferation of cell.
Utilize transgenic technology to make the overexpression of SFRP1 gene suppress liver cancer cell growth.
1.PCDNA3.1-SFRP1 the ORF district of plasmid construction pcr amplification SFRP1 is totally 314 amino acid, restriction enzyme site BamHI and EcoRI are introduced in two ends, and enzyme is cut PCDNA3.1 back and with same enzymic digestion and is connected, and chooses mono-clonal behind the transformed into escherichia coli, order-checking.
Used primer sequence is as follows, and the primer of SFRP1 is (do not remove termination codon and do not contain his-myc):
Sfrpl?3.1B(-)：F：5’-CGGGATCCATGGGCATCGGG-3’：
R：5’-CGGAATTCCGTCACTTAAACACGGACT-3’。
With the plasmid transfection cell strain, be western with the antibody of anti-SFRP1 and detect the proteic expression of SFRP1.
2. transfection
Shop cell (35mm) density reached 80% in (1) first day, shook up 37 ℃, the 5%C02 overnight incubation;
(2) transfection, tubel: plasmid pcDNA3.1-LZP 1～2 μ g joins among the 100 μ l DMEM (FCS free), mixing; Tube2: liposome (lipofectamin) 2～5 μ l join among the 100 μ l DMEM (FCS free), mixing; Mixed t ube1,2, room temperature leaves standstill 30min; Attached cell inhales and goes culture supernatant, washes 2 times with serum-free DMEM, each 2ml; Add 1.5ml DMEM (FCS free) in the culture dish, transfection mixture is dropwise splashed into mixing; 37 ℃, 5%C02 cultivates.
Inhale after (3) 5～8 hours and remove the transfection supernatant, wash 2 times with fresh DMEM (10%FCS) and change liquid, each 2ml adds 2ml DMEM (10%FCS) subsequently.
Receive albumen after (4) 48 hours and be Western Blot.
3.Western?Blot
Initiating cell albumen that collection is good and the cell strain albumen while electrophoresis of crossing after expressing are done contrast.
(1) electrophoresis: conventional protein electrophoresis sample separation (selecting the concentration of glue for use according to the albumen size is 12%); NC film deionized water rinsing is transferred to the middle balance of transfering buffering liquid (Transferring buffer) 20 minutes again; Running gel was put among the Transferring buffer balance 20 minutes.
(2) change film: install membrane-transferring device (blot), 18V, 40 minutes by negative pole-2 metafiltration paper washer-running gel-pvdf membrane-2 metafiltration paper washer-positive pole order.
(3) membrane closure is 2 hours.
(4) adding one resists: the antibody in the anti-source of rabbit, extent of dilution is (1:300～500) 2 hours.
(5) adding two resists: the family dependents of military personel in the liberated areas's fluorescence two is anti-, and extent of dilution is (1:2000) 40 minutes.
(6) detect: in cell strains such as L02,7721, YY-8103, MHCC-H, cross and express successfully.
4. cell growth curve
Adopt Cell Counting Kitt-8 test kit
(1) select L02,7721, YY-8103, MHCC-H to wait to express the successful cell strain dysuria with lower abdominal colic of running business into particular one to dye;
(2) second days cell inoculations are in 96 hole culture dish, every hole 5 * 10
2Individual cell (SMMC-7721) or 1 * 10
3Individual cell (L02), each cell strain is got three holes, adds 10 μ l CCK-8, continues to cultivate 1 hour;
(3) read the 450nm absorbance, calculating mean value and standard error continuously measured 5-7 days, are drawn growth curve.
The result as shown in Figure 3, the survival rate of the liver cancer cell of overexpression human SFRP 1 gene of the present invention is starkly lower than the cell of control group, illustrates that the overexpression of human SFRP 1 gene can suppress liver cancer cell growth to a certain extent.
Sequence table
＜110〉Research Center of Shanghai Human Genome
＜120〉human SFRP 1 gene, its proteins encoded and application
<130>NP-10012
<160>6
<210>1
<211>25
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>1
TCACCCACACTGTGCCCA?TCTACGA 25
<210>2
<211>25
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>2
CAGCGGAACCGCTCATTGCCAATGG 25
<210>3
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
AAAGCAAGGGCCATTTAGATTAG 23
<210>4
<211>23
<212>DNA
＜213〉artificial sequence
220>
<221>misc_feature
＜223〉primer
<400>4
TTCTGGGCTTGACCTTAATTGTA 23
<210>5
<211>4465
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(303)..(1247)
<400>5
1?cctgcagcct?ccggagtcag?tgccgcgcgc?ccgccgcccc?gcgccttcct?gctcgccgca
61?cctccgggag?ccggggcgca?cccagcccgc?agcgccgcct?ccccgcccgc?gccgcctccg
121?accgcaggcc?gagggccgcc?actggccggg?gggaccgggc?agcagcttgc?ggccgcggag
181?ccgggcaacg?ctggggactg?cgccttttgt?ccccggaggt?ccctggaagt?ttgcggcagg
241?acgcgcgcgg?ggaggcggcg?gaggcagccc?cgacgtcgcg?gagaacaggg?cgcagagccg
301?gcatgggcat?cgggcgcagc?gaggggggcc?gccgcggggc?agccctgggc?gtgctgctgg
361?cgctgggcgc?ggcgcttctg?gccgtgggct?cggccagcga?gtacgactac?gtgagcttcc
421?agtcggacat?cggcccgtac?cagagcgggc?gcttctacac?caagccacct?cagtgcgtgg
481?acatccccgc?ggacctgcgg?ctgtgccaca?acgtgggcta?caagaagatg?gtgctgccca
541?acctgctgga?gcacgagacc?atggcggagg?tgaagcagca?ggccagcagc?tgggtgcccc
601?tgctcaacaa?gaactgccac?gccggcaccc?aggtcttcct?ctgctcgctc?ttcgcgcccg
661?tctgcctgga?ccggcccatc?tacccgtgtc?gctggctctg?cgaggccgtg?cgcgactcgt
721?gcgagccggt?catgcagttc?ttcggcttct?actggcccga?gatgcttaag?tgtgacaagt
781?tccccgaggg?ggacgtctgc?atcgccatga?cgccgcccaa?tgccaccgaa?gcctccaagc
841?cccaaggcac?aacggtgtgt?cctccctgtg?acaacgagtt?gaaatctgag?gccatcattg
901?aacatctctg?tgccagcgag?tttgcactga?ggatgaaaat?aaaagaagtg?aaaaaagaaa
961?atggcgacaa?gaagattgtc?cccaagaaga?agaagcccct?gaagttgggg?cccatcaaga
1021?agaaggacct?gaagaagctt?gtgctgtacc?tgaagaatgg?ggctgactgt?ccctgccacc
1081?agctggacaa?cctcagccac?cacttcctca?tcatgggccg?caaggtgaag?agccagtact
1141?tgctgacggc?catccacaag?tgggacaaga?aaaacaagga?gttcaaaaac?ttcatgaaga
1201?aaatgaaaaa?ccatgagtgc?cccacctttc?agtccgtgtt?taagtgattc?tcccgggggc
1261?agggtgggga?gggagcctcg?ggtggggtgg?gagcgggggg?gacagtgccc?cgggaacccg
1321?gtgggtcaca?cacacgcact?gcgcctgtca?gtagtggaca?ttgtaatcca?gtcggcttgt
1381?tcttgcagca?ttcccgctcc?cttccctcca?tagccacgct?ccaaacccca?gggtagccat
1441?ggccgggtaa?agcaagggcc?atttagatta?ggaaggtttt?taagatccgc?aatgtggagc
1501?agcagccact?gcacaggagg?aggtgacaaa?ccatttccaa?cagcaacaca?gccactaaaa
1561?cacaaaaagg?gggattgggc?ggaaagtgag?agccagcagc?aaaaactaca?ttttgcaact
1621?tgttggtgtg?gatctattgg?ctgatctatg?cctttcaact?agaaaattct?aatgattggc
1681?aagtcacgtt?gttttcaggt?ccagagtagt?ttctttctgt?ctgctttaaa?tggaaacaga
1741?ctcataccac?acttacaatt?aaggtcaagc?ccagaaagtg?ataagtgcag?ggaggaaaag
1801?tgcaagtcca?ttatgtaata?gtgacagcaa?agggaccagg?ggagaggcat?tgccttctct
1861?gcccacagtc?tttccgtgtg?attgtctttg?aatctgaatc?agccagtctc?agatgcccca
1921?aagtttcggt?tcctatgagc?ccggggcatg?atctgatccc?caagacatgt?ggaggggcag
1981?cctgtgcctg?cctttgtgtc?agaaaaagga?aaccacagtg?agcctgagag?agacggcgat
2041?tttcgggctg?agaaggcagt?agttttcaaa?acacatagtt?aaaaaagaaa?caaatgaaaa
2101?aaattttaga?acagtccagc?aaattgctag?tcagggtgaa?ttgtgaaatt?gggtgaagag
2161?cttaggattc?taatctcatg?ttttttcctt?ttcacatttt?taaaagaaca?atgacaaaca
2221?cccacttatt?tttcaaggtt?ttaaaacagt?ctacattgag?catttgaaag?gtgtgctaga
2281?acaaggtctc?ctgatccgtc?cgaggctgct?tcccagagga?gcagctctcc?ccaggcattt
2341?gccaagggag?gcggatttcc?ctggtagtgt?agctgtgtgg?ctttccttcc?tgaagagtcc
2401?gtggttgccc?tagaacctaa?caccccctag?caaaactcac?agagctttcc?gtttttttct
2461?ttcctgtaaa?gaaacatttc?ctttgaactt?gattgcctat?ggatcaaaga?aattcagaac
2521?agcctgcctg?tccccccgca?ctttttacat?atatttgttt?catttctgca?gatggaaagt
2581?tgacatgggt?ggggtgtccc?catccagcga?gagagtttca?aaagcaaaac?atctctgcag
2641?tttttcccaa?gtaccctgag?atacttccca?aagcccttat?gtttaatcag?cgatgtatat
2701?aagccagttc?acttagacaa?ctttaccctt?cttgtccaat?gtacaggaag?tagttctaaa
2761?aaaaatgcat?attaatttct?tcccccaaag?ccggattctt?aattctctgc?aacactttga
2821?ggacatttat?gattgtccct?ctgggccaat?gcttataccc?agtgaggatg?ctgcagtgag
2881?gctgtaaagt?ggccccctgc?ggccctagcc?tgacccggag?gaaaggatgg?tagattctgt
2941?taactcttga?agactccagt?atgaaaatca?gcatgcccgc?ctagttacct?accggagagt
3001?tatcctgata?aattaacctc?tcacagttag?tgatcctgtc?cttttaacac?cttttttgtg
3061?gggttctctc?tgacctttca?tcgtaaagtg?ctggggacct?taagtgattt?gcctgtaatt
3121?ttggatgatt?aaaaaatgtg?tatatatatt?agctaattag?aaatattcta?cttctctgtt
3181?gtcaaactga?aattcagagc?aagttcctga?gtgcgtggat?ctgggtctta?gttctggttg
3241?attcactcaa?gagttcagtg?ctcatacgta?tctgctcatt?ttgacaaagt?gcctcatgca
3301?accgggccct?ctctctgcgg?cagagtcctt?agtggagggg?tttacctgga?acattagtag
3361?ttaccacaga?atacggaaga?gcaggtgact?gtgctgtgca?gctctctaaa?tgggaattct
3421?caggtaggaa?gcaacagctt?cagaaagagc?tcaaaataaa?ttggaaatgt?gaatcgcagc
3481?tgtgggtttt?accaccgtct?gtctcagagt?cccaggacct?tgagtgtcat?tagttacttt
3541?attgaaggtt?ttagacccat?agcagctttg?tctctgtcac?atcagcaatt?tcagaaccaa
3601?aagggaggct?ctctgtaggc?acagagctgc?actatcacga?gcctttgttt?ttctccacaa
3661?agtatctaac?aaaaccaatg?tgcagactga?ttggcctggt?cattggtctc?cgagagagga
3721?ggtttgcctg?tgatttccta?attatcgcta?gggccaaggt?gggatttgta?aagctttaca
3781?ataatcattc?tggatagagt?cctgggaggt?ccttggcaga?actcagttaa?atctttgaag
3841?aatatttgta?gttatcttag?aagatagcat?gggaggtgag?gattccaaaa?acattttatt
3901?tttaaaatat?cctgtgtaac?acttggctct?tggtacctgt?gggttagcat?caagttctcc
3961?ccagggtaga?attcaatcag?agctccagtt?tgcatttgga?tgtgtaaatt?acagtaatcc
4021?catttcccaa?acctaaaatc?tgtttttctc?atcagactct?gagtaactgg?ttgctgtgtc
4081?ataacttcat?agatgcagga?ggctcaggtg?atctgtttga?ggagagcacc?ctaggcagcc
4141?tgcagggaat?aacatactgg?ccgttctgac?ctgttgccag?cagatacaca?ggacatggat
4201?gaaattcccg?tttcctctag?tttcttcctg?tagtactcct?cttttagatc?ctaagtctct
4261?tacaaaagct?ttgaatactg?tgaaaatgtt?ttacattcca?tttcatttgt?gttgtttttt
4321?taactgcatt?ttaccagatg?ttttgatgtt?atcgcttatg?ttaatagtaa?ttcccgtacg
4381?tgttcatttt?attttcatgc?tttttcagcc?atgtatcaat?attcacttga?ctaaaatcac
4441?tcaattaatc?aatgaaaaaa?aaaaa
<210>6
<211>314
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>6
1 MGIGRSEGGR RGAALGVLLA LGAALLAVGS ASEYDYVSFQ SDIGPYQSGR
50 FYTKPPQCVD IPADLRLCHN VGYKKMVLPN LLEHETMAEV KQQASSWVPL
100 LNKNCHAGTQ VFLCSLFAPV CLDRPIYPCR WLCEAVRDSC EPVMQFFGFY
150 WPEMLKCDKF PEGDVCIAMT PPNATEASKP QGTTVCPPCD NELKSEAIIE
200 HLCASEFALR MKIKEVKKEN GDKKIVPKKK KPLKLGPIKK KDLKKLVLYL
250 KNGADCPCHQ LDNLSHHFLI MGRKVKSQYL LTAIHKWDKK NKEFKNFMKK
300 MKNHECPTFQ SVFK
Claims (10)
1. human SFRP 1 gene is characterized in that it comprises one of following nucleotide sequences:
(1) dna sequence dna of SEQ ID NO.5 in the sequence table;
(2) polynucleotide of SEQ ID NO.6 protein sequence in the code sequence tabulation;
(3) with sequence table in the dna sequence dna of SEQ ID NO.5 have 70% above homology, and the identical function protein DNA sequence of encoding.
2. gene as claimed in claim 1 is characterized in that described nucleotide sequence has the dna sequence dna of SEQ ID NO.5.
3. gene as claimed in claim 2 is characterized in that, described sequence has among the SEQ ID NO.5 nucleotide sequence from Nucleotide 303-1247 position.
4. human SFRP 1 protein is characterized in that it comprises: have the protein of SEQ ID NO.6 aminoacid sequence, or its conservative property variant protein matter or its active fragments, or its reactive derivative.
5. protein as claimed in claim 4 is characterized in that, this protein is selected from down a kind of of group:
(a) has the protein of SEQ ID NO.6 aminoacid sequence;
(b) SEQ ID NO.6 aminoacid sequence is passed through replacement, disappearance or the interpolation of one or several amino-acid residue and has identical with SEQ ID NO.6 aminoacid sequence active by (a) deutero-protein.
6. as claim 4 or 5 described protein, it is characterized in that described protein is the protein with SEQ ID NO.6 aminoacid sequence.
7. a carrier is characterized in that, it comprises the described human SFRP 1 gene of claim 1.
8. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 7.
9. a pharmaceutical composition that suppresses growth of tumour cell is characterized in that, it contains the described protein of claim 4 and the pharmaceutically acceptable carrier of safe and effective amount.
10. the application of each described human SFRP 1 protein in the medicine of preparation inhibition tumor growth in the claim 4 to 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2005101101176A CN1962865A (en) | 2005-11-08 | 2005-11-08 | Human SFRP1 gene, its coded protein and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2005101101176A CN1962865A (en) | 2005-11-08 | 2005-11-08 | Human SFRP1 gene, its coded protein and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1962865A true CN1962865A (en) | 2007-05-16 |
Family
ID=38082092
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2005101101176A Pending CN1962865A (en) | 2005-11-08 | 2005-11-08 | Human SFRP1 gene, its coded protein and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1962865A (en) |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103951743A (en) * | 2014-04-25 | 2014-07-30 | 陈秀定 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106336454A (en) * | 2016-11-18 | 2017-01-18 | 李露青 | Human SFRP1 variant and application thereof |
| CN106349369A (en) * | 2016-11-15 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349372A (en) * | 2016-11-16 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349380A (en) * | 2016-11-22 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349374A (en) * | 2016-11-17 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349371A (en) * | 2016-11-16 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349367A (en) * | 2016-11-15 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349377A (en) * | 2016-11-18 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349383A (en) * | 2016-11-21 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349382A (en) * | 2016-11-21 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349376A (en) * | 2016-11-18 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349379A (en) * | 2016-11-22 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349370A (en) * | 2016-11-16 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349381A (en) * | 2016-11-21 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349368A (en) * | 2016-11-15 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349375A (en) * | 2016-11-17 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349373A (en) * | 2016-11-17 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
-
2005
- 2005-11-08 CN CNA2005101101176A patent/CN1962865A/en active Pending
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103951743B (en) * | 2014-04-25 | 2016-11-23 | 李露青 | Human SFRP 1 variant and application thereof |
| CN103951743A (en) * | 2014-04-25 | 2014-07-30 | 陈秀定 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349367A (en) * | 2016-11-15 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349368A (en) * | 2016-11-15 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349369A (en) * | 2016-11-15 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349372A (en) * | 2016-11-16 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349371A (en) * | 2016-11-16 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349370A (en) * | 2016-11-16 | 2017-01-25 | 李露青 | Human SFRP1 varient and application thereof |
| CN106349374A (en) * | 2016-11-17 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349373A (en) * | 2016-11-17 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349375A (en) * | 2016-11-17 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349376A (en) * | 2016-11-18 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106336454A (en) * | 2016-11-18 | 2017-01-18 | 李露青 | Human SFRP1 variant and application thereof |
| CN106349377A (en) * | 2016-11-18 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349382A (en) * | 2016-11-21 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349383A (en) * | 2016-11-21 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349381A (en) * | 2016-11-21 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349379A (en) * | 2016-11-22 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
| CN106349380A (en) * | 2016-11-22 | 2017-01-25 | 李露青 | Human SFRP1 (secreted frizzled-related protein 1) variant and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1962865A (en) | Human SFRP1 gene, its coded protein and application | |
| KR100631766B1 (en) | Polypeptides, cDNAs encoding the polypeptides and uses thereof | |
| JP2001501460A (en) | Secreted proteins and polynucleotides encoding them | |
| CN101300346B (en) | Novel biological substance nesfatin and its related substances and uses thereof | |
| BRPI0708340A2 (en) | isolated peptide, mimetic thereof, composition, process of treating a condition in a mammal requiring removal or destruction of cells, and process for preventing or inhibiting stenosis, occlusion or blockage of a catheter | |
| EP1283214B1 (en) | Novel collectins | |
| CN100513567C (en) | Human SCARA5 gene, its coded protein and application | |
| JP2000508909A (en) | Secreted proteins and polynucleotides encoding them | |
| JP2001501455A (en) | Polynucleotides encoding secreted proteins | |
| JP2000508908A (en) | Secreted proteins and polynucleotides encoding them | |
| TW201734040A (en) | Protein crud extract isolated from non-human connective tissue, manufacturing method and use thereof | |
| CN100425695C (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
| CN1408724A (en) | Novel testicular function relative protein and its use | |
| CN101045926A (en) | Human CLL1 gene and its coded protein and application | |
| JP2002515753A (en) | Secreted proteins and polynucleotides encoding them | |
| JP2002512503A (en) | Secreted proteins and polynucleotides encoding them | |
| CN1302897A (en) | Polypeptide-human phosphodiesterase 21 similar to acidic sphingomyelinase and polynucleotide for coding it | |
| JP2002516573A (en) | 207 human secreted proteins | |
| CN1406982A (en) | Polypeptide-human protein containing transferring growth factor family characteristic sequential fragments-12.87 and polynucleotide for encoding it | |
| CN1296013A (en) | Novel human membrane granulosa protein and coding sequence | |
| CN1292420A (en) | New human NADH oxido-reductase composite I subunit and its code sequence | |
| JP2003532623A (en) | Anti-angiogenic angiotensin-7 and method of regulating angiogenesis by using polynucleotides encoding the same | |
| CN1296966A (en) | Polypeptide-human SR splicing factor 52 and polynucleotide for coding said polypeptide | |
| CN1303933A (en) | Novel polypeptide-human muscle BOP protein 41 and polynucleotide coding said polypeptide | |
| CN1477120A (en) | A polypeptide-human tissue anion transport polypeptide 41 and polynucleotide coding said polypeptide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |