CN1936016A - Method for verifying exogenous gene amplicon for transgenic plant and product detection - Google Patents
Method for verifying exogenous gene amplicon for transgenic plant and product detection Download PDFInfo
- Publication number
- CN1936016A CN1936016A CN 200510029929 CN200510029929A CN1936016A CN 1936016 A CN1936016 A CN 1936016A CN 200510029929 CN200510029929 CN 200510029929 CN 200510029929 A CN200510029929 A CN 200510029929A CN 1936016 A CN1936016 A CN 1936016A
- Authority
- CN
- China
- Prior art keywords
- amplicon
- enzyme
- cut
- gene
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091093088 Amplicon Proteins 0.000 title claims abstract description 32
- 238000000034 method Methods 0.000 title claims abstract description 20
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 16
- 230000009261 transgenic effect Effects 0.000 title claims description 9
- 238000001514 detection method Methods 0.000 title claims description 8
- 102000004190 Enzymes Human genes 0.000 claims abstract description 17
- 108090000790 Enzymes Proteins 0.000 claims abstract description 17
- 238000000246 agarose gel electrophoresis Methods 0.000 claims abstract description 11
- 108091028043 Nucleic acid sequence Proteins 0.000 claims abstract description 9
- 108091008146 restriction endonucleases Proteins 0.000 claims description 21
- 108020004414 DNA Proteins 0.000 claims description 12
- 238000006062 fragmentation reaction Methods 0.000 claims description 11
- 238000012795 verification Methods 0.000 claims description 11
- 239000012634 fragment Substances 0.000 claims description 7
- 230000033228 biological regulation Effects 0.000 claims description 6
- 238000013461 design Methods 0.000 claims description 6
- 101150103518 bar gene Proteins 0.000 claims description 5
- 230000004544 DNA amplification Effects 0.000 claims description 4
- 101150113864 pat gene Proteins 0.000 claims description 2
- 101000702488 Rattus norvegicus High affinity cationic amino acid transporter 1 Proteins 0.000 claims 1
- 238000005516 engineering process Methods 0.000 abstract description 6
- 238000012360 testing method Methods 0.000 abstract description 5
- 108700019146 Transgenes Proteins 0.000 abstract description 3
- 238000006243 chemical reaction Methods 0.000 description 22
- 238000004519 manufacturing process Methods 0.000 description 13
- 239000000523 sample Substances 0.000 description 10
- 108010042407 Endonucleases Proteins 0.000 description 7
- 102000004533 Endonucleases Human genes 0.000 description 7
- 238000013467 fragmentation Methods 0.000 description 7
- 241000196324 Embryophyta Species 0.000 description 5
- 238000004458 analytical method Methods 0.000 description 5
- 235000013305 food Nutrition 0.000 description 5
- 238000012408 PCR amplification Methods 0.000 description 4
- XYFCBTPGUUZFHI-UHFFFAOYSA-N Phosphine Chemical compound P XYFCBTPGUUZFHI-UHFFFAOYSA-N 0.000 description 4
- 238000001962 electrophoresis Methods 0.000 description 4
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 4
- 230000009182 swimming Effects 0.000 description 3
- 229920002684 Sepharose Polymers 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 230000007812 deficiency Effects 0.000 description 2
- 238000001502 gel electrophoresis Methods 0.000 description 2
- 229910000073 phosphorus hydride Inorganic materials 0.000 description 2
- 239000011541 reaction mixture Substances 0.000 description 2
- 229920001817 Agar Polymers 0.000 description 1
- 229920000936 Agarose Polymers 0.000 description 1
- 241000589158 Agrobacterium Species 0.000 description 1
- 241000701489 Cauliflower mosaic virus Species 0.000 description 1
- 108020004635 Complementary DNA Proteins 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 238000001712 DNA sequencing Methods 0.000 description 1
- 244000068988 Glycine max Species 0.000 description 1
- 235000010469 Glycine max Nutrition 0.000 description 1
- 102000003960 Ligases Human genes 0.000 description 1
- 108090000364 Ligases Proteins 0.000 description 1
- 101710202061 N-acetyltransferase Proteins 0.000 description 1
- 108090000992 Transferases Proteins 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 240000008042 Zea mays Species 0.000 description 1
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 1
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 1
- 239000008272 agar Substances 0.000 description 1
- 239000003513 alkali Substances 0.000 description 1
- 229910000147 aluminium phosphate Inorganic materials 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000010804 cDNA synthesis Methods 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 235000005822 corn Nutrition 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000009792 diffusion process Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 244000037671 genetically modified crops Species 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- JEIPFZHSYJVQDO-UHFFFAOYSA-N iron(III) oxide Inorganic materials O=[Fe]O[Fe]=O JEIPFZHSYJVQDO-UHFFFAOYSA-N 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000003147 molecular marker Substances 0.000 description 1
- 238000000465 moulding Methods 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- NBIIXXVUZAFLBC-UHFFFAOYSA-N phosphoric acid Substances OP(O)(O)=O NBIIXXVUZAFLBC-UHFFFAOYSA-N 0.000 description 1
- 238000005498 polishing Methods 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000001954 sterilising effect Effects 0.000 description 1
- 238000004659 sterilization and disinfection Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
- 230000004304 visual acuity Effects 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an identification method for external gene amplicon used in transgene plant and the product testing. It uses DNA sequence analyzing software to analyze the four sequences of external gene amplicon of PAT BAR FMV35S and NPTII4 to find the enzyme cutting point according two conditions. The length difference between the two sub-DNA sections after enzyme cutting is over 20bp, and the smaller is over 50bp. Under the condition of not altering the testing technology through agarose gel electrophoresis, according to the PCR result, the tested sample would be judged whether it is transgene plant and the product. The method has the advantages of easy to operate, low cost and accurate.
Description
Technical field
The invention belongs to transgenic plant safety management technology field, be specifically related to the verification method of external source gene amplification in the detection of a kind of transgenic plant and goods thereof.
Technical background
Methods for detecting transgenic foods, be with polymerase chain amplified reaction (PCR, polymerase chainreaction) technology increases to the partial dna sequence as the specific foreign gene in the genomic dna of the genetically modified crops of food raw material, with agarose gel electrophoresis technology amplified production (amplicon) is carried out analyzing and testing again, thereby determine the existence of transgene component.Yet because itself some technological deficiencies of round pcr, produce nonspecific amplification sometimes, produce false positive (promptly should be negative but amplify similar positive reaction amplified production) phenomenon, common agarose gel electrophoresis is difficult to this false-positive phenomenon of identification, thereby the accuracy that detects has been buried hidden danger.
The amplified production of positive reaction has multiple different verification technique in both at home and abroad transgenosis being detected at present, mainly contains following several technology:
1. the dna sequencing of the amplified production of positive reaction (amplicon).Amplified production to positive reaction carries out the order-checking of DNA complete sequence, determined amplicon sequence was carried out the comparison of dna sequence dna when the amplicon sequence of this amplified production that order-checking is obtained was with the pairing design of primers of this amplicon then, be true positives if both dna sequence dnas coincide substantially, otherwise be false positive.
2. the amplicon fusing point is analyzed.The fusing point here is meant that the temperature of oneself when unwinding takes place the dna molecular that half is arranged in the double chain DNA fragment to a certain amount of a certain particular sequence, this temperature is subjected to the different of factors such as dna fragmentation length, sequence and GC% content and changes, thereby has certain representativeness.
3. dna molecule hybridize.The dna sequence dna of the amplicon of determining during according to design of primers, design again and amplicon sequence complementary dna probe, and on mark on the probe fluorescent signal molecule, amplified production hybridization with this probe and positive reaction, if true positives, probe meeting and amplicon combine, thereby detect corresponding fluorescent signal in amplified production, otherwise can not detect fluorescent signal, be false positive.
4. specific limited endonuclease digestion.The amplicon sequence of foreign gene and sequence is carried out many restriction endonuclease sites designs, cut two of generation by this restriction enzyme site enzyme and have distinctive sub-dna fragmentation agarose gel electrophoretogram, whether come the amplified production of the positive reaction of amplicon is verified, be false positive to differentiate.
Because pcr amplification during the food transgenosis detects is all very short, generally less than 250bp, the probability that occurs in the situation that identical restriction enzyme site is arranged on the close site of different amplicon sequences is very low, so accuracy and the reliability of 4. planting method planted not second to first three.
The method validation PCR positive products that " the PCR-RFLP detection method of genetically engineered soybean and corn " (project No.650/93/97 of European Union) that European Union is recommended just adopted the Restriction Enzyme enzyme to cut, but this standard has only been introduced the enzyme blanking method of cauliflower mosaic virus 35S promoter sequence (CaMV35S) and two segmental evaluations of external source of Agrobacterium rouge alkali synthetase termination, does not have the verification method of other foreign gene.In addition in recent years, also how to verify positive products in the transgenosis detection technique that European transgenosis test experience chamber associating (ENGL, European Network ofGMO Laboratories) and some domestic scientific research institutions are recommended with this method.But these methods have following 3 defectives mostly:
1. owing to the amplicon segment of pcr amplification in the detection of food transgenosis is all very short, generally all not enough 250bp, often have the long sub-segment of not enough 50bp in the sub-dna fragmentation that produces after enzyme is cut, so short dna fragmentation is low excessively owing to its molecular weight in the analysis of common agarose gel electrophoresis, mobility speed is too fast, and cause the very fast of its free diffusion motion so that finally can't from gel, observe moulding corresponding D NA band.
2. common agarose gel electrophoresis resolving power is lower, promptly uses the sepharose (sepharose as 3%) of high density, and its minimum resolution is also wanted about 20bp.If the amplicon enzyme is cut the intersegmental length difference of two sub-sheets of generation apart from less than about 20bp, then be difficult to separate by agarose gel electrophoresis.
3. need to use expensive restriction endonuclease kind mostly, detect the cost height.
Summary of the invention
The verification method that the purpose of this invention is to provide external source gene amplification in the detection of a kind of transgenic plant and goods thereof.This method is to use dna sequence analysis software the sequence of the amplicon of PAT, BAR, FMV35S and four foreign genes of NPTII is analyzed, and find the restriction enzyme site that meets 2 conditions: the length difference between two sub-dna fragmentations that produce after enzyme is cut is not less than 50bp greater than 20bp, a shortest sub-fragment of length.With conventional cheap restriction endonuclease, do not change under the prerequisite that agarose gel electrophoresis is a detection technique, according to PCR result, judge whether sample is transgenic plant and goods thereof.Thereby overcome the deficiency of above-mentioned existing restriction enzyme verification method.
The inventive method is achieved in that mainly to careless fourth phosphine N-acetyl-transferase gene (pat gene), anti-careless fourth phosphine weedicide gene (BAR gene), the amplicon of these 4 foreign genes of Xin Meisu-3 '-phosphoric acid transferase gene (NPTII gene) and radix scrophulariae mosaic virus 35 S promoter and sequence (seeing relevant normative document respectively at the primer that these three amplicons match) sequence is carried out the analysis of many restriction endonuclease sites, therefrom find out certain/meet particular requirement a bit---enzyme is cut the two cross-talk dna fragmentations that the back produces and is easy to by plain agar sugar gel electrophoresis compartment analysis, and select for use common as far as possible, cheap restriction endonuclease kind---restriction endonuclease sites, cut two of generation by this restriction enzyme site enzyme and have distinctive sub-dna fragmentation agarose gel electrophoretogram, whether come the amplified production of the positive reaction of these 4 amplicons is verified, be false positive to differentiate.This technology derives from molecular genetics, often will be in molecular genetics with various dna molecular markers to genes all in the genome location of mapping, wherein there is a big class dna molecular marker to be called as restriction fragment length polymorphism mark (RFLP, restriction fragment lengthpolymorphism).It is with round pcr different allelotrope to be increased earlier, using a certain restriction enzyme that these amplified productions (amplicon) are carried out enzyme then cuts, because not homoallelic dna sequence dna is difference to some extent, caused different allelic restriction enzyme sites and quantity thereof all different, therefore as long as select proper restriction site and restriction endonuclease, just different allelic amplified production (amplicon) enzymes can be cut into many length differences, the sub-dna fragmentation of different amts, separate the polymorphism that just can demonstrate dna fragmentation by agarose gel electrophoresis, thereby identify this allelic kind and function etc.
Embodiment
The invention will be further described below by specific embodiment.
Checking with the BAR gene test.The complete sequence of BAR gene 17 5bp amplicon following (regulation among establishing criteria SN/T1196-2003, SN/T 1197-2003 and the SN/T 1202-2003):
ACAAGCACGGTCAACTTCCGTACCGAGCCGCAGGAACCGCAGGAGTGGA
CGGACGACCTCGTCCGTCTGCGGGAGCGCTATCCCTGGCTCGTCGCCGAG
GTGGACGGCGAGGTCGCCGGCATCGCCTACGCGGGCCCCTGGAAGGCAC
GCAACGCCTACGACTGGACGGCCGAGT
1) with above sequence input dna sequence analysis software
2) software will draw analytical results automatically, as following table (partial results):
Restriction endonuclease title restriction enzyme site
ApaI 136
HincIl 12
MspI 116
HhaI 77
Clearly comparatively satisfactory is the MspI restriction endonuclease.
3) verification experimental verification
A) PCR reaction
25uL PCR reaction system and reaction conditions thereof (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003).
B) after amplified reaction finished, the amplified production of drawing 10uL from the reaction tubes of each sample carried out agarose (3%) gel electrophoresis, and analytical results sees Table 1 and Figure of description 1.
Table 1 specification sheets Fig. 1 sample analysis is table as a result
The positive reaction of the sample of the 2nd, No. 3 swimming lane obviously, but also might be false positive, further checking.
C) endonuclease reaction operation
The special-purpose endonuclease reaction buffer of endonuclease reaction system 15uL:MspI 1.5uL
8～12 enzyme activity units of MspI
Pcr amplification product 10uL (adding at last)
With sterilization ultrapure water polishing reaction system
From the PCR reaction tubes of No. 2 pairing sample of swimming lane, draw remaining pcr amplification product 10uL in another new reaction tubes, add above-mentioned reaction system mixed solution more in proportion, put into 37 ℃ air thermostat container internal reaction 3 to 4 hours behind the thorough mixing
D) electrophoretic analysis
After reaction finishes the endonuclease reaction mixture being analyzed Figure of description 2 with 3% agarose gel electrophoresis (100～120V constant voltage) is agarose gel electrophoresis figure of endonuclease reaction mixture, and table 2 is the electrophoretic analysis results to 6 swimming lanes in the Figure of description 2.
Table 2 specification sheets Fig. 2 sample analysis is table as a result
So can determine to contain in the food samples 1 BAR gene composition.
Claims (3)
1. the verification method of external source gene amplification during transgenic plant and goods detect.It is characterized in that: take ordinary method to extract sample DNA, using dna sequence analysis software analyzes the sequence of the amplicon of PAT, BAR, a FMV35S and NPTII4 foreign gene, the design restriction enzyme site, with conventional cheap restriction endonuclease, do not changing under the prerequisite that agarose gel electrophoresis is a detection technique, according to PCR result, judge whether sample is transgenic plant and goods thereof.
2 verification methods according to the described foreign gene amplicon of claim 1, the design of its restriction enzyme site comprises following feature:
Length difference between two sub-dna fragmentations that produce after 1. enzyme is cut is greater than 20bp.
2. enzyme is cut in two sub-dna fragmentations of back generation, and a shortest sub-fragment length is not less than 50bp.
3. according to the verification method of the described foreign gene amplicon of claim 1, the restriction enzyme site feature of the amplicon of PAT, BAR, a FMV35S and NPTII4 foreign gene is:
1. BAR gene 17 5bp amplicon (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003) is cut the characteristic fragment that the back produces 116bp and 59bp by the MspI enzyme.
2. pat gene 191bp amplicon (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003) is cut the characteristic fragment that the back produces 74bp and 117bp by EcoR V enzyme.
3. NPTII gene 183bp amplicon (regulation among establishing criteria SN/T 1196-2003, SN/T 1197-2003 and the SN/T 1202-2003) is cut the characteristic fragment that the back produces 113bp and 70bp by Hinf I enzyme.
4. FMV35S promotor 196bp amplicon (regulation among establishing criteria SN/T 1197-2003, SN/T 1202-2003 and the SN/T 1203-2003) is cut the characteristic fragment that the back produces 117bp and 89bp by the NsiI enzyme.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510029929 CN1936016A (en) | 2005-09-23 | 2005-09-23 | Method for verifying exogenous gene amplicon for transgenic plant and product detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510029929 CN1936016A (en) | 2005-09-23 | 2005-09-23 | Method for verifying exogenous gene amplicon for transgenic plant and product detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1936016A true CN1936016A (en) | 2007-03-28 |
Family
ID=37953760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510029929 Pending CN1936016A (en) | 2005-09-23 | 2005-09-23 | Method for verifying exogenous gene amplicon for transgenic plant and product detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1936016A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115003815A (en) * | 2020-02-05 | 2022-09-02 | 百塞生技有限责任公司 | Wheat transgenic event IND-in-production line 412-7 |
-
2005
- 2005-09-23 CN CN 200510029929 patent/CN1936016A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115003815A (en) * | 2020-02-05 | 2022-09-02 | 百塞生技有限责任公司 | Wheat transgenic event IND-in-production line 412-7 |
| EP4100536A4 (en) * | 2020-02-05 | 2023-11-15 | Bioceres LLC | Wheat transgenic event ind-øø412-7 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nadal et al. | A new PCR‐CGE (size and color) method for simultaneous detection of genetically modified maize events | |
| EP2118312A1 (en) | Transgenic plant event detection | |
| CN112126692B (en) | Molecular markers, identification methods and applications for identification of sika deer Yakushima subspecies | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN109234423B (en) | Application of Soybean Molecular Markers and Their Polymorphisms in Identifying Soybean Branch Number Traits | |
| CN114836556B (en) | Molecular marker closely linked with wheat stripe rust resistance QTL QYr.sicau-6B and application | |
| CN102154454A (en) | Method for detecting transgenosis constituents in plant by GeXP multi-PCR (polymerase chain reaction) technology and application thereof | |
| CN103468790B (en) | Primers used for detecting polymorphism of saccharum arundinaceum, and detection method and applications | |
| CN114134249B (en) | Multiplex PCR primer combination and multiplex PCR kit for rapidly detecting aflatoxin-producing bacteria and detection method | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN110777218B (en) | Molecular marker linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN104593504A (en) | Composite PCR (polymerase chain reaction) amplification fluorescence detection kit for 27 plant transgenic loci | |
| CN101016554A (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| US20230183822A1 (en) | Molecular markers for identifying allele at rice-blast-resistant pik locus of rice and use thereof | |
| CN1936016A (en) | Method for verifying exogenous gene amplicon for transgenic plant and product detection | |
| CN111394497A (en) | Specific primers, probes, kits and methods for detecting barley components | |
| CN103509875B (en) | Detection of CaMV 35S promoter and nos terminator by adopting RPA (Recombinase Ploymerase Amplification) technology | |
| KR101219546B1 (en) | Development of grain weevils resistive molecular markers in mung beans and uses thereof | |
| Du et al. | A novel SCAR marker for detecting Psathyrostachys huashanica Keng chromatin introduced in wheat | |
| CN111733220B (en) | Method for high-specificity identification of transgenic carnation | |
| CN103397086B (en) | Probe for transgenic maize strain MLPA detection and primer for preparation of long probe | |
| CN103757110B (en) | A kind of vibrio cholerae analyzes parting kit | |
| AU2013201571B2 (en) | Transgenic plant event detection | |
| CN114807411A (en) | Method for detecting sex of kiwi fruits | |
| CN114369686A (en) | RPA primer pair for detection of barley yellow dwarf virus, RPA-LFS detection primer set, detection kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C57 | Notification of unclear or unknown address | ||
| DD01 | Delivery of document by public notice |
Addressee: Sun Wei Document name: Notice of publication of application for patent for invention |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20070328 |