CN1936016A - Method for verifying exogenous gene amplicon for transgenic plant and product detection - Google Patents

Abstract

The invention relates to an identification method for external gene amplicon used in transgene plant and the product testing. It uses DNA sequence analyzing software to analyze the four sequences of external gene amplicon of PAT BAR FMV35S and NPTII4 to find the enzyme cutting point according two conditions. The length difference between the two sub-DNA sections after enzyme cutting is over 20bp, and the smaller is over 50bp. Under the condition of not altering the testing technology through agarose gel electrophoresis, according to the PCR result, the tested sample would be judged whether it is transgene plant and the product. The method has the advantages of easy to operate, low cost and accurate.

Description

The verification method of external source gene amplification during a kind of transgenic plant and goods detect

Technical field

The invention belongs to transgenic plant safety management technology field, be specifically related to the verification method of external source gene amplification in the detection of a kind of transgenic plant and goods thereof.

Technical background

Methods for detecting transgenic foods, be with polymerase chain amplified reaction (PCR, polymerase chainreaction) technology increases to the partial dna sequence as the specific foreign gene in the genomic dna of the genetically modified crops of food raw material, with agarose gel electrophoresis technology amplified production (amplicon) is carried out analyzing and testing again, thereby determine the existence of transgene component.Yet because itself some technological deficiencies of round pcr, produce nonspecific amplification sometimes, produce false positive (promptly should be negative but amplify similar positive reaction amplified production) phenomenon, common agarose gel electrophoresis is difficult to this false-positive phenomenon of identification, thereby the accuracy that detects has been buried hidden danger.

The amplified production of positive reaction has multiple different verification technique in both at home and abroad transgenosis being detected at present, mainly contains following several technology:

1. the dna sequencing of the amplified production of positive reaction (amplicon).Amplified production to positive reaction carries out the order-checking of DNA complete sequence, determined amplicon sequence was carried out the comparison of dna sequence dna when the amplicon sequence of this amplified production that order-checking is obtained was with the pairing design of primers of this amplicon then, be true positives if both dna sequence dnas coincide substantially, otherwise be false positive.

2. the amplicon fusing point is analyzed.The fusing point here is meant that the temperature of oneself when unwinding takes place the dna molecular that half is arranged in the double chain DNA fragment to a certain amount of a certain particular sequence, this temperature is subjected to the different of factors such as dna fragmentation length, sequence and GC% content and changes, thereby has certain representativeness.

3. dna molecule hybridize.The dna sequence dna of the amplicon of determining during according to design of primers, design again and amplicon sequence complementary dna probe, and on mark on the probe fluorescent signal molecule, amplified production hybridization with this probe and positive reaction, if true positives, probe meeting and amplicon combine, thereby detect corresponding fluorescent signal in amplified production, otherwise can not detect fluorescent signal, be false positive.

4. specific limited endonuclease digestion.The amplicon sequence of foreign gene and sequence is carried out many restriction endonuclease sites designs, cut two of generation by this restriction enzyme site enzyme and have distinctive sub-dna fragmentation agarose gel electrophoretogram, whether come the amplified production of the positive reaction of amplicon is verified, be false positive to differentiate.

Because pcr amplification during the food transgenosis detects is all very short, generally less than 250bp, the probability that occurs in the situation that identical restriction enzyme site is arranged on the close site of different amplicon sequences is very low, so accuracy and the reliability of 4. planting method planted not second to first three.

The method validation PCR positive products that " the PCR-RFLP detection method of genetically engineered soybean and corn " (project No.650/93/97 of European Union) that European Union is recommended just adopted the Restriction Enzyme enzyme to cut, but this standard has only been introduced the enzyme blanking method of cauliflower mosaic virus 35S promoter sequence (CaMV35S) and two segmental evaluations of external source of Agrobacterium rouge alkali synthetase termination, does not have the verification method of other foreign gene.In addition in recent years, also how to verify positive products in the transgenosis detection technique that European transgenosis test experience chamber associating (ENGL, European Network ofGMO Laboratories) and some domestic scientific research institutions are recommended with this method.But these methods have following 3 defectives mostly:

1. owing to the amplicon segment of pcr amplification in the detection of food transgenosis is all very short, generally all not enough 250bp, often have the long sub-segment of not enough 50bp in the sub-dna fragmentation that produces after enzyme is cut, so short dna fragmentation is low excessively owing to its molecular weight in the analysis of common agarose gel electrophoresis, mobility speed is too fast, and cause the very fast of its free diffusion motion so that finally can't from gel, observe moulding corresponding D NA band.

2. common agarose gel electrophoresis resolving power is lower, promptly uses the sepharose (sepharose as 3%) of high density, and its minimum resolution is also wanted about 20bp.If the amplicon enzyme is cut the intersegmental length difference of two sub-sheets of generation apart from less than about 20bp, then be difficult to separate by agarose gel electrophoresis.

3. need to use expensive restriction endonuclease kind mostly, detect the cost height.

Summary of the invention

The verification method that the purpose of this invention is to provide external source gene amplification in the detection of a kind of transgenic plant and goods thereof.This method is to use dna sequence analysis software the sequence of the amplicon of PAT, BAR, FMV35S and four foreign genes of NPTII is analyzed, and find the restriction enzyme site that meets 2 conditions: the length difference between two sub-dna fragmentations that produce after enzyme is cut is not less than 50bp greater than 20bp, a shortest sub-fragment of length.With conventional cheap restriction endonuclease, do not change under the prerequisite that agarose gel electrophoresis is a detection technique, according to PCR result, judge whether sample is transgenic plant and goods thereof.Thereby overcome the deficiency of above-mentioned existing restriction enzyme verification method.

The inventive method is achieved in that mainly to careless fourth phosphine N-acetyl-transferase gene (pat gene), anti-careless fourth phosphine weedicide gene (BAR gene), the amplicon of these 4 foreign genes of Xin Meisu-3 '-phosphoric acid transferase gene (NPTII gene) and radix scrophulariae mosaic virus 35 S promoter and sequence (seeing relevant normative document respectively at the primer that these three amplicons match) sequence is carried out the analysis of many restriction endonuclease sites, therefrom find out certain/meet particular requirement a bit---enzyme is cut the two cross-talk dna fragmentations that the back produces and is easy to by plain agar sugar gel electrophoresis compartment analysis, and select for use common as far as possible, cheap restriction endonuclease kind---restriction endonuclease sites, cut two of generation by this restriction enzyme site enzyme and have distinctive sub-dna fragmentation agarose gel electrophoretogram, whether come the amplified production of the positive reaction of these 4 amplicons is verified, be false positive to differentiate.This technology derives from molecular genetics, often will be in molecular genetics with various dna molecular markers to genes all in the genome location of mapping, wherein there is a big class dna molecular marker to be called as restriction fragment length polymorphism mark (RFLP, restriction fragment lengthpolymorphism).It is with round pcr different allelotrope to be increased earlier, using a certain restriction enzyme that these amplified productions (amplicon) are carried out enzyme then cuts, because not homoallelic dna sequence dna is difference to some extent, caused different allelic restriction enzyme sites and quantity thereof all different, therefore as long as select proper restriction site and restriction endonuclease, just different allelic amplified production (amplicon) enzymes can be cut into many length differences, the sub-dna fragmentation of different amts, separate the polymorphism that just can demonstrate dna fragmentation by agarose gel electrophoresis, thereby identify this allelic kind and function etc.

Embodiment

The invention will be further described below by specific embodiment.

Checking with the BAR gene test.The complete sequence of BAR gene 17 5bp amplicon following (regulation among establishing criteria SN/T1196-2003, SN/T 1197-2003 and the SN/T 1202-2003):

ACAAGCACGGTCAACTTCCGTACCGAGCCGCAGGAACCGCAGGAGTGGA

CGGACGACCTCGTCCGTCTGCGGGAGCGCTATCCCTGGCTCGTCGCCGAG

GTGGACGGCGAGGTCGCCGGCATCGCCTACGCGGGCCCCTGGAAGGCAC

GCAACGCCTACGACTGGACGGCCGAGT

1) with above sequence input dna sequence analysis software

2) software will draw analytical results automatically, as following table (partial results):

Restriction endonuclease title restriction enzyme site

ApaI 136

HincIl 12

MspI 116

HhaI 77

Clearly comparatively satisfactory is the MspI restriction endonuclease.

3) verification experimental verification

A) PCR reaction

25uL PCR reaction system and reaction conditions thereof (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003).

B) after amplified reaction finished, the amplified production of drawing 10uL from the reaction tubes of each sample carried out agarose (3%) gel electrophoresis, and analytical results sees Table 1 and Figure of description 1.

Table 1 specification sheets Fig. 1 sample analysis is table as a result

The positive reaction of the sample of the 2nd, No. 3 swimming lane obviously, but also might be false positive, further checking.

C) endonuclease reaction operation

The special-purpose endonuclease reaction buffer of endonuclease reaction system 15uL:MspI 1.5uL

8～12 enzyme activity units of MspI

Pcr amplification product 10uL (adding at last)

With sterilization ultrapure water polishing reaction system

From the PCR reaction tubes of No. 2 pairing sample of swimming lane, draw remaining pcr amplification product 10uL in another new reaction tubes, add above-mentioned reaction system mixed solution more in proportion, put into 37 ℃ air thermostat container internal reaction 3 to 4 hours behind the thorough mixing

D) electrophoretic analysis

After reaction finishes the endonuclease reaction mixture being analyzed Figure of description 2 with 3% agarose gel electrophoresis (100～120V constant voltage) is agarose gel electrophoresis figure of endonuclease reaction mixture, and table 2 is the electrophoretic analysis results to 6 swimming lanes in the Figure of description 2.

Table 2 specification sheets Fig. 2 sample analysis is table as a result

So can determine to contain in the food samples 1 BAR gene composition.

Claims (3)

1. the verification method of external source gene amplification during transgenic plant and goods detect.It is characterized in that: take ordinary method to extract sample DNA, using dna sequence analysis software analyzes the sequence of the amplicon of PAT, BAR, a FMV35S and NPTII4 foreign gene, the design restriction enzyme site, with conventional cheap restriction endonuclease, do not changing under the prerequisite that agarose gel electrophoresis is a detection technique, according to PCR result, judge whether sample is transgenic plant and goods thereof.

2 verification methods according to the described foreign gene amplicon of claim 1, the design of its restriction enzyme site comprises following feature:

Length difference between two sub-dna fragmentations that produce after 1. enzyme is cut is greater than 20bp.

2. enzyme is cut in two sub-dna fragmentations of back generation, and a shortest sub-fragment length is not less than 50bp.

3. according to the verification method of the described foreign gene amplicon of claim 1, the restriction enzyme site feature of the amplicon of PAT, BAR, a FMV35S and NPTII4 foreign gene is:

1. BAR gene 17 5bp amplicon (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003) is cut the characteristic fragment that the back produces 116bp and 59bp by the MspI enzyme.

2. pat gene 191bp amplicon (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003) is cut the characteristic fragment that the back produces 74bp and 117bp by EcoR V enzyme.

3. NPTII gene 183bp amplicon (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003) is cut the characteristic fragment that the back produces 113bp and 70bp by Hinf I enzyme.

4. FMV35S promotor 196bp amplicon (regulation among establishing criteria SN/T 1197-2003, SN/T 1202-2003 and the SN/T 1203-2003) is cut the characteristic fragment that the back produces 117bp and 89bp by the NsiI enzyme.